Hemopoietic protein (variants), dna sequence, method for preparing hemopoietic protein, method for selective expansion of hemopoietic cells, method for producing dendritic cells, method for stimulating for producing hemopoietic cells in patient, pharmaceutical composition, method for treatment

FIELD: biotechnology, molecular biology, medicine, genetic engineering, pharmacy.

SUBSTANCE: the hemopoietic protein comprises the amino acid sequence of the formula: R1-L1-R1, R2-L1-R1, R1-R2 or R2-R1 wherein R1 represents the modified ligand flt-3; R2 represents the modified human IL-3, the modified or unmodified colony-stimulating factor. Modification of R1 is carried out by addition of N-end with C-end directly or through linker (L2) that is able to join N-end with C-end to form new C- and N-ends. The modified human IL-3 is prepared by replacing amino acids at positions 17-123. The human G-CSF is modified by exchange of amino acids. The hemopoietic protein is prepared by culturing cells transformed with vector comprising DNA that encodes the hemopoietic protein. The hemopoietic protein stimulates producing hemopoietic cells and this protein is used as a component of pharmaceutical composition used in treatment of humans suffering with tumor, infectious or autoimmune disease. Invention provides preparing multifunctional hemopoietic proteins eliciting the enhanced activity with respect to stimulation of hemopoietic cells and eliciting the improved physical indices. Invention can be used for preparing chimeric multifunctional hemopoietic proteins.

EFFECT: improved preparing and producing method, valuable medicinal properties of protein.

22 cl, 19 dwg, 18 tbl, 117 ex

 

This application claims the priority under article 35 of law, USA, b, in accordance with the provisional application serial No. 60/029629, filed October 25, 1996.

The scope of the invention

The present invention relates to a multifunctional chimeric to agonists hematopoietic receptors. Such multifunctional chimeric agonists hematopoietic receptors exhibit one or more types of activity of the individual components of the chimeric molecules and can also be more active in the stimulation of hematopoietic cells and(or) to show increased activity, which may include reduction of undesirable biological activities associated with individual hematopoietic growth factors, and(or) possess superior physical characteristics, which may include increased solubility, stability and efficiency of the recovery of the spatial structure.

Background of the invention

Colony-stimulating factors (CSFs), which stimulate differentiation and / or proliferation of bone marrow cells are of great interest because of their therapeutic potential associated with the restoration of suppressed activity level of cells derived from hematopoietic stem cells.

CSFs in humans and mice already identified and delineated by the type of their asset is barb. For example, CSFs granulocytes (G-CSF) and CSF macrophages (M-CSF) stimulate the formation of in vitro colonies of neutrophils and macrophages, respectively, while GM-CSF and interleukin-3 (IL-3) are characterized by a broader spectrum of activity and stimulate the formation of colonies as macrophages, neutrophils, and eosinophils. IL-3 stimulates the formation of basophilic, megakaryocytic and pure and mixed erythroid colonies.

In U.S. Patent 4877729 and 4959455 described cDNA of IL-3 Gibbon and decoded the DNA sequence of IL-3 human and sequences of proteins of which they are encoded. Presents hIL-3 is in the 8th position of the protein sequence serine instead of Proline.

In the application for an international patent (PCT) WO 88/00598 described IL-3, similar to IL-3 Gibbon and man. In the structure of hIL-3 was replaced serine8for Proline8. Received confirmation of substitution of cysteine with serine, which leads to the destruction of disulfide bonds and the substitution of one or several amino acids at the potential sites of glycosylation.

In U.S. patent 4810643 presents the DNA sequence encoding G-CSF person.

In the International patent WO 91/02754 presents a hybrid protein comprising GM-CSF and IL-3, which has increased biological activity compared to the individual GM-CSF and IL-3. Also presents neglikozidnye the data protein analogs of IL-3 and GM-CSF, such as components of multifunctional chimeric agonist hematopoietic receptors.

In the International patent WO 92/04455 presents a hybrid proteins, including IL-3, heriditary with lymphokines selected from the group consisting of IL-3, IL-6, IL-7, IL-9, IL-11, EPO and G-CSF.

In the International patent WO 95/21197 and WO 95/21254 presents a hybrid proteins with a wide range of multi-functional hematopoietic effects.

Patent UK 2285446 refers to the ligand of the C-mpl (thrombopoietin) and various forms of thrombopoietin, which demonstrated the effect on replication, differentiation and maturation of megakaryocytes and predecessors of megakaryocytes, which can be used in the treatment of thrombocytopenia.

Patent EP 675201 A1 refers to the ligand of the C-mpl (a factor in the growth and development of megakaryocytes, MGDF), allelic variants of the ligand of C-mpl and the ligand of the C-mpl, is attached to water-soluble polymers such as polyethylene glycol.

In the International patent WO 95/21920 described ligands of C-mpl mouse and human and polypeptide fragments. Proteins suitable for use in therapy, in vivo and ex vivo to stimulate the production of platelets.

In U.S. patent 4703008, issued to F.-K.Lin, described the cDNA sequence encoding erythropoietin, methods of production and use of erythropoietin.

In the International patent WO 91/any analogs of human erythropoietin, having a larger number of sites of attachment of carbohydrates compared to human erythropoietin, such as EPO(-Asn69), EPO(-Asn125Ser127), EPO(-Thr125) and EPO(-Pro124, Thr125).

In the International patent WO 94/24160 presents mutant variants of erythropoietin, which are characterized by increased activity, which is associated with substitutions in positions 20, 49, 73, 140, 143, 146, 147 and 154.

In the International patent WO 94/28391 presents the sequence of native flt3 ligand and the cDNA sequence encoding the flt3 ligand, the ways of expression of flt3 ligand in the cell-master, transtitional cDNA, and methods of treatment of patients with disorders of the blood with the use of flt3 ligand.

In U.S. patent 5554512 presents the flt3 ligand person in the form of a selected protein, the DNA encoding the flt3 ligand, a host cell transformed with cDNA, encoding the flt3 ligand, and methods of treatment of patients with flt3 ligand.

In the International patent WO 94/26891 presents the flt3 ligand mammals, including the option of having a box of 29 amino acids, and the corresponding fragment.

Rurangirwa protein sequences

In the evolution of rearrangeable DNA sequences plays an important role in the emergence of varieties of structure and functions of proteins. Gene duplication and the "mixing" of exons represent important the mechanisms for rapid education diversity and, accordingly, provide organisms competitiveness, especially in cases of low natural rate of mutation engine (Doolittle, 1992, Protein Sci., 1, 191-200).

The development of techniques of recombinant DNA made it possible to study the effect of sequence changes on the spatial structure, organization and function of the protein. The way to create new sequences has allowed to establish, that in nature there are pairs of proteins, which are related by a linear reorganization of their amino acid sequences (Cunningham et al., 1979, Proc. Natl. Acad. Sci. USA, 76, 3218-3222; Teather & Erfle, 1990, J. Bacteriol., 172, 3837-3841; Schimming et al., 1992, Eur. J. Biochem., 204, 13-19; Yamiuchi & Minamikawa, 1991, FEBS Lett., 260, 127-130; MacGregor et al., FEBS Lett., 378, 263-266). The first application of this type of rearrangement of proteins in vitro was described by Mikhail and Creighton (Goldenberg & Creighton, 1983, J. Mol. Biol., 165, 407-413). New N-end was selected in the intermediate customers (as a point of rupture) of the original sequence: a new sequence is characterized by the same order of amino acids as the original sequence, from the point of break up or almost up to the source-end. At this point a new sequence connected (directly or indirectly through an incremental fragment sequence - linker) with the amino acid located in or near the source of the N-end; new sequence continue the same sequence, the original sequence, until then, until it reaches the point or area adjacent to an amino acid which is N-terminal to the site of rupture of the initial sequence, this residue forms a new C-end of the chain.

This approach has been applied to proteins, the size of which ranged from 58 to 462 amino acids (Goldenberg & Creighton, 1983, J. Mol. Biol., 165, 407-413; Li & Coffino, 1993, Mol. Cell. Biol., 13, 2377-2383). The investigated proteins cover a wide range of structural classes, including proteins containing dominant α-helix, for example, interleukin-4 (Kreitm an et al., 1995, Cytokine, 7, 311-318), β-plane, for example, interleukin-1 (Horlick et al., 1992, Protein Eng., 5, 427-431), or a mixture of these two structures, for example, phosphoribosyltransferase yeast (Luger et al., 1989, Science, 243, 206-210). A large number of categories of protein functions presented in these studies the reorganization of the amino acid sequence:

Enzymes
lysozyme T4Zhang et al., 1993, Biochemistry, 32, 12311-12318; Zhang et al., 1995, Nature Struct. Biol., 1, 434-438
dihydrotetrazoloBuchwalder et al., 1994, Biochemistry, 31, 1621-1630; Protasova et al., 1995, Protein Eng., 7, 1373-1377
ribonuclease T1Mullins et al., 1994, J. Amer. Chem. Sco., 116, 5529-5533; Garrett et al., 1996, Protein Sci., 5, 204-211
β-glucanase sticksHahn et al., 1994. Proc. Natl. Acad. Sci. USA, 91, 10417-10421
aspartataminotranferaseYang & Schachman, 1993, Proc. Natl. Acad. Sci. USA, 90, 11980-11984
phosphoribosyl-anthranilatesLuger et al., 1989, Science, 243, 206-210; Luger et al., 1990, Protein Eng., 3, 249-258
pepsin/pepsinogenLin et al., 1995, Protein Sci., 4, 159-166
glyceraldehyde-3-phosphatedehydrogenaseVignais et al., 1995, Protein Sci., 4, 994-1000
ornithindecarboxilaseLi & Coffino, 1993, Mol. Cell. Biol., 13, 2377-2383
phosphoglyceraldehyde yeastRitco-Vonsovici et al., 1995, Biochemistry, 34, 16543-16551
Enzyme inhibitors
the basic trypsin inhibitor of the pancreasGoldenberg & Creighton, 1983, J. Mol. Biol., 165, 407-413
Cytokines
interleukin-1bHorlick et al., 1992, 'Protein Eng., 5, 427-431
interleukin-4Kreitman et al., 1995, Cytokine, 7, 311-318
Domain recognition, tyrosinekinase
domain SH3 α-spectrinViguera et al., 1995, J. Mol. Biol., 247, 670-681
Transmembrane protein
MRA-Koebnik & Krmer, 1995, J. Mol. Biol., 250, 617-626
Chimeric protein
interleukin-4-Pseudomonas exotoxinKreitman et al., 1994, Proc. Natl. Acad. Sci. USA, 91, 6889-6893.

The results of these studies vary. In many cases was detected significantly less activity, solubility and thermodynamic stability (dihydrotetrazolo Escherichia coli, aspartate-transcarbamylase, phosphoribosyltransferase, glyceraldehyde-3-phosphatedehydrogenase, ornithindecarboxilase, MRA, sir, phosphoglyceraldehyde yeast). In other cases, proteins with altered sequence are characterized by many properties are practically identical to their natural counterparts (main tripeny inhibitor of the pancreas, T4 lysozyme, ribonuclease T1, β-glucanase sticks, interleukin-1b, domain, SH3 α-spectrin, pepsinogen, interleukin-4). In exceptional cases, it was observed an unexpected improvement in certain properties of the natural sequence, for example, solubility and rate of recovery of spatial structure (domain SH3 α-spectrin), receptor affinity and anticancer activity of the transferred molecules chimeric protein composed of interleukin-4 and exotoxin found (Kreitman et al., 1994, Proc. Natl. Acad. Sci. USA, 91, 6889-6893; Kreitman et al., 1995, Cancer Res., 55, 3357-3363).

The original motif is of marked types of research was related to the study of the role of short - and long-term interactions, protein folding and stability. Realignment of amino acid sequences of this type represent a group of interactions that can develop from long-term in the original sequence in the short rebuilt in sequence, and Vice versa. The fact that many of these reconstructed sequences capable of maintaining the conformational state with at least some level of activity, is strong evidence that the formation of protein folding (spatial organization) involves a variety of mechanisms (Viguera et al., 1995, J. Mol. Biol., 247, 670-681). In the case of the SH3 domain α-spectrin selection of new endings in the sites corresponding to the rpm β-pins, lead to the formation of proteins with slightly reduced stability, which, however, are able to form a spatial structure.

The provisions of the internal points of the gaps used in the above works, found exclusively on the protein surface and are distributed along the primary sequence of the polypeptide without a distinct bias towards the ends or the middle (the variability of the relative distance from the source of the N-end to the point of tears ranged from 10 to 80% (based on full-length sequence). The length of the linkers used to connect IP is adnych N - and C-ends, ranged from 0 to 9 amino acid residues. In one case (Yang & Schachman, 1993, Proc. Natl. Acad. Sci. USA, 90, 11980-11984) fragment sequence cut from the original C-terminal segment, and the connection is carried through the shorter-end of the original N-end. Flexible hydrophilic residues, such as glycine and serine, are often used in the composition of the linkers. Figueroa et al. (Viguera et al., 1995, J. Mol. Biol., 247, 670-681) compared the source connection of the N - and C-ends in 3 or 4 amino acid linkers; thermodynamically 3-amino acid linker is less stable. Protasov et al. (Protasova et al., 1994, Protein Eng., 7, 1373-1377) used linkers consisting of 3 or 5 residues, when connecting the source of N-ends digidrofolatreduktazy E.coli: only a 3-amino acid linker allowed to get protein in good yield.

The invention

Hematopoietic protein comprising the amino acid sequence according to the following formula:

R1-L1-R2, R2-L1-R1or R1-R2or R2-R1,

despite the fact that R1and R2are independently selected fragments from the group including:

(I) a polypeptide agonist receptor EPO person, including a modified amino acid sequence of EPO according to the formula:

despite the fact that arbitrarily 1-6 linakis is from the N-Terminus and 1-5 amino acids from the C-end can be deleterows of the composition of the above-mentioned polypeptide receptor agonist;

despite the fact that the N-end attached to the C-end directly or through a linker (L2)capable of linking the N-end C-end and having a new C - and N-ends in amino acids;

23-2447-48109-110
24-2548-49110-111
25-2649-50111-112
26-2750-51112-113
27-2851-52113-114
28-2952-53114-115
29-3053-54115-116
30-3154-55116-117
31-3255-56117-118
32-3356-57118-119
33-3457-58119-120
34-3577-78120-121
35-3678-79121-122
36-3779-80122-123
37-3880-81123-124
38-3981-82124-125
39-4082-83125-126
40-4184-85126-127
41-4285-86127-128
42-4386-87128-129
43-4487-88129-130
44-4588-89130-131
45-46108-109131-132
46-47 respectively; and

(II) a polypeptide agonist factor receptor of human stem cells, including modified amino acid sequence of the factor of stem cells according to the formula:

despite the fact that arbitrarily 1-23 amino acids can be deleterows from the C-end of the said polypeptide agonist of the receptor of stem cell factor;

despite the fact that the N-end attached to the C-end directly or through a linker (L2)capable of linking the N-end C-end and having a new C - and N-ends in amino acids;

23-2439-4096-97
24-2540-4197-98
25-2664-6598-99
26-2765-6699-100
27-2866-67100-101
28-2967-68101-102
29-3068-69102-103
30-3169-70103-104
31-3270-71104-105
2-33 89-90105-106
33-3490-91106-107
34-3591-92107-108
35-3692-93108-109
36-3793-94109-110
37-3894-95110-111
38-3995-96respectively

(III) a polypeptide agonist receptor flt-3, comprising a modified amino acid sequence of the ligand, flt-3 according to the formula:

with that, 1-7 amino acids randomly deleteroute with the end of the above-mentioned polypeptide agonist receptor flt-3;

despite the fact that the N-end attached to the C-end directly or through a linker (L2)capable of linking the N-end C-end and having a new C - and N-ends in amino acids;

28-2942-4393-94
29-3064-6594-95
30-3165-6695-96
31-3266-6796-97
32-3386-8797-98
34-3587-8898-99
36-3788-8999-100
37-3889-90100-01
38-3990-51101-102
39-4091-92102-103
40-4192-93respectively, and
41-42  

(IV) a polypeptide comprising a modified amino acid sequence of G-CSF person according to the formula:

despite the fact that

XAA in position 1 is Thr, Sr, AGD, Tight or Gly;

XAA in position 2 is Pro or Leu;

XAA at position 3 is Leu, AGD, Tyr or Ser;

XAA in position 13 is Phe, Ser, His, Thr or Pro;

XAA at position 16 is Lys, Pro, Ser, Thr, or His;

XAA at position 17 is Cys, Ser, Gly, Ala, Ile, Tyr, or Arg;

XAA at position 18 is Leu, Thr, Pro, His, Ile or Cys;

XAA in position 22 is Arg, Tyr, Ser, Thr or Ala;

XAA at position 24 is Ile, Pro, Tyr, or Leu;

XAA at position 27 is Asp or Gly;

XAA at position 30 is Ala, Ile, Leu, or Gly;

XAA at position 34 is Lys or Ser;

XAA at position 36 is Cys or Ser;

XAA at position 42 is Cys or Ser;

XAA at position 43 is His, Thr, Gly, Val, Lys, Trp, Ala,Arg, Cys or Leu;

XAA at position 44 is Pro, Gly, Arg, Asp, Val, Ala, His, Trp, Gln, or Thr;

XAA at position 46 is Glu, Arg, Phe, Arg, Ile, or Ala;

XAA at position 47 is Leu or Thr;

XAA at position 49 is Leu, Phe, Arg or Ser;

XAA at position 50 is Leu, Ile, His, Pro, or Tyr;

XAA at position 54 is Leu or His;

XAA in which ulozhenie 64 - this is Cys or Ser;

XAA at position 67 is Gln, Lys, Leu or Cys;

XAA at position 70 is Gln, Pro, Leu, Arg or Ser;

XAA at position 74 is s or Ser;

XAA at position 104 is Asp, Gly or Val;

XAA at position 108 is Leu, Ala, Val, Arg, Trp, Gln, or Gly;

XAA at position 115 is Thr, His, Leu, or Ala;

XAA at position 120 is Gln, Gly, Arg, Lys or His;

XAA at position 123 is Glu, Arg, Phe or Thr;

XAA at position 144 is Phe, His, Arg, Pro, Leu, Gln or Glu;

XAA at position 146 is Arg or Gln;

XAA at position 147 is Arg or Gln;

XAA at position 156 is His, Gly or Ser;

XAA at position 159 is Ser, Arg, Thr, Tight, Val or Gly;

XAA at position 162 is Glu, Leu, Gly, or Trp;

XAA at position 163 is Val, Gly, Arg, or Ala;

XAA at position 169 is Arg, Ser, Leu, Arg or Cys;

XAA at position 170 is His, Arg or Ser;

with that, 1-11 amino acids from N-Terminus and 1-5 amino acids from the C-end can deleteroute of these modified amino acid sequence of G-CSF person; and

despite the fact that the N-end attached to the C-end directly or through a linker (L2)capable of linking the N-end C-end and having a new C - and N-ends in amino acids;

38-3962-63123-124
39-4063-64124-125
40-4164-65125-126
41-42 126-127
42-4366-67128-129
43-4467-68128-129
45-4668-69129-130
48-4969-70130-131
49-5070-71131-132
52-5371-72132-133
53-5491-92133-134
54-4492-93134-135
55-5693-94135-136
56-5794-95136-137
57-5895-96137-138
58-5996-97138-139
59-6097-98139-140
60-6198-99140-141
61-6299-100141-142
  or 142-143
  respectively

(V) a polypeptide comprising a modified amino acid sequence of IL-3, according to the formula:

despite the fact that

XAA at position 17 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;

XAA at position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln;

XAA at position 19 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;

XAA in position the AI 20 - is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;

XAA at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;

XAA in position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly;

XAA at position 23 is Ile, Val, Ala, Gly, Trp, Lys, Phe, Leu, Ser, or Arg;

XAA at position 24 is Ile, Gly, Val, Arg, Ser, Phe or Leu;

XAA at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;

XAA at position 26 is His, Thr, Phe, Gly, Arg, Ala, or Trp;

XAA at position 27 is Leu, Gly, Arg, Thr, Ser or Ala;

XAA at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;

XAA at position 29 is Gln, Asn, Leu, Pro, Arg, or Val;

XAA at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;

XAA at position 31 is Pro, Asp, Gly, Ala, Arg, Leu Gln;

XAA at position 32 is Leu, Val, Arg, Gln, Asn, Gly, Ala or Glu;

XAA at position 33 is Pro, Leu, Gln, Ala, Thr, or Glu;

XAA at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;

XAA at position 35 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;

XAA at position 36 is Asp, Leu, or Val;

XAA at position 37 is Phe, Ser, Pro, Trp, or Ile;

XAA at position 38 is Asn or Ala;

XAA at position 40 is Leu, Trp, or Arg;

XAA at position 41 is Asn, Cys, Arg, Leu, His, Met, or Pro;

XAA at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala;

XAA at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;

XAA at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;

XAA at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu, or His;

XAA in which ulozhenie 46 - this is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;

XAA at position 47 is Ile, Gly, Val, Ser, Arg, Pro, or His;

XAA at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;

XAA at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;

XAA at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met, or Gln;

XAA at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;

XAA at position 52 is Asn, His, Arg, Leu, Gly, Ser or Thr;

XAA at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;

XAA at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;

XAA at position 55 is Arg, Thr, Val, Ser, Leu, or Gly;

XAA at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;

XAA at position 57 is Asn or Gly;

XAA at position 58 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;

XAA at position 59 is Glu, Tyr, His, Leu, Pro, or Arg;

XAA at position 60 is Ala, Ser, Pro, Tyr, Asn, or Thr;

XAA at position 61 is Phe, Asn, Glu, Pro, Lys, Arg or Ser;

XAA at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;

XAA at position 63 is Arg, Tyr, Trp, Lys, Ser, His, Pro, or Val;

XAA at position 64 is Ala, Asn, Pro, Ser or Lys;

XAA at position 65 is Val, Thr, Pro, His, Leu, Phe or Ser;

XAA at position 66 is Lys, Ile, Arg, Val, Asn, Glu or Ser;

XAA at position 67 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;

XAA at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;

XAA at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;

XAA at position 70 is Asn, Leu, Val, Trp, Pro, or Ala;

Haa, position 71 - this is Ala, Met, Leu, Pro, Arg, Glu, Thr,Gln, Trp, or Asn;

XAA at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;

XAA at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;

XAA at position 74 is Ile, Met, Thr, Pro, Arg, Gly or Ala;

XAA at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln or Leu;

XAA at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;

XAA at position 77 is Ile, Ser, Arg, Thr, or Leu;

XAA at position 78 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;

XAA at position 79 is Lys, Thr, Asn, Met, Arg, Ile, Gly, or Asp;

XAA at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu or Arg;

XAA at position 81 is Leu, Gln, Gly, Ala, Thr, Arg, Val or Lys;

XAA at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;

XAA at position 83 is Pro, Ala, Thr, Trp, Arg, or Met;

XAA at position 84 is Cys, Glu, Gly, Arg, Met, or Val;

XAA at position 85 is Leu, Asn, Val, or Gln;

XAA at position 86 is Pro, Cys, Arg, Ala, or Lys;

XAA at position 87 is Leu, Ser, Trp, or Gly;

XAA at position 88 is Ala, Lys, Arg, Val or Trp;

XAA at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn or Ser;

XAA at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile or Met;

XAA at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;

XAA at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile, or Leu;

XAA at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;

XAA at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro;

XAA at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile, or Tyr;

XAA at position 96 is the fact Pro Lys, Tyr, Gly, Ile, or Thr;

XAA at position 97 is Ile, Val, Lys, Ala, or Asn;

XAA at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr, or Pro;

XAA at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;

XAA at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln or Pro;

XAA at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu, or Gln;

XAA at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;

XAA at position 103 is Asp, or Ser;

XAA at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe or Gly;

XAA at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile. Asp or His;

XAA at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;

XAA at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro;

XAA at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;

XAA at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser, or Trp;

XAA at position 111 is Leu, Ile, Arg, Asp, or Met;

XAA at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;

XAA at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;

XAA at position 114 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;

XAA at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;

XAA at position 116 is Lys, Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln, or Ile;

XAA at position 117 is Thr, Ser, Asn, Ile, Trp, Lys or Pro;

XAA at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;

XAA at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tight or AGD;

XAA at position 120 is Asn, Ala, ro, Leu, His, Val, or Gln;

XAA at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;

XAA at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tight or Cys;

XAA at position 123 is Ala, Met, Glu, His, Ser, Pro, Tight or Leu;

despite the fact that amino acids 1 to 14 can be arbitrarily deleterows from N-Terminus and / or amino acids 1 to 15 can be arbitrarily deleterows with the end of the said modified amino acid sequence of IL-3 people; despite the fact that amino acids with the 0-th 44 th denoted by XAA are different from the corresponding amino acid sequence of native interleukin-3 (I-133); and

despite the fact that the N-end attached to the C-end directly or through a linker (L2)capable of linking the N-end C-end and having a new C - and N-ends in amino acids;

26-2749-5083-84
27-2850-5184-85
28-2951-5285-86
29-3052-5386-87
30-3153-5487-88
31-3254-5588-89
32-3364-6589-90
33-3465-6690-91
34-3566-6791-92
35-3667-68/td> 92-93
36-3768-6997-98
37-3869-7098-99
38-3970-7199-100
39-4071-72100-101
40-4172-73101-102
41-4282-83102-103
  or 103-104
  respectively

(VI) a polypeptide comprising a modified amino acid sequence of the ligand of the C-mpl person, according to the formula:

despite the fact that

XAA at position 112 deleterule or is Leu, Ala, Val, Ile, Pro, Phe, Trp or Met;

XAA at position 113 deleterule or is Pro, Phe, Ala, Val, Leu, Ile, Trp or Met;

XAA at position 114 deleterule or is Pro, Phe, Ala, Val, Leu, Ile, Trp or Met;

XAA at position 115 deleterule or is Gln, Gly, Ser, Thr, Tight or Asn;

and

when Cho N-end attached to the C-end directly or through a linker (L2)capable of linking the N-end C-end and having a new C - and N-ends in amino acids;

26-2751-52108-109
27-2852-53109-110
28-2953-5 110-111
29-3054-55111-112
30-3155-56112-113
32-3356-57113-114
33-3457-58114-115
34-3558-59115-116
36-3759-60116-117
37-3878-79117-118
38-3979-80118-119
40-4180-81119-120
41-4281-82120-121
42-4382-83121-122
43-4483-84122-123
44-4584-85123-124
46-4785-86124-125
47-4886-87125-126
48-4987-88126-127
50-5188-89or 127-128,
  respectively;

(VII) a polypeptide comprising a modified amino acid sequence of IL-3, according to the formula:

despite the fact that

XAA at position 17 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;

XAA at position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln;

Haa floor in the position 19 - it Met, Phe, Ile, Arg, Gly, Ala, or Cys;

XAA in position 20 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;

XAA at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;

XAA in position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly;

XAA at position 23 is Ile, Val, Ala, Gly, Trp, Lys, Phe, Leu, Ser, or Arg;

XAA at position 24 is Ile, Gly, Val, Arg, Ser, Phe or Leu;

XAA at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;

XAA at position 26 is His, Thr, Phe, Gly, Arg, Ala, or Trp;

XAA at position 27 is Leu, Gly, Arg, Thr, Ser or Ala;

XAA at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;

XAA at position 29 is Gln, Asn, Leu, Pro, Arg, or Val;

Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;

Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu Gln;

Xaa at position 32 is Leu, Val, Arg, Gln, Asn, Gly, Ala or Glu;

Xaa at position 33 is Pro, Leu, Gln, Ala, Thr, or Glu;

Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;

Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;

Xaa at position 36 is Asp, Leu, or Val;

Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile;

Xaa at position 38 is Asn or Ala;

XAA at position 40 is Leu, Trp, or Arg;

Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met, or Pro;

Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala;

Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;

Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;

Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Sr, Ala, Ile, Glu, or His;

Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;

Xaa at position 47 is Ile, Gly, Val, Ser, Arg, Pro, or His;

Xaa at position 48 is Leu, Ser, Cys, Arg, Ile. His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;

Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;

Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met, or Gln;

Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;

Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser or Thr;

Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;

Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;

Xaa at position 55 is Arg, Thr, Val, Ser, Leu, or Gly;

Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;

Xaa at position 57 is Asn or Gly;

Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;

Xaa at position 59 is Glu, Tyr, His, Leu, Pro, or Arg;

Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn, or Thr;

Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg or Ser;

XAA at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;

XAA at position 63 is Arg, Tyr, Trp, Lys, Ser, His, Pro, or Val;

XAA at position 64 is Ala, Asn, Pro, Ser or Lys;

XAA at position 65 is Val, Thr, Pro, His, Leu, Phe or Ser;

XAA at position 66 is Lys, Ile, Arg, Val, Asn, Glu or Ser;

XAA at position 67 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;

XAA at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;

XAA at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;

XAA at position 70 is Asn, Leu, Val, Trp, Pro, or Al;

XAA at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr,Gln, Trp, or Asn;

XAA at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg or sp;

XAA at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;

XAA at position 74 is Ile, Met, Thr, Pro, Arg, Gly or Ala;

XAA at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln or Leu;

XAA at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;

XAA at position 77 is Ile, Ser, Arg, Thr, or Leu;

XAA at position 78 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;

XAA at position 79 is Lys, Thr, Asn, Met, Arg, Il, Gly, or Asp;

XAA at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu or Arg;

XAA at position 81 is Leu, Gln, Gly, Ala, Thr, Arg, Val or Lys;

XAA at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;

XAA at position 83 is Pro, Ala, Thr, Trp, Arg, or Met;

XAA at position 84 is Cys, Glu, Gly, Arg, Met, or Val;

XAA at position 85 is Leu, Asn, Val, or Gln;

XAA at position 86 is Pro, Cys, Arg, Ala, or Lys;

XAA at position 87 is Leu, Ser, Trp, or Gly;

XAA at position 88 is Ala, Lys, Arg, Val or Trp;

XAA at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn or Ser;

XAA at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile or Met;

XAA at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;

XAA at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile, or Leu;

XAA at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;

Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro;

Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile, or Tyr;

p> Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile, or Thr;

Xaa at position 97 is Ile, Val, Lys, Ala, or Asn;

Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr, or Pro;

Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;

Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln or Pro;

Xaa at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu, or Gln;

Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;

Xaa at position 103 is Asp, or Ser;

Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe or Gly;

Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;

Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;

Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro;

Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;

Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser, or Trp;

Xaa at position 111 is Leu, Ile, Arg, Asp, or Met;

Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;

Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;

Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;

Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;

Xaa at position 116 is Lys, Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln, or Ile;

Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys or Pro;

Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;

Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;

Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val, or Gln;

Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;

Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;

Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;

despite the fact that amino acids 1 to 14 can be arbitrarily deleterows from N-Terminus and / or amino acids 1 to 15 can be arbitrarily deleterows with the end of the said modified amino acid sequence of IL-3 people; despite the fact that amino acids 1 to 44-s, denoted by XAA are different from the corresponding amino acid sequence of native (1-133) interleukin-3 (IL-3); and

(VIII) factor selected from the group consisting of a colony stimulating factor, cytokine, lymphokine, interleukin;

despite the fact that L1is a linker capable of binding R1with R2;

with the proviso that at least R1or R2selected from the polypeptides according to formula (I), (II) or (III); and

arbitrarily referred to hematopoietic protein can be immediately anticipated (methionine-1), (alanine-1or (methionine-2, alanine-1).

The most convenient break points, by which new C - and N-ends can be created in the above polypeptide (I), the following: 23-24, 24-25, 25-26, 27-28, 28-29, 29-30, 30-31, 31-32, 32-33, 33-34, 34-35, 35-36, 36-37, 37-38, 38-39, 40-41, 41-42, 42-43, 52-53, 53-54, 54-55, 55-56, 77-78, 78-79, 79-80, 80-81, 81-82, 82-83, 83-84, 84-85, 85-86, 86-7, 109-110, 110-111, 111-112, 112-113, 113-114, 114-115, 115-116, 116-117, 117-118, 118-119, 119-120, 120-121, 121-122, 122-123, 123-124, 124-125, 125-126, 126-127, 127-128, 128-129, 129-130, 130-131 131-132 and.

The most convenient break points, by which new C - and N-ends can be created in the above polypeptide (I), the following: 23-24, 24-25, 31-32, 32-33, 37-38, 38-39, 82-83, 83-84, 85-86, 86-87, 87-88, 125-126, 126-127 and 131-132.

Agonists EPO-receptor according to the present invention may include amino acid substitutions, such as described in patent WO 94/24160, or in one or more glycosylation sites (Asn24, Asn83and Asn126) with substitutions of other amino acids, with no restrictions aspartic or glutamic acids, as well as deletions and / or insertions. Also have in mind that agonists EPO-receptor according to the present invention can also include deletions of amino acids in both N - and C-ends of the original polypeptide, and deletions in the new N - and / or-end sequence of the modified polypeptide according to the formulas given above.

The most convenient break points, by which new C - and N-ends can be created in the above polypeptide (II), the following: 23-24, 24-25, 25-26, 33-34, 34-35, 35-36, 36-37, 38-39, 39-40, 40-41, 64-65, 65-66, 66-67, 67-68, 68-69, 69-70, 70-71, 89-90, 90-91, 91-92, 92-93, 93-94, 94-95, 95-96, 96-97, 97-98, 98-99, 99-100, 100-101, 101-102, 102-103, 103-104, 104-105 and 105-16, respectively.

The most convenient break points, by which new C - and N-is ncy can be created in the above polypeptide (II), the following: 64-65, 65-66, 92-93 and 93-94, respectively.

The most convenient break points, by which new C - and N-ends can be created in the above polypeptide (III), the following: 36-37, 37-38, 39-40, 41-42, 42-43, 64-65, 65-66, 66-67, 86-87, 87-88, 88-89, 89-90, 90-91, 91-92, 92-93, 93-94, 94-95, 95-96, 96-97, 97-98, 98-99, 99-100 100-101 and.

The most convenient break points, by which new C - and N-ends can be created in the above polypeptide (III), the following: 39-40, 65-66, 89-90, 99-100 100-101 and.

The most convenient break points, by which new C - and N-ends can be created in the above polypeptide (IV), the following: 38-39, 39-40, 40-41, 41-42, 48-49, 53-54, 54-55, 55-56, 56-57, 57-58, 58-59, 59-60, 60-61, 61-62, 62-63, 64-65, 65-66, 66-67, 67-68, 68-69, 69-70, 96-97, 125-126, 126-127, 127-128, 128-129, 129-130, 130-131, 131-132, 132-133, 133-134, 134-135, 135-136, 136-137, 137-138, 138-139, 139-140, 140-141 and 141-142.

The most convenient break points, by which new C - and N-ends can be created in the above polypeptide (IV), the following: 38-39, 48-49, 96-97, 125-126, 132-133 and 141-142.

The most convenient break points, by which new C - and N-ends can be created in the above polypeptide (V): 28-29, 29-30, 30-31, 31-32, 32-33, 33-34, 34-35, 35-36, 36-37, 37-38, 38-39, 39-40, 66-67, 67-68, 68-69, 69-70, 70-71, 84-85, 85-86, 86-87, 87-88, 88-89, 89-90, 90-91, 98-99, 99-100, 100-101 101-102 and.

The most convenient break points, about which the new C - and N-ends can be created in the above polypeptide (V), the following: 34-35, 69-70 and 90-91.

The most convenient points of discontinuity, the cat is the second new C - and N-ends can be created in the above polypeptide (VI), the following: 80-81, 81-82, 82-83, 83-84, 84-85, 85-86, 86-87, 108-109, 109-110, 110-111, 111-112, 112-113, 113-114, 114-115, 115-116, 116-117, 117-118, 118-119, 119-120, 120-121, 121-122, 122-123, 123-124, 124-125, 125-126 and 126-127.

The most convenient break points, by which new C - and N-ends can be created in the above polypeptide (VI), the following: 81-82, 108-109, 115-116, 119-120, 122-123 and 125-126.

Multifunctional receptor agonist according to the present invention can also be represented by the following formula:

(T1)a-(L1)b-X1-(L)c-X2-(L2)d-(T2)e

or

X1-(L)c-X2-(L)-Y1-(L)c-Y2

in which:

X1a peptide consisting of the amino acid sequence corresponding to the sequence of residues n+1 through J of the original polypeptide in which amino acid residues numbered sequentially 1 through J with an N-end for the remainder of 1;

L is an arbitrary linker;

X2a peptide consisting of the amino acid sequence of residues 1 to n in the original polypeptide;

Y1a peptide consisting of the amino acid sequence corresponding to the sequence of residues n=1 through To the original polypeptide comprising amino acid residues are numbered sequentially from 1 through To N-end of a remainder of 1;

Y2a peptide consisting of amino acid after which outermost residues from 1 to n of the original polypeptide;

L1and L2- random peptide spacers;

n is an integer from 1 to J-1;

b, c, and d are independently take values 0 or 1;

a and e is either 0 or 1 in that both cannot be simultaneously 0, and

T1and T2- proteins.

Multifunctional chimeric agonists hematopoietic receptors according to the present invention may include amino acid substitutions, deletions and / or insertions in individual polypeptide components of the chimeric molecule. Also have in mind that multifunctional chimeric agonists hematopoietic receptors according to the present invention can also lead to the deletion of amino acids of both the N - and C-ends of the original protein and deletions in the new N - and / or-ends sequences of modified polypeptides according to the formulas given above.

The preferred formation of the present invention, the linker (L), (L1) or (L2)mentioned in the above formulas connecting the N-end C-end must match the polypeptide selected from the group including:

Ser;

Asn;

Gly;

Thr;

GlySer;

AlaAla;

GlySerGly;

GlyGlyGly;

GlyAsnGly;

GlyAlaGly;

GlyThrGly;

AlaSerAla;

AlaAlaAla;

GlyGlyGlySer SEQ ID NO 778;

GlyGlyGlySerGlyGlyGlySer SEQ ID NO 779;

GlyGlyGlySerGlyGlyGlySerGlyGlyGlyser SEQ ID NO 780;

SerGlyGlySerGlyGlySer SEQ ID NO 781;

GluPheGlyAsnMet SEQ ID NO 782;

GluPheGlyGlyAsnMe SEQ ID NO 783;

GluPheGlyGlyAsnGlyGlyAsnMet SEQ ID NO 784;

GlyGlySerAspMetAlaGly SEQ ID NO 785;

SerGlyGlyAsnGly SEQ ID NO 786;

SerGlyGlyAsnGlySerGlyGlyAsnGly SEQ ID NO 787;

SerGlyGlyAsnGlySerGlyGlyAsnGlySerglyglyasngly SEQ ID NO 788;

SerGlyGlySerGlySerGlyGlySerGly SEQ ID NO 789;

SerGlyGlySerGlySerGlyGlySerGlySerglyglysergly SEQ ID NO 790;

GlyGlyGlySerGlyGly SEQ ID NO 791;

GlyGlyGlySerGlyGlyGly SEQ ID NO 792;

GlyGlyGlySerGlyGlyGlySerGlyGly SEQ ID NO 793;

GlyGlyGlySerGlyGlyGlySerGlyGlyGlysergly SEQ ID NO 794;

GlyGlyGlySerGlyGlyGlySerGlyGlyGlyserglyglygly SEQ ID NO 795;

GlyGlyGlySerGlyGlyGlySerGlyGlyGlyserglyglyglyserglyglyglysergly SEQ ID NO 796;

ProProProTrpSerProArgProLeuGlyAlathralaprothralaglyglnproproleu SEQ ID NO 797;

ProProProTrpSerProArgProLeuGlyAlathralaprothr SEQ ID NO 798; and

ValGluThrValPheHisArgValSerGlnAspglyleuleuthrser SEQ ID NO 799.

In addition, the present invention is expressing recombinant vectors comprising a nucleotide sequence encoding a multifunctional chimeric agonists hematopoietic receptors required mikroorganismen expression systems and processes for the production of multifunctional chimeric agonists hematopoietic receptors. The invention is also pharmaceutical preparations containing multifunctional chimeric agonists hematopoietic receptors, and methods of using multifunctional chimeric agonists hematopoietic receptors.

In addition to the use of multifunctional chimeric agonists hematopoietic receptors according to the present invention in vivo, it is believed that the use of In vitro is oglo would be based on the ability to stimulate the activation and growth of bone marrow cells and blood before how to conduct a blood transfusion patients. Another suggested use is associated with produced dendritic cells in vivo and ex vivo.

It is believed that the reduced affinity of the chimeric proteins is determined (at least partly) by the failure of individual components to form their native spatial structure in the case when they are embedded in the structure of the chimeric molecule, or the emergence of spatial interference of active sites on the composition of the individual components of the chimeric protein. This invention overcomes these limitations by offering new multifunctional chimeric agonists hematopoietic receptors, which are characterized by affinity binding, comparable or even exceeding that of the individual components of the chimeric molecule.

Brief description of drawings

Figure 1 schematically illustrates the adjustment sequence of the polypeptide. N-terminal (N) and the end (S) of the original polypeptide linked via a linker or connected to each other directly. Protein "open" point break, which creates a new N-end (new N) and the new-the end (new): the result is a protein with a new primary amino acid sequence. The converted molecule can be synthesized de novo as a linear molecule without passing through the stages of the connection of the original N-Terminus and C-con is and "disclosure" of the polypeptide at the point of discontinuity.

Figure 2 shows schematically the way I intended to create new proteins, in which the source of the N-end and C-end of the native polypeptide is connected to the linker, and can result in different N-end and C-end. In the example shown, the rearrangement of the sequence leads to the emergence of a new gene encoding a protein in which a new N-end is created by the 97-th amino acid residue of the original polypeptide, the source-end (remainder 174) is connected with the 11th amino acid (amino acids 1-10 deleteroute) through a linker segment and the new C-end is created by the 96th amino acid source sequence.

Figure 3 shows schematically the method II used to create new proteins, in which the source of the N-end and C-end native polypeptide are connected to each other without the linker with the emergence of different N-Terminus and C-end of the protein. In the example shown, the rearrangement of the sequence leads to the formation of a new gene encoding a protein with a new N-end, created by the 97-th residue of the original polypeptide, the source-end (residue 174)connected to the source of the N-end and new-end formed by the 96th amino acid source sequence.

Figure 4 schematically shows the method III is used to create new proteins, in which the source of the N-end and C-end of the native polypeptide is uedineny using a linker with the formation of different N-Terminus and C-end of the polypeptide. In the example shown, the rearrangement of the sequence leads to the formation of the gene encoding a protein with a new N-end formed by the 97-th residue of the original protein source-end (residue 174), attached to the 1st amino acid via a linker segment, and the C-end, formed in 96-th amino acid of the source sequence.

Figure 5 shows the biological activity of multifunctional receptor agonists, including agonists of the receptor flt3 pMON32332, pMON32333, pMON32334 and pMON32335, in comparison with recombinant native flt3 (Genzyme) in the test for cell proliferation MUTZ-2. MT = imitation transfection.

6 shows the DNA sequence encoding the Mature EPO, based on the sequence published by Lin et al. (1085, Proc. Natl. Acad. Sci. USA, 82, 7580-7584).

Figa and 7b show the DNA sequence encoding the native stem cell factor, based on the sequence published by Martin et al. (1990, Cell, 63, 203-211).

Fig shows the DNA sequence encoding the soluble (cytoplasmic) stem cell factor, based on the sequence published by Langley et al. (1994, Arch. Biochem. Biophys., 311, 55-61).

Figa and 9b show the DNA sequence encoding a 209 amino acid composition of the active flt3 ligand, according to Lyman et al. (1995, Oncogene, 11, 1165-1172).

Figure 10 shows the DNA sequence, coderush the Yu 134 amino acids soluble (cytoplasmic) forms of flt3 ligand, according to Lyman et al., (1995, Oncogene, 11, 1165-1172).

Detailed description of the invention

The present invention is multifunctional chimeric agonists hematopoietic receptors that are generated by covalent binding polypeptides, each of which can be active indirectly through different and specific cellular receptors, initiating complementary forms of biological activity. Hematopoiesis involves a complex set of cellular processes, in which stem cells continuously generate a large population of Mature cells of all major types. Currently, there are at least 20 regulators proliferation activity in hematopoiesis. Most of these regulators of cell proliferation can be stimulated only one or another type of forming colonies in vitro, despite the fact that detailed parameters of the formation of colonies stimulated by each of the regulators, is distinctly different. No two of these controllers, which would show the same parameters for the formation of colonies, estimated by the number of colonies or, more importantly, the type of differentiated cells and their differentiation (maturation). The most convenient way to study the control of cell proliferation associated with the use of simple culture systems In vitro. Three distinct features : the ISR can be defined: change the size of the colony, the change in the number of colonies and the cell type. Two or more factors can affect the cell-predecessor, infecting the formation of larger quantities of offspring, i.e. increasing the size of the colony. Two or more factors can cause the increase in the number of progenitor cells, whose proliferation is initiated, because there are different groups of progenitor cells that respond exclusively to one of the factors, or because of some precursor cells require stimulation of two or more factors before they become able to respond. Activation of additional receptors on the cell by using two or more factors can apparently enhance the mitotic signal by combining the original differential signal paths into a single final signal path reaching the nucleus (Metcalf; 1989, Nature, 339, 27). Other mechanisms may explain the phenomenon of synergism. For example, if one of the signal paths is limited to mediate activation of additional signaling pathways, mediated by the kind of the second factor, the result can be achieved "superadditivity" response. In some cases, the activation of one type of receptor can induce increased expression of other types of receptors (Metcalf, 1993, Blood, 82, 3515-3523). Two or more factors can obespechivayuschim cell types, different from that under the action of a single factor. The use of multifunctional chimeric agonists hematopoietic receptors could have significant clinical benefits, determined by the nature of the proliferative response, which is impossible when using a separate similar factors.

Receptors of hematopoietic and other growth factors can be classified into two clearly distinguished family of related proteins: 1) tyrosinekinase receptors, including the receptors for epidermal growth factor, M-CSF (Sherr, 1990, Blood, 75, (1) and SCF (Yarden et al., 1987, EMBO J. 6, 3341); and (2) hematopoietic receptors, deprived tyrosinekinase domain, but also showing significant similarity of their extracellular domain (Bazan, 1990, Proc. Natl. Acad. Sci. USA, 87, 6934-6938). In this second group include erythropoietin (EPO) (D'andrea et al., 1989, Cell, 57, 277), GM-CSF (Gearing et al., 1989, EMBO J. 8, 3667), IL-3 (Kitamura et al., 1991, Cell 66, 1165), G-CSF (Fukunaga et al., 1990, J. Biol. Chem., 265, 14008-14015), IL-4 (Harada et al., 1990, Proc. Natl. Acad. Sci. USA, 87, 857), IL-5 (Takaki et al., 1990, EMBO'3., 9, marketed 4 367), IL-6 (Yamasaki et al., 1988, Science, 241, 825), IL-7 (Goodwin et al., 1990, Cell, 60, 941-951), LIF (Gearing et al., 1991, EMBO J. 10, 2839) and IL-2 (Cosman et al., 1986, Mol.-Immunol., 23, 935-994). Most of the receptors listed in the latter group, the high-affinity heterodimeric form is. After binding of the ligand specific α-subunit becomes associated with at least some is another subunit of the receptor (β -subunit, γ-subunit). Many of these factors include the common receptor subunit: α-subunit of the receptors for GM-CSF, IL-3 and IL-5 are associated with the General β-subunit (Kitamura et al., 1991, Cell 66, 1165; Takaki et al., 1991, EMBO J. 10, 2833-2838), and the receptor complexes of IL-6, LIF and IL-11 have a common β-subunit (Dr) (Tada et al., 1989, Cell, 58, 573-581; Gearing et al., 1992, Science, 255, 1434-1437). The receptor complexes of IL-2, IL-4, IL-7, IL-9 and IL-15 have a common γ-subunit (Kondo et al., 1993, Science, 266, 1042-1045; Noguch et al., 1993, Science, 262, 1877; Giri et al., 1994, EMBO J. 13, 2822-2830).

The use of blood, manifesting multiple activity can have significant benefits by reducing needs factor-producing cells and their induction systems. In cases of restrictions in the ability of cells to produce a factor, by reducing the required concentrations of each of the required factors and due to its composition of any combination can be achieved a significant reduction of the required number of factor-producing cells. The use of hematopoietic factor, with multiple activities, can reduce the number of factors that would be necessary, apparently, by reducing the likelihood of negative side effects.

The new compounds of this invention are represented by formula selection from the group consisting of:

R1-L1-R2, R2-L1-R1or R1-R2or R2-R1,

where R1and R2are determined as described above.

Preferably R2- colony stimulating factor with a different but complementary activity with respect to R1. Under a complementary activity refers to the activity that enhances or modifies the response to any other cell modulator. Polypeptide R1attach either directly or through linery segment to polypeptide R2. The term "directly" determines the sign of multifunctional chimeric agonists hematopoietic receptors, in which the polypeptides are connected to each other without a peptide linker. Thus, L1represents a chemical bond or polypeptide segment which R1and R2attached "within the scope"; most often L1linear peptide to which R1and R2attached amide links connecting With the end of R1N-end of the L1and With the end of the L1N-end R2. Under "connection within the scope of (reading)" means that the translation termination or the gap between reading frames (coding sequences) in a DNA that encodes R1and R2that is not happening.

A non-limiting list of other the actors of growth, i.e. colony-stimulating factors (CSFs), includes: cytokines, lymphokines, interleukins, hematopoietic growth factors, which can be connected with (I), (II) or (III), including GM-CSF, G-CSF, the ligand of the C-mpl (also known as TRO or MGDF), M-CSF, erythropoietin (EPO), IL-1, IL-4, IL-2, IL-3, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL -12, IL-13, IL-15, LIF, flt3 ligand/flt2, human growth hormone, growth factor b-cells, a factor of differentiation In cells, the factor of differentiation of eosinophils and stem cell factor (SCF), also known as "hard" factor or ligand of c-kit. In addition, the present invention is the use of modified molecules R1or R2or mutated, or modified DNA sequences encoding these molecules R1or R2. The present invention is also multifunctional chimeric agonists hematopoietic receptors, among which R1or R2may be a variant of hIL-3 variant of the ligand of the C-mpl or variant of G-CSF. "Variant hIL-3" is defined as a molecule hIL-3, carrying amino acid substitutions, and (or) partial deletions in accordance with the options described in patents WO 94/12638, WO 94/12639 and WO 95/00646, as well as other variants known to specialists in this field of technology. "Variant of the ligand of the C-mpl″ is defined as a molecule ligand of the C-mpl, which includes amino acid substitutions, and (or) partial cases the tion of the ligand of c-mpl in accordance with options, described in U.S. patent 08/383035, as well as other variants known to specialists in this field of technology. "A variant of G-CSF" is defined as a molecule G-CSF that includes amino acid substitutions, and (or) partial deletions in G-CSF according to the options described here, as well as other factors known to specialists in this field of technology. In addition to the above list of options IL-3 according to patent WO 94/12639 and WO 94/b, agonists of the receptor for G-CSF according to patent WO 97/12977, agonists of receptor-mr1 according to patent WO 97/12978, agonists of the receptor for IL-3 according to patent WO 97/12979 can be used as R1or R2according to the present invention. "Variants of IL-3" refers to variants of IL-3 according to patent WO 94/12639 and WO 94/12638. In this text "fused protein" refers to a fused protein according to patent WO 95/21197 and WO 95/21254. In this text, "agonists of the receptor for G-CSF" corresponds to the agonists of the receptor for G-CSF described in the patent WO 97/12978. In this text, "agonists of the receptor C-mpl" meet the agonists described in the patent WO 87/12978. In this text, "agonists of the receptor for IL-3" correspond to the agonists of the receptor, IL-3, described in the patent WO 97/12979. In this text "multifunctional receptor agonists correspond multifunctional receptor agonists, described in the patent WO 97/12985.

Linker segment (L1the principle is polypep the home, comprising from 1 to 500 amino acids. The linkers connecting the two molecules must ensure the following: 1) allow the two molecules to form a spatial structure and to be active independently of each other; 2) do not show the tendency to the formation of spatial structures that could interfere with the functional domains of the two proteins; 3) must have a minimum hydrophobicity due to the interaction of the functional domains of proteins; and 4) to provide spatial separation R1and R2so that R1and R2could simultaneously interact with their corresponding receptors in the same cell. In General, the surface amino acids of mobile proteins are glycine, asparagine, and serine. Virtual any permutation of amino acid sequences containing these three amino acids, is expected to meet the above criteria linker sequences. Other neutral amino acids such as threonine and alanine, can also be used in the composition of the linker sequence. Additional amino acids may also be included in the composition of the linkers that will allow you to add unique restriction sites in the linker sequence to facilitate the design of multi-chem is situations agonists hematopoietic receptors.

Preferred linkers L1according to the present invention include sequences selected from the group of the formula: (Gly3Ser)n(SEQ ID NO 861), (Gly3Ser)n(SEQ ID NO 862), (Gly5Ser)n(SEQ ID NO 863), (GlynSer)n(SEQ ID NO 864) or (AlaGlySer)n(SEQ ID NO 865).

One example of a mobile linker is rich residues glycine and serine spacer elements of the plot that is present in the protein pIII filament bacteriophages, for example, bacteriophage M13 or fd (Schaller et al., 1975, Proc. Natl. Acad. Sci. USA, 72, 737-741). This segment represents a long movable spacer separating two domains of surface protein pIII. This spacer elements section includes an amino acid sequence:

GlyGlyGlySerGlyGlyGlySerGlyGlyGlysergluglyglyglyserglu

GlyGlyGlySerGluGlyGlyGlySerGluGlyglyglyserglyglyglyser

(SEQ ID NO 800).

The present invention is also linkers that include a sequence recognized by the endopeptidase. Such a cleavage site may be suitable for the separation of individual components multifunctional chimeric agonist hematopoietic receptors with the aim of determining formed if they are normal spatial structure and active in vitro. Examples of different endopeptidase include (but are not limited to) plasmin, enterokinase, kallickrein, urokinase, tissue plasminogen activator, clostridia, Himos is h, collagenase, protease venom Viper Russell, enzyme postponing splitting, V8 protease, thrombin and factor XA.

Peptide linker segments of the plot, called the "hinge"part of the heavy chains of immunoglobulins IgG, IgA, IgM, IgD or IgE, provide the angular relationship between the United polypeptides. The most applicable are those articulated segments, in which residues of cysteine replaced by serine residues. Preferred linkers of the present invention include sequences derived from the "hinge"-2b γ-subunit of mouse IgG, in which residues of cysteine replaced by serine residues.

These linkers may also include sites of cleavage by endopeptidases. Examples of such linkers include the following sequence:

IleSerGluProSerGlyProIleSerThrlleasnproserproproserlys

GluSerHisLysSerPro (SEQ ID NO 801)

IleGluGlyArglleSerGluProSerGlyProileserthrlleasnproser

ProProSerLysGluSerHisLysSerPro (SEQ ID NO 802).

The present invention, however, is not ogranichetsya in shape, number and size of the linker sequences and only by the requirement that its functionality was associated with the absence of interference with the formation of the spatial structure and activity of individual molecules, forming part of a multifunctional chimeric agonist hematopoietic receptors.

The definition of the linker L2

The length of the last amino acid is the sequences of the linker L 2intended for use in R1and (or) R2can be selected empirically or according to the patterns of spatial information, or using combinations of these two approaches.

In the absence of any information about the structure of a small group of linkers can be generated for testing using the scheme in which the length varies so as to provide an interval 0-50and the sequence is chosen in such a way as to conform to the surface activity (hydrophilicity; Norr & Woods, 1983, Mol. Immunol., 20, 483-489; Kyte &Doolittle, J. Mol. Biol., 157, 105-132; processed solvents surface area; Lee &Richards, 1971, J. Mol. Biol., 55, 379-400) and the ability to adapt the necessary conformation without disrupting the conformation of R1or R2(conformationally mobile; Karplus &Schulz, 1985, Sciences), 72, 212-213). Taking the range of 2.0-3.8for the average broadcast, this may mean that the length of the test is from 0 to 30 amino acid residues (with a preferred range 0-15 amino acids). Such empirical groups linkers can be constructed using cassette sequence, such as glycine-glycine-glycine-serine", repeated n times, n is 1, 2, 3 or 4. Analysis of the known Dan who's allows you to note the existence of a large number of such sequences, which vary in length or structure and can serve as linkers, initially considering the fact that they are neither too long nor too short (Sandhu, 1992, Critical Rev. Biotech., 12, 437-462); if they are too long, then the entropy factor can destabilize the three-dimensional organization, in particular making spatial laying kinetically inefficient; if they are too short, they can destabilize the molecule due to the torsion elastic or steric effects.

Studies of protein structure allow to establish that the distance between the ends of polypeptide chains, defined as the distance between Sα-carbons, can be used to determine the length of the sequence, intended for use, or at least to limit the number of possible options that should be tested in the empirical selection of linkers. The available data also allow us to determine that in some cases the position of the ends of the polypeptide chain mistakenly marked in the structural models generated by analyzing x-ray diffraction or nuclear magnetic resonance spectroscopy; in the case of accurate estimates this situation should be considered in the future in order to accurately assess the length of required linker. Of those amino acids OS is Atkov, the position of which is precisely defined, choose two of the remnant that are adjacent to the ends of the sequence, the distance between the CA atoms are used to calculate the approximate length of the linker between them. Using the calculated length as the template selected linkers with a certain range of the number of residues (calculated on the assumption that one residue has 2-3,8). Such linkers may be composed of the original sequences, if necessary shortened or lengthened - lengthening additional residues may be selected so as to provide mobility and hydrophilicity as described above; or random source sequence may be substituted for the use of the group of linkers, such as those having repeat glycine-glycine-glycine-serine" according to the approach outlined above; or a combination of the original sequence and the new sequence, having a suitable overall length, can be arbitrarily used.

Determination of the amino - and carboxyl ends in R1and R2

Sequence R1and R2to be able to form a spatial structure with biologically active status can be sformirovany by selecting the initial (N-terminal) and end (C-terminal) from the composition of the original polypeptide and the use of the linker sequence L 2according to the above. N - and C-ends of opting out of the typical sequence associated with the break point, using the receipt templates as described above. Thus, the new amino acid sequence is generated by selecting N - and C-ends of the same section of the gap. In many cases, the selection of new ends should be such that the initial position From the end of the immediately preceded the N-end. However, the information known to experts in the art, indicate that the selection ends in any area of the segment can effectively lead to either deletions or additions residues at the N - or C-terminal positions of the new sequence.

A Central tenet of molecular biology is that the primary amino acid sequence of a protein determines the formation of spatial three-dimensional structure necessary for the manifestation of its biological functions. Methods known to experts in this field techniques used for analysis and interpretation of three-dimensional organization is testing x-ray diffraction on single protein crystals or nuclear magnetic resonance spectroscopy of protein solutions. Examples of structural information, which is enough to determine the points of discontinuities include position and x is the predominant secondary structure of the protein (helix α and 3-10, parallel and antiparallel β-plane, turns and speed chains and loops; Kabsch &Sander, 1983, Biopolymers, 22, 2577-2637), the degree of solvent effects on amino acid residues, the degree and type of interactions of amino acids with each other (Chothia, 1984, Ann. Rev Biochem., 53, 537-572) and static and dynamic conformational distribution of elements along the polypeptide chain (Alber & Mathews, 1987, Methods Enzymol., 154, 511-533). In some cases, well-known for more information about solvent effects on amino acid residues: one example is the site of posttranslational attachment of the hydrocarbon, which is required on the surface of the protein. When the information structure is not available or difficult to analyze, can be also used methods of analysis of the primary amino acid sequence to predict the secondary and Quaternary structure of the protein, solvent accessibility and the frequency of u-turns and loops. Biochemical methods may also be effective for the empirical determination of surface effects in cases when direct methods of structural analysis is not applicable; for example, the use of identifying sites of the cutting chain due to the limited proteolysis to determine surface effects (Gentile & Salvatore, 1993, Eur. J. Biochem., 218, 603-621).

Thus, when ispolzovaniem or experimentally obtained information about the structure, or with the use of predictive methods (e.g., Srinivisan & Rose, 1995, Proteins: Struct., Function & Genet., 22, 81-99) of the original amino acid sequence test to classify sites according to their inclusion or not involving in maintenance of the secondary and Quaternary structure. Known occurrence sequences within parcels that confirmed participation in periodic secondary structure (helix α and 3-10, parallel and antiparallel β-plane): these sites it is advisable to avoid. Similarly, the sites of amino acid sequences that have or are predicted low level of solvent sensitivity, with high probability are part of the so-called "hydrophobic axis" of a protein, they also should be avoided during the selection of the N - and C-ends. In contrast, those areas for which it is known or predicted location on the surface of twists and loops, and especially in those segments for which we know no need to provide biological activity, are the preferred sites for the localization of the end segments of the polypeptide chain. Long segments of amino acid sequence is considered to be preferred on the basis of the above criteria, defined as "a segment break point".

Additional p is Ptichye sequence can also be added to facilitate purification or identification of a multifunctional chimeric agonists hematopoietic receptors (for example, polyhistidine motive). Vysokopatogennyj peptide may also be added that can provide rapid testing and simplified purification of multifunctional chimeric agonists hematopoietic receptors using specific monoclonal antibodies.

The terms "mutant amino acid sequence", "mutant protein", "variant protein", "mutein" or "mutant polypeptide" refers to a polypeptide having the amino acid sequence that differs from the native sequence from amino acid deletions, substitutions, or both, or is encoded by a nucleotide sequence that is deliberately changed compared with the native sequence. The term "native sequence" means an amino acid or nucleotide sequence that is identical to that of the native form (form wild-type) gene or protein.

Hematopoietic growth factors can be characterized by their ability to stimulate the formation of colonies of cells-the precursors of blood in humans. Formed colonies include erythroid cells, granulocytes, megakaryocytes, macrophages-granulocytes and their combinations. Many hematopoietic growth factors have the ability to restore the function of bone marrow and peripheral populations of cells to the Ovi to therapeutically satisfactory level in research, initially conducted on monkeys and then humans. Many or even all of these biological activity of hematopoietic growth factors involved in the transmission of signals and high-affinity binding to the receptor. Multifunctional chimeric agonists hematopoietic receptor of the present invention can be a valuable qualities, such as the manifestation of the same or even greater biological activity in comparison with the signal factor or such as increased half-life, or such as reducing the number of negative side effects, or a combination of such properties.

Multifunctional chimeric agonists hematopoietic receptors, which have weak or no agonistic activity, can be used as antagonists, as antigens with the aim of obtaining antibodies for use in immunology or immunotherapy, as genetic probes or as intermediate products when designing other applicable Malinov hIL-3.

The biological activity of multifunctional chimeric agonists hematopoietic receptor of the present invention can be determined by DNA synthesis in the factor-dependent cell lines or by counting the resulting colonies in the test with bone marrow in vitro.

Multifunctional chimeric AGON the texts of hematopoietic receptors of the present invention can improve therapeutic performance in comparison with monoactive hematopoietic agonists. For example, some multifunctional chimeric agonists hematopoietic receptor of the present invention can have similar or even greater activity as a growth factor in comparison with other hematopoietic agonists in the absence of similar or increasing level of side effects.

The present invention also provides DNA sequences that encode proteins multifunctional chimeric agonists hematopoietic receptors, DNA sequences which are substantially similar and are essentially similar functions, and DNA sequences which differ from the DNA encoding the multifunctional chimeric agonists hematopoietic receptors according to the present invention due to the degeneracy of the genetic code. Also the present invention is oligonucleotide intermediates used in the creation of mutant DNA and polypeptides encoded by these oligonucleotides.

Methods of genetic engineering currently in science standardized (U.S. patent 4935233 and Sambrook et al., 1989, "Molecular cloning: A Laboratory Manual", Cold Spring Harbor Lab.) and can be used to create DNA sequences of the present invention. One such method is cassette mutagenesis (Wells et al., 1985, Gene, 34, 315-323), in which part of oderwise sequence in the plasmid is replaced with synthetic oligonucleotides, which encode the desired amino acid substitutions in the portion of the gene between the two marker restriction enzymes cut sites. A pair of complementary synthetic oligonucleotides encoding the desired gene can be formed by annealing to each other. The DNA sequence in the oligonucleotide must encode the amino acid sequence of the desired gene with the exception of those which are substituted and (or) deleterow from the sequence.

Plasmid DNA can be processed selected restrictase and then Legerova the past annealing oligonucleotides. Legirovannye the mixture can be used for transformation of competent JM101 cells while marking resistance to a suitable antibiotic. Individual colonies can be sorted, and plasmid DNA can be tested by restrictase or by using DNA sequencing to identify plasmids containing the desired gene.

Cloning of DNA sequences of new multifunctional hematopoietic agonists in that at least one of them is similar to the DNA sequence of the gene of another colony-stimulating factor, can be accompanied by the use of intermediate vectors. As opposed approach, one of the genes can be cloned directly into a vector containing a different gene. Linkers and ADAP is a career can be used to join DNA sequences as well as for replacement of lost sequences, where the restriction site is located within the area of interest. Thus, genetic material (DNA)that encodes one polypeptide, a peptide linker and the other polypeptide is included in the composition is suitable expressing vector, which is used for transformation of bacteria, yeast, insect cells and mammalian cells. The transformed organism is grown, and secrete protein using standard methods. The resulting product is, thus, a new protein that includes colony-stimulating factor, coupled through the linker segment with a second colony stimulating factor.

On the other hand, the present invention is a plasmid DNA vector designed for use in securing expression of these new multifunctional chimeric agonists hematopoietic receptors. These vectors include new DNA sequences described above which encode new polypeptides according to the present invention. Suitable vectors through which transform microorganisms, able to Express the multifunctional chimeric agonists hematopoietic receptors, presents expressing vectors comprising nucleotide sequence, to yousie multifunctional chimeric agonists hematopoietic receptors, United with sequences regulating transcription and translation, which can be chosen according to the type of host cells.

Vectors, incorporarse modified sequences as described above are included in the present invention and used to obtain multifunctional chimeric agonists hematopoietic receptors. Used vector also includes selected regulatory sequences in operative communication with the coding DNA sequences of the present invention, which is capable of directing the replication and expression in selected cells of the host.

As another part of the present invention, a method of obtaining new multifunctional chimeric agonists hematopoietic receptors. The method according to the present invention includes culturing suitable cells or cell lines that have been transformed using a vector comprising the coding DNA sequence, with the purpose of expression of the new multifunctional chimeric agonist hematopoietic receptors. Suitable cells or cell lines may be bacterial cells. For example, various strains of E. coli are well known as cell hosts from the point of view of biotechnology. Examples of such strains vklyuchayushchem E. coli JM101 (Yanish-Perron et al., 1985, Gene, 33, 103-119) and MON105 (Obukowicz et al., 1992, Appl. Environ. Environ., 58, 1511-1523). Also in the present invention included a way of expression of the protein multifunctional chimeric agonist hematopoietic receptors using chromosomal expressing vector for E. coli, formed on the basis of the bacteriophage Mu (Weinberg et al., 1993, Gene, 126, 25-33). Different strains of the hay Bacillus B.subtilis can also be used in this way. Many strains of yeast cells known to experts in the art, are also a convenient cell-hosts for expression of the polypeptides according to the present invention. When the expression in the cytoplasm of E. coli cells the gene encoding the multifunctional chimeric agonists hematopoietic receptor of the present invention can also be designed in such a way that from the 5’end of the gene has been extended due to the codons encoding the Met-2Ala-1or Met-1from N-Terminus of the encoded polypeptide. Formed in the cytoplasm of Escherichia coli N~-ends proteins undergo post-translational processing involving methioninamide (Ben Bassat et al., 1987, J. Bacteriol., 169, 751-757) and probably other peptidases, respectively, even if the expression of the methionine from the N-terminal split-off. Multifunctional chimeric agonists hematopoietic receptor of the present invention can include peptide multifunctional chimeric agonists hematopoietic receptors, with the N-terminal additional amino acids Met-1Ala-1or Met-2Ala-1. Such multi-function mutant chimeric agonists hematopoietic receptors may also be expressed in E. coli by fusion with the signal fragment secreted protein N-Terminus. This signal segment is cleaved from the polypeptide at one of the stages of the process of secretion. Additional methods of achieving high-level expression of genes in E. coli cells can be taken from C.M.Savvas (1996, Environ. Rev., 60, 512-538).

Also according to the present invention are suitable mammalian cells, such as cells of the Chinese hamster ovary (Cho). The basic methods of expression of foreign genes in mammalian cells are summarized in the overview Kaufman (R.J.Kaufman, 1987, "Genet. Engineering, Principles &Methods", Vol.9, ed. K.Setlow, Plenum Press, New York). Expressing the vector construct in such a way that its composition was present powerful promoter capable to demonstrate functional activity in mammalian cells and to provide transciption segment encoding the eukaryotic secretory signal segment, which at the translational level attached to the segment, codereuse multifunctional chimeric agonists hematopoietic receptors. For example, can be used such plasmids pcDNA I/Neo, pRc/RSV, and pRc/CMV (manufactured by nvitrogen Corp., San Diego, CA). The segment encoding the eukaryotic secretory signal segment may be separated from the gene itself or from another secreted protein of a mammal (Bayne et al., 1987, Proc. Natl. Acad. Sci. USA, 84, 2638-2642). Upon completion of the formation of the vector containing the gene, the vector DNA transferout mammalian cells. Such cells can be, for example, cell lines COS-7, HeLa, KSS, SNO or line L of the mouse. Cells can be grown, for example, in DMEM (JRH Scientific). Secreted into the culture medium, the polypeptide can be isolated using standard biochemical techniques after intermittent expression for 24-72 hours after transfection cells or after the formation of a stable cell line followed by selection for antibiotic resistance. Selection of suitable host cells mammals and methods for transformation, culture, amplification, screening, preparation of recombinant product and its purification are well known: see, for example, (Gething &Sambrook, 1981, Nature, 293, 620-625) or (Kaufman et al., 1985, Mol. Cell. Biol., 5, 1750-1759) or (Howley et al., U.S. patent 4419446).

Other suitable line of mammalian cells is a cell line COS-1 green monkeys. Used with similar frequency line of mammalian cells is a cell line CV-1.

If desired, the cells of insects can be used in quality the ve host cells of the present invention. For example, you can refer to (Miller et al., 1986, Genet. Eng., 8, 277-298) and the references given here. In addition, the main methods of expression of foreign genes in insect cells using vectors based on baculoviruses described by Summers & Smith (1987, "A manual of methods for Baculovirus vectors and insect cell culture procedures, Texas Agricult. .. Stat. Bull No.1555). Expressing the vector form based on baculovirus transformation vector, in which powerful baculovirus promoter (such as the polyhedrin promoter) provides a transcription of the segment encoding the eukaryotic secretory signal segment, which at the translational level is attached to the site, codereuse polypeptide multifunctional chimeric agonist hematopoietic receptors. For example, can be used plasmid pVL1392 (produced by Invitrogen Corp., San Diego, CA). After construction of a vector carrying the gene encoding the polypeptide multifunctional chimeric agonist hematopoietic receptors, two micrograms of this DNA co-transferout with 1 micrograms baculo viral DNA (see Summers & Smith, 1987) in the cells of the insect line SF9. Pure recombinant baculovirus carrying the gene multifunctional chimeric agonist hematopoietic receptors, are used to infect cells, cultured, for example, does not contain serum environment Ecell-401 (JRH Bioscience, Lenexa KS). Secreted into the culture medium multifunctional chimeric agonist hematopoietic receptors can be isolated using standard biochemical methods. The supernatant fraction of mammalian cells or insect expressing the polypeptide multifunctional chimeric agonist hematopoietic receptors, can be increased in concentration with the use of a number of standard concentration of the reactants.

Multifunctional chimeric agonists hematopoietic receptor of the present invention can be used in the treatment of diseases characterized by reduced levels of the myeloid, erythroid, lymphoid, or megakaryocytic cells in the blood system or combinations thereof. In addition, they can be used for the activation of Mature myeloid and (or) lymphoid cells. Among States, are susceptible to this effect of the polypeptides of the present invention, the radiation, i.e. the reduction in the number of leukocytes (white blood cells) circulating in the blood. Leukopenia can coil irradiation also be caused by some viruses. It often proves to be a side manifestation of various forms of anticancer therapy (chemotherapy treatment or irradiation), infections or hemorrhages. The radiation therapy using multi-functional chimeras what's agonists hematopoietic receptor of the present invention may provide for the exclusion of undesirable side effects, resulting from the use of the above drugs.

Multifunctional chimeric agonists hematopoietic receptor of the present invention can be used in the treatment of neutropenia and, for example, in the treatment of many pathologies such as aplastic anemia, cyclic neutropenia, idiopathic neutropenia, syndrome Chediak-Higashi, systemic lupus erythematosus (SLE), leukemia, myelodysplastic syndrome and myelofibrosis.

Multifunctional chimeric agonists hematopoietic receptor of the present invention can be used in the treatment or prevention of thrombocytopenia. Currently, the only treatment for thrombocytopenia is the transfusion of platelets, which are very expensive and associated with a high risk of infections (HIV, HBV) and alloimmunization. Multifunctional chimeric agonist hematopoietic receptors can completely replace or significantly reduce the need for transfusion of platelets. Severe thrombocytopenia may be due to some genetic defects such as anemia, Fanconi syndrome Wiskott-Aldrich or syndrome Mae Hegglin. Acquired thrombocytopenia may be the result of the formation of auto - or alloantigen, for example, when the Magenta immunochemotherapy, systemic lupus erythematosus, hemolytic anemia Il the incompatibility of mother and fetus. Moreover, splenomegaly, diffuse intravascular coagulation of blood, Magenta, thrombotic thrombocytopenia, infection or the presence of prosthetic heart valve can cause thrombocytopenia. Severe thrombocytopenia may also be a consequence of hemoterapia and / or radiotherapy of tumors. Thrombocytopenia may also be the result of invasion of the bone marrow in carcinomas, lymphoma, leukemia, or fibrosis.

Multifunctional chimeric agonists hematopoietic receptor of the present invention can be used to mobilize hematopoietic precursors and stem cells in the peripheral blood. For derived from peripheral blood precursors proved effective in the treatment of patients with autologous bone marrow transplantation. For hematopoietic growth factors, including G-CSF and GM-CSF was confirmed participation in the increase in the number of circulating precursors and stem cells in the peripheral blood. This greatly simplifies the process of collecting peripheral blood stem cells and dramatically reduces the cost of the procedure by reducing the required number of takes samples. Multi-functional chimeric agonist hematopoietic receptors can be used to mobilize stem cells and further enhance the efficiency of transplantati the peripheral stem cells.

Multifunctional chimeric agonists hematopoietic receptor of the present invention can also be used for expansion ex vivo precursors of blood cells and stem cells. Colony-stimulating factors (CSFs), such as hIL-3, administered separately, together with other CSFs or in combination with bone marrow after high chemotherapy doses in the treatment of neutropenia and thrombocytopenia, which are often the consequence of such therapy. However, the period of severe neutropenia and thrombocytopenia can be fully overcome. Myeloid cell line, consisting of monocytes (macrophages), granulocytes (including neutrophils and megakaryocytes, is critical for the prevention of infections and bleeding, which can pose a threat to life. Neutropenia and thrombocytopenia may also be a consequence of the disease, genetic abnormalities, effects of drugs, poisons, radiation and many types of therapeutic effects, such as traditional anticancer therapy.

For the treatment of defined groups of patients used bone marrow transplantation. However, the use of bone marrow tissue for regeneration of the blood is associated with a number of problems: 1) the number of stem cells in the bone marrow, spleen or peripheral blood is limited; 2) the effect of the counter is Orsta" donor tissue and recipient organism, graft-versus-host (Graft vs. Host Disease); 3) graft rejection, and 4) possible contamination of tumor cells. Stem cells constitute only a small part among nuclear cells in the bone marrow, spleen and peripheral blood. It seems clear dependency on the dose so that a greater number of stem cells provides increased recovery of hematopoietic function. In addition, the expansion of stem cells in vitro should enhance the recovery of hematopoiesis. For preparation of bone marrow transplant using bone marrow derived from an allogeneic donor. However, the factors mismatch of donor and recipient (Graft vs. Host Disease and rejection tissues limit the possibility of bone marrow transplantation, even in cases where donors are HLA matching patients. Alternative allogeneic bone marrow transplant is autologous transplantation. When autologous transplantation of bone-marrow transplants, the patient selects a portion of their own bone marrow before carrying out any treatment (for example, when hemoterapia myeloid diseases using high doses), and then return it back at the end of treatment. Autologous transplantation eliminates the risk of Graft vs. Host Disease and rejection of the tissue. However, autological the th bone marrow transplantation has its own problems, due to the limited number of stem cells in the bone marrow and with the possibility of contamination by tumor cells. Factor in the limited number of stem cells can be overcome by the expansion of stem cells ex vivo. Moreover, stem cells can be isolated in a specific way (based on the presence of specific surface antigens, such as CD34+), which allows to reduce the possible risk of contamination of bone marrow transplant tumor cells.

The following patents include detailed information on the division of stem cells, CD34+cell, culturing cells with hematopoietic factors, the use of cells in the treatment of patients with diseases of the blood and the use of hematopoietic factors for the expansion of cells and gene therapy.

U.S. patent 5061620 represents the composition geopoetika of human stem cells obtained by separation of stem cells from labeled cells.

U.S. patent 5199942 describes how autologous transplantation of hematopoietic cells, including: (1) isolation of precursor cells in the blood of the patient; (2) expansion ex vivo in cell growth factor selected from the group consisting of IL-3, flt3 ligand, ligand, c-kit, GM-CSF, IL-1, a chimeric protein of GM-CSF/IL3 or combinations thereof; (3) introduction to patient cell patients is A.

U.S. patent 5240856 is cell separator, which is a device for automatic control of the process of cell division.

Patent WO 91/16116 describes devices and methods for selective extraction and separation of target cells from a cell mixture.

Patent WO 91/18972 describes how in vitro culturing of bone marrow by incubating suspensions of bone marrow cells in bioreactive hollow tubes.

Patent WO 92/18615 is the process of maintaining and increasing the number of bone marrow cells using a culture medium containing a specific mixture of cytokines, with subsequent use in transplants.

Patent WO 93/08268 describes a method of selective growth of stem cells, comprising the steps of (a) separation of stem cells bearing the CD34 antigen+, from other cells and (or) incubation separated cells in a selective medium that allows you to selectively increase the number of selected stem cells.

Patent WO 93/18136 describes the process of maintaining in vitro mammalian cell derived from peripheral blood.

Patent WO 93/18648 is a composition consisting of precursor cells of human neutrophils with a high content of myeloblasts and promyelocytes used for the treatment of congenital and acquired neutropenia.

Patent WO 94/08039 describes the manual enrichment of hematopoietic stem cells using a selection of cells, expresarse protein c-kit.

Patent WO 94/11493 describes the population of stem cells bearing the CD34 antigen+ and has a small size, which emit using the method of countercurrent of otseivaniya.

Patent WO 94/27698 is a way of combining immunoaffinity separation and separation by centrifugation in a continuous flow, designed for selective screening of the nuclear population of hematopoietic cells from a heterogeneous cell mixture.

Patent WO 94/25848 describes an apparatus for the separation of cells used for collecting the set of cells with the subsequent manipulation of them.

Long-term cultivation of highly enriched bearing antigen CD34+ precursors of hematopoietic progenitor cells isolated from human bone marrow, in cultures containing IL-1a, IL-3, IL-6 or GM-CSF, as described by Brandt et al. (Brandt et al., 1990, U. Clin. Invest., 86, 932-941).

One aspect of the present invention is associated with a description of the method of selective expansion of stem cells ex vivo. The term "stem cell" refers to a totipotent hematopoietic cells, as well as an early precursor cells (undifferentiated cells), which can be isolated from bone marrow, spleen or peripheral blood. The term "expansion" refers to the whole complex of processes of differentiation and proliferation of cells. The present image is the buy is way selective expansion ex vivo, which includes the following steps: (a) separation of stem cells from other cells; (b) culturing the aforementioned separated stem cells in selective medium containing protein (protein) multifunctional chimeric agonist hematopoietic receptors, and (C) the fee referred stem cells. Stem cells and precursor cells, which is intended to be neutrophils, erythrocytes, platelets and the like, can be separated from most other cell types by the presence-absence of private antigenic markers, such as CD34, which are on the surface of these cells, and morphological characters. Phenotype vysokoobogashchennogo fraction of human stem cells is described as CD34+, Thy-l+, lin; however, it should be clear that the present invention is not limited to such expansion of stem cell populations. Highly enriched fraction of human stem cells, labelled CD34+, can be separated using a number of previously described methods, including affinity column, magnetic beads or flow cytometry using antibodies to surface antigens, such as CD34+. In addition, methods of physical separation, such as straining in the opposite flows, can be used to enrich the fraction of hematopoietic precursors. Predecessor is with CD34+ heterogeneous and can be divided into several subpopulations, characterized by the presence or absence of co-expression of different types of molecules associated with cell surfaces. The most immature (undifferentiated) precursor cells do not Express any of the known markers associated with cell types, such as HLA-DR or CD38, but they can Express CD90 (thy-1). Other surface antigens such as CD33, CD38, CD41, CD71, HLA-DR or c-kit, can also be used for the selective extraction of hematopoietic precursors. The separated cells can be incubated in selective medium in culture flasks, sterile packages or hollow tubes. Various colony-stimulating factors can be used to control the selective expansion of cells. Suitable to control the expansion of bone marrow ex vivo factors include the ligand, c-kit, IL-3, G-CSF, GM-CSF, IL-1, IL-6, IL-11 ligand, flt-3, or a combination thereof. The proliferation of stem cells can be monitored by counting the number of stem cells and other cells using standard techniques (for example, using hemocytometer, CFU, LTCIC) or flow cytometry before and after incubation.

A number of methods expansion of stem cells ex vivo have been described and are based on the methods of selection and expansion, using various colony-stimulating factors, including the ligand of c-kit (Brandt et al., 1994, Blood, 83, 1507-1514; McKenna e al., 1995, Blood, 86, 3413-3420), IL-3 (Brandt et al., 1994, Blood, 83, 1507-1514; Sato et al., 1993, Blood, 82, 3600-3609), G-CSF (Sato et al., 1993, Blood, 82, 3600-3609), GM-CSF (Sato et al., 1993, Blood, 82, 3600-3609), IL-1 (Muench et al., 1993, Blood, 81, 3463-3473), IL-6 (Sato et al., 1993, Blood, 82, 3600-3609), IL-11 (Lemoli et al., 1993, .. Hematol., 21, 1668-1672; Sato et al., 1993, Blood, 82, 3600-3609), flt3 ligand (McKenna et al., 1995, Blood, 86, 3413-3420) and (or) a combination of (Brandt et al., 1994, Blood, 83, 1507-1514; Haylock et al., 1992, Blood, 80, 1405-1412; Koller et al., 1993, Biotechnology, 11, 358-363; Lemoli et al., 1993, .. Heamtol., 21, 1668-1672; McKenna et al., 1995, Blood, 86, 3413-3420; Muench et al., 1993, Blood, 81, 3463-3473; Patchen et al., 1994, Biotherapy, 7, 13-26; Sato et al., 1993, Blood, 82, 3600-3609; Smith et al., 1993, .. Hematol., 21, 870-877; Steen et al. Stem Cells 12: 214 [1994], Tsujino et al., 1993, .. Hematol., 21, 1379-1386). Among individual colony stimulating factors the patent from the point of view of the expansion of peripheral blood cells with antigen CD34+ is hIL-3 (Sato et al., 1993, Blood, 82, 3600-3609; Kobayashi et al., 1989, Blood, 73, 1836-1841). However, no single factor may not be as effective as the combination of several factors. The present invention represents a means of monitoring the expansion ex vivo, using multifunctional chimeric agonists hematopoietic receptors, which are much more effective in comparison with several other factors.

Also the present invention is a means of monitoring the resistance (continuity) and (or) expansion of hematopoietic precursor cells, which are based on the inoculation of the cells in multiwire the range of the vessel in the culture medium, the state which is established by working with the culture of the stroma cell line, such as HS-5 (patent WO 96/02662; Roecklein & Torok-Strob, 1995, Blood, 85, 997-1105), and in which add a multifunctional chimeric agonist hematopoietic receptor of the present invention.

It is also important to note that the multifunctional chimeric agonists hematopoietic receptor of the present invention can be used in peredergivany (storage) blood, when agonists eritropoetinov receptor is administered to the patient to increase the number of blood cells and blood products should be withdrawn from the patient before any medical procedures. Blood keep and injected back into the patient at the end of these procedures. In addition, you can highlight the possibility of using multifunctional chimeric agonists hematopoietic receptors for introducing them to donors prior to blood collection to increase the number of blood cells, thus giving an opportunity to the donor is safe to take more blood.

Another prospective clinical application of growth factors is the activation of in vitro hematopoietic progenitor cells and stem cells in gene therapy. Considering the fact that precursor cells of the blood are characterized by significant life expectancy and their daughter cells are distributed practical and throughout the body, hematopoietic cell precursors are promising objects for ex vivo transgenesis. In order to provide the necessary gene, integrated into the genome of a stem cell or cells predecessor, it is necessary to stimulate cell division and DNA replication. Cyclicity of hematopoietic stem cells characterized by low frequency: hence, the growth factors can be effective from the point of view of control transduction gene and a corresponding increase clinical prospects of gene therapy. Potential aspects of gene therapy (see review Crystal, 1995, Science, 270, 404-410) include: 1) the treatment of many congenital metabolic disorders, and immunodeficiency (KAU & Woo, 1994, Trends Genet., 10, 253-257), 2) treatment of neuropathology (Friedmann, 1994, Trends Genet., 10, 210-214), 3) cancer treatment (Culver & Blaese, 1994, Trends Genet., 10, 174-178) and 4) the treatment of infectious diseases (Gilboa 8& Smith, 1994, Trends Genet., 10, 139-144).

There is a wide range of well-known experts in the art methods for depositing genetic material in the cell of the host (recipient cell). For this purpose there are various viral vectors and non-viral nature, allowing to bring in primary cells of genes that have medical value. The viral vectors of nature: 1) recombinant, scarce replication retrovirus (Boris-Lawrie & Temin, 1993, Curr. Opinion Genet. Develop., 3, 102-109; Boris-Lawrie &Temin, 1994, Ann. New York Acad. Sci., 716, 59-71; Miller, 1992, Current Topics Environ. Immunol., 1992, 158, 1-24) and (2) recombinant, deficient in replication, adenovirus (Berkner, 1988, Bio-Techn., 6, 616-629; Berkner, 1992, Current Topics Environ. Immunol., 158, 39-66; Brody & Crystal, 1994, Ann. New York Acad. Sci., 716, 90-103). Vectors non-viral nature include DNA-protein complexes (Cristiano et al., 1993, Proc. Natl. Acad. Sci. USA, 90, 2122-2126; Curiel et al., 1991, Proc. Natl. Acad. Sci. USA, 88, 8850-8854; Curiel, 1994, Ann. New York Acad. Sci., 716, 36-58), electroporation and migration mediated by liposomes, for example, cationic liposomes (Farhood et al., 1994, Ann. New York Acad. Sci., 716, 23-35).

The present invention offers an improvement of existing methods expansion of hematopoietic cells, which may be introduced new genetic material, in particular by offering the use of multifunctional chimeric agonists hematopoietic receptors possessing high biological activity, including activity that may not be a separate colony-stimulating factors.

Many drugs can cause suppression of the work of the bone marrow or deficit disorders. Examples of such drugs are azacitidine, DDI, alkylating agents and antimetabolites used in chemotherapy, antibiotics (such as chloramphenicol, penicillin, ganciclovir, daunomycin), sulfopropyl, phenothiazine, tranquilizers such as meprobamate), analgesics (such as am, is noirin and dipyrone), anticonvulsive drugs (such as phenytoin or carbamazepine, medicines thyroid gland (such as propylthiouracil and methimazole) and diuretics. Multifunctional chimeric agonists hematopoietic receptor of the present invention can be used for prevention or treatment suppressed bone marrow function or deficit disorders, which are often observed in patients when the use of the above drugs.

Deficit disorders are often due to viral, bacterial and parasitic infections, burns and as a result of dialysis used in the treatment of renal diseases or dysfunction of the kidneys. Multifunctional chimeric agonists hematopoietic receptor of the present invention can be used to treat such cases of deficiency disorders.

Treatment of deficit disorders may include introduction to the patient a pharmaceutical preparation comprising a multifunctional chimeric agonists hematopoietic receptors. Multifunctional chimeric agonists hematopoietic receptor of the present invention can also be used for activation and amplification of progenitor cells of the blood by treatment of these cells in vitro protein multifunctional chimeric agonists, hemopet the ical receptor of the present invention before injecting these cells into the patient.

In the treatment of various forms of immunodeficiency, for example, T - and / or lymphocytes, or forms of immune diseases (e.g. rheumatoid arthritis) can also be achieved substantial progress in the application of multifunctional chimeric agonists hematopoietic receptor of the present invention. Forms of immunodeficiency can be caused by viral infections (such viruses as HTLVI, HTLVII, HTLVIII), strong radiation, anticancer therapy, or other clinical effects. Multifunctional chimeric agonists hematopoietic receptor of the present invention can also be used (alone or in combination with other colony stimulating factors) for the treatment of other types of deficiency of blood cells, including thrombocytopenia (lack of platelets), or anemia. Other possible applications of new polypeptides therapy patients In vivo and ex vivo for recovery of bone marrow and the production of mono - and polyclonal antibodies carried out by standard methods for diagnostic or therapeutic purposes.

Also the present invention is of methods and therapeutic formulations for the treatment of the above diseases and conditions. Such formulations comprise a therapeutically effective amount of one or more multiple the national chimeric agonists hematopoietic receptor of the present invention when mixed with pharmaceutically suitable carrier. This list may be entered in any of these ways, parenterally, intravenously or subcutaneously. With the introduction of a therapeutic composition of the present invention preferably its preparation in the form deprived of pyrogens (components capable of increasing the temperature of the aqueous solutions suitable for parenteral introduction. Preparation suitable for parenteral protein solutions taking into account the required parameters pH, isotonicity, stability, and others, well known to specialists in this field of technology.

Another way to use multifunctional chimeric agonists hematopoietic receptor of the present invention is their involvement in the formation of larger numbers of dendritic cells from the appropriate precursors and their subsequent use as an adjuvant during immunization. Dendritic cells play an important role in the immune system. They are a specific antigen-presenting cells and the most effective in the activation of resting T cells, and are also antigen-presenting cells that activate unspecialized T-lymphocytes in vivo, thus initiating a primary immune response.

They effectively internalizing, ProcessInput and are soluble tumor-specific antigens (Ad). Dendritic cell which have the unique ability to cluster non-specialized T-cells and respond to the accumulation of Hell fast positive regulation of expression of MHC (major histocompatibility complex) and co-stimulatory molecules and production of cytokines and migration to the lymph organs. Considering the fact that dendritic cells play a key role in the sensitization of the organism to a new antigen in the formation of CD4-dependent immune response, they can also play a fundamental role in the generation and regulation of tumor immunity.

Dendritic cells originate from bone marrow precursors from CD34+, related to granulocytes and macrophages: in particular, the person confirmed the existence of a separate colonies-forming units dendritic cells (CFU-DC), which provides for the formation of pure colonies of dendritic cells. Besides, the last phase CFU SR+-intermediates are characterized by the potential for differentiation toward dendritic cells or macrophages in the presence of different cytokines. This bipotential precursor is present in the bone marrow, cord blood and peripheral blood. Dendritic cells can be selected during the analysis of the maturation of cultured dendritic cells on the basis of the specificity of the surface-cell markers such as CD1a+, CD3-, CD4-, CD20-, CD40+, CD80+, CD83+.

Based on the use of dendritic cells approaches support a way to strengthen the immune response against tumors and infectious agents. AIDS is a disease, in the treatment to the showing can be used dendritic cells, because dendritic cells may play an important role in maintaining the replication of HIV-1. For immunotherapy is required the generation of dendritic cells from cancer patients, their treatment in vitro with tumor antigens isolated from surgically deleted tumor mass tissue, and reinjected these cells cancer patients. Relatively crude membrane fraction of tumor cells is sufficient for use as a source of tumor antigen, which eliminates the need for molecular identification of tumor antigen. The tumor antigen can also be a synthetic polypeptide, a hydrocarbon or a sequence of nucleic acid. Moreover, consistent introduction of cytokines, such as multifunctional chimeric agonists hematopoietic receptor of the present invention may also provide for the induction of antitumor immunity. It can be foreseen that immunotherapy can be performed in vivo, despite the fact that multifunctional chimeric agonists hematopoietic receptor of the present invention is injected cancer patient separately or together with other hematopoietic growth factors to increase the number of dendritic cells and the content of endogenous tumor antigen, presentiamo dendritic cells. Also ledue is to be noted, that immunotherapy in vivo can be carried out with the use of exogenous antigen. It can also be noted that immunotherapy activities may include the mobilization of precursors of dendritic cells or Mature dendritic cells by introducing the patient multifunctional chimeric agonists hematopoietic receptor of the present invention alone or in combination with other hematopoietic growth factors, the subsequent selection of the precursors of dendritic cells and Mature dendritic cells from the patient, treatment of dendritic cells with antigen and return of dendritic cells into the patient. Further, dendritic cells, which are excreted from the body, are cultured ex vivo in the presence of multifunctional chimeric agonists hematopoietic receptor of the present invention alone or together with other hematopoietic growth factors to increase the number of dendritic cells to antigen exposure. Approaches based on the use of dendritic cells, also can provide a method of reducing an immune response in autoimmune diseases.

Studies of dendritic cells significantly more difficult due to the complexity of the preparation of the cells in sufficient quantity and in a fairly "pure" form. In the method of expansion of cells ex vivo colonies kulinowski factor granulocyte-macrophage (GM-CSF) and factor-α tumor necrosis (TNF-α) cooperate to generate ex vivo dendritic cells from hematopoietic precursors (CD34+cells)in the bone marrow, cord blood or peripheral blood, and the ligand flk-2/flt-3 ligand, c-kit (stem cell factor - SCF) are synergies to strengthen GM-CSF - and TNF-α-induced generation of dendritic cells (Siena et al., 1995, .. Hematol., 23, 1463-1471). It also seems way expansion precursors of dendritic cells or Mature dendritic cells ex vivo using multifunctional chimeric agonists hematopoietic receptor of the present invention for the purpose of accumulating sufficient quantities of dendritic cells for immunotherapy methods.

Dose mode, part of the treatment of the above diseases and conditions should be determined taking into account physical condition, which is determined by various factors, which can modify the activity of drugs such as individual air-condition, body weight, gender, preferred diet, the severity of infection, time of drug administration and other clinical indicators. In General, day mode is recommended in the range of 0.2-150 µg protein multifunctional chimeric agonists hematopoietic receptors per 1 kg of body weight. Doses should be adapted taking into account the activity specifically what about the multifunctional chimeric agonist hematopoietic receptors; thus there is a sense be noted that the dose schedule may include low-dose (less than 0.1 μg)and high dose (1 mg) per 1 kg of body weight per day. Moreover, there may exist specific conditions under which dose multifunctional chimeric agonists hematopoietic receptors can be moved outside the recommended range of 0.2-150 μg per 1 kg of body weight. This may be due to the simultaneous introduction of other colony stimulating factors or variants of interleukin-3, or growth factors, with the simultaneous introduction of chemotherapeutic drugs and irradiation, the use of glycosylated protein multifunctional chimeric agonist hematopoietic receptors and different associated with the individual patient factors noted above. As noted above, therapeutic methods and formulations may include simultaneous introduction and other protein factors. A non-exhaustive list of other suitable colony-stimulating factors (CSFs), cytokines, lymphokines, hematopoietic growth factors and interleukins for simultaneous or sequential (serial) introduction polypeptides of the present invention is as follows: GM-CSF, G-CSF, the ligand of the C-mpl (also known as TRO or MGDF), M-CSF, erythropoietin (EPO), IL-1, IL-4, IL-2, IL-3, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-5, LIF ligand flt3/flt2, human growth hormone, growth factor b-cells, a factor of differentiation In cells, the factor of differentiation of eosinophils and stem cell factor (SCF), also known as "hard" factor or ligand of c-kit or combinations thereof. The above doses should be modified to compensate for the presence of such additional components as part of a therapeutic procedures. The progress of the patients can be monitored by periodic assessment of hematological parameters, for example, differential counting of cells and the like.

Materials and methods

Except as expressly provided herein, all special reagents obtained from Sigma Co. (St.Louis, MO). Restrictase and DNA T4 ligase obtained from New England Biolabs (Beverley, MA) or Boehringer Mannheim (Indianapolis, IN).

Transformation of E. coli strains

Strains of E.coli, such as DH5™ (Life Technologies, Gaithersburg, MD) and TG1 (Amersham Corp., Arlington Heights, IL)was used for transformation of ligation products were used as a source of plasmid DNA for transliterowany of mammalian cells. Strains of E.coli, such as JM101 (Yanish-Perron et al., 1985, Gene, 33, 103-119) and MON105 (Obukowicz et al., 1992, Appl. Environ. Environ., 58, 1511-1523), can be used for the expression of multifunctional chimeric agonist hematopoietic receptor of the present invention in the cytoplasm or periplasmic space.

MN105 ATCC#55204: F-, λ-, IN (rrnD rrE)l, rpoD+, rpoH358

DH5™: F-, φ80dlacZΔM15, Δ(lacZYA-argF) U169, deoR, recAl, endA1, hsdR17 (rk-, mk+), phoA, supE44λ-, thi-1, gyrA96, relA1

TG1: Δ(l-Pro), supE, thi-1, hsd05/F’(traD36, proA+B+, lacIq, lacZΔM15)

JM101 ATCC#33876; Δ(lac-pro), supE, thi, F’(traD36, proA+B+, lacIq, lacZΔM15)

Effective subclones RNA™ select competent cells, ready for transformation using manufacturer suggested procedures, while both strains of E.coli - TG1 and MON105 become competent to enable DNA using the method with calcium chloride. In principle, 20-50 ml of cells grown in LB medium (1% bacteriophora, 0.5% of bacterial-yeast extract, 150 mm Nacl) until reaching a density, measured approximately 1.0 unit of optical density at 600 nm (OD600) when measured on the spectrophotometer, Bausch & Lomb breakers (Rochester, NY). Cells are harvested by centrifugation and resuspension in one-fifth of the culture volume in a solution of CaCl2(50 mm CaCl2, 10 mm Tris-HCl, pH=7,4) and incubated at 4°C for 30 minutes. Cells are again collected using centrifugation and resuspension in solution l2based 1/3 of the volume of culture medium. Legirovannoi DNA added to the cells in a volume of 0.2 ml: the resulting preparation was kept at 4°C for 30-60 minutes. The samples for 2 minutes put on 42°and 1.0 ml of LB medium add to Strahan the I samples at 37° C, then held for 1 hour. Cells of these samples are placed in Petri dishes (LB medium + 1.5% of bacteriaare)containing either ampicillin (100 μg/ml) in the event of selection of resistant to ampicillin transformed, or spectinomycin (75 µg/ml) for the selection of resistant to spectinomycin transformed. Petri dishes are incubated overnight at 37°C. Colonies are selected and inoculant in LB medium with the addition of the required antibiotic (100 μg/ml ampicillin (75 μg/ml spectinomycin) and grown at 37°C.

How to create genes with new N-ends/C-ends

Method I. the Creation of genes with new N-ends/C-ends containing linker segment (L2)

Genes with new N-ends/C-ends containing linker segment (L2), which divides the original C - and N-ends, can be formed in principle according to the method described by Mallinson et al. (Mullins et al., 1994, J. Amer. Chem. Soc., 116, 5529-5533). Successive stages of amplification using the polymerase chain reaction (PCR) is used for reconstruction of DNA sequences encoding the primary amino acid sequence of the polypeptide. These stages are shown in figure 2.

In the first stage, the first set of stations ("new start" and "linker starting") is used to create and amplification on the basis of the original gene sequence fra is ment DNA ("starting fragment"), which contains a sequence encoding a new N-terminal site of a new polypeptide, followed by a linker (L2)in contact with the P - and N-ends of the original polypeptide. In the second stage, the second set of blades ("new leaf" and "linker end") is used to create and amplification on the basis of the original gene sequence of the DNA fragment ("limit fragment")that encodes the same linker that is listed above, continue the C-terminal part of the new polypeptide. As part of the anticipated "new start" and "new leaf" ensure the availability of appropriate restriction sites that allows you to clone a new gene in the composition of expressing plasmids. Typical PCR parameters are as follows: 1 cycle at 95°C for 2 minutes (melting), 25 cycles at 94°C for 1 minute (denaturation), 50°C for 1 minute (annealing) and 72°C for 1 minute (extension); plus 1 cycle at 72°C for 7 minutes (for completion). For PCR use reagents GeneAmp PCR Core Reagents Kit (Perkin-Elmer). The reaction mixture in a volume of 100 μl contains 100 RMB each seed and 1 µg DNA templates, and 1x PCR buffer, 200 μm DSTF, 200 μm dATP, 200 μm dTTP, 200 μm dCTP, and 2.5 units of DNA polymerase ApliTaq and 2 mm of magnesium chloride. The PCR reaction is performed with the use of the device Model 480 DNA Thermal cycler (Perkin-Elmer Corp., Norwalk, CT).

"The starting fragment" and "limit fragment comprising the sequence complementary linker segment, and the segment encoding two amino acids from both ends of the linker, join together at the third stage PCR with the aim of forming a full-sized gene encoding a new polypeptide. DNA fragments starting fragment" and "limit fragment identified in 1%TAE-gel bromide stained with ethidium and allocate using reagents Qiaex Gel Extraction Kit (Qiagen). These fragments are combined in equimolar quantities, heated to 70°C for 10 minutes and slowly cooled to achieve annealing for their common sequences in the linker start" and "end of the linker" fragments. In the third stage PCR "new start" and "new leaf" add seed to the past annealing the fragments to create and amplification of the full-size gene with the new N - and C-ends. Typical PCR parameters: 1 cycle at 95°C for 2 minutes (melting), 25 cycles at 94°C for 1 minute (denaturation), 60°C for 1 minute (annealing) and 72°C for 1 minute (extension); plus 1 cycle at 72°C for 7 minutes (for completion).

For PCR use reagents GeneAmp PCR Core Reagents Kit (Perkin-Elmer). The reaction mixture in a volume of 100 μl containing 100 RMB each seed and 1 µg DNA templates, and 1x PCR buffer, 200 μm dggf, 200 μm dATP, 200 μm dTTP, 200 μm dCTP, and 2.5 units of DNA polymerase ApliTaq and 2 mm chloride magnety PCR purified using reagents Wizard PCR Preps Kit (Promega).

Method II. The creation of genes with new N-ends/C-ends that do not contain the linker segment

New C-terminal/N-terminal genes without linker compounds the original N-Terminus and C-end can be formed by using two stages of PCR amplification and ligation "blunt ends". These stages are shown in figure 3. In the first stage, a set of seed ("new start" and "starting R-bl") is used to create and amplification on the original gene sequence of the DNA fragment ("starting fragment"), which contains a sequence encoding a new N-terminal segment of the new protein. In the second stage, a set of seed ("new leaf" and "end the R-bl") is used to create and amplification on gene sequence of the DNA fragment ("limit fragment"), which contains a sequence encoding a new C-terminal part of the new protein. Seed starting fragment" and "limit fragment include appropriate restriction sites that allow you to clone a new gene in the composition expressing vector. Typical PCR conditions: 1 cycle at 95°C for 2 minutes (melting), 25 cycles at 94°C for 1 minute (denaturation), 50°C for 45 seconds (annealing) and 72°C for 45 seconds (extension). Polymerase Deep-Vent (New England Biolabs) is used to reduce the occurrence of tabs in the conditions recommended by the manufacturer. C the grass starting R-bl" and "end the R-bl" phosphorylate 5’-end for subsequent ligation "blunt ends" "the starting fragment and end of slice on each other. 100 μl of the reagent contain 150 RMB each seed and 1 µg DNA templates, buffer 1 x Vent (New England Biolabs), 300 μm DRTF, 300 μm dATP, 300 μm dTTP, 300 μm dCTP and 1 unit of polymerase Deep-Vent. The PCR reaction is performed on the device Model 480 Dna Thermal cycler (Perkin-Elmer Corp., Norwalk, CT). The PCR product purified using a set of reagents Wizard PCR Preps Kit (Promega).

The seed thus created that include appropriate restriction sites that allow you to clone a new gene in the composition expressing vectors. Usually starting fragment" includes site recognition by the restriction enzyme NcoI, and "limit fragment" includes site recognition by the restriction enzyme HindIII. The cleavage reaction by restrictase carried out using a set of reagents Mars DNA Clean-up System Kit (Promega). The start and end fragments are separated in a 1%TAE gel, bromide stained with ethidium and allocate using a set of Qiaex Gel Extraction Kit (Qiagen). These fragments are mixed and carry out annealing on the ends of the NcoI/HindIII-fragment length of about 3800 nucleotides in the vector pMON3934 with warming to 50°C for 10 minutes followed by slow cooling. Three fragments are ligated together using DNA T4 ligase (Boehringer Mannheim). The result is a plasmid containing a full-sized gene with the new N-end/end. Part of the ligation reaction mixture used to transform cells of E. coli strain DH5α (Life threat, Gaithersburg, MD). Plasmid DNA purified and the sequence confirmed, as described above.

Method III. The creation of genes with new N-end/end method tandem duplications

Genes with new N-end and C-end can be formed based on the method described by Goricom et al. (Horlick et al., 1992, Protein Eng., 5, 427-431). Amplification of genes with new N-end and C-end polymerase chain reaction (PCR) performed using tandemly duplicated DNA template. The steps of the method shown in figure 3.

Tandemly duplicated DNA template is generated by cloning: it contains two copies of the gene, separated by a DNA sequence that encodes a linker connecting the source S - and N-ends of two copies of the gene. A set of specific seed is used to create and amplification of the full-size gene with the new N-end and C-end to tandemly duplicated DNA matrix. These seed created in such a way that include appropriate restriction sites that allow you to clone a new gene in the composition expressing vector. Typical PCR conditions are as follows: 1 cycle at 95°C for 2 minutes (melting), 25 cycles at 94°C for 1 minute (denaturation), 50°C for 1 minute (annealing) and 72°C for 1 minute (extension); plus 1 cycle at 72°C for 7 minutes (for completion). For PCR using the reagent is GeneAmp PCR Core Reagents Kit (Perkin-Elmer). The reaction mixture in a volume of 100 μl containing 100 RMB each seed and 1 µg DNA templates, and 1x PCR buffer, 200 μm dggf, 200 μm dATP, 200 μm dTTP, 200 μm dCTP, and 2.5 units of DNA polymerase ApliTaq and 2 mm of magnesium chloride. The PCR reaction is performed with the use of the device Model 480 DNA Thermal cycler (Perkin-Elmer Corp., Norwalk, CT). The PCR products purified using reagents Wizard PCR Preps Kit (Promega).

Cloning of genes with new N-end and C-end into vectors expressing a multifunctional receptor agonists

The gene with the new To-end and N-end split restrictable to create all required for installation in expressing a vector containing a different gene colony-stimulating factor. This expressing vector similarly digested by restrictase education combined ends. After cleaning the gene and vector DNA are combined and are ligated using DNA ligase T4. Part of the ligation reaction mixture used to transform E. coli. Plasmid DNA purified and is sequenced to correct insertion. Correct clones grown for expression of the coded protein.

Selection and characterization of DNA

Plasmid DNA can be isolated using a number of different methods and with the use of standard sets, well-known experts in the field of technology. Some of these methods are described here. asmitou DNA allocate using sets Promega Wizard™ Miniprep Kit (Madison, WI), Qiagen QIAwell Plasmid Isolation Kit (Chatsworth, CA) or Qiagen Plasmid Midi Kit. These sets correspond to the similar procedure for selection of plasmid DNA. Briefly, cells granularit by centrifugation (5000 g), plasmid DNA release sequential treatment with caustic soda and acid, and cell clusters are removed by centrifugation (10000 g). The supernatant fraction (containing plasmid DNA) is loaded into a column containing DNA-binding resin column is washed, and plasmid DNA elute with Tris-Hcl. After screening of colonies for the presence of the desired plasmid of E.coli cells inoculant in 50-100 ml volumes of the LB medium with the addition of antibiotics to grow over night at 37°in an air incubator, followed by shaking. Purified plasmid DNA used for DNA sequencing, and subsequent cleavage by restrictase, additional sublimirovanny fragments of DNA and transfection into mammalian cells, E. coli and other cells.

The confirmation sequence

Purified plasmid DNA resuspension in distilled water and perform quantitative analysis by measuring the absorption in the range of 260-280 nm spectrometer Bausch/Lomb breakers 601 UV. The DNA is sequenced using a sequenced set ABI PRISM™ DyeDepxy™ (Appl. Biosystems Div., Perkin-Elmer Corp., Lincoln City, CA; part No. 401388 and 402078) in accordance with R comencemos manufacturers procedure usually modified by adding 5% DMSO in sequential mixture. The sequencing reaction is performed on the device Model 480 DNA Thermal cycler (Perkin-Elmer Corp., Norwalk, CT) in accordance with the recommended conditions of amplification. Samples purified to remove excess paint terminators on columns message-Sep™ (Princeton Separations, Adelphia, NJ) and lyophilizers. Tagged with fluorescent dyes sequention drugs resuspension in distilled formamide and is sequenced in denaturing of 4.75%polyacrylamide-8M-urea gel using an automatic DNA sequencer ABI Model 373. Overlapping fragments of DNA sequences analyze and gather in the main DNA contig using Sequencher software product-DNA-analysis (Gene Codes Corp., Ann Arbor, MI).

Expression of a multifunctional receptor agonists in mammalian cells

Transfection and production of mammalian cells in conditioned environments

Cell line KSS-21 can be obtained in ATSC (Rockville, MD). Cells were cultured in modified according Dulbecco environment Needle (DMEM with high glucose) supplemented with 2 mm L-glutamine and 10% fetal bovine serum (FBS). This composition is designated as cultural medium KSS. A selective medium is a growth medium KSS with the addition of 453 units/ml hygromycin (Calbiochem, San Diego, CA). Cell line KSS-21 was previously stable is rangitiratanga HSV-derived transactivism protein VP16, which transactional promoter UE110 detected in the plasmid pMON3359 (see Hippenmeyer et al., 1993, Bio/Technol., 1037-1041). Protein VP16 controls the expression of genes that are built after promoter E. Cells KSS-21 expressing transactivity protein VP16, indicate BHK-VP16. Plasmid pMON1118 (see Highkin et al., 1991, Poultry Sci., 70, 970-981) expresses the gene of resistance to hygromycin with the SV40 promoter. A similar plasmid, pSV2-hph can be obtained in ATSS.

Cells BHK-VP16 plated on 60-mm Cup for tissue culture based on 3·105cells at 1 Cup per 24 hours prior to transfection. Cells transferout for 16 hours in 3 ml OPTIMEM"™ (Gibco-BRL, Gaithersburg, MD)containing 10 μg of plasmid DNA containing the gene of interest, 3 μg of the plasmid with hygromycin resistance (pMON1118) and 80 µg of "LIPOFECTAMINE"™ (Gibco-BRL) per Cup. Next, the medium is removed and replaced by 3 ml of growth medium. 48 hours after transfection Wednesday of each Cup is collected and tested for activity (intermittent conditioned environment). Cells are removed from the plate with trypsin-EDTA, diluted 1:10 and transferred to 100-mm Cup for culturing tissue containing 10 ml of selective medium. After approximately 7 days of being in selective medium resistant cells grow in colonies with several millimeters in diameter. Colonies are removed from the cups using filter paper (cut is going to pieces the size, approximately the same as the size of the colonies, and impregnated with trypsin-EDTA) and transferred to individual wells of 24-hole tablet, containing 1 ml of selective medium. After the colonies grow to the stage of merger, conditioned environment test again, and positive clones are transferred to the growth medium.

The expression of multi-functional agonists of the receptors in E. coli

The E. coli strains MON105 and JM101 carrying the desired plasmid, grown at 37°in M9 medium with the addition of free amino acids with shaking air incubator Model G25 from New Brunswick Scientific (Edison, NJ). Growth control by OD600 (optical density) until it reaches a value of 1.0 at this point add nalidixic acid (10 mg/ml) in 0.1 normal NaOH to a final concentration of 50 μg/ml Culture is then shaken at 37°C for 3-4 more hours. A high degree of aeration provide during the cultivation period in order to achieve maximum yield the desired gene product. Cells analyzed under a light microscope for the presence of incorporated cells (IB). 1-ml aliquots of the culture are taken for analysis of protein content by boiling granular cells with subsequent processing of the reduced buffer and analysis in SDS-PAGE electrophoresis (see Maniatis et al., 1982, Molecular Cloning: A Laboratory Manual). Culture centrifuge the comfort (5000g) before pelleting of cells.

Preparation included Taurus, extraction, refolding, dialysis, DEAE chromatography and characterization of multifunctional chimeric agonists hematopoietic receptors, which accumulate in the cells included in E.coli

The selection included Taurus:

Cell pellets of culture E.coii in the volume of 330 ml resuspension in 15 ml sonication buffer (10 mm 2-amino-(hydroxymethyl)-1,3-propandiol-hydrochloride (Tris-Hcl), pH=8,0+1 mm ethylenediaminetetraacetic acid (EDTA). These resuspension cells treated with ultrasound using a probe Sonicator Cell Disrupotor Model W-375 (Heat Systems Ultrasonics Inc., Farmingdale, NY). Three circles of influence of ultrasound in sonication buffer followed by centrifugation used for cell disruption and leaching enabled Taurus (IB). The first round effects of ultrasound presents a 3-minute break with subsequent 1-minute break, and the final two rounds of the influence of ultrasound continue for 1 minutes each.

Extraction and refolding of proteins from granules included Taurus;

After the final centrifugation the pellets IB resuspension in 10 ml of 50 mm Tris-HCl, pH=9,5, 8 M urea and 5 mm of dithiothreitol (DTT) and shaken at room temperature for approximately 45 minutes to ensure denaturation expressed protein.

The extract solution transferring is suspended in a beaker, containing 70 ml of 5M Tris-HCl, pH=9.5 and 2.3 M urea and thoroughly shaken and then left in air at 4°C for 18-48 hours to ensure the refolding of the protein. Refolding control analysis on columns 0,46×25 cm liquid chromatography in reverse phase high pressure Vydac (Hesperia, CA) C18. A linear gradient of acetonitrile from 40% to 65%, containing 0.1% triperoxonane acid (TPA), used for control of refolding. This gradient is formed within 30 minutes at a flow rate of 1.5 ml per minute. Denaturated proteins in General suiryudan later this gradient in comparison with proteins having restored the spatial structure.

Clean

After refolding contaminated with E. coli proteins removed by acid precipitation. Using 15% (volume concentration) of acetic acid is titrated pH refolding solution in the range from pH 5.0 to pH=5,2. This solution is shaken out with 4°C for 2 hours and then centrifuged for 20 minutes at 12000 g to granule formation all insoluble proteins.

The supernatant fraction obtained at the stage of acid precipitation, dialist using membrane Spectra/Por-3 with cut-off at the value of the molecular weight of 3500 daltons. The dialysis is carried out against 2 changes of 4 liters (50-fold excess) in 10 mm Tris-HCl, pH=8.0 in 18 hours in a is m Dialysis reduces the conductivity of the sample and removes urea before DEAE chromatography. Then the samples are centrifuged (20 minutes at 12000 g) prior to the formation of granules of all insoluble protein after dialysis.

Speakers Bio-Rad Bio-Scale DEAE2 (7×52 mm) used for ionoobmennoi chromatography. Column offset in buffer containing 10 mm Tris-HCl, pH=8.0 and gradient of sodium chloride in the range of 0-500 mm in the equilibrium buffer, over 45 volumes of the columns used for protein elution. Use a flow rate of 1.0 ml per minute. Column fractions (2.0 ml per fraction) are collected along the gradient and analyzed by columns 0,46×25 cm liquid chromatography in reverse phase high pressure Vydac (Hesperia, CA) C18. Use a linear gradient of acetonitrile in the range from 40% to 65%, containing 0.1% triperoxonane acid. This gradient form in 30 minutes at a flow rate of 1.5 ml per minute. Combined fractions are then subjected to dialysis against 2 changes of 4 liters (in excess 50-500 times) 10 mm ammonium acetate, pH=4.0 for 18 hours in General. The dialysis is carried out with the use of membrane Spectra/Por-3 with cut-off at the value of the molecular weight of 3500 daltons. At the end of the sample is filtered under sterile conditions using a syringe filter 0.22 μm (syringe filter μStar LB, Costar, Cambridge, MA) and maintained at 4°C.

In some cases, proteins with normal question is rastenii structure can be affinity purified using the appropriate reagents, such as monoclonal antibodies or receptor subunit attached to a suitable matrix. On the other hand (or in addition), cleaning can be carried out using any of a group of chromatographic procedures such as ion exchange, gel filtration or hydrophobic chromatography, or HPLC in reverse phase.

These and other methods of protein purification are described in detail in "Methods in Enzymology", Vol. 182 "Guide to Protein Purification, ed. M.Deutscher, Academic Press, San Diego, CA (1990).

Characterization of protein:

The purified protein is analyzed by HPLC in reverse phase, electrospray-mass spectrometry and SDS-PAGE. Quantitative protein analysis is performed on the amino acid composition using HPLC in reverse phase and the test protein by Bradford. In some cases conduct triticeae mapping of proteins together with electrospray-mass spectrometry to confirm the identity of proteins.

Test on the proliferation of AML for biologically active interleukin-3 human

The factor-dependent cell line AML-193 received in the American type culture collection (ATS, Rockville, MD). This cell line generated from cells of a patient with acute myelogenous leukemia, is cell line-dependent growth factors, showing strong growth in the presence in the culture medium GM-CSF (Lange et al., 1987, Blood, 70, 192; Valtieri et al., 1987, J. Immunol., 13, 4042). Was confirmed by the ability of cells AML-193 to proliferate in the presence of IL-23 (Santoli et al., 1987, J. Immunol., 139, 348). Was used variant cell line AML-193/1 .3, which was adapted for long-term growth in the presence of IL-3 by leaching of growth factors and starvation cytokine-dependent cells AML-193 on growth factors for 24 hours. The cells are then subcultured based 105 cells per well in 24-hole tablets in a medium containing 100 units/ml IL-3. They are matured for about 2 months to ensure rapid growth of cells in the presence of IL-3. These cells support as AML-193/1 .3 by adding environment for the cultivation of tissues (see above) in the presence of IL-3 people.

Cells AML-193/1 .3 washed 6 times in cold balanced salt solution Hanks (HBSS, Gibco, Grand Island, NY) using centrifugation of cell suspensions at 250 g for 10 minutes, followed by otmuchivanie the supernatant fraction. Granular cells resuspension in HBSS and the procedure is repeated up until six wash cycles will not be completed. Cells washed 6 times according to the described procedure, resuspension for cultureware tissue density in the range from 2·105up to 5·105living cells in 1 ml of the medium was prepared by adding to a modified on Iscove environment Dalbec what about the (IMDM, Hazelton, Lenexa, KS) albumin, transferrin, lipids and 2-mercaptoethanol. Bovine albumin (Boehringer-Mannheim, Indianapolis, IN) add in a dose of 500 μg/ml; human transferrin (Boehringer-Mannheim, Indianapolis, IN) add in a dose of 100 μg/ml; soybean oil (Boehringer-Mannheim, Indianapolis, IN) add in a dose of 50 μg/ml; and 2-mercaptoethanol (Sigma, St.Louis, MO) add in a dose of 5·10-5M

Serial dilution of interleukin-3 human or multifunctional proteins chimeric agonists hematopoietic receptors is carried out in series with the triple repetition in the environment for the cultivation of tissues with the addition of the above components on a 96-well tablets Costar-3596 for the cultivation of tissues. Each hole upon completion of serial dilutions contains 50 ál of the environment, including interleukin-3 or proteins are multifunctional chimeric agonists hematopoietic receptors. Control wells containing only medium for cultivation of tissues (negative control). Suspension cells AML-193/1 .3, prepared as described above, add to each well using a pipette, 50-ál (2.5·104cells per well). The culture plates are incubated at 37°With 5% CO2in moist air for 3 days. On day 3 labeled3H-thymidine activity 0.5 microcurie (2 Kyu/mm, New England Nuclear, Boston, MA)add 50 µl of media for culturing tissues. Culture incubi the Ute at 37° With 5% CO2in moist air for 18-24 hours. Cellular DNA is collected on a glass filter film (Pharmacia LKB, Gaithersberg, MD) using the device TOMAS (TOMTEC, Orange, CT), which is based on a cyclical water rinse followed a cyclical washing with 70%ethanol. The filter film is left to dry in air and then placed in a box for samples in which add scintillation fluid (Scintiverse II, Fisher Scientific, St.Louis, MO or BetaPlate Scintillation Fluid, Pharmacia LKB, Gaithersburg, MD). The issue β-particle samples separate holes for tissue cultures consider using a scintillation counter, LKB 1205 BetaPlate (Pharmacia LKB, Gaithersburg, MD), and the obtained data is expressed as counts per minute number of incorporated residues3H-thymidine in the cells in each of the holes for the cultivation of tissues. The activity of each drug interleukin-3 or multifunctional protein chimeric agonist hematopoietic receptors analyzed quantitatively by measuring the intensity of cell proliferation (incorporation3H-thymidine)induced consistent concentrations of interleukin-3 or multifunctional chimeric agonist hematopoietic receptors. Typical range of concentrations analyzed in these tests is in the range of from 0.05 RMB to 105PKM. Activity is ü determined by measuring the dose of interleukin-3 or multifunctional protein chimeric agonist hematopoietic receptors, which provides 50% of maximal proliferation (EC50=0,5×and(maximum average count per minute level3H-thymidine incorporated in 1 hole, among thrice repeated cultures at all tested concentrations of interleukin-3 - initial proliferation rate, measured by the level of incorporation3H-thymidine in the thrice repeated cultures in the absence of interleukin-3). This EC50also equivalent to 1 unit of bioactivity. Each test is carried out with native interleukin-3, as the calibration standard, which allows to assess the relative activity.

In General, proteins are multifunctional chimeric agonists hematopoietic receptors were tested in the concentration range from 2000 right up to 0.06 PKM, titrated in a series of twofold dilutions.

The activity of each sample was determined by the concentration, which provided 50% of the maximum response when engaging 4-parametric documentary model of the received data. It was found that the upper plateau (maximum response) of the sample and the standard to which it was compared, did not differ. Consequently, to assess the relative potential of each sample was determined estimated EC50for sample and standard, as described above. Cells AML-193/1 .3 proliferate in response to hIL-3, hGM-CSF and hG-CSF, sootvetstvenno is, the following additional tests were performed for some samples to demonstrate that agonist of the receptor for G-CSF, which is part of a multifunctional protein chimeric agonists hematopoietic receptors active. Test on the proliferation was carried out with multifunctional chimeric agonist hematopoietic receptor, plus or minus a neutralizing monoclonal antibodies to the part, which is an agonist of the receptor hIL-3. In addition chimeric molecule with the site of cleavage by factor XA were digested, then purified and received half of the molecules tested on proliferation activity. These experiments showed that both proteins are multifunctional chimeric agonist hematopoietic receptors active.

Test on the proliferation-dependent ligand TF1 C-mpl

Proliferation activity of the ligand of the C-mpl can be tested using subclone pluripotent cell line TF1 person (Kitamura et al., 1989, J. Cell Physiol., 140, 323-334). Cells TF1 support in the presence of hIL-3 (100 units/ml). For the formation of subclone, responsive to the ligand of the C-mpl, the cells were maintained in peressini medium containing 10% supernatant fraction of cells KSS, transfected with the gene expressing the form 1-153 ligand c-mpl (pMON26448). The majority of cells die, but some survive. After dilutional to the onirovaniya selected responsive to the ligand of the c-mpl clone, and these cells are placed in Presevo Wednesday at the rate of 0.3·106cells, 1 ml per day before the test.

Beresina environment for these cells is as follows: RPMI-1640 (gibco), 10% fetal bovine serum (Harlan, Lot #91206), 10% supernatant fraction KSS-cells transfected with the ligand c-mp1, 1 mm sodium pyruvate (Gibco), 2 mm glutamine (Gibco) and 100 μg/ml penicillin-streptomycin (Gibco). The next day, cells are harvested and washed twice in media RPMI or IMDM with final rinse in ATL or in a test environment. The ATL environment includes the following: IMDM (Gibco), 500 μg/ml bovine serum albumin, 100 μg/ml human transferrin, 50 μg/ml soybean fat, 4·10-8M β-mercaptoethanol and 2 ml A (Sigma, an antibiotic solution) in 1000 ml of ATL. Cells were diluted in a test environment with final density of 0.25-10 cells per 1 ml in 96-well nishibayashi plates (Costar) to a final volume of 50 µl. Temporary supernatant fraction (conditioned medium from transfected clones added in a volume of 50 μl as duplicated sample, with final concentration of 50%, and diluted with three times before the final dilution at 1.8%. Triplicate samples curve doses variant of IL-3 in structure pMON13288 ranging from 1 ng/ml and by a threefold dilution to 0,0014 ng/ml, include as a positive control. Plates are incubated in 5% CO2and 37°C. On the 6th the Yan cultivation plate irradiated with pulses of tritium activity of 0.5 Kyu 1 well at a volume of 20 μl for 1 well and incubated in 5% CO 2and 37°C for 4 hours. Plates gather and analyze using a Betaplate counter.

Test for cell proliferation MUTZ-2

Cell line, such as MUTZ-2, which is derived from cell lines of myeloid leukemia (German collection of microorganisms and cell cultures, DSM ACC 271), can be used to determine proliferation agonist activity of flt3 receptors. Culture MUTZ-2 support with recombinant native flt3 ligand (20-100 ng/ml) in the growth medium. 18 hours before the test cells MUTZ-2 washed in IMDM medium (Gibco) three times, resuspension in the medium IMDM at a concentration of 0.5-0.7·106cells in 1 ml and incubated in 5% CO2and 37°in conditions of starvation of the cells with flt3 ligand. On the day of the test standards and agonists of the receptor flt3 diluted 2-fold more than the desired final concentration in the test medium in a sterile 96-well tablets for the cultivation of tissues. Agonists of the receptor flt3 and standards are tested in three replicates. All wells, except number of And pour 50 μl of the test environment. 75 μl of agonist-receptor flt3 or standards add in row a and 25 μl are taken back from this number by serial dilutions (1:3), transferring the remaining portion of the tablet (rows b to G). The number N retain control, including only environment. Hungry cells MUTZ-2 washed two times IMDM medium and resuspension 50 μl of the test environment. 50 μl of cells added to each well, resulting in a final concentration of 0.25·106cells in 1 ml of the Test tablets containing cells, incubated in 5% CO2and 37°C for 44 hours. Each well is then irradiated tritium-labeled with thymidine activity 1 Kyu 1 well in a volume of 20 μl for 4 hours. The tablets are then harvested and cheated.

Other tests on cell proliferation in vitro

Other cellular in vitro tests, known to experts in the art, can also be used to determine the activity of multifunctional chimeric agonists hematopoietic receptors, depending on factors that include the molecule, similar to that described for the test on cell proliferation of AML-193/1 .3. The following examples are applicable tests.

Test on the proliferation of TF1: TF1 - pluripotent cell line person (Kitamura et al., 1989, J. Cell Physiol., 140, 323-334), reacting to hIL-3.

Test on the proliferation of 32D: 32D - IL3-dependent cell line mouse, which does not respond to IL-3, but responds to G-CSF, human, for which there is no restriction on withspecific.

Test on the proliferation of Baf/3: Baf/3 - IL3-dependent cell line mouse, which does not respond to IL-3 or the ligand of the C-mpl person, but responds to G-CSF, human, for which there is no restriction on vidoe is epichnosti.

Test on the proliferation T: T - IL6-dependent cell line mouse (Nordan et al., 1986), responsive to IL-6 and IL-11.

Test plasma Clot meg-CSF man: used to test the activity on the formation of colonies of megakaryocytes (Mazur et al., 1981).

Line transfected cells:

Cell lines such as the cell line Baf/3 mouse can be transliterowany receptor colony stimulating factor, such as the receptor for G-CSF person or receptor C-mpl person that cell lines are not available. These transfetsirovannyh cell lines can be used to determine the activity of the ligand, the receptor for which transfirieran cell line.

One such transfusiona cell line Baf/3 was formed from the cell line that responds to C-mpl, and cloned in the multiple cloning site of the plasmid pcDNA3 (Invitrogen, San Diego, CA). Cells Baf/3 was transfusional the plasmid using electroporation. Cells were grown in G418 selection in the presence of IL-3 mouse in conditioned medium Wehi. Clones were generated by limited dilution.

On a similar scheme receptor G-CSF may be transfirieran cell line Baf/3 and used to determine the biological activity of multifunctional chimeric agonists hematopoietic receptors.

Analysis proliferation activity and ligand C-mpl

Methods

1, the Test on the proliferation of bone marrow

A. Purification of CD34+cell:

The bone marrow aspirates (15-20 ml) were obtained from normal allogeneic bone marrow donor after consent. Cells were diluted 1:3 in phosphate buffer (PBS, Gibco-BRL), 30 ml was placed in layers of 15 ml of Histopaque-1077 (Sigma) and centrifuged for 30 minutes at 300 RCF. Surface managermy layer was collected and washed in PBS. CD34+ cells were enriched from drug managernew cells using affinity column and the manufacturers instructions (CellPro Inc., Bothell, WA). After enrichment, the purity of the CD34+ cell reached 70% on average, which was determined using flow cytometry with a polyclonal antibody to CD34, coupled with fluorescein, and aHTH-CD38, coupled with phycoerythrin (Becton Dickinson, San Jose, CA).

The cells were ressponsible based 40000 cells per 1 ml in X-Vivo10 (Vu-Whittaker, Walkersville, MD), and 1 ml was placed on a 12-hole tablets for the cultivation of tissues (Costar). Growth factor rhIL-3 was added at the rate of 100 ng/ml (pMON5873) in some wells. Options hIL-3 was used at a concentration of 10-100 ng/ml of Conditioned medium of cells KSS transfected with a plasmid that encodes the ligand of the C-mpl or multifunctional chimeric agonists hematopoietic receptors, was tested by adding 100 μl of the supernatant fraction, added to 1 ml of culture (approximately the 10%dilution). Cells were incubated at 37°within 8-14 days at 5% CO2in a humid incubator with a constant temperature of 37°C.

b. Collection and analysis of cells:

At the end of the cultivation period, the total number of cells was counted in each of the options. For fluorescence analysis and determination of level density cells were washed in special megakaryocytes buffer (buffer MK: 13, 6 mm sodium quote, 1 mm theophylline, a 2.2 μm PGE1, 11 mm glucose, 3% (weight percent) of bovine serum albumin dissolved in saline phosphate buffer (PBS): pH=7,4 (Tomer et al., 1987, Blood, 70, 1735-1742), was reasponsible 500 ál MK-buffer containing anti-D41 FITC-antibody (1:200, AMAC, Westbrook, ME), and washed in MK-buffer. For analysis of cell DNA was used in a buffer MK containing 0.5% tween-20 (Fisher, Fair Lawn, NJ) for 20 minutes on ice, followed by fixation in 0.5%tween-20 and 1%parathormone (Fisher Chemical) for 30 minutes and then incubated in the iodide propecia (Calbiochem, La Jolla, CA) (50 μg/ml) RNase (400 units/ml) in 55% (volume percent) buffer MK (200 m0sm) within 1-2 hours on ice. Cells were analyzed on the scanner FACScan or a flow cytometer Vantage (Becton Dickinson, San Jose, CA). The signals of the green fluorescence (CD41a-FITC) were collected along a linear and logarithmic signals of red fluorescence (propidium iodide) to determine the ploidy DNA. All cells Liberales determine the percentage of cells positive for CD41. Data analysis was performed using the computer program LYSIS (Becton Dickinson, San Jose, CA). The proportion of cells expressing the antigen CD41, was determined using flow cytometry (the indicator "percentage"). The absolute number D41-positvnyi cells in 1 ml was determined by the formula: Abs=(number of cells)× ("%")/100.

Clot-test with fibrin megakaryocytes

Enriched CD34-positive cell population was isolated, as described above. The cells were suspensively based on 25,000 cells in 1 ml with or without cytokines (cytokines) in a medium containing a basic environment Isco-ves-IMDM, supplemented with 0.3% bovine serum albumin, 0.4 mg/ml apotransferrin, to 6.67 μm FeCl2, 25 μg/ml CaCl2, 25 μg/ml L-asparagine, 500 μg/ml ε-amino-n-kupreeva acids and penicillin/streptomycin. Before sowing on 35-mm cups thrombin was added from the calculation of 0.25 units/ml with the aim of induction "clot (clotting). Cells were incubated at 37°C for 13 days at 5% CO2in a humid incubator with a constant temperature of 37°C.

At the end of the cultivation period, the plates were fixed with a mixture of methanol and acetone in the ratio 1:3, dried in air and kept at 200°before staining. Procedure was peroxidase immunocytochemical staining (Zymed, Histostain-SP, San Francisco, CA), using a mixture of primary the monoclonal antibody to CD41a, CD42 and CD61. Colonies were counted after staining and classified as negative, CFU-MK (small colonies with 1-2 tricks and less, which corresponds to about 25 cells), BFU-MK (large multifocus colonies with more than 25 cells) or mixed colonies (a mixture of both positive and negative cells).

Methylcellulose test

This test reflects the ability of colony-stimulating factors to stimulate normal cells in the bone marrow for the production of various types of hematopoietic colonies in vitro (Bradley et al., 1966, Austral. .. Biol. Sci., 44, 287-300; Pluznik et al., 1965, J. Cell. The OMRS. Physiol., 66, 319-324).

Methods

Approximately 30 ml of fresh normal healthy bone marrow aspirate receive from donors with their consent. Under sterile conditions the samples diluted 1:5 in 1x saline solution with phosphate buffer (No. 14040.059 Life Technologies, Gaithersburg, MD) in a 50 ml conical tubes (No. 25339-50 Corning, Corning, MD). Ficoll (Histopaque 1077, Sigma H-8889) place a layer of diluted sample and centrifuged at 300 g for 30 minutes. Layer managernew cells is isolated and washed twice in 1x saline solution with phosphate buffer and once in a physiological solution with phosphate buffer containing 1% bovine serum albumin (CellPro Col., Bothel, WA). Menagerie cell count and positive for CD34 cells are selected using column and set Ceprate C (CD34) Kit (CellPro Co., Bothel, WA). Such fractionation is carried out, although all stem cells and precursor cells in the bone marrow are surface antigen CD34.

Culture form in triplicate with a final volume of 1.0 ml in Petri dishes 35 mm×10 mm (Nunc No. 174926). Culture medium acquire at the Terry Fox Labs. In the culture medium was added Wednesday NSS-4230 (Terry Fox Labs, Vancouver, BC, Canada) and erythropoietin (Amgen, Thousand Oaks, CA). For every Cup place for 3-10 thousand CD34+cell. Recombinant IL-3, purified from mammalian cells or E. coli, and proteins are multifunctional chimeric agonists hematopoietic receptors from conditioned culture media of transfected mammalian cells or purified from nondivisional culture media of transfected mammalian cells or E. coli added to a final concentration of 0.001 nm to 10 nm. Recombinant hIL-3, GM-CSF, the ligand of C-mpl and multifunctional chimeric agonist hematopoietic receptors remain at home. G-CSF (Neupogen) is obtained from Amgen (Thousand Oaks, CA). Culture resuspension using a syringe and 1.0 ml of culture was placed in 1 Cup. In the control culture (baseline response) do not contribute colony-stimulating factors. In culture, which is the positive control, make a conditioned environment (stimulated phytohemagglutinin cells brow the ESA: Tag Fox Lab. H2400). The culture is incubated at 37°With 5% CO2in the humid air.

Hematopoietic colonies, defined as colonies with more than 50 cells counted per day maximum response (10-11 day) using an inverted microscope with light phase of the brand Nikon lens 40x. Groups containing less than 50 cells, defined as clusters. On the other hand, the colonies can be identified by the distribution of colonies on slides with staining, or they can be removed resuspension and placed on cytopenia preparations for painting.

Tests on the reaction of umbilical cord blood for hematopoietic growth factors

Bone marrow cells are traditionally used in tests in vitro activity of colony-stimulating factors (CSF). However, human bone marrow is not always enough easily accessible, and there is considerable variability between individual donors. Umbilical artery compared with bone marrow as a source of stem cells and precursor cells of the blood (Broxmeyer et al., 1992, Proc. Natl. Acad/ Sci., 89, 4109-4113; Mayani et al., 1993, Blood, 81, 3252-3258). In contrast to bone marrow, umbilical cord blood can be easily accessed on a regular basis. There is also the possibility of reducing the variability of the test results by taking dostatochnogo cells from several donors, or through the establishment of banks reconceiving cells for the same purpose. By modifying the culture conditions and (or) test-specific cell marker types, it becomes possible to specifically test colonies of granulocytes/macrophages (CFU-GM), CSF activity in respect of megakaryocytes or activity control vysokoprofessionalnogo potential Colonie-forming cells (HPP-CFC).

Methods

Menagerie cells (MNC) isolated from umbilical cord blood within days after the selection of the sample using standard density gradient (1,077 g/ml Histopaque). The cells cord blood MNC enrich for stem cells and cell-predecessors by using a number of procedures, including manytomany selection for cells CD14-, CD34+, seeding fractions CD14-, CD34+ in special flasks Applid Immune Science (Santa Clara, CA) and selection of CD34+ cell on videnovic columns CellPro (Bothell, WA). For test use both freshly isolated and cryopreserved fractions enriched for CD34-positive cells. Culture in two replications for each of the serial dilutions of the sample (concentration range from 1 to 1204 RMB) at the rate of 10,000 cells in 1 ml of medium containing 0.9% methylcellulose, and devoid of additional growth factors (Methocult H4230, Stem Cell Technologies, Vancouver, BC, Canada). In some experiments containing Methocult-H4330 erytropoietin was used instead of Methocult-N, or were added 50 ng/ml of factor stem the notches SCF (Biosource Intern., Camarillo, CA). After cultivating for 7-9 days counted colonies containing more than 30 cells. The calculations in the test carried out "blind" way to avoid subjective variance in the count.

Additional details on the methods of recombinant DNA, which can be used to create variants, their expression in bacteria, mammalian cells or insect cells, purification and refolding of the desired protein, and tests to determine the biological activity of proteins can be found in the descriptions of the patents WO 95/00646, WO 94/12639, WO 94/12638, WO 95/20976, WO 95/21197, WO 95/20977, WO 95/21254 and US 08/383035 that in full here included in the list of citations.

Further details known to specialists in this field of technology can be found in Maniatis et al., 1982, "Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Lab. and the links provided in this publication, as well as Sambroook et al., 1989, "Molecular Cloning, A Laboratory Manual, 2D ed., Cold Spring Harbor Lab. and in the references listed in this publication.

Table. 1 to 3, and the sequence following claims.

The following examples illustrate the invention in greater detail, although it should be understood that the invention is not limited to these specific examples.

Example 1

The original design expressing vector KSS

A. Remove AflIII restriction site of expressing plasma the s mammals

New expressing vector for mammalian cells was constructed for the connection of gene fragments NcoI-HindIII or AflIII-HindIII located within the frame and the 3’segment, to gene agonist receptor hIL-3 plasmid pMON13146 (WO 94/12638) and linker fragment IgG2b mouse. First, the only AflIII restriction site was removed from the plasmid pMON3934, which is a derivative of plasmid pMON359. Plasmid pMON3359 is based on the plasmid pUCl8 vector containing a set of elements for expression in mammalian cells. This set includes herpes virus promoter E (from -800 to +120) followed by a stretch of coding sequence modified signal plot of IL-3, and then later polyadenylate signal of the SV40 virus, which subcloning in polylinker pUCl8 (see Hippenmeyer et al., 1993, Bio/Technol., 1037-1041). The modified signal plot of IL-3, which provides for secretion of the gene product outside the cage, flank the restriction site BamHI 5’-end and a unique restriction site NcoI 3’-end. A unique restriction site HindIII is located on the 3’side of the NcoI site and the 5’side with respect to polyadenylation signal. The DNA sequence encoding a signal plot shown earlier (restriction sites were defined above). Codon ATG (methionine) in the composition of the restriction site NcoI is within the scope of SGAs is ivania with the initiation ATG in the composition of the signaling site (underlined):

BamHI

5'GGATCCACCAGCCGCCTGCCCGTCCTGCTCCTGCTCCAACTCCTGGT

NcoI

CCGCCCCGCCATGG (SEQ ID NO 857)

The only AflIII restriction site was removed from the plasmid pMON3934 by cleavage with restriction enzyme AflIII followed by filling in the tabs by adding DNA polymerase and nucleotides. Split the DNA fragment was purified using a set of Magic PCR Clean-up Kit (Promega) and ligated using DNA ligase T4. The ligation product was transferred into DH5α™ and the cells were sown on LB-agar with the addition of ampicillin. Individual colonies were skanirovali loss of AflIII restriction site using restricting analysis with AflIII and HindIII, which produced a single piece, devoid of AflIII site. The resulting plasmid was designated pMON30275.

C. Transfer stencil pMON13416/IgG2b agonist receptor hIL-3 pMON30275

Marked by restrictase NcoI-HindIII fragment (approximately 426 base pairs) of the pMON30245 ligated with a fragment of NcoI-HindIII (approximately 3800 nucleotides) in the composition pMON30275. Plasmid pMON30245 (WO 94/12638) includes the gene encoding the receptor agonist hIL-3 pMON13416, coupled with a linker fragment IgG2b mouse. Immediately 3’-side of IgG2b and 5’-side of the restriction site HindIII is the AflIII restriction site. Genes can be cloned into the AflIII sites-HindIII, as fragments NcoI-HindIII or AflIII-HindIII, within the scope of the coding for the variant of the linker pMON13416/IgG2b with the aim of creating new chimeras. The restriction sites NcoI and AflIII characterized compatible projections and, accordingly, are ligated to each other with the loss of recognition sites. Plasmid pMON30304, including the DNA sequence SEQ ID NO 1, encoding a variant pMON13416 IL-3, coupled with a linker segment of mouse IgG2c, was the result of this cloning.

Example 2

Construction of intermediate plasmid containing one copy of the gene ligand of C-mpl (1-153) dimeric matrix

To create plasmid DNA comprising the coding sequence of the ligand of the C-mpl (1-153), continued restriction site EcoRI, gene allocate using the method of polymerase chain reaction with repertorium (RT-PCR). RNA from fetal (No. 38130) and adult (No. 46018) human liver get Clontech (Palo Alto, CA) as the source of the messenger RNA (mRNA) ligand c-mpl. The reaction in the first chain cDNA is carried out with a set of cDNA Cycle™ Kit (Invitrogen, San Diego, CA). In response revertive randomly selected priming and oligo-dt priming is used to create cDNA based on the combination of mRNA fetal and adult human liver. For amplification of the gene fragment of the ligand of the C-mpl, encoding amino acids 1-153, product revertive used as template for PCR with a combination of seed: the leading seed - c-mplNcoI (SEQ ID NO 317), and reverse priming - Ecompl. Seed c-mplNcoI annealed at gene ligands-mpl (base 279-311 on the gene sequence of the ligand of the C-mpl from the database Genbank # L33410 or according to de Sauvage et al., 1994, Nature, 369, 533-538) and placed a restriction site NcoI immediately with 5’-end from the first codon (serine+1) ligand C-mpl. The restriction site NcoI includes codons methionine and alanine before Ser+1and is characterized by the degeneracy of the alanine codon and the first four codons of the ligand of the C-mpl (Ser, Pro, Ala, Pro). Seed Ecompl annealed at base 720-737 gene ligand of C-mpl: it contains the restriction site EcoRI (GAATTC) within the scope of coding, located at the coding part of the gene ligand c-mpl immediately after the codon arginine153. The restriction site EcoRI creates codons glutamic acid and phenylalanine followed by codon Arg153. The PCR product length of about 480 nucleotides were purified, digested with restrictase NcoI and EcoRI and ligated into NcoI fragment-EcoRI vector pMON3993 (about 4550 nucleotides). Plasmid pMON3993 is a derivative of plasmid pMON3359 (described in example 1). The signal sequence plot of IL-3, which was subcloned as BamHI fragment into the unique restriction site between BamHI promoter A and polyadenylation signal contains the restriction site NcoI in its 3’-part and ends with a unique restriction site EcoRI. The result of this cloning plasmid is pMON26458 containing the DNA sequence SEQ ID NO 1, coding for amino acids 1-153 of ligand c-mpl.

Example 3

The design of the original plasmids containing the WTO is haunted genes dimeric matrices

For amplification of gene fragments of the ligand c-mpl, starting from the 1st amino acid (serine) with a stop codon after the codon 153-th amino acid (arginine) reaction revertive according to example 2 is used as template for PCR with a combination of the following basic structures: c-mplNcoI (SEQ ID NO 317) (leading seed) and c-mplHindIII (SEQ ID NO 319) (inverse priming). Seed c-mplNcoI (SEQ ID NO 317) described in example 2. Seed c-mpl-HindIII (SEQ ID NO 319), which annealed to the base 716-737 gene ligand c-mpl, and adds a stop codon and a restriction site HindIII immediately after the last codon Arg153.

Create two types of PCR products on the cDNA samples after revertive: one with a deletion of the codons of amino acids 112-115 and the other without deletions of these codons. The PCR product of the ligand c-mpl (approximately 480 nucleotides) split by restrictase NcoI and HindIII to migrate in expressive vector pMON3934 to mammalian cells. Plasmid pMON3934 split restrictase NcoI and HindIII (length approximately 3800 nucleotides) for joining of PCR products.

Plasmid pMON32132 (SEQ ID NO 84), encoding amino acids 1-153 of the ligand of the C-mpl (SEQ ID NO 546), was the result of this cloning. Plasmid pMON32134 (SEQ ID NO 86), encoding amino acids 1-153 of the ligand of the C-mpl (SEQ ID NO 548), was the result of this cloning. Plasmid pMON32133 (SEQ ID NO 86), encoding amino acids 1-153 of the ligand of the C-mpl with the loss of codons 112-115 (Δ112-115) (SEQ ID NO 547), I is ilaci the result of this cloning.

Example 4

Creating a dimer PCR matrices 5L with deletion 112-115 second gene for the ligand of C-mpl

PCR-matrix for the creation of new forms of the ligand of the C-mpl design by ligating the fragment BstXI-EcoRI length 3700 nucleotides in pMON-26458 with NcoI fragment-BstXI of pMON32133 (containing a deletion of amino acids 112-115) together with a synthetic oligonucleotide with EcoRI linkers-AflIII 5L-5’ (SEQ ID NO 322) and 5L-3’ (SEQ ID NO 323).

EcoRI-end of the linker are ligated to EcoRI-end plasmids pMON26458. AflIII-end of the linker are ligated to the restriction site NcoI plasmid pMON32133: i.e. after ligation of the free sites of the restriction remains. Also are ligated sites BstXI restriction in the structure of the plasmid pMON26458 and pMON32133. Plasmid pMON28548 is the result of cloning and contains the DNA sequence (SEQ ID NO 3), which encodes amino acids 1-153 of the ligand of the C-mpl connected via a linker GluPheGlyGlyAsnMet (SEQ ID NO 783) with codons of amino acids 1-153 of the ligand of the C-mpl with deletions of amino acids 112-115 (SEQ ID NO 468).

Example 5

Creating a dimer PCR-matrix 4L

PCR-matrix for the creation of new forms of the ligand of the C-mpl design by ligating the fragment BstXI-EcoRI length 3700 nucleotides in pMON26458 with NcoI fragment-BstXI of pMON32132 (containing a deletion of amino acids 112-115) together with a synthetic oligonucleotide with EcoRI linkers-AflIII 4L-5’ (SEQ ID NO 320) and 4L-3’ (SEQ ID NO 321).

EcoRI-end of the linker are ligated to EcoRI-end plasmids pMON26458. AflIII-end linker League is the comfort at the restriction site NcoI plasmid pMON32132: ie after ligating the free sites of the restriction remains. Also are ligated sites BstXI restriction in the structure of the plasmid pMON26458 and pMON32132. Plasmid pMON28500 is the result of cloning and contains the DNA sequence (SEQ ID NO 4), which encodes amino acids 1-153 of the ligand of the C-mpl connected via a linker 4L GluPheGlyAsnMetAla (SEQ ID NO 223) with codons of amino acids 1-153 of the ligand of the C-mpl (SEQ ID NO 469).

Example 6

Creating a dimer PCR-matrix 5L

PCR-matrix for the creation of new forms of the ligand of the C-mpl design by ligating the fragment BstXI-EcoRI length 3700 nucleotides in pMON26458 with NcoI fragment-BstXI of pMON32132 (containing a deletion of amino acids 112-115) together with a synthetic oligonucleotide with EcoRI linkers-AflIII 5L-5’ (SEQ ID NO 322) and 5L-3’ (SEQ ID NO 323).

EcoRI-end of the linker are ligated to EcoRI-end plasmids pMON26458. AflIII-end of the linker are ligated to the restriction site NcoI plasmid pMON32132: i.e. after ligation of the free sites of the restriction remains. Also are ligated sites BstXI restriction in the structure of the plasmid pMON26458 and pMON32132. Plasmid pMON28501 is the result of cloning and contains the DNA sequence (SEQ ID NO 4), which encodes amino acids 1-153 of the ligand of the C-mpl connected via a linker 4L GluPheGlyGlyAsnMet (SEQ ID NO 783) with codons of amino acids 1-153 of ligand c-rnpl (SEQ ID NO 470).

Example 7

Creating a dimer PCR-matrix 8L

PCR-matrix for the creation of new forms of the ligand of the C-mpl design by l the delegation fragment BstXI-EcoRI length 3700 nucleotides in pMON26458 with NcoI fragment-BstXI of pMON32134 (containing a deletion of amino acids 112-115) together with a synthetic oligonucleotide with EcoRI linkers-AflIII 8L-5’ (SEQ ID NO 324) and 8L-3’ (SEQ ID NO 325).

EcoRI-end of the linker are ligated to EcoRI-end plasmids pMON26458. AflIII-end of the linker are ligated to the restriction site NcoI plasmid pMON32132: i.e. after ligation of the free sites of the restriction remains. Also are ligated sites BstXI restriction in the structure of the plasmid pMON26458 and pMON32134. Plasmid pMON28502 is the result of cloning and contains the DNA sequence (SEQ ID NO 6), which encodes amino acids 1-153 of the ligand of the C-mpl connected via a linker 8L GluPheGlyGlyAsnGlyGlyAsnMetAla (SEQ ID NO 224) with codons of amino acids 1-153 of ligand c-rnpl (SEQ ID NO 471).

Examples 8-44

The creation of new genes ligands of C-mpl with new N-end and C-end

A. PCR-generating genes coding for new agonists of the receptor ligand of C-mpl

Genes encoding new agonists of the receptor ligand of C-mpl were created by using method III (Horlick et al., 1992, Protein Eng., 5, 427-433). PCR reaction was performed using a dimeric matrices (pMONs 28500, 28501, 28502 or 28548) and one of the sets of synthetic seeds below. (The first number indicates the position of the first amino acid in the source sequence. For example, 31-5’ and 31-3’ designates the 5’- and 3’-oligotherapy, respectively, for sequences starting with a codon encoding the 31st amino acid residue in the original sequence of the polypeptide).

31-5’ (SEQ ID NO 326) and 31-3’ (SEQ ID NO 327), 35-5’ (SEQ ID NO 328) and 35-3’ (SEQ ID NO 329), 39-5’ (SEQ ID NO 330) and 39-3’ (SEQ ID NO 331), 43-5 is (SEQ ID NO 332) and 43-3’ (SEQ ID NO 333), 45-5’ (SEQ ID NO 334) and 45-3’ (SEQ ID NO 335), 49-5’ (SEQ ID NO 336) and 49-3’ (SEQ ID NO 337), 82-5’ (SEQ ID NO 338) and 82-3’ (SEQ ID NO 339), 109-5’ (SEQ ID NO 340) and 109-3’ (SEQ ID NO 341), 115-5’ (SEQ ID NO 342) and 115-3’ (SEQ ID NO 343), 120-5’ (SEQ ID NO 344) and 120 will receive 3 entries’ (SEQ ID NO 345), 123-5’ (SEQ ID NO 346) and 123-3’ (SEQ ID NO 347), 126-5’ (SEQ ID NO 348) and 126-3’ (SEQ ID NO 349).

Matrices and sets of oligonucleotides used for PCR are shown in table 4. Products that are created, are characterized by a length of about 480 nucleotides: they were purified with the use of Magic sets PCR Clean-up Kit (Promega).

Century Subclavian products new gene agonists of the receptor C-mpl in expressing vector for mammalian cells to create chimeras

PCR products of the gene agonists of the receptor C-mpl were digested with restrictase NcoI and HindIII or AflIII and HindIII (length of about 470 nucleotides) to migrate in expressing vector for mammalian cells. Expressing the vector pMON30304 were digested with restrictase NcoI and HindIII (approximately 4200 nucleotides) was added to PCR products as fragments NcoI-HindIII or AflIII-HindIII. Parameters restrictions PCR products and the resulting plasmids are shown in table. 4.

Example 45

Design pMON15960

The constructed plasmid pMON15960, which is the intermediate plasmid used in the construction of plasmids comprising a DNA sequence encoding G-CSF with serine17with the new N-end and C-end. DNA plasmids rasus (Chang & Cohen, 1978, J. Bacteriol. 134, 1141-1156) was split restrictase HindIII and BaniHI: the result is a Hindlll, VMN-fragment length 3092 nucleotides. DNA plasmids pMON13037 (WO 95/21254) were digested with restrictase BglII and Fspl: the result is a BglII, Fspl-fragment length 616 nucleotides.

DNA in the second sample plasmids pMONl3037 were digested with restrictase NcoI and HindIII: the result is a NcoI,HindIII-fragment length 556 nucleotides. Synthetic DNA oligonucleotides 1GGGS (SEQ ID NO 380) (direct seed) and 1GGGS (SEQ ID NO 381) (inverse priming) were annealed to each other: then they were digested with restrictase AflIII and Fspl, which formed the Af1III, Fspl-fragment length of 21 nucleotides. Restriction fragments ligated, and the reaction mixture ligation was used to transform cells of E. coli K-12 strain JM101. Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA was isolated and analyzed using restricts to confirm the accuracy of the insert.

Example 46

Design pMON15981

Implemented design pMON15981 - plasmid comprising a DNA sequence encoding a multifunctional agonist hematopoietic receptors. DNA plasmids pMON15960 were digested with restriction enzyme Smal and used as template for PCR using synthetic DNA oligonucleotides 38 (SEQ ID NO 369) end of the seed) and 39 (SEQ ID NO 368) (initial seed), resulting amplificatoare DNA fragment length 576 nucleotides. Amplificatory fragment was digested with restrictase HindIII and NcoI, resulting formed HindIII, NcoI-fragment length 558 nucleotides. DNA plasmids pMON13181 were digested with restrictase HindIII and AflIII, which formed the Hindlll, AflIII fragment length 4068 nucleotides. Restriction fragments ligated, and the reaction mixture ligation was used to transform cells of E. coli K-12 strain JM101. Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA was isolated, analyzed using restricted and sequenced to confirm the accuracy of the insert. Plasmid pMON15981 includes the DNA sequence (SEQ ID NO 78), coding for the following amino acid sequence:

Example 47

Design pMON15982

Implemented design pMON15982 - plasmid comprising a DNA sequence encoding a multifunctional agonist hematopoietic receptors. DNA plasmids pMON15960 were digested with restriction enzyme Smal and used as template for PCR using synthetic DNA oligonucleotides 96 (SEQ ID NO 370) (leaf seed) and 97 (SEQ ID NO 370) (initial seed), resulting amplificatoare DNA fragment length 576 nucleotides. Amplificatory fragment Rasse the Lyali-restrictable HindIII and NcoI, as a result, were formed HindIII, NcoI-fragment length 558 nucleotides. DNA plasmids pMON13181 were digested with restrictase HindIII and AflIII, which formed the Hindlll, flIII-fragment length 4068 nucleotides. Restriction fragments ligated, and the reaction mixture ligation was used to transform cells of E. coli K-12 strain JM101. Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA was isolated, analyzed using restricted and sequenced to confirm the accuracy of the insert. Plasmid pMON15982 includes the DNA sequence (SEQ ID NO 79), coding for the following amino acid sequence:

Example 48

Design pMON15965

Implemented design pMON15965 - plasmid comprising a DNA sequence encoding a multifunctional agonist hematopoietic receptors. DNA plasmids pMON15960 were digested with restriction enzyme Smal and used as template for PCR using synthetic DNA oligonucleotides 142 (SEQ ID NO 377) (leaf seed) and 141 (SEQ ID NO 376) (initial seed), resulting amplificatoare DNA fragment length 576 nucleotides. Amplificatory fragment was digested with restrictase HindIII and NcoI, resulting formed indIII, NI-fragment length 558 nucleotides. DNA plasmids pMON13181 were digested what strictatime HindIII and AflIII, as a result, were formed iildIII, flIII-fragment length 4068 nucleotides. Restriction fragments ligated, and the reaction mixture ligation was used to transform cells of E. coli K-12 strain JM101. Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA was isolated, analyzed using restricted and sequenced to confirm the accuracy of the insert. Plasmid pMON15965 includes the DNA sequence (SEQ ID NO 80), coding for the following amino acid sequence:

Example 49

Design pMON15966

Implemented design pMON15966 - plasmid comprising a DNA sequence encoding a multifunctional agonist hematopoietic receptors. DNA plasmids pMON15960 were digested with restriction enzyme Smal and used as template for PCR using synthetic DNA oligonucleotides 126 (SEQ ID NO 372) (leaf seed) and 125 (SEQ ID NO 373) (initial seed), resulting amplificatoare DNA fragment length 576 nucleotides. Amplificatory fragment was digested with restrictase HindIII and NcoI, resulting formed indIII, NI-fragment length 558 nucleotides. DNA plasmids pMON13181 were digested with restrictase HindIII and AflIII, which formed the indIII, flIII-fragment length 4068 nucleotides. Restriction fragments of the League is ovali, and the reaction mixture ligation was used to transform cells of E. coli K-12 strain JM101.

Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA was isolated, analyzed using restricted and sequenced to confirm the accuracy of the insert. Plasmid pMON15966 includes the DNA sequence (SEQ ID NO 81), coding for the following amino acid sequence:

Example 50

Design pMON15967

Implemented design pMON15967 - plasmid comprising a DNA sequence encoding a multifunctional agonist hematopoietic receptors. DNA plasmids pMON15960 were digested with restriction enzyme SmaI and used as template for PCR using synthetic DNA oligonucleotides 132 (SEQ ID NO 375) (leaf seed) and 133 (SEQ ID NO 374) (initial seed), resulting amplificatoare DNA fragment length 576 nucleotides. Amplificatory fragment was digested with restrictase HindIII and NcoI, resulting formed HindIII, NcoI-fragment length 558 nucleotides. DNA plasmids pMON13181 were digested with restrictase HindIII and AflIII, which formed the Hindlll, AflIII fragment length 4068 nucleotides. Restriction fragments ligated, and the reaction mixture ligation was used to transform cells of E. coli K-12 strain JM101. Transform the level of bacteria were selected on the cups, containing ampicillin. Plasmid DNA was isolated, analyzed using restricted and sequenced to confirm the accuracy of the insert. Plasmid pMON15967 includes the DNA sequence (SQ ID NO 82), coding for the following amino acid sequence:

Example 51

Design pMON13180, which is the intermediate plasmid used to construct plasmids that comprise a DNA sequence encoding a multifunctional agonists hematopoietic receptors

DNA plasmids pMON13046 (WO 95/21254) were digested with restrictase XmaI and SnaBI, which formed the vector fragment length 4018 nucleotides. Vector XmaI,SnaBI fragment consisting of 4018 nucleotides were purified with a set of Magic DNA Clean-up Kit (Promega), resulting in a 25-nucleotide insertion XmaI, SnaBI fragment was not saved. A complementary pair of oligonucleotide seed glyxal (SEQ ID NO 378) and glyxa2 (SEQ ID NO 379) formed in such a way as to remove the sequence encoding the cleavage site of factor XA. When properly build these oligonucleotides also contribute to the appearance of the ends XmaI and SnaBI. Seed Glyxal and Glyxa2 annealed in a suitable buffer (20 mm Tris-HCl, pH=7,5, 10 mm MgCl2, 50 mm NaCl) by heating to 70°C for 10 minutes followed by slow cooling. XmaI-SnaBI fragment length 018 nucleotides from a plasmid pMON13046 ligated with linked oligonucleotides using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA was isolated from transformants and analyzed in the test based on PCR. Plasmid DNA from selected transformants sequenced to confirm the correct inserts oligonucleotides. The resulting plasmid was designated pMON13180 (SEQ ID NO 88).

Example 52

Design pMON13181, which is the intermediate plasmid used to construct plasmids that comprise a DNA sequence encoding a multifunctional agonists hematopoietic receptors

DNA plasmids pMON13047 (WO 95/21254) were digested with restrictase XmaI and SnaBI, which formed the vector fragment length 4063 nucleotides. Vector XmaI, SnaBI fragment consisting of 4063 nucleotides were purified with a set of Magic DNA Clean-up Kit (Promega), resulting in a 25-nucleotide insertion Xinal, SnaBI fragment was not saved. A complementary pair of oligonucleotide seed glyxal (SEQ ID NO 378) and glyxa2 (SEQ ID NO 379) formed in such a way as to remove the sequence encoding the cleavage site of factor XA. When properly build these oligonucleotides also contribute to the appearance of the ends XmaI and SnaBI. Seed Glyxal The Glyxa2 annealed in a suitable buffer (20 mm Tris-HCl, pH of 7.5, 10 mm MgCl2, 50 mm NaCl) by heating to 70°C for 10 minutes followed by slow cooling. XmaI-SnaBI fragment length 4063 nucleotides from a plasmid pMON13046 ligated with linked oligonucleotides using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA was isolated from transformants and analyzed in the test based on PCR. Plasmid DNA from selected transformants sequenced to confirm the correct inserts oligonucleotides. The resulting plasmid was designated pMON13181 (SEQ ID NO 87).

Example 53

Design pMON13182

Gene protein with new N-end/the end part plasmids pMON13182 was created using the method I described in "Materials and methods". Starting fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, which includes the initial 39 (SEQ ID NO 368) and the starting L-11 (SEQ ID NO 364). Terminal fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, including end 38 (SEQ ID NO 369) and the limit L-11 (SEQ ID NO 365). Panoram the RNA gene G-CSF Ser 17with the new N-end/With-end was created and amplified by annealing the start and end of fragments using seed starting 39 and the terminal 38.

The obtained DNA fragment, containing the new gene, was digested with restrictase NcoI and HindIII and purified using Magic DNA Clean-up Kit (Promega, Madison, WI). The intermediate plasmid pMON13180 were digested with restrictase HindIII and AflIII, resulting received vector fragment length 4023 nucleotides, which was purified using Magic DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and ligated using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DHSα (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA from selected transformants sequenced to confirm the correct inserts. The resulting plasmid was designated pMON13182.

Cells of E. coli strain JM101 transformed with plasmid pMON13182 to protein expression and allocation of the included cells.

Plasmid pMON13182 includes the DNA sequence (SEQ ID NO 17), encoding the following amino acid sequence:

Example 54

Design pMON13183

Gene protein with new N-end/With-end with the composition of plasmids pMON13183 was created by using method I, described in "Materials and methods". Starting fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, which includes the initial 39 (SEQ ID NO 368) and the starting L-11 (SEQ ID NO 364). Terminal fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, including end 38 (SEQ ID NO 369) and the limit L-11 (SEQ ID NO 365). Full gene G-CSF Ser17with the new N-end/With-end was created and amplified by annealing the start and end of fragments using seed starting 39 and the terminal 38.

The obtained DNA fragment, containing the new gene, was digested with restrictase NcoI and HindIII and purified using Magic DNA Clean-up Kit (Promega, Madison, WI). The intermediate plasmid pMONl3181 were digested with restrictase HindIII and AflIII, resulting received vector fragment length 4068 nucleotides, which was purified using Magic DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and ligated using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA from selected transformants sequ is coordinated in order to confirm the correctness of the inserts. The resulting plasmid was designated pMON13183.

Cells of E. coli strain JM101 transformed with plasmid pMON13183 to protein expression and allocation of the included cells.

Plasmid pMONl3183 includes the DNA sequence (SEQ ID NO 18), coding for the following amino acid sequence:

Example 55

Design pMONl3184

Gene protein with new N-end/the end part plasmids pMON13184 was created using the method I described in "Materials and methods". Starting fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, which includes the initial 97 (SEQ ID NO 370) and the starting L-11 (SEQ ID NO 364). Terminal fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, including end-96 (SEQ ID NO 371) and the limit L-11 (SEQ ID NO 365). Full gene G-CSF Ser17with the new N-end/With-end was created and amplified by annealing the start and end of fragments using seed starter 97 and the terminal 96.

The obtained DNA fragment, containing the new gene, was digested with restrictase NcoI and HindIII and purified using Magic DNA Clean-up Kit (Promega, Madison, WI). The intermediate plasmid pMON13180 were digested with restrictase HindIII and AflIII, consequently the those which received vector fragment length 4023 nucleotides, which was purified using Magic DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and ligated using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA from selected transformants sequenced to confirm the correct inserts. The resulting plasmid was designated pMON13184.

Cells of E. coli strain JM101 transformed with plasmid pMON13184 to protein expression and allocation of the included cells.

Plasmid pMON13184 includes the DNA sequence (SEQ ID NO 19), coding for the following amino acid sequence:

Example 56

Design pMON13185

Gene protein with new N-end/the end part plasmids pMON13185 was created using the method I described in "Materials and methods". Starting fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, which includes the initial 97 (SEQ ID NO 370) and the starting L-11 (SEQ ID NO 364). Terminal fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 using set is travok, including end 96 (SEQ ID NO 371) and the limit L-11 (SEQ ID NO 365). Full gene G-CSF Serl7with the new N-end/With-end was created and amplified by annealing the start and end of fragments using seed starter 97 and the terminal 96.

The obtained DNA fragment, containing the new gene, was digested with restrictase NcoI and HindIII and purified using Magic DNA Clean-up Kit (Promega, Madison, WI). The intermediate plasmid pMON13181 were digested with restrictase HindIII and AflIII, resulting received vector fragment length 4068 nucleotides, which was purified using Magic DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and ligated using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA from selected transformants sequenced to confirm the correct inserts. The resulting plasmid was designated pMON13185.

Cells of E. coli strain JM101 transformed with plasmid pMON13185 to protein expression and allocation of the included cells.

Plasmid pMON13185 includes the DNA sequence (SQ ID NO 20), coding for the following amino acid sequence:

/p>

Example 57

Design pMONl3186

Gene protein with new N-end/the end part plasmids pMON13186 was created using the method I described in "Materials and methods". Starting fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, which includes the initial 126 (SEQ ID NO 372) and the starting L-11 (SEQ ID NO 364). Terminal fragment was generated and amplified based on a sequence of G-CSF SER17included pMON13037 with a set of blades, including end 125 (SEQ ID NO 373) and the limit L-11 (SEQ ID NO 365). Full gene G-CSF Ser17with the new N-end/With-end was created and amplified by annealing the start and end of fragments using seed starting 126 and the terminal 125.

The obtained DNA fragment, containing the new gene, was digested with restrictase NcoI and HindIII and purified using Magic DNA Clean-up Kit (Promega, Madison, WI). The intermediate plasmid pMON13180 were digested with restrictase HindIII and AflIII, resulting received vector fragment length 4023 nucleotides, which was purified using Magic DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and ligated using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Lfe Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA from selected transformants sequenced to confirm the correct inserts. The resulting plasmid was designated pMON13186.

Cells of E. coli strain JM101 transformed with plasmid pMON13186 to protein expression and allocation of the included cells.

Plasmid pMON13186 includes the DNA sequence (SEQ ID NO 21), coding for the following amino acid sequence:

Example 58

Design pMON13187

Gene protein with new N-end/the end part plasmids pMON13187 was created using the method I described in "Materials and methods". Starting fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, which includes the initial 126 (SEQ ID NO 372) and the starting L-11 (SEQ ID NO 364). Terminal fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, including end 125 (SEQ ID NO 373) and the limit L-11 (SEQ ID NO 365). Full gene G-CSF Ser17with the new N-end/With-end was created and amplified by annealing the start and end of fragments using seed starting 126 and the terminal 125.

The resulting fragment D Is K, containing a new gene, was digested with restrictase NcoI and HindIII and purified using Magic DNA Clean-up Kit (Promega, Madison, WI). The intermediate plasmid pMON13181 were digested with restrictase HindIII and AflIII, resulting received vector fragment length 4068 nucleotides, which was purified using Magic DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and ligated using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA from selected transformants sequenced to confirm the correct inserts. The resulting plasmid was designated pMON13187.

Cells of E. coli strain JM101 transformed with plasmid pMON13187 to protein expression and allocation of the included cells.

Plasmid pMON13187 includes the DNA sequence (SEQ ID NO 22), coding for the following amino acid sequence:

Example 59

Design pMON13188

Gene protein with new M-the end/the end part plasmids pMON13188 was created using the method I described in "Materials and methods". Starting fragment was generated and amplified based on a sequence of G-CSF Ser17 included pMON13037 with a set of blades, which includes the initial 133 (SEQ ID NO 374) and the starting L-11 (SEQ ID NO 364). Terminal fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, including end-132 (SEQ ID NO 375) and the limit L-11 (SEQ ID NO 365). Full gene G-CSF Ser17with the new N-end/With-end was created and amplified by annealing the start and end of fragments using seed starting 133 and the terminal 132.

The obtained DNA fragment, containing the new gene, was digested with restrictase NcoI and HindIII and purified using Magic DNA Clean-up Kit (Promega, Madison, WI). The intermediate plasmid pMON13180 were digested with restrictase HindIII and AflIII, resulting received vector fragment length 4023 nucleotides, which was purified using mouse DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and ligated using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA from selected transformants sequenced to confirm the correct inserts. The resulting plasmid was designated pMON13188.

Cells of E. coli strain J101 transformed with plasmid pMON13188 to protein expression and allocation of the included cells.

Plasmid pMON13188 includes the DNA sequence (SEQ ID NO 23), coding for the following amino acid sequence:

Example 60

Design pMON13189

Gene protein with new N-end/the end part plasmids pMON13189 was created using the method I described in "Materials and methods". Starting fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, which includes the initial 133 (SEQ ID NO 374) and the starting L-11 (SEQ ID NO 364). Terminal fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, including end-132 (SEQ ID NO 375) and the limit L-11 (SEQ ID NO 365). Full gene G-CSF Ser17 with the new N-end/With-end was created and amplified by annealing the start and end of fragments using seed starting 133 and the terminal 132.

The obtained DNA fragment, containing the new gene, was digested with restrictase NcoI and HindIII and purified using Magic DNA Clean-up Kit (Promega, Madison, WI). The intermediate plasmid pMON13181 were digested with restrictase HindIII and AflIII, resulting received vector fragment length 4068 nucleotides, which was purified using Magic DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and luigirules using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA from selected transformants sequenced to confirm the correct inserts. The resulting plasmid was designated pMON13189.

Cells of E. coli strain JM101 transformed with plasmid pMON13189 to protein expression and allocation of the included cells.

Plasmid pMON13189 includes the DNA sequence (SEQ ID NO 24), coding for the following amino acid sequence:

Example 61

Design pMON13190

Gene protein with new N-end/the end part plasmids pMON13190 was created using the method I described in "Materials and methods". Starting fragment was created and amplificador based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, which includes the initial 142 (SEQ ID NO 376) and the starting L-11 (SEQ ID NO 364). Terminal fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, including end-141 (SEQ ID NO 377) and terminal L-11 (SEQ ID NO 365). Full gene G-CSF Ser17with the new N-end/With-end was created and amplified by oti the ha start and end of fragments using seed starting 142 and the terminal 141.

The obtained DNA fragment, containing the new gene, was digested with restrictase NcoI and HindIII and purified using Magic DNA Clean-up Kit (Promega, Madison, WI). The intermediate plasmid pMON13180 were digested with restrictase HindIII and AflIII, resulting received vector fragment length 4023 nucleotides, which was purified using Magic DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and ligated using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin.

Plasmid DNA from selected transformants sequenced to confirm the correct inserts. The resulting plasmid was designated pMON13190.

Cells of E. coli strain JM101 transformed with plasmid pMON13190 to protein expression and allocation of the included cells.

Plasmid pMON13190 includes the DNA sequence (SEQ ID NO 25), coding for the following amino acid sequence:

Example 62

Design pMON13191

Gene protein with new N-end/the end part plasmids pMON13191 was created using the method I described in "Materials and methods". Starting fragment was generated and amplified OS is ove sequence of G-CSF Ser 17included pMON13037 with a set of blades, which includes the initial 142 (SEQ ID NO 376) and the starting L-11 (SEQ ID NO 364). Terminal fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, including end-141 (SEQ ID NO 377) and terminal L-11 (SEQ ID NO 365). Full gene G-CSF Ser17with the new N-end/With-end was created and amplified by annealing the start and end of fragments using seed starting 142 and the terminal 141.

The obtained DNA fragment, containing the new gene, was digested with restrictase NcoI and HindIII and purified using Magic DNA Clean-up Kit (Promega, Madison, WI). The intermediate plasmid pMON13181 were digested with restrictase HindIII and AflIII, resulting received vector fragment length 4068 nucleotides, which was purified using Magic DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and ligated using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA from selected transformants sequenced to confirm the correct inserts. The resulting plasmid was designated pMON13191.

Cells of E. coli shtam is and JM101 transformed with plasmid pMON13191 to protein expression and allocation of the included cells.

Plasmid pMON13191 includes the DNA sequence (SEQ ID NO 26), coding for the following amino acid sequence:

Example 63

Design pMON13192

Gene protein with new N-end/the end part plasmids pMON13192 was created by using method II described in section "Materials and methods". Starting fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, which includes the initial 39 (SEQ ID NO 368) and the starting R-bl (SEQ ID NO 366). Terminal fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, including end 38 (SEQ ID NO 369) and leaf P-bl (SEQ ID NO 367). Starting fragment was digested with restriction enzyme NcoI, and terminal fragment by restriction enzyme HindIII. After cleaning the split start and end fragments were combined and ligated in the vector NcoI, HindIII-a fragment length of about 3800 nucleotides in the structure of the plasmid pMON3934.

The intermediate plasmid, described above, containing a full-sized gene G-CSF Ser17with the new N-end/end, were digested with restrictase NcoI and HindIII. Cleaved DNA was dissolved in 1%TAE gel, bromide stained with ethidium and a full-sized gene G-CSF Ser17with the new N-end/the end was isolated from ispolzovaniem Geneclean (Bio101, Vista, CA). The intermediate plasmid pMON13180 were digested with restrictase HindIII and AflIII, resulting received vector fragment length 4023 nucleotides, which was purified using Magic DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and ligated using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA from selected transformants sequenced to confirm the correct insertion of the new gene. The resulting plasmid was designated pMON13192.

Cells of E. coli strain JM101 transformed with plasmid pMONl3192 to protein expression and allocation of the included cells.

Plasmid pMONl3192 includes the DNA sequence (SEQ ID NO 27), coding for the following amino acid sequence:

Example 64

Design pMON13193

Gene protein with new N-end/the end part plasmids pMON13193 was created by using method II described in section "Materials and methods". Starting fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, which includes the initial 39 (SEQ ID NO 368) the starting R-bl (SEQ ID NO 366). Terminal fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, including end 38 (SEQ ID NO 369) and leaf P-bl (SEQ ID NO 367). Starting fragment was digested with restriction enzyme NcoI, and terminal fragment by restriction enzyme HindIII. After cleaning the split start and end fragments were combined and ligated in the vector NcoI, HindIII-a fragment length of about 3800 nucleotides in the structure of the plasmid pMON3934.

The intermediate plasmid, described above, containing a full-sized gene G-CSF Ser17with the new N-end/end, were digested with restrictase NcoI and HindIII. Cleaved DNA was dissolved in 1%TAE gel, bromide stained with ethidium and a full-sized gene G-CSF Ser17with the new N-end/the end was isolated using reagents Geneclean (Bio101, Vista, CA). The intermediate plasmid pMON13181 were digested with restrictase HindIII and AflIII, resulting received vector fragment length 4068 nucleotides, which was purified using Magic DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and ligated using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA is C selected transformants sequenced to confirm the correct insertion of the new gene. The resulting plasmid was designated pMON13193.

Cells of E. coli strain JM101 transformed with plasmid pMON13193 to protein expression and allocation of the included cells.

Plasmid pMON13193 includes the DNA sequence (SEQ ID NO 28), coding for the following amino acid sequence:

Example 65

Design pMON25190

Gene protein with new N-end/the end part plasmids pMON25190 was created by using method II described in section "Materials and methods". Starting fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, which includes the initial 97 (SEQ ID NO 370) and the starting R-bl (SEQ ID NO 366). Terminal fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, including end-96 (SEQ ID NO 371) and leaf P-bl (SEQ ID NO 367). Starting fragment was digested with restriction enzyme NcoI, and terminal fragment by restriction enzyme HindIII. After cleaning the split start and end fragments were combined and ligated in the vector NcoI, HindIII-a fragment length of about 3800 nucleotides in the structure of the plasmid pMON3934.

The intermediate plasmid, described above, containing a full-sized gene G-CSF Ser17with the new N-end/end, were digested by the restriction enzyme and NcoI and HindIII. Cleaved DNA was dissolved in 1%TAE gel, bromide stained with ethidium and a full-sized gene G-CSF Ser17with the new N-end/the end was isolated using reagents Geneclean (Bio101, Vista, CA). The intermediate plasmid pMON13180 were digested with restrictase HindIII and AflIII, resulting received vector fragment length 4023 nucleotides, which was purified using Magic DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and ligated using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA from selected transformants sequenced to confirm the correct insertion of the new gene. The resulting plasmid was designated pMON25190.

Cells of E. coli strain JM101 transformed with plasmid pMON25190 to protein expression and allocation of the included cells.

Plasmid pMON25190 includes the DNA sequence (SEQ ID NO 29), coding for the following amino acid sequence:

Example 66

Design pMON25191

Gene protein with new N-end/the end part plasmids pMON25191 was created by using method II described in section "Materials and Mody". Starting fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, which includes the initial 97 (SEQ ID NO 370) and the starting R-bl (SEQ ID NO 366). Terminal fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, including end-96 (SEQ ID NO 371) and leaf P-bl (SEQ ID NO 367). Starting fragment was digested with restriction enzyme NcoI, and terminal fragment by restriction enzyme HindIII. After cleaning the split start and end fragments were combined and ligated in the vector NcoI, HindIII-a fragment length of about 3800 nucleotides in the structure of the plasmid pMON3934.

The intermediate plasmid, described above, containing a full-sized gene G-CSF Ser17with the new N-end/end, were digested with restrictase NcoI and HindIII. Cleaved DNA was dissolved in 1%TAE gel, bromide stained with ethidium and a full-sized gene G-CSF Ser17with the new N-end/the end was isolated using reagents Geneclean (Bio101, Vista, CA). The intermediate plasmid pMON13181 were digested with restrictase HindIII and AflIII, resulting received vector fragment length 4068 nucleotides, which was purified using Magic DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and ligated using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). H is here ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA from selected transformants sequenced to confirm the correct insertion of the new gene. The resulting plasmid was designated pMON25191.

Cells of E. coli strain JM101 transformed with plasmid pMON25191 to protein expression and allocation of the included cells.

Plasmid pMON25191 includes the DNA sequence (SEQ ID NO 30), coding for the following amino acid sequence:

Example 67

Design pMON13194

Gene protein with new N-end/the end part plasmids pMON13194 was created by using method II described in section "Materials and methods". Starting fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, which includes the initial 126 (SEQ ID NO 372) and initial P-S (SEQ ID NO 366). Terminal fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, including end 125 (SEQ ID NO 373) and leaf P-bl (SEQ ID NO 367). Starting fragment was digested with restriction enzyme NcoI, and terminal fragment by restriction enzyme HindIII. After cleaning the split start and end fragments were combined and ligated in the vector coI, HindIII-a fragment length of about 3800 nucleotides in the structure of the plasmid pMON3934.

The intermediate plasmid, described above, containing a full-sized gene G-CSF Ser17with the new N-end/end, were digested with restrictase NcoI and HindIII. Cleaved DNA was dissolved in 1%TAE gel, bromide stained with ethidium and a full-sized gene G-CSF Ser17with the new N-end/the end was isolated using reagents Geneclean (Bio101, Vista, CA). The intermediate plasmid pMON13180 were digested with restrictase HindIII and AflIII, resulting received vector fragment length 4023 nucleotides, which was purified using Magic DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and ligated using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA from selected transformants sequenced to confirm the correct insertion of the new gene. The resulting plasmid was designated pMON13194.

Cells of E. coli strain JM101 transformed with plasmid pMON13194 to protein expression and allocation of the included cells.

Plasmid pMON13194 includes the DNA sequence (SEQ ID NO 31), coding for the following amino acid posledovatel the activity:

Example 68

Design pMON13195

Gene protein with new N-end/the end part plasmids pMON13195 was created by using method II described in section "Materials and methods". Starting fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, which includes the initial 126 (SEQ ID NO 372) and the starting P-bl (SEQ ID NO 366). Terminal fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, including end 125 (SEQ ID NO 373) and leaf P-bl (SEQ ID NO 367). Starting fragment was digested with restriction enzyme NcoI, and terminal fragment by restriction enzyme HindIII. After cleaning the split start and end fragments were combined and ligated in the vector NcoI, HindIII-a fragment length of about 3800 nucleotides in the structure of the plasmid pMON3934.

The intermediate plasmid, described above, containing a full-sized gene G-CSF Ser17with the new N-end/end, were digested with restrictase NcoI and HindIII. Cleaved DNA was dissolved in 1%TAE gel, bromide stained with ethidium and a full-sized gene G-CSF Ser17with the new N-end/the end was isolated using reagents Geneclean (Bio101, Vista, CA). The intermediate plasmid pMON13181 were digested with restrictase HindIII and AflIII, resulting in perfectly and the vector fragment length 4068 nucleotides, which was purified using Magic DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and ligated using DNA T4 ligase (Boehringer Manhleim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA from selected transformants sequenced to confirm the correct insertion of the new gene. The resulting plasmid was designated pMON13195.

Cells of E. coli strain JM101 transformed with plasmid pMON13195 to protein expression and allocation of the included cells.

Plasmid pMON13195 includes the DNA sequence (SEQ ID NO 32), coding for the following amino acid sequence:

Example 69

Design pMON13196

Gene protein with new N-end/the end part plasmids pMON13196 was created by using method II described in section "Materials and methods". Starting fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, which includes the initial 133 (SEQ ID NO 374) and the starting R-bl (SEQ ID NO 366). Terminal fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 used with the set of blades, including end-132 (SEQ ID NO 375) and leaf P-bl (SEQ ID NO 367). Starting fragment was digested with restriction enzyme NcoI, and terminal fragment by restriction enzyme HindIII. After cleaning the split start and end fragments were combined and ligated in the vector NcoI, HindiII-a fragment length of about 3800 nucleotides in the structure of the plasmid pMON3934.

The intermediate plasmid, described above, containing a full-sized gene G-CSF Ser17with the new N-end/end, were digested with restrictase NcoI and HindIII. Cleaved DNA was dissolved in 1%TAE gel, bromide stained with ethidium and a full-sized gene G-CSF Ser17with the new N-end/the end was isolated using reagents Geneclean (Bio101, Vista, CA). The intermediate plasmid pMON13180 were digested with restrictase HindIII and AflIII, resulting received vector fragment length 4023 nucleotides, which was purified using Magic DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and ligated using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA from selected transformants sequenced to confirm the correct insertion of the new gene. The resulting plasmid on which nacili pMON13196.

Cells of E. coli strain JM101 transformed with plasmid pMON13196 to protein expression and allocation of the included cells.

Plasmid pMON13196 includes the DNA sequence (SEQ ID NO 33), coding for the following amino acid sequence:

Example 70

Design pMON13197

Gene protein with new N-end/the end part plasmids pMON13197 was created by using method II described in section "Materials and methods". Starting fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, which includes the initial 133 (SEQ ID NO 374) and the starting P-bl (SEQ ID NO 366). Terminal fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, including end-132 (SEQ ID NO 375) and leaf P-bl (SEQ ID NO 367). Starting fragment was digested with restriction enzyme NcoI, and terminal fragment by restriction enzyme HindIII. After cleaning the split start and end fragments were combined and ligated in the vector NcoI, HindiII-a fragment length of about 3800 nucleotides in the structure of the plasmid pMON3934.

The intermediate plasmid, described above, containing a full-sized gene G-CSF Ser17with the new N-end/end, were digested with restrictase NcoI and HindIII. Cleaved DNA was dissolved in 1%galatae, was bromide stained with ethidium and a full-sized gene G-CSF Ser17with the new N-end/the end was isolated using reagents Geneclean (Bio101, Vista, CA). The intermediate plasmid pMON13181 were digested with restrictase HindIII and AflIII, resulting received vector fragment length 4068 nucleotides, which was purified using Magic DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and ligated using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA from selected transformants sequenced to confirm the correct insertion of the new gene. The resulting plasmid was designated pMON13197.

Cells of E. coli strain JM101 transformed with plasmid pMON13197 to protein expression and allocation of the included cells.

Plasmid pMON13197 includes the DNA sequence (SEQ ID NO 34), coding for the following amino acid sequence:

Example 71

Design pMON13198

Gene protein with new N-end/the end part plasmids pMON13198 was created by using method II described in section "Materials and methods". Starting fragment was created and ampli is econovan based on a sequence of G-CSF Ser 17included pMON13037 with a set of blades, which includes the initial 142 (SEQ ID NO 376) and the starting R-bl (SEQ ID NO 366). Terminal fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, including end-141 (SEQ ID NO 377) and leaf P-bl (SEQ ID NO 367). Starting fragment was digested with restriction enzyme NcoI, and terminal fragment by restriction enzyme HindIII. After cleaning the split start and end fragments were combined and ligated in the vector NI, indiII-fragment length of about 3800 nucleotides in the structure of the plasmid pMON3934.

The intermediate plasmid, described above, containing a full-sized gene G-CSF Ser17with the new N-end/end, were digested with restrictase NcoI and HindIII. Cleaved DNA was dissolved in 1%TAE gel, bromide stained with ethidium and a full-sized gene G-CSF Ser17with the new N-end/the end was isolated using reagents Geneclean (Bio101, Vista, CA). The intermediate plasmid pMON13180 were digested with restrictase HindIII and AflIII, resulting received vector fragment length 4023 nucleotides, which was purified using Magic DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and ligated using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used for transformation of E.coli cells shtam is and DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA from selected transformants sequenced to confirm the correct insertion of the new gene. The resulting plasmid was designated pMON13198.

Cells of E. coli strain JM101 transformed with plasmid pMON13198 to protein expression and allocation of the included cells.

Plasmid pMON13198 includes the DNA sequence (SEQ ID NO 35), coding for the following amino acid sequence:

Example 72

Design pMON13199

Gene protein with new N-end/the end part plasmids pMON13199 was created by using method II described in section "Materials and methods". Starting fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, which includes the initial 142 (SEQ ID NO 376) and the starting R-bl (SEQ ID NO 366). Terminal fragment was generated and amplified based on a sequence of G-CSF Ser17included pMON13037 with a set of blades, including end-141 (SEQ ID NO 377) and leaf P-bl (SEQ ID NO 367). Starting fragment was digested with restriction enzyme NcoI, and terminal fragment by restriction enzyme HindIII. After cleaning the split start and end fragments were combined and ligated in the vector NoI, HindiII-a fragment length of about 3800 nucleotides in the structure of the plasmid pMON3934.

The intermediate plasmid, described above, containing a full-sized gene G-CSF Ser17with the new N-end/end, were digested with restrictase NcoI and HindIII. Cleaved DNA was dissolved in 1%TAE gel, bromide stained with ethidium and a full-sized gene G-CSF Ser17with the new N-end/the end was isolated using reagents Geneclean (Bio101, Vista, CA). The intermediate plasmid pMONl3181 were digested with restrictase HindIII and AflIII, resulting received vector fragment length 4068 nucleotides, which was purified using Magic DNA Clean-up Kit (Promega, Madison, WI). Purified restriction fragments were combined and ligated using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA from selected transformants sequenced to confirm the correct insertion of the new gene. The resulting plasmid was designated pMON13199.

Cells of E. coli strain JM101 transformed with plasmid pMON13199 to protein expression and allocation of the included cells.

Plasmid pMON13199 includes the DNA sequence (SEQ ID NO 36), coding for the following amino acid posledovatel the activity:

Example 73

The design of tandemly duplicated plasmid matrix Syntanl

To create a tandemly duplicated matrix pMON13416 agonist receptor hIL-3 - Syntanl three DNA connected with each other by ligation using DNA ligase 4 (Boehringer Mannheim). These three DNA are as follows: 1) pMON13046, including plasmid agonist receptor hIL-3 pMON13416, split restrictase BstEII and SnaBI; 2) held annealing pair of complementary oligonucleotides is the starting seed L1syn (SEQ ID NO 352) and leaf seed L1syn (SEQ ID NO 353), which contain a sequence encoding a linker that provides contact-end and N-end of the original polypeptide and small areas surrounding sequences of the composition pMON13416, which, if accurate Assembly lead all BstEII and Clal; and 3) part plasmids pMON13416 agonist receptor hIL-3, derived from pMON13046 using restricted Clal (DNA were grown in a dam-cells: DM1 (Life Technologies)and SnaBI. Cleaved DNA was dissolved in 0.9%TAE gel, bromide stained with ethidium and were isolated using reagents Geneclean (Bio101).

Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Minipreparation DNA was isolated from transformants and transformants were skanirovali in the test based on PCR. Plasmid DNA from selected t is ansformation sequenced to obtain the correct matrix. The resulting plasmid was designated syntanl: it included a DNA sequence according to SEQ ID NO 7.

Example 74

The design of tandemly duplicated matrix syntan3

To create a tandemly duplicated matrix pMON13416 agonist receptor hIL-3 - Syntan3 three DNA connected with each other by ligation using DNA T4 ligase (Boehringer Mannheim). These three DNA are as follows: 1) pMON13046, including plasmid agonist receptor hIL-3 pMON13416, split restrictase BstEII and SnaBI; 2) held annealing pair of complementary oligonucleotides is the starting seed L3syn (SEQ ID NO 354) and leaf seed L3syn (SEQ ID NO 355), which contain a sequence encoding a linker that provides contact-end and N-end of the original polypeptide and small areas surrounding sequences of the composition pMON13416, which, if accurate Assembly lead all BstEII and SnaBI; and 3) part plasmids pMON13416 agonist receptor hIL-3, derived from pMON13046 using restricted Clal (DNA were grown in a dam-cells: DM1 (Life Technologies)and SnaBI. Cleaved DNA was dissolved in 0.9%TAE gel, bromide stained with ethidium and were isolated using reagents Geneclean (Bio101).

Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Minipreparation DNA was isolated from transformants and transformants were skanirovali in the natural-based PCR. Plasmid DNA from selected transformants sequenced to obtain the correct matrix. The resulting plasmid was designated syntan3: it included a DNA sequence according to SEQ ID NO 8.

Example 75

Design pMON31104

Gene protein with new N-end/the end of the plasmids pMON31104 created by using method III described above in the section "Materials and methods". Full gene agonist receptor hIL-3 with the new N-end/the end part pMONl3416 was created and amplified from the intermediate plasmid Syntanl using nucleating direct 35 (SEQ ID NO 356) 34 and reverse (SEQ ID NO 357).

The resulting DNA fragment containing the new gene, was digested with restrictase NcoI and SnaBI. Split the DNA fragment was dissolved in 1%TAE gel, bromide stained with ethidium and were isolated using reagents Geneclean (Bio101, Vista, CA). Purified cleaved DNA fragment ligated into the composition expressing vector pMON13189 using DNA ligase 4 (Boehringer Mannheim, Indianapolis, IN). DNA plasmids pMON13189 was pre-digested with restrictase NcoI and SnaBI to remove the coding sequence of the receptor agonist hIL-3 pMON13416: using reagents Geneclean (Bio101, Vista, CA) allocated vector fragment length 4254 nucleotides after the pickup 0.8%TAE gel and bromide staining by ethidium. Part of the reaction mixture of Ligero is of transformed cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA was isolated and sequenced to confirm the accuracy of the insert. The resulting plasmid was designated pMON31104.

Cells of E. coli strain JM101 transformed with plasmid pMON31104 to protein expression and allocation of the included cells.

Plasmid pMON31104 contains the DNA sequence (SEQ ID NO 9), which encodes the following amino acid sequence:

Example 76

Design pMON31105

Gene protein with new N-end/the end of the plasmids pMON31105 created by using method III described above in the section "Materials and methods". Full gene agonist receptor hIL-3 with the new N-end/the end part pMON13416 was created and amplified from the intermediate plasmid Syntanl using direct seed 70 (SEQ ID NO 358) and reverse 69 (SEQ ID NO 359).

The resulting DNA fragment containing the new gene, was digested with restrictase NcoI and SnaBI. Split the DNA fragment was dissolved in 1%TAE gel, bromide stained with ethidium and were isolated using reagents Geneclean (Bio101, Vista, CA). Purified cleaved DNA fragment ligated into the composition expressing vector pMON13189 using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). DNA plasmids pMON13189 pre Ross plale restrictase NcoI and SnaBI to remove the coding sequence of the receptor agonist hIL-3 pMON13416: using reagents Geneclean (Bio101, Vista, CA) allocated vector fragment length 4254 nucleotides after the pickup 0.8%TAE gel and bromide staining by ethidium. Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA was isolated and sequenced to confirm the accuracy of the insert. The resulting plasmid was designated pMON31105.

Cells of E. coli strain JM101 transformed with plasmid pMON31105 to protein expression and allocation of the included cells.

Plasmid pMON31105 contains the DNA sequence (SEQ ID NO 10), which encodes the following amino acid sequence:

Example 77

Design pMON31106

Gene protein with new N-end/the end of the plasmids pMON31106 created by using method III described above in the section "Materials and methods". Full gene agonist receptor hIL-3 with the new N-end/the end part pMON13416 was created and amplified from the intermediate plasmid Syntanl using nucleating direct 91 (SEQ ID NO 360) and reverse 90 (SEQ ID NO 361).

The resulting DNA fragment containing the new gene, was digested with restrictase NcoI and SnaBI. Split the DNA fragment was dissolved in 1%TAE gel, bromide stained with ethidium and allocated using the reaction is ivov Geneclean (Bio101, Vista, CA). Purified cleaved DNA fragment ligated into the composition expressing vector pMON13189 using DNA ligase 4 (Boehringer Mannheim, Indianapolis, IN). DNA plasmids pMONl3189 was pre-digested with restrictase NcoI and SnaBI to remove the coding sequence of the receptor agonist hIL-3 pMON13416: using reagents Geneclean (Bio101, Vista, CA) allocated vector fragment length 4254 nucleotides after the pickup 0.8%TAE gel and bromide staining by ethidium. Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA was isolated and sequenced to confirm the accuracy of the insert. The resulting plasmid was designated pMON31106.

Cells of E. coli strain JM101 transformed with plasmid pMON31106 to protein expression and allocation of the included cells.

Plasmid pMON31106 contains the DNA sequence (SEQ ID NO 11), which encodes the following amino acid sequence:

Example 78

Design pMON31107

Gene protein with new N-end/the end of the plasmids pMON31107 created by using method III described above in the section "Materials and methods". Full gene agonist receptor hIL-3 with the new N-end/With-end with the cave pMON13416 was created and amplified from the intermediate plasmid Syntanl using direct seed 101 (SEQ ID NO 362) and reverse 100 (SEQ ID NO 363).

The resulting DNA fragment containing the new gene, was digested with restrictase NcoI and SnaBI. Split the DNA fragment was dissolved in 1%TAE gel, bromide stained with ethidium and were isolated using reagents Geneclean (Bio101, Vista, CA). Purified cleaved DNA fragment ligated into the composition expressing vector pMON13189 using DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). DNA plasmids pMON13189 was pre-digested with restrictase NcoI and SnaBI to remove the coding sequence of the receptor agonist hIL-3 pMON-13416: using reagents Geneclean (Bio101, Vista, CA) allocated vector fragment length 4254 nucleotides after the pickup 0.8%TAE gel and bromide staining by ethidium. Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA was isolated and sequenced to confirm the accuracy of the insert. The resulting plasmid was designated pMON31107.

Cells of E. coli strain JM101 transformed with plasmid pMON31107 to protein expression and allocation of the included cells.

Plasmid pMON31107 contains the DNA sequence (SEQ ID NO 12), which encodes the following amino acid sequence:

Example 79

Designed and what their pMON31108

Gene protein with new N-end/the end of the plasmids pMON31108 created by using method III described above in the section "Materials and methods". Full gene agonist receptor hIL-3 with the new N-end/the end part pMON13416 was created and amplified from the intermediate plasmid Syntan3 using nucleating direct 35 (SEQ ID NO 356) 34 and reverse (SEQ ID NO 357).

The resulting DNA fragment containing the new gene, was digested with restrictase NcoI and SnaBI. Split the DNA fragment was dissolved in 1%TAE gel, bromide stained with ethidium and were isolated using reagents Geneclean (Bio101, Vista, CA). Purified cleaved DNA fragment ligated into the composition expressing vector pMON13189 using DNA ligase 4 (Boehringer Mannheim, Indianapolis, IN). DNA plasmids pMON13189 was pre-digested with restrictase NcoI and SnaBI to remove the coding sequence of the receptor agonist hIL-3 pMON13416: using reagents Geneclean (Bio101, Vista, CA) allocated vector fragment length 4254 nucleotides after the pickup 0.8%TAE gel and bromide staining by ethidium. Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA was isolated and sequenced to confirm the accuracy of the insert. Obtained is the result of a plasmid identified pMON31108.

Cells of E. coli strain JM101 transformed with plasmid pMON31108 to protein expression and allocation of the included cells.

Plasmid pMON31108 contains the DNA sequence (SEQ ID NO 13), which encodes the following amino acid sequence:

Example 80

Design pMON31109

Gene protein with new N-end/the end of the plasmids pMON31109 created by using method III described above in the section "Materials and methods". Full gene agonist receptor hIL-3 with the new N-end/the end part pMON13416 was created and amplified from the intermediate plasmid Syntan3 using direct seed 70 (SEQ ID NO 358) and reverse 69 (SEQ ID NO 359).

The resulting DNA fragment containing the new gene, was digested with restrictase NcoI and SnaBI. Split the DNA fragment was dissolved in 1%TAE gel, bromide stained with ethidium and were isolated using reagents Geneclean (Bio101, Vista, CA). Purified cleaved DNA fragment ligated into the composition expressing vector pMON13189 using DNA T4 ligase (Boehringer Meppem, Indianapolis, IN). DNA plasmids pMON13189 was pre-digested with restrictase NcoI and SnaBI to remove the coding sequence of the receptor agonist hIL-3 pMON13416: using reagents Geneclean (Bio101, Vista, CA) allocated vector fragment length 4254 nucleotides after RA the race 0.8%TAE gel and bromide staining by ethidium. Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA was isolated and sequenced to confirm the accuracy of the insert. The resulting plasmid was designated pMON31109.

Cells of E. coli strain JM101 transformed with plasmid pMON31109 to protein expression and allocation of the included cells.

Plasmid pMON31109 contains the DNA sequence (SEQ ID NO 14), which encodes the following amino acid sequence:

Example 81

Design pMON31110

Gene protein with new N-end/the end of the plasmids pMON31110 created by using method III described above in the section "Materials and methods". Full gene agonist receptor hIL-3 with the new N-end/the end part pMON13416 was created and amplified from the intermediate plasmid Syntan3 using nucleating direct 91 (SEQ ID NO 360) and reverse 90 (SEQ ID NO 361).

The resulting DNA fragment containing the new gene, was digested with restrictase NcoI and SnaBI. Split the DNA fragment was dissolved in 1%TAE gel, bromide stained with ethidium and were isolated using reagents Geneclean (Bio101, Vista, CA). Purified cleaved DNA fragment ligated into the composition expressing vector pMON13189 with use the of DNA T4 ligase (Boehringer Mannheim, Indianapolis, IN). DNA plasmids pMON13189 was pre-digested with restrictase NcoI and SnaBI to remove the coding sequence of the receptor agonist hIL-3 pMON13416: using reagents Geneclean (Bio101, Vista, CA) allocated vector fragment length 4254 nucleotides after the pickup 0.8%TAE gel and bromide staining by ethidium. Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA was isolated and sequenced to confirm the accuracy of the insert. The resulting plasmid was designated pMON31110.

Cells of E. coli strain JM101 transformed with plasmid pMON31110 to protein expression and allocation of the included cells.

Plasmid pMON31110 contains the DNA sequence (SEQ ID NO 15), which encodes the following amino acid sequence:

Example 82

Design pMON31111

Gene protein with new N-end/the end of the plasmids pMON31111 created by using method III described above in the section "Materials and methods". Full gene agonist receptor hIL-3 with the new N-end/the end part pMON13416 was created and amplified from the intermediate plasmid SyntanS using direct seed 101 (SEQ ID NO 362) and reverse 100 (SEQ ID NO 363).

The resulting DNA fragment containing the new gene, was digested with restrictase NcoI and SnaBI. Split the DNA fragment was dissolved in 1%TAE gel, bromide stained with ethidium and were isolated using reagents Geneclean (Bio101, Vista, CA). Purified cleaved DNA fragment ligated into the composition expressing vector pMONl3189 using DNA ligase 4 (Boehringer Mannheim, Indianapolis, IN). DNA plasmids pMONl3189 was pre-digested with restrictase NcoI and SnaBI to remove the coding sequence of the receptor agonist hIL-3 pMON13416: using reagents Geneclean (Bio101, Vista, CA) allocated vector fragment length 4254 nucleotides after the pickup 0.8%TAE gel and bromide staining by ethidium. Part of the ligation reaction mixture was used to transform cells of E. coli strain DH5α (Life Technologies, Gaithersburg, MD). Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA was isolated and sequenced to confirm the accuracy of the insert. The resulting plasmid was designated pMON31111.

Cells of E. coli strain JM101 transformed with plasmid pMON31111 to protein expression and allocation of the included cells.

Plasmid pMON31111 contains the DNA sequence (SEQ ID NO 16), which encodes the following amino acid sequence:

Example 83

Designed the e pMON31112

Implemented design pMON31112 - plasmid containing a DNA sequence encoding a multifunctional agonist hematopoietic receptors, which activates the receptor hIL-3 receptor G-CSF. DNA plasmids pMON13189 were digested with restrictase NcoI and XmaI, the result of which was separated and purified by 0.8%agarose gel NcoI vector, -XmaI fragment. The second DNA plasmid - pMON13222 (WO 94/12639, U.S. patent 08/411796) was digested with restrictase NcoI and EcoRI, resulting in NIl,EcoRI-fragment length 281 nucleotide. This fragment was isolated and purified in 1.0%agarose gel. Two of the oligonucleotide - SYNNOXA1.REQ (SEQ ID NO 350) and SYNNOXA2.REQ (SEQ ID NO 351) were annealed to each other and ligated with a 281-BP DNA fragment from a plasmid pMON13222 on a vector fragment of plasmid pMON13189. Part of the ligation reaction mixture is then used to transform cells of E. coli K-12 strain JM101. Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA was isolated and subjected to restriction analysis to establish the presence of the EcoRI-fragment and sequenced to confirm the accuracy of the insert.

Plasmid pMON31112 contains the DNA sequence (SEQ ID NO 37), coding for the following amino acid sequence:

Example 84

Design pMON31113

Implemented design pMON31113 - PL is smidi, containing a DNA sequence encoding a multifunctional agonist hematopoietic receptors, which activates the receptor hIL-3 receptor-SF. plasmids pMON13197 were digested with restrictase NcoI and XmaI, the result of which was separated and purified by 0.8%agarose gel NcoI vector, -XmaI fragment. The second DNA plasmid - pMON13239 (WO 94/12639, U.S. patent 08/411796) was digested with restrictase NcoI and EcoRI, resulting NcoI, EcoRI-fragment length 281 nucleotide. This fragment was isolated and purified in 1.0%agarose gel. Two of the oligonucleotide - SYNNOXA1.REQ (SEQ ID NO 350) and SYNNOXA2.REQ (SEQ ID NO 351) were annealed to each other and ligated with a 281-BP DNA fragment from a plasmid pMON13239 on a vector fragment of plasmid pMON13197. Part of the ligation reaction mixture is then used to transform cells of E. coli K-12 strain JM101. Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA was isolated and subjected to restriction analysis to establish the presence of the EcoRI-fragment and sequenced to confirm the accuracy of the insert.

Plasmid pMON31113 contains the DNA sequence (SEQ ID NO 38), coding for the following amino acid sequence:

Example 85

Design pMON3114

Implemented design pMON31114 - plasmid containing the DNA sequence, Cody the existing multi-agonist hematopoietic receptors, which activates the receptor hIL-3 receptor, G-CSF,DNA plasmids pMON13189 were digested with restrictase NcoI and XmaI, the result of which was separated and purified by 0.8%agarose gel NcoI vector, -XmaI fragment. The second DNA plasmid - pMON13239 (WO 94/12639, U.S. patent 08/411796) was digested with restrictase NcoI and EcoRI, resulting NcoI,EcoRI-fragment length 281 nucleotide. This fragment was isolated and purified in 1.0%agarose gel. Two of the oligonucleotide - SYNNOXA1.REQ (SEQ NO. 350) and SYNNOXA2.REQ (SEQ ID NO 351) were annealed to each other and ligated with a 281-BP DNA fragment from a plasmid pMON13239 on a vector fragment of plasmid pMON13189. Part of the ligation reaction mixture is then used to transform cells of E. coli K-12 strain JM101. Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA was isolated and subjected to restriction analysis to establish the presence of the EcoRI-fragment and sequenced to confirm the accuracy of the insert.

Plasmid pMON31114 contains the DNA sequence (SEQ ID NO 39), coding for the following amino acid sequence:

Example 86

Design pMON31115

Implemented design pMON31115 - plasmid containing a DNA sequence encoding a multifunctional agonist hematopoietic receptors, which activates the receptor hIL-3 receptor GCSF. plasmids pMON13197 were digested with restrictase NcoI and XmaI, in the result of which was separated and purified by 0.8%agarose gel NcoI vector, -XmaI fragment. The second DNA plasmid - pMON13222 was digested with restrictase NcoI and EcoRI, resulting NcoI, EcoRI-fragment length 281 nucleotide. This fragment was isolated and purified in 1.0%agarose gel. Two of the oligonucleotide - SYNNOXA1.REQ (SEQ ID NO 350) and SYNNOXA2.REQ (SEQ ID NO 351) were annealed to each other and ligated with a 281-BP DNA fragment from a plasmid pMONl3222 on a vector fragment of plasmid pMON13197. Part of the ligation reaction mixture is then used to transform cells of E. coli K-12 strain JM101. Transformed bacteria were selected on plates containing ampicillin. Plasmid DNA was isolated were subjected to restriction analysis to establish the presence of the EcoRI-fragment and sequenced to confirm the accuracy of the insert.

Plasmid pMON31115 contains the DNA sequence (SEQ ID NO 40), coding for the following amino acid sequence:

Example 87

Determination of in vitro activity of multifunctional proteins agonists hematopoietic receptors

The concentration of the multifunctional protein agonist hematopoietic receptors can be determined using the method of TYPHOID sandwich on the affinity purified polyclonal antibodies. On the other hand, the protein concentration can be defined is Elena analysis of amino acid composition. The biological activity of multifunctional agonist hematopoietic receptor can be determined in a number of in vitro tests. For example, a multi-agonist hematopoietic receptor, which binds to the receptor hIL-3 receptor G-CSF can be tested in tests on cell proliferation using cell lines expressing the receptors hIL-3 and (or) G-CSF. One such test is the test on cell proliferation of AML-193. Cells AML-193 respond to IL-3 and G-CSF, which allows to determine the biological activity of multifunctional agonist hematopoietic receptors IL-3/G-CSF. Another such test is the test on the proliferation of TF1 cells.

Other factor-dependent cell lines, such as M-NFS-60 (ATCC CRL-1838) or 32D, which lines are dependent on IL-3 mouse cells, can be used. The activity of IL-3 is species-specific, while the activity of G-CSF is not: accordingly, the biological activity of a component of G-CSF in the multifunctional agonist hematopoietic receptors IL-3/G-CSF can be determined independently. Cell lines, such as KSS or Baf/3 mouse that does not Express the receptors for these ligands can be transliterowany a plasmid containing the gene of the desired receptor. An example of such a line is a cell line BaF3, transferir the bathroom receptor hG-CSF (BaF3/hG-CSF). The multifunctional activity of agonist hematopoietic receptors in these cell lines can be used for comparison with the hIL-3 or G-CSF alone or together. The biological activity of examples of multi-functional agonists of hematopoietic receptors of the present invention, as measured by cell proliferation in BaF3/hG-CSF and proliferation of TF1 cells, shown in the table. 5 and table. 6. The biological activity of multifunctional agonist hematopoietic receptors are expressed as relative activity compared with standard protein pMON13056 (WO 95/21254), which shows binding activity of the receptor of IL-3 and G-CSF. The biological activity of examples of multi-functional agonists of hematopoietic receptors of the present invention, as measured by cell proliferation in BaF3/c-mpl and proliferation of TF1 cells, shown in table 7 and table 8.

In the same way other factor-dependent cell line, known to specialists in this field of technology can be used to measure the biological activity of the desired multi-functional agonist of hematopoietic receptors. Methylcellulose test can be used to determine the effect of multi-functional agonists of hematopoietic receptors on the expansion of progenitor cells of the blood and the settings of various types hemopet the economic colonies in vitro. Methylcellulose test may allow to estimate the number of predecessors by the fact that it is possible to measure the number of share predecessors per 100 thousand of tested cells. Long-term, dependent stromal cultures are used to distinguish primitive precursor cells hematopoiesis and stem cells. This test can be used to determine, does multifunctional agonist hematopoietic receptors expansion of very primitive progenitor cells and / or stem cells. In addition can be supplied culture with ohranenim dilution, which will allow us to determine the number of primitive precursor cells, stimulated multifunctional agonist hematopoietic receptors.

Table 5

Activity dual agonists of the receptors IL-3/G-CSF by induction of cell proliferation
pMONRelative activity* in the test on the proliferation of cells with receptors F3/hG-CSFRelative activity* in the test on the proliferation of TF1 cells
131820,0151,1
131830,02n/o
131840,010,3
131850,023 0,36
131860,360,45
131870,070,26
131880,641,3
131890,581,37
131900,0451,2
131910,142,7
131920,092,2
131930,063,0
25190n/on/o
251910,431,2
13194n/on/o
131951,34,3
131960,660,5
131970,60.77
131980,60,5
13199n/on/o
159820,71,9
159810,0681,2
159650,70,82
159660,361,48
159670,621,37
n/d - not determined

* biological activity of the multi-functional agonist of hematopoietic receptors are expressed as relative activity compared to the standard be the ku pMON13056: n=3 or more
Table 6

Activity dual agonists of the receptors IL-3/G-CSF by induction of cell proliferation
pMONRelative activity* in the test on the proliferation of cells with receptors BaF3/hG-CSFRelative activity* in the test on the proliferation of TF1 cells
31104++
31105++
31106++
31107n/an/a
31108++
31109++
31110n/an/a
31111n/an/a
31112++
31113++
31114++
31115++
31116n/an/a
31117n/an/a
n/d - not determined

* biological activity (n=1 or 2) multi-functional agonist of hematopoietic receptors are expressed as relative activity compared to standard protein pMON 13056

"+" indicates that the molecule is comparable to pMON13056
Table 7

The activity of cell proliferation
pMONActivity* in the test on the proliferation of cells with receptors BaF3/c-mplActivity** in the test on the proliferation of TF1 cells
28505-+
28506-+
28507-+
28508-+
28509-+
28510-+
28511++
28512++
28513++
28514++
28519-+
28520-+
28521-+
28522-+
28523-+
28524-+
28525++
28526++
28533-+
28534-+
28535-+
28536-+
28537-+
28538-+
28539++
28540++
28541++
28542++
28543++
28544++
28545++
* activity was measured in cell line Baf3, transfected with the receptor C-mpl in relation to the ligand of the C-mpl (1-153)

** activity was measured in relation to pMON13056

Table 8
pMONThe activity of the agonist IL-3 (test for cell proliferation AML)The activity of the agonist receptor C-mpl (test on the proliferation of Baf3 cells/c-mpl)
28505+-
28506+-
28507+-
28508+-
28509+-
28510+-
28511++
28512++
28513 ++
28514++
28515++
28519+-
28520+-
28521+-
28522+-
28523+-
28524+-
28525++
28526++
28527++
28528++
28529++
28535+-
28539++
28540++
28541++
28542++
28545++
28551++
28571++

Example 88

Variants of G-CSF, which contain single or multiple amino acid substitutions were generated using methods PCR mutagenesis, as described in patents WO 94/12639 and WO 94/12638. These and other options (i.e. conditioned and inoculate substitutions, insertions or deletions and extensions of the N - or C-end) can also be formed, as is known in the art, with the use of other methods, including the Assembly of synthetic genes or directed mutagenesis (see Taylor et al., 1985, Nucl. Acids Res., 13, 7684-8785; Kunkel et al., 1985, Proc. Natl. Acad. Sci. USA, 82, 488-492; Sambrook et al., 1989, "Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Lab. Press, Cold Spring Harbor, NY; the patents WO 94/12639 and WO 94/12638). These replacements can be carried out singly or in combination with other amino acid substitutions and / or deletions and / or insertions and / or with the movements of the ends. After verification of the sequence variation of plasmid DNA can be transliterowany in suitable mammalian cells, insect cells or bacterial strains, such as production strains of E. coli Known variants of G-CSF, which are active include substitutions in positions 1 (threonine to serine, arginine, or glycine), 2 (Proline to leucine), 3 (leucine for arginine or serine) and 17 (cysteine to serine) and deletions of amino acids 1-11 (Kuga et al., 1989, Biochem. Biophys. Res. Commun., 159, 103-111). These variants of G-CSF with amino acid substitutions can be used as matrices to create agonists of the receptors, G-CSF, which creates a new N-end and new-end. Examples of variants of G-CSF with amino acid substitutions shown in table. 9.

Table 9
The position of the amino acids in the polypeptideThe native amino acidMutant amino acidActivity*
13PheSer+
13PheHis+
13PheThr+
13PhePro+
16LysPro+
16LysSer+
16LysThr+
16LysHis+
18LeuPro+
18LeuThr+
18LeuHis+
18LeuCys+
18LeuHe+
19GluAla-
19GluThr-
19GluArg-
19GluPro-
19GluLeu-
19GluSer-
22ArgTyr+
22ArgSer+
22ArgAla+
22ArgThr+
24IlPro+
24IlLeu+
24IlTight+
27AspGly+
30AlaIl+
30AlaLeu+
34LysSer+
43HisGly+
43HisThr+
43HisVal+
Table 9 (continued)
43HisLys+
43HisTrp+
43HisAla+
43HisArg+
43HisCys+
43HisLeu+
44ProArg+
44ProAsp+
44ProVal+
44ProAla+
44ProHis+
44ProGln+
44ProTrp+
44ProGly+
44ProThr+
46GluAla+
46GluArg+
47LeuThr+
49LeuPhe+
49LeuArg+
49LeuSer+
50LeuHis+
54LeuHis+
67GlnLys+
67GlnLeu+
67GlnCys
70GlnPro+
70GlnLeu+
70GlnArg+
70GlnSer+
104AspGly+
104AspVal+
108LeuAla+
108LeuVal+
108LeuArg+
108LeuGly+
Table 9 (continued)
108LeuTrp+
108LeuGln+
115ThrHis4-
115ThrLeu+
115ThrAla+
144PheHis+
144PheArg+
144PhePro+
144PheLeu+
144Phe Glu+
146ArgGln+
147ArgGln+
156HisAsp-
156HisSer+
156HisGly+
159SerArg+
159SerThr+
159SerTyr+
159SerVal+
159SerGly+
162GluGly-
162GluTrp+
162GluLeu+
163ValArg+
163ValAla+
163ValGly+
165TightCysn/a
169SerLeu+
169SerCys+
169SerArg+
170HisArg+
170HisSer+
* activity relative to the native hG-CSF

n/d - not determined

Example 89

Determination of biological activity of the variants of G-CSF with amino acid substitutions

Variants of G-CSF having the amino acid replacement can be tested for activity by induction of cell proliferation using cell line Baf/3, transtitional receptor G-CSF person. The biological activity of examples of variants of G-CSF with amino acid substitutions shown in table. 9 in comparison with the activity of native G-CSF person. The sign "+" denotes an activity comparable with the activity of native factor, and the sign "-" indicates a significantly reduced or no measurable activity.

Example 90

The allocation of a cDNA that encodes a ligand flt3

Three clone ligand flts were amplified from polyadenylated RNA cells of human bone marrow using PCR-nucleating NCOFLT, HIND160 and HIND165 (in accordance with the conditions provided by the manufacturers), These amplificatoare PCR products were gel purified and cloned in KSS-expressing vector pMON5723, thereby creating plasmid pMON30237 (NCOFLT + HIND160), pMON30238 (NCOFLT + HIND165) and deletion clone pMON30239 (NCOFLT + HIND165). The deletion of part of the pMON 30239 corresponds to the loss of amino acids 89-106.

Example 91

Agonists of the receptor flt3 with modified sequences were designed using a range of techniques and linker types. The first set of structures that includes the linker peptides (SerGlyGlyAsnGly)x(where x=1, 2, or 3), with breaks 39/40, 65/66 and 89/90 were created using a two-step PCR occurs Mullins et al.: in them, the front half and the rear half of each final sequence rebuilt molecules were created separately in the first stage PCR, and then pairwise products of the first reaction were combined in the second stage PCR and extended in the absence of exogenous nucleating. For example, six of the original PCR products were generated with the aim of creating three precursor molecules to break 89/90 - used amino acid linkers SerGlyGlyAsnGly (SEQ ID NO 786), SerGlyGlyAsnGlySerGlyGlyAsnGly (SEQ ID NO 787) and SerGlyGlyAsnGlySerGlyGlyAsnGlySerglyglyasngly (SEQ ID NO 788) (respectively, pMON32326, pMON32327 and pMON32328). The following pairs of blades were used in the first stage PCR reaction: (a) 89For/L5B; (b) 89For/L10B; (C) 89For/L15B; (d) 89Rev/L5A; (e) 89Rev/L10A; (f) 89Rev/L15A. A similar approach was used for the formation of precursors pMON32321 (point break 39/40, a pair of blades 39For/L108 and 39Rev/L10A) and pMON32325 (point break 65/66, a pair of blades 65For/LSB and 65Rev/LSA). With the exceptions noted above, all subsequent PCR reactions used the components of the PCR Optimizer Kit (Invitrogen), and the conditions of amplification taking is whether taking into account the manufacturer's recommended procedures. The reactions were as follows: combined 50 RMB each seed, 10 ál of 5x buffer [300 mm Tris-Hcl (pH of 8.5), 10 mm MgCl275 mm (NH4)2SO4], 5 units of Taq polymerase and 100 ng heated denatured DNA template (in this sample pMON30238) and then brought to a final volume of 45 μl by adding distilled water. The reaction mixture was preincubated at 80°C for 1-5 minutes, then added to 5 μl of 10 mm dNTP into each reaction mixture and held denaturation by heating to 94°C for 2 minutes before the subsequent amplification in the device Model 480 (Perkin-Elmer). Seven cycles of DNA amplification was carried out under the following conditions: denaturation by heating to 94°C for 1 minute, annealing at 65°C for 2 min, extension at 72°C for 3 minutes. Twenty-three additional cycle was performed according to the scheme - denaturation by heating to 94°C for 1 minute, annealing/extension at 72°C for 4 minutes followed final extension cycle at 72°C for 7 minutes. Except plasmids pMON32328, the products of PCR amplification were dispersed in 1.2%agarose TAE gel, and the appropriate size of the zone of amplification (i.e. the main amplication product) was cut out and purified using reagents Geneclean II (Bio101). Samples were resuspendable in 10 μl of distilled water. Products is amplificatio pMON32328 was purified directly using reagents Wizard PCR Clean-up Kit (Promega), and DNA was suirable in 50 ál of distilled water.

Method of constructing predecessors pMON32322 (point break 39/40, a pair of blades 39For/L5B and 39Rev/L5A) modified by increasing the number of the matrix to 1 μg and change the conditions of PCR amplification as follows: six cycles at 94°C for 1 min, at 65°C for 2 minutes and at 72°C for 2.5 minutes, followed by 15 cycles at 94°C for 1 min, at 70°C for 2 minutes and at 72°C for 2 minutes and only the final cycle of extension at 72°C for 7 minutes.

In the second stage PCR used purified in the gel precursor obtained in the first stage PCR in combination seed/matrix" in the following mix: 5 μl of each molecule of the predecessor (i.e. the PCR products nucleating 89For/L5B and 89Rev/L5A for pMON32328), 10 ál of 5x buffer, 5 units of Taq polymerase and 24 μl of distilled water. The reaction mixture was heated up to 80°C for 5 minutes, thereto was added 5 μl of 10 mm dNTP and the reaction mixture was denaturiruet by heating to 94°C for 2 minutes.

Conditions for DNA amplification were as follows: 15 cycles at 94°C for 1 minute, at 69°C for 2 minutes followed outfitting cycle at 72°C for 3 minutes. In order to achieve full completion of the last complete cycle single phase at 72°is within 7 minutes. The time of incubation at 80°reduced to 2 minutes and the number of cycles was reduced to 10 for plasmids pMON32325 (PCR-products of pairs of blades 65For/L5B and 65Rev/L5A). The products of PCR reactions with the appropriate size were purified 1.2%agarose TAE gel using reagents Geneclean II. In the case of plasmid pMON32322 (pair nucleating 39For/LSB and 39Rev/L5A) the annealing temperature was lowered to 68°and the time of completion was reduced to 2 minutes. In addition, the PCR product was purified using reagents Wizard OCR Clean-up Kit (Promega) according to the manufacturer's recommendations. The second stage PCR with plasmid pMON32326 (PCR-products of pairs of blades 89For/L15B and 89Rev/L15A) modified as follows. Three sets of reaction mixtures for PCR were also built, as described above, except select the type of buffer (5x buffer either, or D, or J: reagent PCR Optimizer Kit). Composition of buffers D and J is different from the buffer only In pH or content MgCl2. The concentration of magnesium chloride in the buffer D is 3.5 mm, and in buffer J - 9.5 mm. The procedure was modified by increasing the number of PCR cycles when that 20 - and 15-ál aliquots were collected at the end of the 10-th, 15-th and 2-th cycles. 5 ál of each aliquot was used for analysis of the presence of the amplified material 1.2%agarose TAE gel. The remains of the PCR reaction mixtures in buffer b, D and J are maintained and consistently eyes is Ali using reagents Wizard ORSK Clean-up Kit. DNA was suirable in 50 ál of distilled water.

The cleaned samples from the reaction mixture in the second stage PCR were digested with restrictase NcoI/HindIII using one of two standard variants of splitting. For the samples treated in Geneclean II, 10 ál of DNA was digested in a 20 µl reaction mixture at a 7.5% each restricts NcoI/HindIII for 2 hours at 37°and gel purified 1.1%agarose gel in TAE again in Geneclean II. Ready to legirovanie samples were resuspendable in 10 μl of distilled water. In the case of plasmids pMON32322 20 μl of sample was digested in 50 μl of reaction mixture with 20 units each of restricts NcoI and HindIII for 3 hours at 37°C. thereafter was added 0.1 volume of 3 M NaOAc (pH of 5.5) and 2.5 volumes of ethanol, stirred and kept overnight at - 20°C. DNA was recovered by pelletierine for 20 minutes on microcentrifuge Sigma Mk-202 at 13,000 rpm at 4°C. the DNA Pellets were washed in chilled 70% ethyl alcohol, liofilizirovanny and resuspendable in 10 μl of distilled water.

Example 92

An alternative approach was used to construct plasmids pMON32320 (point break 39/40, a linker of 15 amino acids), pMON32323 (point break 65/66, a linker of 15 amino acids) and pMON32324 (point break 65/66, the linker of 10 amino acids). New seed (L15, L15D, L15E) were designed to include the site R is stricly BamHI in the seed, appropriate site within the coding that will be cloned in the BamHI site and to maintain the proper coding frame. Conditions of the first stage PCR were chosen identical to those which were described for pMON32322, except that there were used the following pairs of blades: 65For/Ll5D and 65Rev/L15E (pMON32324), 39For/L15D and 39Rev/L15C (pMON32320) and 65For/Ll5D and 65Rev/L15C (pMON32323). PCR products were purified using reagents Wizard PCR Clean-up Kit, as described above, and suirable in 50 ál of distilled water. Samples were digested with restrictase NcoI/BamHI (39For/L15D and 65For/L15D) or BamHI/HindIII (39Rev/L15C, 65Rev/L15C and 65Rev/L15E). Restrictase cleavage was carried out as follows: 10 ál of purified PCR product, 3 μl of 10x universal restriction buffer, 15 units of either NcoI or HindIII, 15 units of BamHI at the final volume of the reaction mixture, 30 μl. The reaction mixture was incubated at 37°C for 90 minutes, and PCR products were purified 1.1%agarose TAE gel using Geneclean II. Ready to legirovanie DNA was reasponsible in 10 μl of distilled water.

Insert ligated in the treated NcoI/HindIII plasmid pMON3977 (expressing vector to cells KSS mammals), which was treated with alkaline phosphatase shrimp (SAP) when a three-way handshake (pMON32320, pMON32323 and pMON32324) or two-stage (pMON32321, pMON32322, pMON32325, pMON32326, pMON32327 and pMON32328) reaction ligating the following education is: 2,5 ál insert (2 µl of each seed amplificada for pMON32320, pMON32323 and pMON32324) was added to 50 ng of vector in a 10 µl reaction mixture at standard conditions of ligation. 2 ml of each reaction mixture was used to transform 100 μl of chemically competent DH5 cellsα (Gibco/BRL) according to the manufacturer's recommendations. Aliquots of 25 ál and 200 ál were sown on plates of LB containing 50 µg/ml ampicillin, and incubated overnight. Selected colonies were removed and DNA was prepared from 50 ml of "trouble" cultures using Qiagen kits DNA midiprep. Kolichestvennyi DNA analysis was performed on the parameters of the absorption at a/A and checked the accuracy of the size of the insert DNA using agarose gel electrophoresis with subsequent cleavage of 1 µg matrix restrictase NcoI/HindIII. Samples, including inserts of the predicted size, is sequenced in both directions using vector-specific nucleating on automated fluorescent DNA sequencer model A (Perkin-Elmer ABI). The sequencing reaction was performed in 20 µl volume of reaction mixture using thermal cycler model 480 (Perkin-Elmer) as follows: 1 μg of the matrix, 3,2 PKM seed, 1 μl DMSO, and 9.5 μl of Taq-termination of dideoxy-mix (Perkin-Elmer ABI) were mixed and subjected to 25 cycles Sequeira amplification as follows: 30 seconds at 94°, 15 seconds annealing at 50°and 4 minutes outfitting cycle is ri 60° C. the Samples were purified on columns message-Sep spin (Princeton Separations) in accordance with the recommended procedures, then liofilizirovanny and subjected to sequencing. The samples, including the predicted amino acid sequences were selected for analysis and designations under the series numbers pMON.

Example 93

A similar approach in designing pMON32320, pMON32323 and pMON32324 used to embed the linker a different type (SerGlyGlySerGly)xwhere x=2 or 3, in the composition of the two sequences with the rebuilt structure, including point break 39/40 (pMON32348 and pMON32350). A pair of blades were as follows: the combination 339For2/339Rev3 and 339Rev2/339-10For3 for pMON32348 and 339For2/339Rev3 and 339Rev2/339-15For3 for pMON32350 were used to create three products PCR amplification. Each reaction of PCR amplification were built in the following way: 50 RMB each pair of blades, 10 ál of 5x buffer, 5 units of Taq polymerase, and distilled water was added to 100 ng of denatured by heating pMON32320 to a final volume of 45 μl. The reaction mixture was plaincourault, as described above. Fifteen cycles of amplification were carried out as follows: denaturation by heating at 94°C for 1 minute, annealing at 70°C for 2 minutes and extension at 72°C for 3 minutes. Upon completion of the last cycle was performed only cycle completion. at 72°C for 7 minutes. The products of PCR and is plification pairs nucleating 339For/339Rev3, 339Rev2/339-10For3 and 339Rev2/339-15For2 was purified using reagents Wizard PCR Clean-up Kit (Promega) and was suirable in 50 ál of distilled water. Splitting restrictase NcoI/BamHI paired nucleating 339For2/339Rev3 was carried out as follows: 8 μl of DNA template was mixed with 2 ml of a universal restriction buffer and 10 units of NcoI and BamHI in 20 μl of reaction mixture and incubated at 37°C for 90 minutes. The cleavage products were purified using Geneclean II according to the original procedure, and ready to legirovanie DNA was reasponsible in 10 μl of distilled water. Restriction cleavage and subsequent purification of amplification products in pairs nucleating 339Rev2/339-10For2 and 339Rev2/339-15For2 was carried out similarly as described for amplificada 339For2/339Rev3, except that he used 10 units of HindIII instead NcoI. The standard way ligation was applied by adding 50 ng of the treated NcoI/HindIII/SAP treated in the gel pMON3977 0,5 ál amplificada 339For2/Rev3, 1 ál of either amplificada 339Rev2/339-10For3 (pMON32348)or amplificada 339Rev2/339-15For3 (pMON32350), 5 units of DNA T4 ligase and 1 μl of 10x ligase buffer in a 10-µl reaction volume for 60 minutes at ordinary temperature. The next steps needed to confirm the results obtained in the DNA sequences was performed as described above.

Example 94

The linker of the third type with varying repetitive motive the (GlyGlyGlySer) xincorporated in another set of agonists of the receptor flt3 rebuilt with a sequence derived from the matrices constructed in a modular type. The length of these linkers is as follows: the linker of 6 amino acids (GlyGlyGlySerGlyGly, SEQ ID NO 792), the linker from 7 amino acids (GlyGlyGlySerGlyGlyGly, SEQ ID NO 793), a linker of 10 amino acids (GlyGlyGlySerGlyGlyGlySerGlyGly, SEQ ID NO 794), the linker of the 13 amino acids (GlyGlyGlySerGlyGlyGlySerGlyGlyGlysergly, SEQ ID NO 795), a linker of 15 amino acids (GlyGlyGlySer GlyGlyGlySerGlyGlyGlySerGlyGlyGly, SEQ ID NO 796) and the linker of the 21 amino acids (GlyGlyGlySerGlyGlyGlySerGlyGlyGlyserglygly GlySerGlyGlyGlySerGly, SEQ ID NO 797). These modular matrix, each of which includes a dimer ligands hflt3 separated VMN-containing linker unique length, designed in the following way. Six intermediate plasmid matrices (FL3N, FL7N, FL11N, FL3C, FL4C and FL10C) were generated by PCR using pairs of blades and pMON30238 as a matrix with parameters PCR cycles, which have been applied for pMON32322. For the reaction of 50 RMB each seed was added to 100 ng of denatured by heating the matrix, and the reaction mixture was as described above for pMON32322. The PCR conditions were as follows: 7 cycles at 94°C for 1 minute, 2 minutes at 65°and 2.5 minutes at 72°C, followed by 10 cycles of 1 minute at 94°C, 2 min at 70°and 2.5 minutes at 72°C. a Single 7-minute cycle of extension at 72°completed the CR. Pair of seed used to create each of the intermediate matrices were as follows: N-term/FLN3 (FL3N), N-term/FLN7 (FL7N), N-term/FLN11 (FL11N), C-term/FLC3 (FL3C), C-term/FLC4 (FL4C) and C-term/FLC10 (FL10C). The products of PCR amplification were purified using reagents Wizard PCR Clean-up Kit (Promega) and was suirable in 50 ál of distilled water. Purified DNA for the first set (FL3N, FL7N and FL11N) were digested with restrictase NcoI/BamHI, gel purified, as described above, and ligated in the treated NcoI/BamHI/Sap vector pSE420 (Invitrogen). The intermediate matrix of the second set (FL3C, FL4C and FL10C) was created the same way, except restrictee HindIII instead NcoI. Next steps to confirm the target DNA sequence was performed as described above.

Example 95

To obtain the final six matrices two sets of intermediates in S420 uncoupled or restrictable NcoI/BamHI (FL3N, FL7N, FL11N - set 1)or restrictable BamHI/HindIII (FL3C, FL4C, FL10C - set 2) and gel purified using Geneclean II, as described above. One intermediate amplifier from each set ligated in the treated NcoI/HindIII/Sap plasmid pMON3977 for each PCR reaction and transformed into DH5 cellsαas described above, using the following combinations to form specific dimensions of linkers: the linker of 6 amino acids (FL3N and FL3C), the linker from 7 linakis is from (FL3N and FL4C), the linker of 10 amino acids (FL7N and FL3C), the linker of the 13 amino acids (FL3N and FL10C), a linker of 15 amino acids (FL11N and NS) and the linker of the 21 amino acids (FL11N and FL10C). DNA was isolated from single colonies 50-ml "trouble" cultures for each of the 6 combinations as described above, were tested for the correct size insert by restriction analysis NcoI/HindIII and used as a matrix. A pair of blades 39For/39Rev (point break 39/40, 65For/65Rev (point break 65/66) and 89For/89Rev (point break 89/90) was used for PCR amplification of each matrix, as was described above for pMON32322, except that used by 75 RMB each seed. The amplification conditions were modified as follows: 6 cycles at 94°C for 1 minute, 2 minutes at 70°C, 2.5 min at 72°C, followed by 9 cycles at 94°C for 1 minute and 72°C for 3 minutes. After the last cycle, a final completion anticipated was carried out at 72°C for 6 minutes, which ensured complete polymerization of the products. Samples were purified using the Wizard PCR Clean-up Kit (Promega), as described above, and subjected to double decomposition restrictase NcoI/HindIII. The resulting products amplificatoare again purified using the Wizard PCR Clean-up Kit. In addition, all six molecules with different lengths of linker for break point 39/40 were Clonie is owani in the treated NcoI/HindIII/Sap plasmid pMON3977 genes as separate proteins (pMON32365, pMON32366, pMON32367, pMON32368, pMON32369 and pMON32370). Next steps to confirm the target DNA sequence was performed as described above.

Example 96

Were designed genes encoding molecules multifunctional chimeric receptor agonists, including agonist of the receptor of IL-3 (pMON13416; WO 94/12638)connected via a linker IgG2b or native flt3 ligand or agonist of the receptor flt3 with a modified sequence (according to the examples 91-93). Insert that includes the desired molecule agonists of the receptor flt3 with a modified sequence, was isolated from the original plasmid in the form of a restriction fragment NcoI/Hindiii and ligated into plasmid pMON30304, split AflIII/Hindlll/SAP. Next steps to confirm the target DNA sequence was performed as described above. In table 10 shows the resulting plasmid, comprising the DNA sequence encoding the molecule multifunctional chimeric receptor agonists, including agonist of the receptor of IL-3 (pMON13416) and agonist receptor flt3 with a different order (see tab. 10).

Table 10
The resulting plasmidPermutation predecessors ligand hft13
pMON30247pMON30237
pMN30248 pMON30238
pMON32332pMON32321
pMON32333pMON32320
pMON32334pMON32325
pMON32335pMON32324
pMON32336pMON32323
pMON32337pMON32328
pMON32338pMON32327
pMON32339pMON32326

Example 97

Were designed genes encoding molecules multifunctional chimeric receptor agonists, including agonist of the receptor of IL-3 (pMON13288; WO 94/12638)connected via a linker IgG2b or native flt3 ligand or agonist of the receptor flt3 with a modified sequence (according to the examples 91-93). Insert that includes the desired molecule agonists of the receptor flt3 with a modified sequence, was isolated from the original plasmid in the form of a restriction fragment NcoI/HindIII and ligated into plasmid RMO, split AflIII/Hindlll/SAP. Next steps to confirm the target DNA sequence was performed as described above. In table. 11 shows the resulting plasmid, comprising the DNA sequence encoding the molecule multifunctional chimeric, including agonist of the receptor of IL-3 (pMON13288) and agonist receptor flt3 with a modified sequence.

Table 11
The resulting plasmidThe precursor ligand ft13
pMON32364pMON30237
pMON32377pMON30238
pMON32352pMON32321
pMON32353pMON32320
pMON32354pMON32325
pMON32355pMON32324
pMON32356pMON32323
pMON32357pMON32328
pMON32358pMON32327
pMON32359pMON32326
pMON32360pMON32348
pMON32362pMON32350
pMON32396pMON30239

Example 98

Two chimeric molecules with the receptor agonist hflt3 rebuilt with the sequence from N-Terminus of the chimeric molecules were constructed by PCR using the plasmid pMON32360 and pMON32362 as matrices and pairs of blades N-term/134rev and N-term/139rev to replace the stop codon in the C-end of the molecule native flt3 ligand and make the coding frame of the SnaBI restriction site. The reaction mixture formed as described above for pMON32322. The PCR conditions were as follows: 7 cycles at 94°C for 1 min, at 65°C for 2 minutes and at 72°C for 2.5 minutes, an additional 10 cycles of amplification were performed so that the temperature of annealing of them was increased from 65° With up to 70°C. the Samples were purified using the Wizard PCR Purification Kit and were suirable 50 ál of the distillated water: 20 µl of each sample were digested with restrictase NcoI and SnaBI. DNA plasmids pMON26431 were digested with restrictase NcoI and SnaBI and ligated using a PCR reaction mixture treated with NcoI/SnaBI. Transformation of competent cells DH5α and next steps to confirm the target DNA sequence was carried out as described above.

Example 99

Five additional points gaps in the ligand hflt3 were made with the use of certain nucleating 28/29 (28For/28Rev), 34/35 (34For/35Rev), 62/63 (62For/62Rev), 94/95 (94For/94Rev) and 98/99 (98For/98Rev) with amplification linkers (GlyGlyGlySer)xconsisting of 10 and 15 amino acids, as described above. The resulting PCR products were digested with restrictase NcoI/HindIII and ligated into plasmid pMON30311 treated with AflII/Hindlll/SAP, as described above. Transformation of competent cells DH5α and next steps to confirm the target DNA sequence was carried out as described above.

Example 100

To increase expression of receptor agonists hflt3 with rebuilt sequence in E.coli cells were used for specific N-end of the priming encoding degenerate codons, to reorganize forms 1-134 and 1-139 native ligand hflt3 in the composition Express youseo in E.coli vector pMON5723. A pair of blades FH3AFor/SCF.rev (AA) and Flt23For/SCF (Gly2) was used for PCR amplification of the N-terminal degenerate mixture of sequences encoding native flt3 ligand using amplification conditions which have been described for pMON23222, except that the number of cycles of amplification reduced to 15 cycles at 95°C for 1 minute, at 55°C for 2 minutes and at 72°C for 2.5 minutes. Amplificare was purified using Wizard RFE Clean-up Kit (Promega) and was suirable in 50 ál of distilled water. Splitting restrictase NcoI/-HindIII and subsequent gel purification using Geneclean II were carried out as described above. Insert ligated in the treated NcoI/HindIII/SAP, gel purified plasmid DNA pMON5723, which transformed competent cells DH5αas described previously. Aliquots of the transformed cells were sown on plates with agarose LB medium containing 75 μg/ml spectinomycin and incubated at 37°C for 14-16 hours, and then counted the number of colonies. After confirmation of colonies remains of each transformation mixture was incubated overnight (14-16 hours) at 37°With 2x5 ml of LB medium containing 75 μg/ml spectinomycin. Minipreparation DNA was prepared using reagents Wizard 373 DNA And Miniprep Kit (Promega) according to the recommended procedure. Cleaned miniprep-DNA elwira the Ali in 50 µl of distilled water and 1-2 μl was used to transform chemically competent cells MON207. Aliquots of 25 and 200 µl were sown in plates with LB medium containing 75 μg/ml spectinomycin and incubated at 37°C for 12-15 hours. 40-50 well-separated colonies representing each original pair of blades that were selected were outlined on the main L/spectinomycin cups and incubated for 4-6 hours at 37°C.

Clones of certain agonists of the receptors hflt3 with reconstructed sequences were skanirovali by expression in E.coli cells in 96-ACANA microtiter device to select superior levels of expression. 100 μl of minimal medium M9 (including 1% free amino acids) was injected into each cell along with a single colony (40-50 isolates were analyzed for each pair of blades in PCR hflt3), incubated at 37°C at 200 rpm for 3-4 hours (1=0) and induced by the addition in each cell 5 µl of freshly prepared solution of 1 mg/ml nalidixic acid (0.1 N NaOH). After an additional 4 hours of incubation at 37° (1=4) approximate aliquots of 5-10 µl were taken from each cell and analyzed on a light microscope for the presence of refracting light Taurus, and the results were defined as the approximate percentage of cells containing refracting light calf in relation to the total number of cells. Clones, characterized by the highest levels of expression were selected for analysis of the scale of expression levels, conducted according to the following scheme. 5 ml of "trouble" cultures were grown in LB medium in the presence of 75 μg/ml spectinomycin at 37°C. the Inoculum satisfactory cultured cells were added to 10 ml of freshly prepared minimal medium M9 (with the addition of 1% of free amino acids) in 125-ml flasks-shakers in order to achieve the original value of 20 units by Klett: then incubation was performed at 37°for about 3-4 hours with shaking until reaching levels approximately 110-150 units by Klett (I=0) with subsequent induction of 50 ál of freshly prepared solution nalidixic acid (10 mg/ml in 0.1 N NaOH). Aliquot 1 ml was removed and cells were palletizable within 1 minute on microcentrifuge. The supernatant fraction was removed by aspiration and the pellets were kept at - 20°until tender analysis in SDS-PAGE (polyacrylamide gel electrophoresis with nitrilotriacetate). The remains of the induced cells were incubated for 4 hours at 37°With constant agitation, then (the time frame I=4) the density of cells was measured in units of the Klett. Aliquot 1 ml was extracted from each sample was palletizable by centrifugation and preserved as described above. Other aliquots of 5-10 μl was extracted from each flask and analyzed on a light microscope for the presence rotten is the shining light of Taurus. Pelletierine samples were resuspendable in volume (in ál) 2x boot buffer (containing 1% β-mercaptoethanol), equal to the index of the Klett while I=4, boiled for 5 minutes and 6-7 ál was transferred to a 12%or 14%Tris-glycine SDS-polyacrylamide gel (Novex) and subjected to electrophoresis for 90 minutes at a voltage of 90 C. the Gels were fixed, stained and analyzed by drying in accordance with the recommended (Novex) procedure. At this stage, the selected clones to scale with the increased level of expression of the individual induced protein band which porgramme at the moment I=4 corresponded to the predicted size in comparison with the samples at time I=0.

Minipreparation DNA was also obtained from selected clones expressing high levels of induced protein, as described previously, and check the resulting DNA sequences were carried out exactly as described above. These clones were designated pMON32329, pMON32330, pMON32341 and pMON32342.

Example 101

A set of chimeric molecules multifunctional receptor agonists, including agonist of the receptor of IL-3 (from pMON13288) and native flt3 ligand, was also constructed for expression in E.coli cells. The genes encoding the chimeric molecule is a multifunctional receptor agonists of pMON32364 and pMON32377, were isolated from the source, etc) the RA splitting restrictase NcoI/HindIII and legirovanyh in vector pMON5677, by which transformed cells MON207, and individual isolates were selected as described above. These constructs were designated pMON32394 (insert originating from pMON32364) and pMON32395 (insert originating from pMON32377).

Example 102

Shortened the flt3 receptor was isolated in the form of PCR product length 1400 nucleotides using 50 RMB nucleating FLTAFLS1 and FLTR1N and approximately 10 ng of plasmid DNA pMON27184 used as matrix. Seed were thus formed to form the AflIII restriction site immediately 5’-end of the first aspartic codon sequence that encodes a Mature polypeptide, as well as the restriction site EcoRI immediately with 5’-end sequence that encodes a transmembrane segment. The reaction mixture was treated with restrictase AflIII and EcoRI in the standard reaction conditions and ligation was carried out in split NcoI/EcoRI plasmid pMON26458. This plasmid includes the following DNA sequence: 5’-GGATCCACCATGAGCCGCCTGCCCGTCCTGCTCCTGCTC CAACTCCTGGTCCGCCCCGCCATGGCTAAAGCTT-3’ (SEQ ID NO 857), - signal encoding section polypeptide of IL-3. This sequence includes the restriction site BamHI at the 5’end and includes meinenemy codon ATG corresponding to the first amino acid of the signal segment with the 3’-side of BanlHI-site. This signal segment is cleaved by the cell, leaving the 5’-end of the Met/Ala, created by the merger of NcoI-SAI is and the signal segment and AflIII site itself receptor in the PCR reactions. Full truncated form of the receptor together with the signal segment of the IL-3 can be re-cut from the vector by splitting BamHI/EcoRI (hIL3L/hFlt3R).

The catalytic domain encoded pMON30298 (hG-CSF), was reorganized with the aim of creating by PCR within the coding frame restriction site EcoRI at the junction of the transmembrane and cytoplasmic domains according to the following scheme. To 0.5 μg denatured by heating pMON30298 was added 100 RMB each of the nucleating HGCFfor and HGCFrev, 10 ál of 5x buffer J, 5 units of Taq polymerase, and distilled water to achieve a final volume of 45 μl as described above. Amplification by PCR was carried out as follows: six cycles (1 minute at 94°C, 2 min at 64°C and 3 minutes at 70° (C) followed by 9 cycles (1 minute at 94°C and 4 minutes at 70°). Final completion was carried out for 7 minutes at 70°C. 10 μl of each PCR reaction mixture was purified in the gel using Geneclean II, as described previously, and were suirable in 10 μl of distilled water. Samples were digested EcoRI and HindIII (10 units each restrictase) in 20 µl reaction mixture for 90 minutes at 37°C. the Samples were again gel purified (using Geneclean II), as described above, and suirable in 10 μl of distilled water. 2 ál insert ligated into 50 ng of vector S420 treated the CSOs NcoI/HindIII/phosphatase, a 10 μl reaction mixture as described above. Transformation of competent cells DH5α and next steps confirm the target DNA sequence was performed exactly as described above. The selected clones are then sequenced to confirm the presence within the coding frame EcoRI site, as well as confirmation of the DNA sequence that encodes the catalytic domain of the receptor for G-CSF Clones, including the predicted sequence, was digested with restrictase EcoRI/HindIII as described above, and purified in the gel. Purified insert fragments hG-CSFR (EcoRI/-HindIII) and hIL3L/hFlt3R (BamHI/EcoRI) and ligated into the vector pcDNA-3.1(-) (Invitrogen), treated with BamHI/HindIII/phosphorylases. Transformation of competent cells DH5α and next steps confirm the target DNA sequence was performed exactly as described above.

Example 103

Additional genes encoding the flt3 ligands with altered sequences were constructed using dimeric intermediate matrices, as described above. Dimeric intermediates Flt4C.seq and Flt11N.seq were used as matrices to obtain agonists receptor flt3 with reconstructed sequences with a 15-amino acid linkers (GlyGlyGlySer)3GlyGlyGly (SEQ ID NO 795). Point breaks, the corresponding amino acid is the action 28/29, 34/35, 62/63, 94/95 and 98/99 comprising flt3, were formed on the basis of the PCR method using reagents PCR Optimizer Kit (Invitrogen) and the following pairs of blades: FL29For/FL29Rev, FL35For/FL35Rev, FL63For/FL63Rev, FL95For/FL95Rev and FL99For/FL99Rev as described in example 94. The conditions of amplification were as follows: seven cycles at 94°C for 1 minute, 62°C for 2 minutes and at 70°C for 2.5 minutes, then twelve cycles at 94°C for 1 minute, 68°C for 2 minutes and at 70°C for 2.5 minutes, then a final cycle at 72°C for 7 minutes. PCR products corresponding to the predicted size of the insert was digested with restrictase NcoI and HindIII and gel purified using Geneclean II (Biol91), as described above, in accordance with the manufacturer's recommended procedure. Samples were resuspendable in 10 µl final volume with distilled water. Inserts cloned in the form of individual genes in expressing vector pMON3934 (treated NcoI/HindIII/SAP) for mammalian cells and meant pMON35712, pMON35713, pMON35714, pMON35715, pMON35716, pMON35717 and pMON35718, respectively.

Genes encoding chimeric proteins comprising an agonist of the receptor of IL-3, encoded hMON13288 (WO 94/12638), designated here as "agonist-I receptor, IL-3, and the ligand of flt3 receptor with altered sequence, were generated by cloning the purified, treated restrictase PR the PCR products, obtained using pairs of seed points breaks 28/29, 34/35, 62/63, 94/95 and 98/99, plasmid pMON30311 treated NcoI/HindIII/SAP. The resulting plasmids were designated pMON32398, pMON35700, pMON35702, pMON35704 and pMON35706, respectively. Additionally, those same pair of blades were used in combination with a dimeric intermediate matrices Fl. t7N.seq and Flt3C.seq with the aim of constructing forms of these chimeric proteins consisting of agonist-I receptor, IL-3 and Flt3L, with a 10 amino acid linker (GlyGlyGlySer)2GlyGly (SEQ ID NO 793): the corresponding plasmids indicated pMON32397, pMON32399, pMON35701, pMON35703 and pMON35705.

Example 104

Genes encoding chimeric proteins consisting of agonist-I receptor, IL-3 and Flt3L, and a 21-amino acid linker (GlyGlyGlySer)5Gly (SEQ ID NO 796), were constructed using the same PCV method and using dimeric intermediate matrices FItllN.seq and FIt 10C.seq and the following pairs of blades: Flt36/36Rev, Flt37/37Rev, Flt38/38Rev, Flt39/39Rev, Flt41/41Rev, Flt42/42Rev and Flt43/43Rev. These pairs of blades correspond to the following points gaps in the ligand receptor flt3 - 35/36, 36/37, 37/38, 38/39, 40/41, 41/42 42/43 (point break 39/40 was first used when constructing plasmids pMON32376): they were used for PCR amplification under the following conditions: seven cycles at 94°C for 1 minute, at 66°C for 2 minutes and at 70°C for 2.5 minutes, then fifteen cycles at 94°in techenie minutes and at 70° C for 4 minutes, the final cycle was performed at 72°C for 7 minutes; used reagents Invitrogen PCR Optimizer Kit (with buffer). After confirming the DNA sequences of these constructs were designated as pMON35733, pMON35734, pMON35735, pMON35736, pMON35738, pMON35739, pMON35740, pMON35741, pMON35742 and pMON35743, respectively. As part of this series of options were designed and tested erroneous by PCR incorporation options, which resulted in the composition of Flt3 chimeric molecule has two point amino acid substitutions (pMON35741, point break 35/36, and pMON-35743, point break 42/43), and one variant (pMON35742, point break 38/39) included two amino acid substitutions (Q133 → R133, Q100 → R100, L112 → R) a part Flt3L.

Additionally, chimeric proteins consisting of Flt3L and agonist-I receptor, IL-3, in which there was point break Flt3L, corresponding to amino acid residues 28/29, 34/35, 62/63, 65/66, 89/90, 94/95 and 98/99 in the amino acid sequence of the flt3 ligand, as described above, were designed with a 15-amino acid linker (GlyGlyGlySer)3GlyGlyGly on matrices FLt4C and FLtllN. The reaction mixture PCR mixtures were similar to those described in example 103, except that the reverse priming, corresponding With the ends of Flt3 with reconstructed sequences were modified by the replacement of the restriction site HindIII site recognition is restrictases SnaBI. The parameters for PCR amplification cycles were as follows: seven cycles at 94°C for 1 minute, at 66°C for 2 minutes and at 70°C for 2.5 minutes, then fourteen cycles at 94°C for 1 min and at 70°C for 4 minutes, then a final cycle at 72°C for 7 minutes. The selection of PCR products, processing restrictase and purification was performed as described above. Insert ligated into a plasmid pMON26431 (expressing vector to cells KSS, including agonist-I receptor, IL-3 and linker IgG2b), treated with NcoI/-SnaBI/SAP, as follows: 50 ng of the treated vector, insert (at the ratio of insert and vector 10:1), 1 unit of DNA ligase 4 (Gibco BRL) and 1 μl of 10x ligase buffer were mixed in 10 μl reaction volume. Ligation was carried out for 1 hour at ambient temperature, then 2 μl of each reaction mixture were taken and used to transform 100 μl of chemically competent DH10B cells (Gibco BRL) (as an alternative to cells DH5α) according to the manufacturer's recommended procedure. One-fifth and 1/25 volume of each transformation mixture were sown on plates with LB medium to which was added the necessary marker antibiotics: the incubation was carried out overnight (14-16 hours) at 37°C. Selected colonies were sorted and identified DNA in accordance with minipreparation the th procedure (Oiagen), as was described above.

Sequencing of selected clones confirmed the presence of points of discontinuities 28/29 (pMON35719), 34/35 (pMON35720), 62/63 (pMON35721), 65/66 (pMON35722), 89/90 (pMON35723) and 98/99 (pMON35725). Plasmid pMON35726 point contains amino acid substitution (leucine to phenylalanine in 94th position) at the point of discontinuity 94/95. Chimeric structure, consisting of Flt3L and agonist-I receptor, IL-3, with a break point in the position 39/40 in the composition of Flt3L and varying number of amino acids in the linker (10, 15 or 21) is represented by the plasmid pMON35707, pMON35708, pMON35709, pMON35710 and pMON35711. These constructs were generated by PCR amplification with one of the following matrices: pMON32373, pMON32375 or pMON32376 and specific to Flt3L pair of blades 39N, term-l/SNABIC,term.

The standard PCR reaction mixture was Packed, as described above, and the DNA is amplified according to the following scheme: seven cycles at 94°C for 1 minute, 62°C for 2 minutes and at 70°C for 2.5 minutes, then twelve cycles at 94°C for 1 minute, 68°C for 2 minutes and at 70°C for 2.5 minutes, the final cycle was performed at 72°C for 7 minutes. PCR products corresponding to the predicted size of the insert was digested completely by restrictase NcoI and SnaBI, was gel purified and cloned in accordance with the above procedure in expressing vector pMON26431 (treated NcoI/SnaBI/SAP) for cell m is capitalship, as a factor chimeric proteins comprising Flt3L, IgG2b and agonist-I receptor of IL-3. Two of these structures contained errors PCR incorporating in the composition part of the chimeric protein F113, which had a point of replacing amino acids (F96 → L96 and I → G58) (respectively, plasmids pMON35710 and pMON35711).

Example 105

Was also constructed another series of chimeric proteins comprising Flt3L with reconstructed sequence and agonist-I receptor, IL-3 with points of discontinuities corresponding to amino acid residues 35/36, 36/27, 38/39, 40/41, 41/42, 42/43 and 65/66 in the polypeptide of Flt3 ligand, as described above: as matrices used selected design/ coding agonist-I receptor, IL-3 and Flt3L with reconstructed sequence (see tab. 12). One exception was due to the fact that the matrix for a 15-amino acid linker (pMON35715) was used to design the variant with the break point 65/66 (pMON35771).

Table 12

Design Flt3L/agonist-I receptor, IL-3
DesignMatrixThe break point in Flt3LA pair of blades
pMON35744pMON3573335/36Flt36/36Rev’
pMON35745pMON3573436/37Flt37/37Rev’
pMON35746 pMON3573537/38Flt38/38Rev’
pMON35747pMON3573638/39Flt39/39Rev’
pMON35748pMON3573840/41Flt41/41Rev’
pMON35749pMON3573941/42Flt42/42Rev’
pMON35750pMON3574042/43Flt43/43Rev’
pMON35769pMON3574342/43Flt43/43Rev’
pMON35771pMON3571565/6665For/66SnaBI

Were used pair of blades corresponding to the same restriction sites that were used in the design of plasmids pMON35719-35725. Reverse priming 36Rev’, 37Rev’, 38Rev’, 39Rev’, 41Rev’, 42Rev’ and 43Rev’ were used to create a restriction site SnaBIs within the coding frame. Were used, such as direct seed Flt36, Flt37, Flt38, Flt39, Flt41, Flt42 and Flt43. The PCR reaction mixture were identical to those that were described above, but with the exception pMON35771 and amplification conditions were modified as follows: 18 cycles at 94°C for 1 minute, 68°C for 2 minutes and at 70°C for 2.5 minutes, then a single cycle of extension at 70°C for 7 minutes. For pMON35771 conditions of amplification were as follows: six cycles at 94°C for 1 minute, 68� C for 2 minutes and at 70°C for 2.5 minutes, then fifteen cycles at 94°C for 1 min and at 70°C for 4 minutes, the final cycle was performed at 72°C for 7 minutes. Specific for Flt3 products of PCR amplification were digested with restrictase, was purified and cloned in plasmid pMON26431 (expressing vector encoding the agonist-I receptor, IL-3 and linker IgG2b, for cells KSS)as described in example 104. One of the options (pMON-32179) was constructed at the point of discontinuity 34/40 using a pair of blades for PCR Flt40/34Rev and dimeric intermediate matrices FIt11lN.seq and FIt10C.seq. Conditions for PCR amplification and subsequent cloning were identical to those used to clone pMON35771. Three additional chimeric protein comprising Flt3L and agonist-I receptor, IL-3 (point break 38/39), were formed in order to test the effect of different lengths of linker and protein. Using pMON35709 as a matrix, the length of the linker motif GlySer was extended to 29 residues according to formula (GlyGlyGlySer)7Gly using pairs of blades BamForl/38Rev (the reaction product, identified as PCR (A) and Flt38/BamRev1 (the reaction product, identified as PCR). The conditions of amplification were as follows: six cycles at 94°C for 1 minute, at 66°C for 2 minutes and at 70°C for 2.5 minutes, then Conven the ü cycles at 94° C for 1 min and at 70°C for 4 minutes, then the final cycle was performed at 72°C for 7 minutes. Obtained results PCR products were isolated using a PCR Clean-up Kit (Pronega), were digested either by restrictase NcoI/BamHI (PCR), or restrictable BamHI/SnaBI (PCR), gel purified and ligated into the composition pMON26431 (expressing vector encoding the agonist-I receptor, IL-3 and linker IgG2b, for cells In NC), as described above. The resulting structure was confirmed on the sequence and meant pMON35774. In a comparative perspective options pMON35775 and pMON35776 differed in that their linker motif GlySer was substituted amino acid fragments 140-154 (pMON35775) or 140-160 (pMON35776) native Flt3L containing point replacement of amino acids. The PCR conditions were identical to those described for plasmids pMON35774, except that there were used the following pairs of blades: 38For/Navfor and 38Rev/NavRevS (pMON35775) and 38For/Navfor and 38Rev/NavRevL (pMON35776). Restriction enzyme KasI was replaced by the restriction enzyme BamHI at what stages of the cloning of these PCR products amplification were identical to those used for pMON35774. Sequencing showed that the PCR resulted in the induction of errors in multiple isolates and pMON35775, and pMON35776. To identify the end-exact sequences had periaswamy otobrannogo restrictase NarI/SnaBI and NcoI/NarI using these treated in the gel slices to reklamiranje desirable designs.

A series of chimeric molecules of dimeric Flt3L was also designed to test the expression in cells GRANDSON. Was collected plasmid pMON32173, including two genes of native molecules Flt3L, joined by a linker IgG2b, using 2 pre molecules as follows: containing Flt3L NcoI/SnaBI-paste from pMON32393 was Legerova in gel purified, cut with NcoI/SnaBI plasmid pMON32377, which also was introduced gene agonist-L receptor, IL-3, which is the partner of Flt3L in the chimeric protein.

Similarly pMON35727 (point break 39/40, a linker of 15 amino acids) was constructed by making the insertion of Flt3L pMON35798 (as NcoI/SnaBI-insert) in gel purified plasmid pMON32375 from which the gene of agonist-I receptor, IL-3, which is the partner of Flt3L in the chimeric protein was cut out. The third dimer Flt3L - pMON32168 (point break 39/40, the linker of the 21 amino acids) was constructed as follows; NcoI/SnaBI-paste of the composition pMON32165 (included in E.coli equivalent pMON35709 formed by sublimirovanny NcoI/BamHI fragment from pMON32163 and BamHI/HindIII fragment from pMON35709 part pMON5723 treated NcoI/HindIII). NcoI/SnaBI-box of pMON32165 (Flt3L 1-139 (39/40)L21) and SnaBI/HindIII insert from pMON32376 (IgG2b/Flt3L 1-139 (39/40L21) was subcloned into the production vector pMON5723 E.coli, which enabled us to create pMON32167. Then NcoI/HindIII insert from pMON32167 was subcloned into the composition pMON30304 and identified as pMON32168.

Example 106

Seri is trimeric molecules, each of which contains two parts Flt3L and a single copy of agonist-I receptor, IL-3 or agonist-II receptor IL-3 (agonist of the receptor of IL-3, encoded by plasmid pMON13416 [WO 94/12638], denoted here as "agonist-II receptor IL-3") was also constructed from the preceding molecules using restriction cleavage with the cleaning of the fragments in the gel. Plasmid pMON35728 was collected using NcoI/EcoRI insert (Flt3L/IgG2b/agonist-I receptor IL-3) of the pMON32375 and EcoRI/HindiII insert (agonist-I receptor IL-3/IgG2b/Flt3L) is included pMON35708. These two fragments were then perilesional in the treated NcoI/HindIII/SAP vector pMON3934 to mammalian cells and subclinically as described above. Plasmid pMON32205 (agonist-II receptor IL-3/IgG2b/Flt3 l-139/IgG2b/Flt3 1-139) was assembled by ligating the NcoI/HindIII fragment of the composition pMON32173 in AflIII/HindIII site of the plasmid pMON30304. A similar approach was used to construct plasmids pMON32206 (agonist-II receptor IL-3/IgG2b/-Flt3L (39/40)L21/IgG2b/Flt3L(39/40)L21). NcoI/HindIII-a fragment of the composition pMON32167 was cleared in the gel and subcloned into the composition of the AflIII/HindIII-cleaved plasmid pMON30304 (which part is agonist-II receptor IL-3/IgG2b). Plasmid pMON32207 (Flt3L (39/40)L21/IgG2b/Flt3L (39/40)L21/G-CSF) was collected by sublimirovanny gel purified NcoI/HindIII insert of the plasmid pMON32170 in the composition of the intermediate plasmid pMON32198 (AflIII/HindIII).

***Plasmid pMON32208 (FltL l-139/IgG2b/G-CSF/IgG2b/Flt3L 1-139) was collected by sublimirovanny purified gel SnaBI-insert of the plasmid pMON30320 (as IgG2b/G-CSF) in split SnaBI, handled SAP plasmids pMON32173. Plasmid pMON32204 was collected by sublimirovanny NcoI/HindIII insert of composition pMON32173 in treated restrictase AflII/HindIII plasmid pMON30309 (which includes G-CSF/IgG2b). Plasmid pMON32195 (Flt3L 1-139(39/40)L21/IgG2b/G-CSF/Flt3L 1-139(39/40) L21) was constructed by sublimirovanny NcoI/SacI insert of composition pMON32190 and SacI/HindIII fragment of the composition pMON32171 in split restrictase NcoI/HindIII plasmid pMON30304. Plasmid pMON32196 (G-CSF/IgG2b/Flt3L 1-139(39/40) L21/IgG2b/Flt3L 1-139) was collected by sublimirovanny NcoI/HindIII fragment of the composition pMON30309 (as G-CSF/IgG2b) in the treated NcoI/SAP plasmid pMON32168 (Flt3L1-139(39/40)L21/IgG2b/Flt3L 1-139) confirmation orientation by DNA sequencing and restriction analysis. Plasmid pMON32197 (G-CSF/IgG2b/Flt3L 1-139(39/40) L21/IgG2b/Flt3L 1-139(39/40)L21) was constructed by sublimirovanny NcoI/HindIII insert pMON32167 (Flt3L 1-139(39/40) L21/IgG2b/Flt3L 1-139(39/40) L21) in the AflIII/HindIII site of the plasmid pMON30309 (G-CSF/IgG2b).

Example 108

A series of molecules, including Flt3L, was designed as expressnew in cells KSS by the replacement of agonist-I receptor, IL-3 or agonist-II receptor IL-3 segment G-CSF as chimeric partner. In the formation of chimeric proteins, intermittent type expressing cells KSS and created using vector pMON3934, segment G-CSF can encode in the 17th position of the polypeptide as a series, and cysteine. In molecules expressed by the cell and E. coli or expressed by neperemeschayuschimsya type in mammalian cells, the position 17 in the composition of G-CSF should be presented exclusively by serine. Chimeric protein that includes native Flt3L, G-CSF, was constructed for expression in cells KSS with both options orientation: G-CSF/IgG2b/Flt3L (pMON-30329) and Flt3L/IgG2b/G-CSF (pMON32175). Plasmid pMON30329 was collected by sublimirovanny insert Flt3L 1-139 of the composition pMON30238 (as a product of cleavage NcoI/HindIII) in plasmid pMON30309 (which contains G-CSF/IgG2b), split restrictase AflIII/HindIII, while plasmid pMON32175 was constructed using gel purified NcoI/SnaBI-paste of the composition pMONM32393 in treated restrictase NcoI/SnaBI plasmid pMON26420 (which contains the gene IgG2b/G-CSF). Third chimeric molecule with native G-CSF/Flt3L (pMON32191) differs from pMON32175 the fact that it includes GlySer linker in place of chimeric linker IgG2b: it was formed for expression in E.coli cells. Plasmid pMON32191 was collected using the same gel purified NcoI/SnaBI-paste of the composition pMON32393 in split restrictase NcoI/SnaBI plasmid pMON31123 (which includes gene GlySer/G-CSF). Equivalent cells (EGC pMON35767) was created by sublimirovanny cleared gel chimeric NcoI/HindIII-gene composition pMON32191 in vector pMON3934, adapted for expression in cells of KSS.

Example 109

Two series of chimeras, including Flt3L with reconstructed sequence, were constructed by replacing agonist receptor of IL-3 by another component - G-CSF. The first set, characterized by the orientation of the G-CSF/IgG2b/Flt3L with reconstructed sequence, was constructed as follows; plasmid pMON30329 (G-CSF/IgG2b/Flt3L 1-139) were digested with restrictase SnaBI/HindIII and the vector containing the gene component of G-CSF was purified in the gel, as described above. Treated restrictase SnaBI/HindIII insert of suitable structures, including agonist-I receptor IL-3/Flt3L, shown below in table. 13, were then subcloned into a plasmid pMON30329 (SnaBI/HindIII).

Table 13

Design G-CSF/IgG2b/Flt3L and their analogues, including agonist-I receptor, IL-3
The break point in Flt3LpMON (G-CSF)pMON (agonist-I receptor IL-3)
35/36L21pMON32188pMON35733
89/90L21pMON32273pMON32389
37/38L21pMON35795pMON35735
38/39L21pMON35796pMON35736
40/41L21pMON35797pMON35738
41/42L21pMON35798pMON35739
42/43L21pMON35799pMON35740

Plasmid pMON32169 (G-CSF/IgG2b/Flt3L 1-139(39/40)L21) was created using NcoI/BamHI insert of composition PMON32163 and AMN/-indIII-paste of the composition pMON32370, subcloned in plasmid pMON3030, split restrictase AflIII/HindIII. Three molecules in this series did not include directly oriented components agonist-I receptor of IL-3. The first of them (pMON39914) was collected using a expressing cells KSS vector pMON30309 (which includes G-CSF/IgG2b), split restrictase AflIII/ HindIII, and inserted Flt3L 1-139(39/40)L29 included pMON32243 (as NcoI/HindIII). When creating the plasmids pMON39915 Flt3L gene 1-154 (39/40) of the pMON32242 (as NcoI/HindII-insert) was subcloned into the original vector pMON30309. Plasmid pMON39916 was created the same way as pMON39915, except that was used to insert Flt3L 1-160 (39/40) of the pMON32252. Plasmids pMON32242, pMON32243 and pMON32252 are constructions, expressed in E.coli, and include nachinery Flt3L gene with altered sequence (as NcoI/HindIII). Finally insert included pMON35799 was subcloned in plasmid pMON5723 (as NcoI/HindIII-fragment) for expression in E.coli cells. This productive in E.coli plasmid was designated pMON39904.

Example 110

Many chimeras G-CSF from the second series, characterized by the orientation of Flt3L/IgG2b/G-CSF, were also constructed on the basis of their analogues, including agonist-I receptor, IL-3, as shown in table 14.

Table 14

Design Flt3L/IgG2b/G-CSF and their analogues, including agonist-I receptor, IL-3
The break point in Flt3LpMON (G-CSF)pMON (agonist-I receptor IL-3)
39/40L10pMON35751pMON35707
39/40L15PMON35752pMON35708
39/40L21PMON35753pMON35709
89/90L15PMON35754pMON35723
35/36L21pMON35755pMON35744
36/37L21pMON35756pMON35745
37/38L21PMON35757pMON35746
34/35L15PMON35759pMON35720
65/66L15pMON35760pMON35722
98/99L15pMON35765pMON35725

These constructs were collected using a split restrictase NcoI/SnaBI plasmids pMON36113 (vector to cells KSS, including gene IgG2b/G-CSF) and specific, split NcoI/SnaBI insert Flt3L with reconstructed the sequence of composition of the chimeric proteins, including agonist-I receptor IL-3/Flt3L, shown in table 14. The resulting plasmids were designated pMON32170, pMON32871, pMON32271, pMON32172, pMON32174, pMON35751, pMON35752, pMON35753, pMON35754, pMON35755, pMON35756, pMON35757, pMON35758, pMON35759, pMON35760, pMON35761, pMON35762, pMON35763, pMON35764, pMON35765, pMON35766, pMON35767, pMON35768, pMON35770, pMON35772, pMON35773, pMON35777, pMON35778, pMON35779, pMON35780, pMON35782 and pMON39908.

Plasmids pMON35777 and pMON35778 were constructed by PCR and you shall be held with the same NcoI/NarI - NarI/SnaBI-inserts, what have been described for pMON35775 and pMON35776, except that split restrictase NcoI/SnaBI plasmid pMON35751 was used as the initial vector containing the gene ISG2b/G-CSF. To construct equivalent pMON35778 carrying a breakpoint 39/40, a pair of blades Flt40/SnaBI-Cterm was used to reamplification matrix pMON35778. Applied the same amplification conditions as described above for plasmid pMON35771, except that the initial temperature of annealing was reduced from 66 to 55°C. the resulting construct was designated pMON35782 (Flt3 1-160 (39/40)/IgG2b/G-CSF).

Plasmid pMON32170 (Flt3L 1-139(39/4)L21/IgG2b/G-CSF) was created using NcoI/SnaBI-paste of the composition pMON32165, legirovannoi in split restrictase NcoI/SnaBI plasmid pMON26430 (which includes IgG2b/G-CSF). Plasmid pMON35764 (Flt3L (38/39)L21/IgG2b/G-CSF) was cloned as follows: insert Flt3L with rebuilt sequence was amplified using PCR using pMON35736 as a matrix and a pair of blades Flt39/39Rev. The amplification conditions were the same that were used for pMON35771, except that the initial temperature of annealing was reduced from 66 to 56°C. Split restrictase NcoI/SnaBI product PCR amplification was subcloned in split restrictase NcoI/SnaBI plasmid pMON35754, including gene IgG2b/G-CSF. Plasmid pMON35768 (Flt3L (38/9)L21/IgG2b/G-CSF) is a mutation in the 15th residue (substitution of serine for phenylalanine) part Flt3 chimeric protein.

Plasmids pMON35762 (Flt3 with matrix pMON35739), pMON35763 (Flt3 with matrix pMON35738), pMON35758 (Flt3 with matrix pMON35740), pMON35770 (Flt3 with matrix pMON35743) were constructed similarly as described for pMON35764.

Plasmid pMON35772 representing the mutation of serine125→ phenylalanine125in the Flt3 gene with altered sequence (according pMON35760), was cloned by PCR using pMON35715 as a matrix for Flt3 and a pair of blades 65For/65SnaBI. Terms of cycles of PCR were identical to those used for amplification of genes of Flt3 composition of plasmids pMON35733, pMON35734, pMON35735 and pMON35736 described above. Plasmid pMON35761 represents the mutation of glutamine133→ arginine133in the Flt3 gene with altered sequence of composition plasmids pMON35758. Plasmid pMON35773 (Flt3L 1-139 (38/39)L29/-IgG2b/G-CSF) was cloned as described above for plasmid pMON35774, except that as the source of the vector used plasmid pMON25430 treated NcoI/SnaBI/SAP, including gene IgG2b/G-CSF.

To construct equivalent, characterized by the break point 39/40, plasmid pMON35773 was used as template in PCR amplification with a pair of nucleating Flt40/SnaBI-Cterm. Amplification was carried out similarly as described for pMON35771. Split restrictase NcoI/SnaBI the amplification product was subcloned in plasmid pMON26430 (treatments is annoy NcoI/SnaBI/SAP) in the resulting plasmid pMON35779 (Flt3L 1-139 (39/40)L29/IgG2b/G-CSF). Plasmid pMON35780 is a variant pMON35779 and encodes part of Flt3 with rebuilt sequence comprising chimeric protein carrying a mutation of leucine60→ Proline60. Plasmid pMON32190 (Flt3L 1-139 (39/40)L21/GS/G-CSF) includes alternative chimeric GlySer linker, which replaces the linker IgG2b available in the plasmids pMON32170. NcoI/SnaBI fragment of the gene of Flt3L composition pMON32165 (Flt3L 1-139 (39/40)L21/IgG2b/agonist-I receptor of IL-3 in the vector pMON5723, expressed in E.coli cells) was subcloned in plasmid pMON31123, split restrictase NcoI/SnaBI. Equivalent option pMON35766 designed for expression in cells KSS, was designed by sublimirovanny in plasmid pMON3934 full of chimeric inserts Flt3L/GlySer/G-CSF in the form of a NcoI/HindIII fragment.

Plasmid pMON39908 similar to pMON35779, except that amino acid residues 133-160 in the composition of Flt3L substituted amino acid sequence VETVFHRVSQDGLDLLTS (SEQ ID NO 798), which is homologous variant Flt3L, resulting from alternative splicing (No. in GenBank HSU29874). Plasmid pMON32190 was used as template for PCR with such used pairs of blades; Flt40/XbaRev and SnaBICterm/XbaFor. The amplification conditions were the same as described for pMON35771, except that the annealing temperature was reduced from 6 to 64° C. Both treated in the gel product of PCR amplification were treated either by restrictase NcoI/Xbal (PCR product Flt40/XbaRev)or restrictable XbaI/SnaBI (PCR product SnaBICterm/XbaFor) and subcloned in plasmid pMON26430 (treated NcoI/SnaBI/SAP). Plasmid pMON32273 (Flt3L 1-139 (39/40) L21/IgG2b/Cs-CSF) was constructed by PCR pMON35777 using pairs of blades FltConNco/Grev to reamplification option Flt31 38/39 option in Flt3L with break points 39/40. Purified amplifico were treated with restrictase NcoI/SnaBI and was subcloned into the NcoI cleaved/SnaBI plasmid pMON32191, and the resulting variant was identified pMON32259 (for expression in E.coli cells). For expression in cells KSS NcoI/HindIII insert of composition pMON32259 was subcloned in plasmid pMON3934 (NcoI/HindIII).

Example 103

(actually - Example 111)

Another series of chimeric proteins were constructed: it is part of Flt3L was characterized by one or two mutations in cysteine residues (table. XIA and XIB). Plasmid pMON35790 (Flt3L 1-139 [cysteine4→ serine4, cysteine85→ serine85]/GS/G-CSF[Ser17]) was constructed by PCR using pMON32191 as matrices and pairs of blades ClFor/C3Rev and C3For/-139Rev in two reactions. Plasmid pMON35791 (Flt3L 1-139 [cysteine93→ serine93, cysteine132→ serine132]/GS/G-CSF[Ser17]) was constructed by PCR using pMON32191 as m is Tracy and vapor nucleating CSFor/C6Rev and CSRev/N-term. The amplification conditions were the same as were described above for pMON35771, except that the annealing temperature was reduced from 66 to 64°C. a Second round of PCR was carried out using amplificado (10 µl of each amplificada) from the first round PCR; then the PCR products were purified, treated restrictase NcoI/SnaBI and subcloned in split restrictase NcoI/SnaBI plasmid pMON-32191. The conditions of PCR amplification in the second round were modified as follows: the initial temperature of annealing was increased to 68°C, and the number of cycles increased from 6 to 15. Additional amplification is not required. These designs - pMON35787 (cysteine4→ serine4, cysteine85→ serine85and pMON35788 (cysteine93→ serine93, cysteine132→ serine132) were used for expression in E.coli cells. Equivalents for the expression of cell KSS - pMON35790 and pMON35791 - were designed by sublimirovanny correctly mutated chimeric inserts Flt3L/GlySer/G-CSF taken as NcoI/HindIII fragments into a plasmid pMON3934. Plasmid pMON35792 (Flt3L l-132 [cysteine132→ serine132]/GlySer/G-CSF [Ser17]) was constructed by PCR using pMON32191 as a matrix and a pair of blades FLDlRev/FltNTerm.

Plasmid pMON39905 (Flt3L 1-139 [cysteine132→ serine132]/ GlySer/CSF [Ser17]) was construe avana by PCR using pMON32191 as a matrix and a pair of blades FLMlRev/FltNTerm.

Plasmid pMON39906 (Flt3L 1-139 [cysteine127→ serine127, cysteine32→ serine32]/GlySer/G-CSF [Ser17]) contains a single amino acid replacement in the 127-th position of the parts with Flt3L reconstructed sequence, resulting PCR induced errors that occurred during PCR amplification pMON39905.

Plasmid pMON32276 (Flt3L 1-139 (39/40)L21 [cysteine4→ serine4, cysteine85→ serine85]/GlySer/G-CSF [Ser17]) was constructed in two rounds of PCR. Were formed three original amplificada: PCR (pMON32190 as a matrix and a couple of gas stations G10L/85N); PCR (pMON32190 as a matrix and a pair of blades 4N/85S) and PCR (pMON32198 as a matrix and a pair of blades 4S/3605Rev). For the second round PCR, PCR and PCR were reamplification in the combined mixture, the result that was obtained by PCR A. PCR was purified, treated with restrictase NcoI/SnaBI and subcloned in plasmid pMON30277 (GlySer/G-CSF). The following three structures were formed in a similar manner. Plasmid pMON32277 (G-CSF [Ser17]/IgG2b/ Flt3L 1-139 (39/40) L21 [cysteine4→ serine4, cysteine85→ series85]) in the first round of PCR was formed three original amplificada: PCR (pMON32190 as a matrix and a pair of blades G10L/85N); PCR (pMON32190 as a matrix and a pair of blades 4N/85S) and PCR (pMON32169 as a matrix and a pair of blades 4S/3605Rev). For the second R is the round PCR, PCR and PCR were reamplification in the combined mixture, the result that was obtained by PCR-Century PCR was purified, treated with restrictase NcoI/HindIII and subcloned in split restrictase NcoI/HindIII plasmid pMON30309 (G-CSF [Ser17]/IgG2b). Plasmid pMON32278 (Flt3L 1-139 (39/40)L21 [cysteine93→ serine93, cysteine132→ serine132]/GlySer/G-CSF [Ser17]) in the first round of PCR was formed three original amplificada: PCR (pMON32190 as a matrix and a pair of blades G10L/93N); PCR (pMON32190 as a matrix and a pair of blades 132N/93S) and PCRS (pMON32198 as a matrix and a pair of blades 132S/3605Rev). For the second round PCR, PCRS and PCR were reamplification in the combined mixture, the result that was obtained by PCR-C. PCR was purified, treated with restrictase NcoI/SnaBI and subcloned in plasmid pMON30277 (GlySer/G-CSF). Plasmid pMON32279 (G-CSF [Ser17]/IgG2b/Flt3L 1-139 (39/40)L21 [cysteine93→ serine93, cysteine132→ serine132] in the first round of PCR was formed three original amplificada: PCR (pMON32190 as a matrix and a pair of blades G10L/93N); PCR (pMON32190 as a matrix and a pair of blades 132N/93S) and PCR (pMON32169 as a matrix and a pair of blades 132S/3605Rev). For the second round PCR, PCR and PCR were reamplification in the combined mixture, the result that was obtained by PCR-D. PCR-D was purified, treated with restrictase NcoI/HindIII and the sub is klonirovana in split restrictase NcoI/HindIII plasmid pMON30309 (G-CSF [Ser 17] /IgG2b).

Example 112

Plasmid pMON39909 (Flt3L 1-139 (39/40)L21/GS/G-CSF [Ser17] (133/132) is one of the two chimeric proteins Flt3/G-CSF, in which the sequence of both components rebuilt. NcoI/AflIII fragment of the composition pMON32198, including Flt3L gene 1-139 (39/40)L21/GlySer, was subcloned in the treated NcoI/SAP plasmid pMON25187 (production for E. coli cells plasmid carrying a single copy of the gene G-CSF [Ser17] (133/132)). After confirming the DNA sequence of a chimeric insert was subcloned into the plasmid pMON3934 as NcoI/HindIII fragment and was designated pMON39909. Plasmid PMON39910 (G-CSF [Ser17] (133/132)/IgG2b/Flt3L 1-139 (39/40L21) was konstruirovanie by PCR using pMON25187 as a matrix and a pair of blades GPForl/GFRev2. The amplification conditions were identical to those used for pMON39908. Treated NcoI/SnaBI gene G-CSF (Ser17) (133/132) was subcloned into the NcoI/SnaBI-site plasmids PMON32376, including gene IgG2b/Flt3L 1-139 (39/40)L21.

Example 113

Plasmid pMON40000 is production plasmid, modified on the basis of plasmids pClneo (Promega)containing the gene G-CSF (Ser17)/GlySer/Flt3L 1-139 (39/40)L21 designed for expression in NSO cells (the equivalent of plasmids pMON32169 expressed in cells KSS). Plasmid pMON40000 includes promotora-enhancer element CMV-IE, leader motive IL-3, located immediately in front of CSF gene (Ser17)/GlySer/Flt3L 1-139 (39/40)L21, p is motor shortened timedancing, polyadenylate signal late gene SV40 and multiple sites hypersensitivity to DNase (as part of the minimum segment LCR gene IgH 3).

Example 114

The biological activity of multifunctional chimeric agonists hematopoietic receptors (see table. 15).

Table 15

Biotest on the activity of multifunctional chimeric agonists hematopoietic receptors in vitro
# exampleCloneProliferation of the BAF3/F113L1Proliferation of the BAF3/Flt3L2Colonies of CFU-GM3
109pMON30247++++
108pMON32169 ++++++
110pMON32175 +++ 
108pMON32190 +++ 
96pMON32191 ++++++
100pMON32333+  
97pMON32342++  
97pMON32352+ +
110pMON32360+ +
113pMON35766+  
 pMON40000  +++
 pMON400024 +++++
Legend:

+ - reduction potential (offset to the right) in comparison with control

++ - equal potential in comparison with control (two times)

+++ - increased capacity (shift left) in comparison with control

1in comparison with the control pMON30247

2in comparison with the control pMON32352

3in comparison with the appropriate extension control

4- tested in a mixed pool pMON40000 and pMON40002

Example 115

Determination of biological activity (see table. 16).

Table 16
# exampleClone (clones)Expansion of hematopoiesis ex vivo1Expansion of dendritic cells ex vivo2
 The degree of expansionPredecessors of neutrophi crystalsPredecessors IU is Akari-Titov The degree of expansionFunctions
1108pMON32175+++  
1102pMON32191++++++++
997pMON32360+++++ 
 agonist-I receptor, IL-3,     
 agonist-I MFR,     
 agonist-II MFR++++++  
 agonist-I receptor, IL-3,     
 agonist-I MFP, agonist-II     
 MFR: pMON30247++++++++  
 agonist-I receptor, IL-3,      
 agonist-I MFR, agonist-II     
997MFR: pMON32360+++++++  
 agonist-I receptor, IL-3,     
 agonist-I MFR, agonist-II     
996MFR: pMON32333++++++  
 agonist-I receptor, IL-3,     
 agonist-I MFR., agonist-II     
1102MFR: pMON32191+++++++++  
 agonist-I receptor, IL-3,     agonist-I MFR, agonist-II     
1108MFR.:pMON32175++++++++  
 agonist-II MFR,     
1102pMON32191+++++  
 pMON30247   +++++
997pMON32352   ++ 
1Legend:

+ - reduced activity compared with IL-3, IL-6, SCF, G-SCF (control according to literature data)

++ - similar (within 20%) activity with IL-3, IL-6, SCF, G-CSF (control according to literature data)

+++ increased activity in comparison with IL-3, IL-6, SCF, G-CSF (control according to literature data)

The cultivation conditions: medium X-Vivo 10, 37°C, 5% CO211 days of incubation

2Legend:

+ - reduced activity in comparison with GM-CSF, TNFαSCF

(the control literature the output data)

++ - similar (within 20%) activity in comparison with GM-CSF, TNFαSCF (control according to literature data)

+++ increased activity in comparison with GM-CSF, TNFαSCF (control according to literature data)

The cultivation conditions: medium IMDM-20 with the addition of 100 ng/ml GM-CSF, 100 ng/ml TNFα, 20 ng/ml SCF, at 37°C, 5% CO2,

for 18-22 days

agonist-I MFR = pMON31140 (WO 95/21i97)

agonist-II MFR = pMON28571 (WO 97/12985)

Test hematopoietic expansion ex vivo

Dedicated enriched fraction of CD34-positive progenitor cells of human bone marrow were cultured at a rate of 5·104cells in 1 ml medium ex-vivo 10 with the addition of 1% HSA with the tested cytokines and monitoring to assess the potential of cytokine expansion. The cells were expansively and perseval 5·104cells in 1 ml in a new environment with the addition of cytokines by about the 5th day, depending on crop growth. On the 10th day, the cells were collected and characterized. The cells were collected with cups and brought their concentration up to 106cells in 1 ml were Determined by the overall level of cell expansion and cell tested for compliance with the cells-the precursors of blood in pre - and postexperience test on methylcellulose (Stem Cell Technol., Methocult HCC3534). Ekspandirovannye cells were also tested using flow cytometry to determine the types of the th facilities: CDllb(RE)/CD15/(FITC), CD34 (FITC), CD41a (STC).

Test expansion of dendritic cells ex vivo

Dedicated enriched fraction of CD34-positive progenitor cells of human bone marrow were cultured at the rate of 2·105cells in 1 ml IMDM medium with addition of 20% fetal calf serum tested cytokines and monitoring for assessment started expanding incorporating potential. The cells were expansively and perseval 5·104cells in 1 ml in a new environment with the addition of cytokines by about the 5th day, depending on crop growth. On 18-22 day cells were selected and characterized. Determined the overall level of expansion cells, and ekspandirovannye cells were tested using flow cytometry to determine standard accessories: HLA-DR+ (PE)/CDla+ (FITC), CD86+(D)/CDla+ (FITC), CD19- (FITC). The degree of expansion of dendritic cells was determined as the product of the overall level of cell expansion and the fraction of cells HLA-DR+/CD1a+. The functional activity of cells was determined using pure reaction mixed lymphocytes. Washed, irradiated cultured dendritic cells were added in a series of doses in the faction managernew peripheral blood cells, which allogeneically immunocompetent cells are placed in 96-well microtonally tablet. The ability of dendritic cells to function as antigen-presentyou the cell determined by the degree of proliferation, stimulated in the preparations of immune cells, as measured by incorporation3H-thymidine.

Example 116

Binding receptors (see table. 17).

Table 17
The analysis of binding receptors
# exampleConnectionFlt3-Fc Kd(HM)G-CSFR IC50(nm)IL-3R’ IC50(nm)
100pMON3234226±7->1000
 pMON3024736±7-6,6±0,5
97pMON3236045±17-26(2)
97pMON3235256±5-13±4
102pMON3219137±140,33±0,01-
 agonist-II receptor IL-3->10001,3±0,2
 agonist-I receptor IL-C->10003,7±0,6
 G-CSF-0,69±0,08>100

Data are given as mean ± standard error of the identified at least three experiments in the series is h three replications, except pMON323600, when only two (2) of the experiment were carried out in full.

The affinity of the agonist Flt-3, including chimeric molecules were evaluated in tests on binding receptors. The BIACORE analysis was performed by direct immobilization of Flt3-Fc, a value of Rd was calculated by determining the constants of Association and dissociation. Comparative tests on the binding were used to assess interactions of chimeric molecules or receptor G-CSF, transfitsirovannykh in BaF3 cells, either γ-subunit of the receptor for IL-3 expressing cells KSS. Using these cells were tested for competitive binding of agonist-specific labeled ligands: indicators IC50determined to competitive chimeras using log-log analysis of the curves depending on the dose.

Example 117

Biological activity In vivo (see tab. 18).

Table 18

Testing data multifunctional chimeric agonists hematopoietic receptors in mice in vivo
# exampleClonePeripheral bloodSpleen
I-Ab+/CD11c+I-Andb+/CD8+I-Ab+/CD11c+I-Andb+/CD8 +CFU-GM/ spleen
cells DC in 1 ml of bloodcells DC in the spleen (X106levelthe degree of enlargement
 pMON3024 7n/an/a33,523,878
100pMON3234 2n/an/a8,04,52
97pMON3236 0n/an/a64,537,5183
102pMON3219 117,0892,379133,578,953

C57BL/6 were subcutaneously injected with plasmids RMK-30247, pMON32342 or pMON32360 (150 µg per day) or pMON32191 (200 mcg/day) or mouse serum albumin (200 mg/day) for 10 days. On the 11th day of fatal bleeding was formed by direct puncture of the heart. Cell count was performed in whole blood. The peripheral blood leukocytes were isolated using gradient centrifugation (Histopaque) with subsequent legirovaniem ammonium chloride to further remove erythrocytes. Cells were stained for flow cytometry using direct monoclonal antibodies connected with fluorescein or phycoerythrin (Pharmingen). Per the e staining non-specific binding of the Fc receptor was blocked using reagent FcBlock (Pharmingen). Cells were analyzed on a FacScan cytometer (Becton/Dickinson). The percentage of positive cells was determined integrally, and the distribution of phenotypes of cells was determined based on WBC count (WBC). Spleen the injected animals were removed under sterile conditions and analyzed needles in RPMI medium. Cell suspension was obtained by using the flat surface of the rear part 5-CC syringe followed by filtration through a cotton plug to remove lumps. Erythrocytes were removed with lysis with ammonium chloride, the cells were washed, reasponsible and counted using a Coulter counter (Coulter Electronics). Cells were prepared for flow cytometry as described above. Phenotype marked as the number of cells per 1 spleen, based on the percentage of cells with positive phenotype and total leukocyte formula spleen. Culture CFU was obtained by inoculation of spleen cells at the rate of 1.5·105the spleen cells in 1 ml of tripartite methylcellulose holes with murine cytokines and erythropoietin (Stem Cell Technologies). Cultures were incubated for 10 days at 37°and worked under a light microscope. Figure CFU was determined as colony containing more than 50 cells. The degree of increase in the number of CFU per 1 spleen was determined as the ratio of the total number of CFU in 1 spleen when tested with the Union to the total number of CFU in 1 spleen in the control (native albumin).

Reference value (when the injection of native albumin) for peripheral blood was 15 and 347 cells in 1 μl of phenotypes I-Ab+/CD11c+and I-Ab+/CD8+, respectively. Reference value (when the injection of native albumin) for splenic leukocytes was 2·1061·106cells 12 spleen for phenotypes I-Ab+/CD11c+and I-Ab+/CD8+respectively.

In the absence of additional developments can be sure that the specialists in the art based on the descriptions will be able to use the present invention to the fullest extent. Further preferred special embodiment, therefore, should be carried out as merely illustrative and in no way limited road use in any respective field.

A more detailed description of molecular-biological methods protein purification and biotests can be found in the patents WO 94/12639, WO 94/12638, WO 95/20976, WO 95/21197, WO 95/20977, WO 95/21254 and WO 96/23888, which are fully incorporated into the present text by reference.

All references, patents and messages tested in this text, incorporated by reference in full required amount.

Various other examples can be available to a person skilled in the art oznakomimsya with the present invention be the deviations from the letter and spirit of the present invention. Have in mind that all such other examples will be included in the formulation of objectives in the claims.

1. Hematopoietic protein containing the amino acid sequence of the formula R1-L1-R1, R2-L1-R1, R1-R2or R2-R1and R1is a polypeptide containing a modified amino acid sequence of the ligand, flt-3 SEQ ID NO:466, where the modification consists in merging the N-end-to-end directly or through a linker (L2)selected from the group consisting of Ser, Asn, Gly, Thr, GlySer, AlaAla, GlySerGly, GlyGlyGly, GlyAsnGly, GlyAlaGly, GlyThrGly, AlaSerAla, AlaAlaAla, SEQ ID NO: 778-799, and is able to connect the N-end C-end with the formation of new C - and N-ends at amino acids

28-2942-4393-94
29-3064-6594-95
30-3165-6695-96
31-3266-6796-97
32-3386-8797-98
34-3587-8898-99
36-3788-8999-100
37-3889-90100-101
38-3990-91101-102
39-40 102-103
40-4192-93respectively
41-42

and R2is a polypeptide containing a modified amino acid sequence of IL-3 human SEQ ID NO:859, where

XAA at position 17 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;

Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln;

Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;

XAA in position 20 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;

Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;

XAA in position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly;

Xaa at position 23 is Ile, Val, Ala, Gly, Trp, Lys, Phe, Leu, Ser, or Arg;

XAA at position 24 is Ile, Gly, Val, Arg, Ser, Phe or Leu;

XAA at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;

XAA at position 26 is His, Thr, Phe, Gly, Arg, Ala, or Trp;

Xaa at position 27 is Leu, Gly, Arg, Thr, Ser or Ala;

XAA at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;

Xaa at position 29 is Gln, Asn, Leu, Pro, Arg, or Val;

XAA at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;

XAA at position 31 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;

Xaa at position 32 is Leu, Val, Arg, Gln, Asn, Gly, Ala or Glu;

XAA at position 33 is Pro, Leu, Gln, Ala, Thr, or Glu;

XAA at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;

Xaa at position 35 is Leu, Ala, Gly, Asn Pro Gln or Val;

XAA at position 36 is Asp, Leu, or Val;

Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile;

XAA at position 38 is Asn or Ala;

Xaa at position 40 is Leu, Trp, or Arg;

XAA at position 41 is Asn, Cys, Arg, Leu, His, Met, or Pro;

XAA at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala;

Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;

XAA at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;

XAA at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu, or His;

XAA at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;

Xaa at position 47 is Ile, Gly, Val, Ser, Arg, Pro, or His;

XAA at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;

XAA at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;

Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met, or Gln;

Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;

XAA at position 52 is Asn, His, Arg, Leu, Gly, Ser or Thr;

XAA at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;

XAA at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;

XAA at position 55 is Arg, Thr, Val, Ser, Leu, or Gly;

Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;

Xaa at position 57 is Asn or Gly;

Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val, or Cys;

Xaa at position 59 is Glu Tyr, His, Leu, Pro or rg;

Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn, or Thr;

XAA at position 61 is Phe, Asn, Glu, Pro, Lys, Arg or Ser;

Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;

Xaa at position 63 is Arg, Tyr, Trp, Lys, Ser, His, Pro, or Val;

Xaa at position 64 is Ala, Asn, Pro, Ser or Lys;

Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe or Ser;

XAA at position 66 is Lys, Ile, Arg, Val, Asn, Glu or Ser;

XAA at position 67 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;

XAA at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;

XAA at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;

Xaa at position 70 is Asn, Leu, Val, Trp, Pro, or Ala;

XAA at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;

XAA at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;

XAA at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;

XAA at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala;

XAA at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln or Leu;

XAA at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;

XAA at position 77 is Ile, Ser, Arg, Thr, or Leu;

Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;

XAA at position 79 is Lys, Thr, Asn, Met, Arg, Ile, Gly, or Asp;

Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu or Arg;

XAA at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val or Lys;

XAA at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;

XAA at position 83 is Pro, Ala, Thr, Trp, Arg, or Met;

XAA in which ogenyi 84 is Cys, Glu, Gly, Arg, Met, or Val;

Xaa at position 85 is Leu, Asn, Val, or Gln;

XAA at position 86 is Pro, Cys, Arg, Ala, or Lys;

XAA at position 87 is Leu, Ser, Trp, or Gly;

XAA at position 88 is Ala, Lys, Arg, Val or Trp;

XAA at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn or Ser;

XAA at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile or Met;

XAA at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;

XAA at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile, or Leu;

XAA at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;

XAA at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro;

Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile, or Tyr;

XAA at position 96 is Pro, Lys, Tyr, Gly, Ile, or Thr;

XAA at position 97 is Ile, Val, Lys, Ala, or Asn;

Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr, or Pro;

XAA at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;

XAA at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln or Pro;

XAA at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu, or Gln;

XAA at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;

Xaa at position 103 is Asp, or Ser;

Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe or Gly;

XAA at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;

Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;

XAA at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, ln, His, Ser, Ala or Pro;

XAA at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;

XAA at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser, or Trp;

XAA at position 111 is Leu, Ile, Arg, Asp, or Met;

XAA at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;

XAA at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;

XAA at position 114 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;

XAA at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;

XAA at position 116 is Lys, Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln, or Ile;

Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys or Pro;

XAA at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;

XAA at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;

XAA at position 120 is Asn, Ala, Pro, Leu, His, Val, or Gln;

XAA at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;

XAA at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;

XAA at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;

and L1is a linker capable of binding R1and R2and specified hematopoietic protein can immediately precede (methionine-1), (alanine-1or (methionine-2, alanine-1);

and L1selected from the group consisting of permutations of amino acid sequences consisting of Gly, Asn, Ser, Thr, Ala, the hinge region of the heavy chain of immunoglobulin IgG, IgA, Ig, IgD or IgE hinge region of the gamma chain 2b mouse IgG, SEQ ID NO: 786-788, 793-797, 800-802, 861-865; and these linkers optionally contain optional sequence recognition endopeptidase; and from 1 to 14 amino acids optional deleterows from N-Terminus and/or from 1 to 15 amino acids optional deleterows with the end of the specified modified amino acid sequence of IL-3, and amino acids 0-44 denoted by XAA are different from the corresponding amino acids of native (1-133) interleukin-3 (IL-3) of a person.

2. Hematopoietic protein according to claim 1, characterized in that said protein is selected from the group consisting of SEQ ID NO: 581-588.

3. Hematopoietic protein of claim 1, wherein R2selected from the group consisting of SEQ ID NO: 803-806.

4. Hematopoietic protein containing the amino acid sequence of the formula R1-L1-R2, R2-L1-R1, R1-R2or R2-R1and R1is a polypeptide containing a modified amino acid sequence of the ligand, flt-3 SEQ ID NO:466, and N is the end attached to the C-end directly or through a linker (L2)selected from the group consisting of Ser, Asn, Gly, Thr, GlySer, AlaAla, GlySerGly, GlyGlyGly, GlyAsnGly, GlyAlaGly, GlyThrGly, AlaSerAla, AlaAlaAla, SEQ ID NO: 778-799 capable of linking the N-end C-end with the formation of new C - and N-to the CC when the amino acids:

28-2942-4393-94
29-3064-6594-95
30-3165-6695-96
31-3266-6796-97
32-3386-8797-98
34-3587-8898-99
36-3788-8999-100
37-3889-90100-101
38-3990-91101-102
39-4091-92102-103
40-4192-93respectively
41-42

and R2selected from the group consisting of GM-CSF, G-CSF, G-CSF Ser17, G-CSF Ala17c-mpl ligand (also known as TPO or MGDF), M-CSF, erythropoietin (EPO), IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, LIF, f1t3/f1k2-ligand, human growth hormone, growth factor B-cell differentiation factor In-cell factor differentiation of eosinophils and stem cell factor (SCF) (also known as steel factor or C-kit-ligand); and L1is a linker capable of binding R1and R2and specified hematopoietic protein may directly is edstone be preceded by (methionine -1), (alanine-1or (methionine-2, alanine-1); and L1selected from the group consisting of permutations of amino acid sequences consisting of Gly, Asn, Ser, Thr, Ala, SEQ ID NO: 786-788, 793-797, 800-802 and 861-865, the hinge region of the heavy chain of immunoglobulin IgG, IgA, IgM, IgD or IgE hinge region of the gamma chain 2b mouse IgG; and these linkers optionally contain optional sequence recognition endopeptidase.

5. Hematopoietic protein containing the amino acid sequence of the formula R1-L1-R2, R2-L1-R1, R1-R2or R2-R1and R1is a polypeptide containing a modified amino acid sequence of the ligand, flt-3 SEQ ID NO:466, and N is the end attached to the C-end directly or through a linker (L2)selected from the group consisting of Ser, Asn, Gly, Thr, GlySer, AlaAla, GlySerGly, GlyGlyGly, GlyAsnGly, GlyAlaGly, GlyThrGly, AlaSerAla, AlaAlaAla, SEQ ID NO: 778-799 capable of linking the N-end C-end with the formation of new C - and N-ends at amino acids

28-2942-4393-94
29-3064-6594-95
30-3165-6695-96
31-3266-6796-97
32-33 86-8797-98
34-3587-8898-99
36-3788-8999-100
37-3889-90100-101
38-3990-91101-102
39-4091-92102-103
40-4192-93respectively
41-42

and R2is a polypeptide containing a modified amino acid sequence of G-CSF human SEQ ID NO:858, where

XAA in position 1 is Thr, Ser, Arg, Tyr or Gly;

XAA in position 2 is Pro or Leu;

XAA at position 3 represents Leu, Arg, Thr or Ser;

Xaa in position 13 is a Phe, Ser, His, Thr or Pro;

XAA at position 16 is a Lys, Pro, Ser, Thr, or His;

XAA in position 17 represents Cys or Ser;

XAA at position 18 is a Leu, Thr, Pro, His, Ile or Cys;

XAA in position 22 is an Arg, Tyr, Ser, Thr or Ala;

Xaa at position 24 is an Ile, Pro, Tyr, or Leu;

XAA at position 27 is Asp or Gly;

XAA at position 30 is an Ala, Ile or Leu;

XAA at position 34 is a Lys or Sr;

Xaa at position 43 is a His, Thr, Gly, Val, Lys, Trp, Ala, Arg, Cys or Leu;

XAA at position 44 is a Pro, Gly, Arg, Asp, Val, Ala, His, Trp, Gln, or Thr;

XAA at position 46 is a Glu, Arg, or Ala;

XAA at position 47 is a Leu or Thr;

XAA at position 49 is a Leu, Phe, Arg or Ser;

XAA at position 50 represents Leu or His;

XAA at position 54 is a Leu or His;

XAA at position 67 is a Gln, Lys, Leu or Cys;

XAA at position 70 is a Gln, Pro, Leu, Arg or Ser;

XAA at position 104 is an Asp, Gly or Val;

Xaa at position 108 represents Leu, Ala, Val, Arg, Trp, Gln, or Gly;

XAA at position 115 is a Thr, His, Leu, or Ala;

XAA at position 144 represents Phe, His, Arg, Pro, Leu or Glu;

XAA at position 146 represents Arg or Gln;

Xaa at position 147 represents Arg or Gln;

XAA at position 156 represents His, Gly or Ser;

XAA at position 159 is a Ser, Arg, Thr, Tyr, Val or Gly;

XAA at position 162 represents Glu, Leu, Gly, or Trp;

XAA at position 163 is a Val, Gly, Arg, or Ala;

XAA at position 169 is a Ser, Leu, Arg or Cys;

Xaa at position 170 represents His, Arg or Sr;

moreover, 1-11 amino acids from N-Terminus and/or 1-5 amino acids from the C-end of optional deleterows from the specified modified amino acid sequence of G-CSF of human rights and with the N-end attached to the C-end directly or through a linker (L2)defined above and is able to connect the N-end C-end with the formation of new C - and N-ends at amino acids:

38-3962-63123-124
39-4063-64124-125
40-4164-65125-126
41-4265-66126-127
42-4366-67128-129
43-4467-68128-129
45-4668-69129-130
48-4969-70130-131
49-5070-71131-132
52-5371-72132-133
53-5491-92133-134
54-5592-93134-135
55-5693-94135-136
56-5794-95136-137
57-5895-96137-138
58-59 96-97138-139
59-6097-98139-140
60-6198-99140-141
61-6299-100141-142
  or 142-143

respectively

and L1is a linker capable of binding R1and R2and specified hematopoietic protein can immediately precede (methionine-1), (alanine-1or (methionine-2, alanine-1); and L1selected from the group consisting of permutations of amino acid sequences consisting of Gly, Asn, Ser, Thr, Ala, SEQ ID NO: 786-788, 793-797, 861-865 and 800-802, the hinge region of the heavy chain of immunoglobulin IgG, IgA, IgM, IgD or IgE; the hinge region of the gamma chain 2b mouse IgG; and these linkers optionally contain optional sequence recognition endopeptidase.

6. Hematopoietic protein according to claim 5, characterized in that said protein is selected from the group consisting of SEQ ID NO: 659, 705 and 743.

7. The DNA sequence encoding a hematopoietic protein and having a nucleotide sequence that determines the amino acid sequence of the protein described in any of items 1-6.

8. The DNA sequence according to claim 7, wherein selected from the group, with Toyama of SEQ ID NO: 121-128, 198, 244 and 282.

9. The method of obtaining hematopoietic protein, providing for cultivation in suitable trophic conditions of the host cell, transformed or transtitional capable of replicating a vector containing a DNA sequence, characterized in claim 7 or 8, therefore, to ensure the expression of the specified hematopoietic protein, the collection of these cultivated cells and the selection of the specified hematopoietic protein.

10. Pharmaceutical composition for stimulating the production of hematopoietic cells, containing an effective amount of hematopoietic protein described in any of items 1 to 6, and a pharmaceutically acceptable carrier.

11. Ways to stimulate the production of hematopoietic cells in a patient to which the stages of introduction of a given patient an effective amount of hematopoietic protein described in any of items 1, 4 and 5.

12. Process for the selective expansion of hematopoietic cells ex vivo, providing a stage (a) cultivation of these hematopoietic cells in culture medium containing hematopoietic protein described in any of items 1 to 6, and (b) the collection of these cultured cells.

13. The method according to item 12, and these hematopoietic cells are CD34-positive cells.

14. The method according to item 12, and pointed to by the E. hematopoietic cells are peripheral blood cells.

15. Method of producing dendritic cells, providing for stage (a) division of precursor cells in the blood from other cell types; (b) cultivation of these precursor cells hematopoiesis in culture medium containing hematopoietic protein described in any of items 1 to 6; and (C) collecting these cultured cells.

16. The method according to clause 15, further providing for the stage (d) antigen stimulation of these precursor cells of the blood.

17. The method according to item 15 or 16, where these precursor cells of the blood are CD34-positive cells.

18. The method according to any of PP-17, with the specified culture medium additionally contains one or more factors selected from the group comprising GM-CSF, IL-4, TNFα, stem cell factor (SCF), the ligand, flt-3, IL-3, variant IL-3, a hybrid protein variant IL-3, and a multi-agonist receptors.

19. A method of treating a person suffering from a tumor, an infectious disease or an autoimmune disease involving stage (a) mobilize the precursors of dendritic cells or Mature dendritic cells by introducing a specified person hematopoietic protein described in any of items 1 to 6; (b) the allocation of these precursors of dendritic cells or Mature dendritic to etoc using sampling blood or Teresa; (C) stimulation by antigen precursors of dendritic cells or Mature dendritic cells and (g) return the specified stimulated by antigen precursors of dendritic cells or Mature dendritic cells in the body of the specified person.

20. The method according to claim 19, further providing for the introduction on the stage (a) one or more factors selected from the group including DM-SF, IL-4, NFα, stem cell factor (SCF), the ligand, flt-3, IL-3, variant IL-3, a hybrid protein variant IL-3, and a multi-agonist receptors.

21. The method according to claim 19 or 20, further providing for stage cultivate these precursors of dendritic cells or Mature dendritic cells at the stage (b) in culture medium containing hematopoietic protein described in any of items 1-6.

22. The method according to any of PP-21, and the specified culture medium additionally contains one or more factors selected from the group comprising GM-CSF, IL-4, TNFα, stem cell factor (SCF), the ligand, flt-3, IL-3, variant IL-3, a hybrid protein variant IL-3, and a multi-agonist receptors.



 

Same patents:

FIELD: immunotherapeutic agents.

SUBSTANCE: antigenic preparations are obtained from keratinophilic fungi Trichophiton or Microsporum species or yeast species Candida by alkali hydrolysis techniques. Thus obtained preparations can be, in particular used, as vaccines and for treating allergy and modulating immune response.

EFFECT: expanded immunotherapeutic possibilities.

17 cl, 5 dwg, 12 tbl, 20 ex

Thrombopoietin // 2245365

FIELD: medicine, molecular biology, polypeptides.

SUBSTANCE: invention describes homogenous polypeptide ligand mpI representing polypeptide fragment of the formula: X-hTPO-Y wherein hTPO has amino acid sequence of human fragments TPO (hML); X means a amino-terminal amino-group or amino acid(s) residue(s); Y means carboxy-terminal carboxy-group or amino acid(s) residue(s), or chimeric polypeptide, or polypeptide fragment comprising N-terminal residues of amino acid sequence hML. Also, invention relates to nucleic acid encoding polypeptide and expressing vector comprising nucleic acid. Invention describes methods for preparing the polypeptide using cell-host transformed with vector, and antibodies raised against to polypeptide. Invention describes methods and agents using active agents of this invention. The polypeptide ligand mpI effects on replication, differentiation or maturation of blood cells being especially on megacaryocytes and progenitor megacaryocyte cells that allows using polypeptides for treatment of thrombocytopenia.

EFFECT: valuable medicinal properties of polypeptide.

21 cl, 92 dwg, 14 tbl, 24 ex

Thrombopoietin // 2245365

FIELD: medicine, molecular biology, polypeptides.

SUBSTANCE: invention describes homogenous polypeptide ligand mpI representing polypeptide fragment of the formula: X-hTPO-Y wherein hTPO has amino acid sequence of human fragments TPO (hML); X means a amino-terminal amino-group or amino acid(s) residue(s); Y means carboxy-terminal carboxy-group or amino acid(s) residue(s), or chimeric polypeptide, or polypeptide fragment comprising N-terminal residues of amino acid sequence hML. Also, invention relates to nucleic acid encoding polypeptide and expressing vector comprising nucleic acid. Invention describes methods for preparing the polypeptide using cell-host transformed with vector, and antibodies raised against to polypeptide. Invention describes methods and agents using active agents of this invention. The polypeptide ligand mpI effects on replication, differentiation or maturation of blood cells being especially on megacaryocytes and progenitor megacaryocyte cells that allows using polypeptides for treatment of thrombocytopenia.

EFFECT: valuable medicinal properties of polypeptide.

21 cl, 92 dwg, 14 tbl, 24 ex

FIELD: biotechnology, medicine, infectious diseases, medicinal microbiology.

SUBSTANCE: invention relates to a composition designated for treatment and prophylaxis of infections caused by Neisseria microorganism that comprises the following components: (a) protein with amino acid sequence similar by 65% and above with the natural Neisseria protein of a single species (the first group of amino acid sequences is given in the text) and/or its fragment consisting of 10 and more amino acids and eliciting antigen properties; (b) the second protein with amino acid sequence similar by 65% and above with the natural Neisseria protein of another species (the second group of amino acid sequences with even numbers is given in the text), and/or its fragment consisting of 10 or more amino acids and eliciting antigen properties; in particular, the second protein represents NspA. The composition comprises additionally adjuvant. The composition is used both a medicinal agent and for manufacturing the medicinal agent. Applying the invention provides enhancing the effectiveness of prophylaxis or treatment due to the universal effect of the composition (vaccine). Invention can be used in medicine for treatment of infections.

EFFECT: valuable medicinal properties of composition.

8 cl, 137 dwg, 5 tbl, 12 ex

FIELD: genetic engineering, immunology, medicine.

SUBSTANCE: invention relates to new antibodies directed against antigenic complex CD3 and can be used in therapeutic aims. Antibody IgG elicits the affinity binding with respect to antigenic complex CD3 wherein heavy chain comprises skeleton of the human variable region in common with at least one CD3 taken among amino acid sequences SEQ ID NO 2, 4 and 6 and their corresponding conservatively modified variants. Light chain comprises skeleton of the rodent variable region in common with at least one CD3 taken among amino acid sequences SEQ ID NO 8, 10 and 12 and their corresponding conservatively modified variants. Antibody is prepared by culturing procaryotic or eucaryotic cell co-transformed with vector comprising recombinant nucleic acid that encodes antibody light chain and vector comprising recombinant nucleic acid that encodes antibody heavy chain. Antibody is administrated in the patient suffering with malignant tumor or needing in immunosuppression in the effective dose. Invention provides preparing chimeric antibodies against CD3 that are produced by expression systems of procaryotic and eucaryotic cells with the enhanced yield.

EFFECT: improved preparing methods, valuable medicinal properties of antibody.

33 cl, 5 dwg, 1 ex

FIELD: biotechnology, microbiology, agriculture.

SUBSTANCE: the strain Lactobacillus plantarum 578/25 is obtained by method of step-by-step selection and selected by its ability to produce significant amount of crude protein and to accumulate the biomass. The strain is deposited in the VGNKI collection at number VGNKI-03.04.09.-DEP. Invention provides eliminating the pollution of environment in producing the protein fodder, to elevate the protein specific yield, to reduce energy consumptions in preparing protein fodder, to simplify and to accelerate the process of its preparing, to simplify apparatus equipment, to utilize waste in manufacturing using the natural raw.

EFFECT: valuable properties of strain.

2 tbl, 10 ex

FIELD: biotechnology, agriculture, microbiology.

SUBSTANCE: invention relates to a new isolated strain of Lactobacillus acidophilus 1660/08 as a producer of the protein fodder. The strain Lactobacillus acidophilus 1660/08 is obtained by the selection method and selected by its ability to form significant amount of crude protein and to accumulate the biomass. The strain is deposited in the VGNKI collection at number VGNKI-03.04.10.-DEP. Invention provides eliminating the environment pollution in producing the protein fodder, to enhance the specific protein yield, to reduce energy consumptions in preparing protein fodder, to simplify and to accelerate the process in its preparing, to simplify equipment fitting out and to utilize waste in manufactures using natural raw.

EFFECT: valuable properties of strain.

2 tbl, 10 ex

FIELD: fodder industry.

SUBSTANCE: invention relates to a method for preparing protein-vitamin fodder that involves solid or liquid waste in production and processing the natural raw (grains, milling waste, post-alcoholic distillery grains, beer pellets, fruit pulps or whey). Enzyme lysates are prepared from solid waste and starch waste. Cobalt salt is added to liquid waste or enzyme lysates. Prepared nutrient medium is used in incubation of lactobacillus and propionibacillus microorganisms taken by the following pairs: Lactobacillus acidophilus 1660/02 with Propionibacterium freudenreichii subsp. shermanii 103/12; or Lactobacillus acidophilus 1660/02 with Propionibacterium acnes 1450/28; or Lactobacillus plantarum 578/25 with Propionibacterium freudenreichii subsp. shermanii 103/12; or Lactobacillus plantarum 578/25 with Propionibacterium acnes 1450/28. This method provides preparing fodder enriched with vitamins and proteins and containing live cells of lactobacillus and propionibacillus microorganisms. Method enriches animal intestine microflora after feeding the prepared fodder to animals. Fodder comprises protective substances (organic acids, enzyme systems) and can be stored as crude form for the prolonged time.

EFFECT: improved preparing method, valuable properties of fodder.

13 cl, 1 tbl, 12 ex

FIELD: genetic engineering, immunology, medicine.

SUBSTANCE: invention relates to new antibodies directed against antigenic complex CD3 and can be used in therapeutic aims. Antibody IgG elicits the affinity binding with respect to antigenic complex CD3 wherein heavy chain comprises skeleton of the human variable region in common with at least one CD3 taken among amino acid sequences SEQ ID NO 2, 4 and 6 and their corresponding conservatively modified variants. Light chain comprises skeleton of the rodent variable region in common with at least one CD3 taken among amino acid sequences SEQ ID NO 8, 10 and 12 and their corresponding conservatively modified variants. Antibody is prepared by culturing procaryotic or eucaryotic cell co-transformed with vector comprising recombinant nucleic acid that encodes antibody light chain and vector comprising recombinant nucleic acid that encodes antibody heavy chain. Antibody is administrated in the patient suffering with malignant tumor or needing in immunosuppression in the effective dose. Invention provides preparing chimeric antibodies against CD3 that are produced by expression systems of procaryotic and eucaryotic cells with the enhanced yield.

EFFECT: improved preparing methods, valuable medicinal properties of antibody.

33 cl, 5 dwg, 1 ex

FIELD: organic chemistry, natural compounds, medicine, oncology.

SUBSTANCE: invention represents new saponin mixtures used for inhibition of initiation and activation of mammalian epithelial cell in pre-malignant or malignant state, for stimulation of apoptosis of mammalian malignant cell, prophylaxis of anomalous proliferation of mammalian epithelial cell, for treatment of inflammatory and regulation of angiogenesis in mammal. These mixtures are isolated form plants of species Acacia victoriae. Also, invention relates to methods for their applying. These compounds can comprise triterpene component, such as acacic or oleanolic acid to which oligosaccharides and monoterpenoid components are joined. Mixtures and compounds elicit properties associated with regulation of apoptosis and cytotoxicity of cells and strong anti-tumor effect with respect to different tumor cells.

EFFECT: valuable medicinal properties of compositions.

43 cl, 53 tbl, 50 dwg, 44 ex

FIELD: biology, genetic engineering.

SUBSTANCE: invention relates to preparing immortalized cellular lines from health human skin tissues and can be used in immunological, pharmacological, photo- and chemical-toxicological analysis of cutaneous response, for expression of heterologous genes and for construction of artificial skin. Keratinocytes are immortalized by infection of keratinocytes of health human. The human skin sample is isolated and prepared its for culturing in vitro. Keratinocytes are prepared from this prepared human skin sample and plated in serum-free medium for growing keratinocytes in cultural plates with cover alleviating attachment and growth of cells. In the process for culturing keratinocytes the serum-free medium is replaced to provide preparing the optimal confluent growth of cells in culture with continuous maintenance of cup cover. Keratinocytes are transferred in selective serum-free medium in cultural cups with cover and infected with vectors pLXSHD + SV40(#328) and pLXSHD + E6/E7. Then prepared immortalized keratinocytes are transferred in cultural cups with cover to useful medium for proliferation. Then prepared proliferated keratinocytes are transferred in medium with high calcium content for differentiation in cultural chambers with cover. Invention provides preparing the human keratinocyte cellular line that has no oncogenic property and retains capacity for differentiation and expression of proteins and enzymes expressing by normal differentiated keratinocytes being even after increased number of passages in culture. Also, this cellular line forms lamellar and polarized epithelium with keratinized layer (stratum corneum) consisting of ortho-keratinocytes in the process for culturing in organotypical culture in serum-free medium and without layer of feeding cells.

EFFECT: improved immortalizing method, valuable biological properties of cellular line.

7 cl, 2 dwg, 4 ex

The invention relates to biotechnology and Cryobiology

The invention relates to medicine, namely to cell therapy, and for the culture of cells containing precursor cells osteogenesis of the implant based on it and use it to restore the integrity of the bone
The invention relates to ophthalmology and is used for correction of degenerative changes of the retina by pathology of various origins

The invention relates to biotechnology and can be used in medical, cosmetic and food industry

The invention relates to biotechnology and medicine, specifically to the media for cryopreservation of human and animal cells

FIELD: genetic engineering, immunology, medicine.

SUBSTANCE: invention relates to new antibodies directed against antigenic complex CD3 and can be used in therapeutic aims. Antibody IgG elicits the affinity binding with respect to antigenic complex CD3 wherein heavy chain comprises skeleton of the human variable region in common with at least one CD3 taken among amino acid sequences SEQ ID NO 2, 4 and 6 and their corresponding conservatively modified variants. Light chain comprises skeleton of the rodent variable region in common with at least one CD3 taken among amino acid sequences SEQ ID NO 8, 10 and 12 and their corresponding conservatively modified variants. Antibody is prepared by culturing procaryotic or eucaryotic cell co-transformed with vector comprising recombinant nucleic acid that encodes antibody light chain and vector comprising recombinant nucleic acid that encodes antibody heavy chain. Antibody is administrated in the patient suffering with malignant tumor or needing in immunosuppression in the effective dose. Invention provides preparing chimeric antibodies against CD3 that are produced by expression systems of procaryotic and eucaryotic cells with the enhanced yield.

EFFECT: improved preparing methods, valuable medicinal properties of antibody.

33 cl, 5 dwg, 1 ex

Up!