Immunostimulating nucleic acids

FIELD: medicine, immunology, nucleic acids.

SUBSTANCE: invention relates to a method for stimulation of the immune response using nucleic acids-containing immunostimulating compositions, oligonucleotide-containing composition and to a method for treatment or prophylaxis of allergy or asthma. For stimulation of the immune response thymidine-enriched nucleic acid comprising poly-T sequences and/or comprising above 60% of thymidine-containing nucleotide residues is administrated. Invention provides the development of new method for stimulation of the immune response due to administration of the proposed immunostimulating nucleic acid.

EFFECT: valuable medicinal properties of nucleic acid.

27 cl, 12 dwg, 12 ex

 

Prior art

Bacterial DNA, but not vertebrate DNA immune-boosting effects on mononuclear cells of peripheral blood (RVMS) in vitro (Krieg et al., 1995). Bacterial DNA, but not vertebrate DNA is characterized immunostimulating effects in relation to the activation of b-cells and cells-natural killer cells (Tokunaga, T., et al., 1988. Jpn. J. Cancer Res. 79: 682-686; Tokunaga, T., et ai., 1984, JNCI 72: 955-962; Messina, J.P., et al., 1991, J.Immunol. 147: 1759-1764; and review Krieg, 1998, In: Applied Oligonucieotide Technology, C.A. Stein and A.M. Krieg, (Eds.), Jone Wiley and Sons, Inc., New York, NY, pp.431-448). It is now clear that these immunostimulatory effects of bacterial DNA are the result of the presence neetilirovannyj CpG dinucleotides in specific contexts (CpG motifs)that are common to bacterial DNA, but are methylated and are underrepresented (decrease CpG from 1/50 to 1/60) in vertebrate DNA (Krieg et al, 1995, Nature 374: 546-549; Krieg, 1999 Biochim. Biophys. Acta 93321: 1-10). Immunostimulatory effects of bacterial DNA can be modeled using a synthetic oligodeoxynucleotides (ODN)containing the data of CpG-motifs. It seems likely that the rapid immune activation in response to CpG-DNA can develop as one of the components of the natural immune defense mechanisms that recognize structural features that are specific to the molecules of microbes.

ODN CpG possess strong the mi stimulating effects in respect of human leukocytes and mouse inducyruya proliferation of almost all (>95%) In cells, and increase the secretion of immunoglobulins (Ig); secretion of cytokines; Lisino cell activity of natural killer cells (NK) and the secretion of lFN-γ; and activation of dendritic cells (DCS) and other antigen-presenting cells in relation to the expression of co-stimulating molecules and secretion of cytokines, particularly Th1-like cytokines, which are important to support the development of Th1-like responses of T cells. Activation of b-cells under the action of CpG-DNA is independent of T cells and antigenspecific. However, activation of b-cells with low concentrations of CpG-DNA is characterized by a strong synergy with the signals transmitted through antigen receptors of b-cells, both in respect of the proliferation of b cells and Ig secretion (Krieg et al., 1995). This apparent synergism between signalling pathways In cells, trigger, which is the antigen receptor of b-cells and CpG DNA promotes antigenspecific immune responses. In addition to their direct effects on b cells with CpG DNA also directly activate monocytes, macrophages and dendritic cells in relation to the secretion of cytokines, including high levels of IL-12 (Klinman et al., 1996; Halpern et al., 1996; Cowdery et al., 1996). These cytokines stimulate the cells-natural killer (NK) for the secretion of interferon gamma (IFN-γ) and increase their Lisino activity (Klinman et al. 1996, above; Cowdery et al., 1996, above; Yamamota et al., 1992; Ballas et al., 1996). In General, CpG-DNA induces Th1-like nature of the production of cytokines with a predominance of IL-12 and IFN-γ and with a small secretion of Th2-cytokines (Klinman et al., 1996). Strong direct effects (independent of T cells) CpG-DNA b cells as well as induction of cytokines, which may have indirect effects on b cells through T-helper path involves the use of CpG-DNA in the form of ODN as adjuvant vaccine. (See patent PCT application, publication No.: WO 98/40100).

Data immunostimulatory effects of natural phosphodieterase backbone CpG ODN of vysokospetsifichnymi for CpG so that effects almost disappear if the motif CpG methylated, changed to GpC or destroyed or changed in another way (Krieg et al., 1995 Nature 374: 546-549; Hartmann et al 1999 Proc. Natl. Acad. Sci USA 96: 9305-10). Phosphodieterase CpG ODN can be enclosed in vesicles of lipids, alum or bubbles of other types with the properties of storing or improved capture of cells to increase the immunostimulatory effects (Yamamoto et al., 1994 Environ. Immunol. 38: 831-836; Gramzinski et al., 1998 Mol. Med. 4: 109-118).

In early studies it was assumed that the immunostimulating CpG motif corresponds to the formula purine-purine-G-pyrimidine-pyrimidine (Krieg et al., 1995 Nature 374: 546-549; Pisetsky, 1996 J. Immunol. 156: 421-423; Hacker et al., 1998 EMBO J. 17: 6230-6240; Lipford et al., 1998 Trends in Environ. 6:496-500). However, it is now clear that limp city mouse quite well answer phosphodieterase CpG-motifs which do not match a given "formula" (Yi et al., 1998 J. Immunol. 160: 5898-5906), and the same is true for human cells and dendritic cells (Hartmann et al., 1999 Proc. Natl. Acad. Sci USA 96: 9305-10; Liang, 1996 J. Clin. Invest. 98: 1119-1129).

Several researchers in the past examined whether the content of the nucleotides in ONE act independently of the sequence of ODN. Interestingly, it was found that antisense ODN usually enriched GG, CCC, CC, CAC and CG sequences, at the same time having reduced the frequency of the nucleotide sequences of TP or TSS compared with expected, if the use of reason was random (Smetsers et al., 1996 Antisense Nucleic Acid Drug Develop. 6: 63-67). This increases the possibility that presents more sequences can contain the preferred elements aimed at a target in the form of antisense oligonucleotides, and Vice versa. One of the reasons to avoid using a thymidine-rich ODN experiments antimuslim sequences is that the destruction of ONE by nucleases present in the cells leads to the release of free thymidine, which competes with3H-thymidine, which is often used in experiments to assess cell proliferation (Matson et al., 1992 Antisense Research and Development 2:325-330).

A brief statement of the substance of the invention

Now izaberete the s refers to partially enriched with pyridine (PY-enriched) and in some implementations it is enriched with thymidine (T) immunostimulatory nucleic acids, which do not require the presence of CpG-motif. The present invention also relates in part to the discovery that nucleic acids that contain TG-dimer motif, are also boosting. The invention is based in part on the unexpected evidence that the nucleic acid sequences that do not contain CpG motifs are boosting. In the analysis of immunostimulatory properties of many sequences of nucleic acids was revealed that these sequences can be Ru-enriched, for example the T-enriched, or they may contain TG-motives. It was also revealed that these sequences preferably activates the immune cells of animals other than rodents. Ru-rich and TG sequences have only a minimal immunostimulating properties in respect of immune cells in rodents compared with the immune cells of animals other than rodents. Thus, it is possible in accordance with the methods of the invention to induce an immune response in the subject, which is not a rodent, through the introduction of Ru-fortified or containing TG-motifs are immunostimulatory nucleic acids. Ru-fortified or containing TG-motifs are immunostimulatory nucleic acid according to the invention may not necessarily include CpG-mo is willow. These data are important for the development of clinical applications containing immunostimulatory CpG and not containing a CpG nucleic acids.

In one embodiment, the invention features a pharmaceutical composition comprising an effective amount to stimulate an immune response selected Ru-fortified or containing TG-motifs are immunostimulatory nucleic acid and a pharmaceutically acceptable carrier. In other embodiments, the invention features a composition of the subject invention, which includes a dedicated Roux-fortified or containing TG-motives immunostimulirutuyu nucleic acid. In other implementations immunostimulirutuyu nucleic acid may be T-enriched. In another aspect immunostimulirutuyu nucleic acid may be T-enriched and also to have at least one TG is the motive.

Preferably Ru-enriched nucleic acid is a T-rich nucleic acid. In some implementations of the T-rich nucleic acid is a poly-T nucleic acid comprising 5 TTTT’. In another implementation poly T nucleic acid comprises in 5'H1X2TTTH3X43’, where X1, X2, X3and X4are nucleotides. In some implementations X1X 2are TT and/or X3X4are TT. In other implementations X1X2selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC; and/or X3X4selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA and GC.

T-enriched immunostimulirutuyu nucleic acid can have only one poly-T motif, or it can have multiple poly-T motifs nucleic acid. In some implementations of the T-enriched immunostimulirutuyu nucleic acid comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 or at least 8 T-motives. In other implementations it includes at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 or at least 8 CpG motifs. In the preferred implementation of numerous CpG motifs and poly-T motifs scattered.

In another implementation, at least one of the sets of poly-T motifs contains at least 3, at least 4, at least 5, at least 6, at least 7, at least 8 or at least 9 contiguous T-nucleotide residue. In other implementations multiple poly-T motifs represents at least 3 of motive and of data IU is greater least 3 motifs each comprises at least 3 contiguous T-nucleotide residue or multiple poly-T motifs represents at least 4 of the motif and data from at least 4 of motives, each comprises at least 3 contiguous T-nucleotide residue.

In some cases the T-enriched immunostimulirutuyu nucleic acid may be free of poly-T motifs, but may preferably include a nucleotide composition of greater than 25% So In other implementations of the T-rich immunostimulatory nucleic acids are poly-T motifs and also include a nucleotide composition of greater than 25% of T. In the preferred implementation of the T-enriched immunostimuliruuchee nucleic acid includes the nucleotide composition with more than 35% T, more than 40% T, greater than 50% T, more than 60% T, more than 80% Vol or more than 90% T nucleotide residues. In an important implementation nucleic acid has at least 50% of T.

T-rich and TG immunostimulatory nucleic acid can be of any length greater than 7 nucleotides, but some implementations may have between 8 and 100 nucleotide residues in length. In the preferred implementation of the T-enriched immunostimulirutuyu nucleic acid comprises at least 20 nucleotides, at least 24 nucleotides is, at least 27 nucleotides, or at least 30 nucleotides. In the preferred implementation immunostimulirutuyu TG-nucleic acid length is between 15 and 25 nucleotides. T-rich and TG immunostimulatory nucleic acid can be single and double-stranded.

In one preferred implementation immunostimulirutuyu nucleic acid has a T-rich region located in the middle of its length (i.e. approximately equal to the number of nucleotides adjacent to the T-rich region with 5’ and 3’ ends).

T-rich nucleic acid in some implementations selected from the group consisting of SEQ ID NO: 59-63, 73-75, 142, 215, 226, 241, 267-269, 282, 301, 304, 330, 342, 358, 370-372, 393, 433, 471, 479, 486, 491, 497, 503, 556-558, 567, 694, 793-794, 797, 833, 852, 861, 867, 868, 882, 886, 905, 907, 908 and 910-913. In other implementations of the T-enriched nucleic acids represent a sequence selected from the group consisting of SEQ ID NO: 64, 98, 112, 146, 185, 204, 208, 214, 224, 233, 244, 246, 247, 258, 262, 263, 265, 270-273, 300, 305, 316, 317, 343, 344, 350, 352, 354, 374, 376, 392, 407, 411-413, 429-432, 434, 435, 443, 474, 475, 498-501, 518, 687, 692, 693, 804, 862, 883, 884, 888, 890 and 891.

In other implementations Ru-enriched immunostimulirutuyu nucleic acid is a C-enriched nucleic acid. Immunostimulirutuyu With-enriched nucleic acid is a nucleic acid containing at IU is greater as one, and preferably at least 2 poly-region, or containing 50% or more With the nucleotide.

Ru-rich and TG immunostimulatory nucleic acid can include one or more CpG motifs. Motives can be methylated or demetilirovanny. In other implementations Ru-rich and TG immunostimulatory nucleic acid is free from one or more CpG dinucleotides.

In other implementations Ru-rich and TG immunostimulatory nucleic acids also include poly-A, poly-G, and/or poly-a motifs. In another implementation Ru-enriched or immunostimulirutuyu TG-nucleic acid-free two poly-C sequences of at least 3 contiguous With nucleotide residues or free from two poly-a sequences of at least 3 contiguous And nucleotide residues. In other implementations Ru-enriched or immunostimulirutuyu TG-nucleic acid has a nucleotide composition of greater than 25% or more than 25% A. in Another implementation Ru-enriched or immunostimulirutuyu TG-nucleic acid-free poly-C sequences, poly-C sequences or poly-a sequences.

Poly-G nucleic acid in some implementations selected from the group consisting of SEQ ID NO: 5, 6, 73, 215, 267-269, 276, 282, 288, 297-299, 355, 359, 386, 387, 444, 476, 531, 57-559, 733, 768, 795, 796, 914-925, 928-931, 933-936 and 938. In other implementations poly-G nucleic acid comprises a sequence selected from the group consisting of SEQ ID NO: 67, 80-82, 141, 147, 148, 173, 178, 183, 185, 214, 224, 264, 265, 315, 329, 434, 435, 475, 519, 521-524, 526, 527, 535, 554, 565, 609, 628, 660, 661, 662, 725, 767, 825, 856, 857, 876, 892, 909, 926, 927, 932 and 937.

In accordance with another variant of the invention, the immunostimulatory nucleic acid can be defined as those having TG-motive, here denoted as TG immunostimulatory nucleic acid. TG-nucleic acid in one implementation contains at least one TG dinucleotide having a sequence comprising at least the following formula: 5'N1X1TGX2N23’. Similar realizations N1is a sequence of nucleic acid, consisting of a number of nucleotides, fluctuating in the range from (11-N2) to (21-N2), and N2is a sequence of nucleic acid, consisting of a number of nucleotides, fluctuating in the range from (11-N2) to (21-N1). In the preferred implementation of the X2represents thymidine.

In other implementations TG-nucleic acid has at least the following formula: 5'X1X2TGX3X43’. In another implementation of TG-nucleic acid which engages in the following sequence: 5'N 1X1X2TGX3X4N23’. A similar implementation of N1is a sequence of nucleic acid, consisting of a number of nucleotides, fluctuating in the range of (9-N2) to (19-N2), and N2is a sequence of nucleic acid, consisting of a number of nucleotides, fluctuating in the range of (9-N1) to (19-N1). In one preferred implementation of the X3represents thymidine. X1X2represent nucleotides that can be selected from the group consisting of GT, GG, GA, AA, AT, AG, P, CA, CG, TA and TT and X3X4represent nucleotides that can be selected from the group consisting of TT, ST, AT, AG, CG, TC, AC, CC, TA, AA and SA. In some preferred implementations X3represents thymidine. In an important implementation X3X4represent nucleotides that can be selected from the group consisting of TT, TC, and TG. In another implementation of the X1X2are GA or GT and X3X4are TT. In another implementation of the X1or X2or both are purines, and X3or X4or both are pyrimidines, or X1X2are GpA and X3or X4or both are pyrimidines. In the bottom the implementation of X 2is a T, and X3is a pyrimidine.

In one implementation 5'X1X2TGX3X13’ sequence TG-nucleic acid or TG-nucleic acid of the full length, or some fragment are nepalindromnoi of the sequence, and other implementation - palindrome sequence.

In some preferred implementations TG-nucleic acid is also T-enriched.

Ru-rich and TG immunostimulatory nucleic acid in some implementations have a nucleotide backbone that includes at least one modification of the skeleton, such as phosphorotioate modification. Nucleotide backbone may be a hybrid or preferably the nucleotide backbone is fully modified. In one preferred implementation immunostimulirutuyu nucleic acid is a poly-T motif and positivity frame.

In another embodiment, the invention is a composition immunostimulatory nucleic acid in the form of a PY-rich or TG immunostimulatory nucleic acid and antigen, where the nucleic acid is free from neetilirovannyj CpG motifs.

Another composition according to the invention is a Roux-enriched or immunostimulirutuyu TG-nucleic acid to the slot and an antimicrobial agent, where PY-rich or TG-nucleic acid is free from neetilirovannyj CpG motifs. Preferably the antimicrobial agent is selected from the group consisting of antiviral agent, an antiparasitic agent, an antibacterial agent and an antifungal agent.

The composition of the device with a constant release, including Roux-enriched and/or immunostimulirutuyu TG-nucleic acid, where Ru-enriched and/or TG-nucleic acid is free from neetilirovannyj CpG motifs, it is proposed in accordance with another variant of the invention.

The invention also includes nutritional supplements PY-rich or TG immunostimulatory nucleic acid and a device for delivering selected from the group consisting of capsules, pills and sublingual tablets, where PY-rich or TG-nucleic acid is free from neetilirovannyj CpG motifs.

It should be clear that when it is useful to enter Ru-enriched, for example, poly-T, T-fortified, enriched or TG-oligonucleotide and CpG-oligonucleotide, may also be desirable joint introduction PY-rich or TG-oligonucleotide together with physically separate CpG, Py-rich or TG-oligonucleotide. In the opposite version of the CpG, PY-rich or TG-motif may be present in the same nuclein the th acid in the form of adjacent PY-rich or TG-oligonucleotide. In another implementation, some or all combinations of Ru-enriched, TG - and CpG nucleic acids can be entered together or as a separate nucleic acid, either in the same molecule of nucleic acid. Under the joint introduction is meant that the nucleic acid will be administered sufficiently close in time to each other to achieve the combined efficiency of both oligonucleotides, preferably greater than the beneficial effect achieved by the introduction of each of the oligonucleotides separately in the same dose.

CpG-oligonucleotides generally have the formula 5'X1X2CGX3X43’, where X1X2, X3and X4represent nucleotides and where at least one of the CpG demetilirovanny. Preferred CpG-oligonucleotides are 8-100 nucleotides in length and have modified skeletons. Specific patterns are described in detail in published PCT application claims the U.S. and cited here for reference, the opening of which is included here in full. In one implementation of the CpG oligonucleotide is free from poly-T and TG-motives and is not T-enriched.

In other implementations of the CpG oligonucleotide has a sequence selected from the group consisting of SEQ ID NO: I, 3, 4, 14-16, 18-24, 28, 29, 33-46, 49, 50, 52-56, 58, 64-67, 69, 71, 72, 76-87, 90, 91, 93, 94, 96, 98, 102-124, 126-128, 131-133, 136-141, 146-150, 152-153, 155-171 173-178, 180-186, 188-198, 201, 203-214, 216-220, 223, 224, 227-240, 242-256, 258, 260-265, 270-273, 275, 277-281, 286 and 287, 292, 295-296, 300, 302, 305-307, 309 to 312, 314-317, 320-327, 329, 335, 337-341, 343-352, 354, 357, 361-365, 367-369, 373-376, 378-385, 388-392, 394, 395, 399, 401-404, 406-426, 429-433, 434-437, 439, 441-443, 445, 447, 448, 450, 453-456, 460 to 464, 466-469, 472-475, 477, 478, 480, 483-485, 488, 489, 492, 493, 495-502, 504-505, 507-509, 511, 513-529, 532-541, 543-555, 564-566, 568-576, 578, 580, 599, 601-605, 607-611, 613-615, 617, 619-622, 625-646, 648-650, 653-664, 666-697, 699-706, 708, 709, 711-716, 718-732, 736, 737, 739-744, 746, 747, 749-761, 763, 766-767, 769, 772-779, 781-783, 785-786, 7900792, 798-799, 804-808, 810, 815, 817, 818, 820-832, 835-846, 849-850, 855-859, 862, 865, 872, 874-877, 879-881, 883-885, 888-904 and 909-913.

In another implementation of the PY-rich or TG-free oligonucleotide from the CpG motifs. This implementation of the invention also includes pharmaceutical compositions and kits that contain CpG-oligonucleotide (which may be free of poly-T and TG-motives and is not T-enriched)and Roux-enriched and/or TG-oligonucleotide, physically separate from the CpG oligonucleotide. Pharmacological agents are effective quantities and usually include pharmaceutically acceptable carriers, all as explained in detail here, for Ru-rich and TG-oligonucleotides. The kits include at least one container containing an oligonucleotide probe, which is a PY-rich or TG-oligonucleotide (or some combination thereof). The same container or in other implementations, the second container may with erati oligonucleotide from the CpG-motif which can be free from Ru-enriched and/or TG-motives. The kit also contains instructions for the introduction of the oligonucleotide to the subject. The kits can also include a container containing a solvent or diluent.

In General, as quoted here in full, CpG-oligonucleotide physically separated from the PY-rich or TG-oligonucleotide, may be applied together with the PY-rich or TG-oligonucleotides in the methods, compositions, and products described above.

The invention relates to other aspects of immunostimulatory oligonucleotides that have Chimera hulls and which do not require the presence of CpG-motif. The invention is based in part on the discovery that nucleic acid sequences that did not contain CpG motifs were immunostimuliruyushhim, and that those who have Chimera hulls, have suddenly increased immunostimulating properties. Thus, in one embodiment, the invention relates to the composition of the oligonucleotide having the formula: 5'Y1N1ZN2Y23’, where Y1and Y2independently from each other represent a molecule of nucleic acids having from 1 to 10 nucleotides, where Y1includes at least one modified mezhnukleotidnyh communication, a Y2includes at least one modi is annoy mezhnukleotidnyh communication, and where N1and N2represent molecules of nucleic acids, which independently of one another are from 0 to 5 nucleotides, but where N1ZN2has at least 6 nucleotides in the amount, and where the nucleotides N1ZN2have fosfodiesterzy frame, and where Z is an immunostimulating motif nucleic acid, but does not include the CG. In one implementation Z is a sequence of a nucleic acid selected from the group consisting of TTTT, TG, and the sequence in which at least 50% of the bases of the sequence represent the Ts.

In some implementations Y1and/or Y2have from 3 to 8 nucleotides. In other implementations Y1and/or Y2include at least three Gs at least four Gs, at least seven Gs or all Gs. In other implementations Y1and/or Y2selected from the group consisting of TCGTCG, TCGTCGT and TCGTCGTT (SEQ ID NO:1145). In another implementation Y1and/or Y2include at least one, two, three, four or five poly-A, poly-T or poly-C sequence.

Central nucleotides (N1ZN2) formula Y1N1ZN2Y2have phosphodieterase mezhnukleotidnyh communication and Y1and Y2have at least one modified mezhnukleotidnyh communication. In some the realizations Y 1and/or Y2have at least two modified mezhnukleotidnyh communication. In other implementations Y1and/or Y3have from two to five modified mezhnukleotidnyh ties. In another implementation Y1has two modified mezhnukleotidnyh communication, and Y2has five modified mezhnukleotidnyh ties or Y1has five modified mezhnukleotidnyh ties and Y2has two modified mezhnukleotidnyh communication. Modified mezhnukleotidnyh communication in some implementations is phosphorotioate modified link, phosphorodithioate modified communication or p-ethoxy-modified link.

Part of the formula Y1N1ZN2Y2can optionally form a palindrome. Thus, in some implementations nucleotides N1ZN2form a palindrome. In some implementations, the palindrome is not a direct repeat. In some implementations nucleotides N1ZN2do not form a palindrome.

In accordance with other implementations of N1ZN2have a nucleotide sequence selected from the group consisting of

GATTTTATCGTC (SEQ ID NO: 1098),

TCGATTTTTCGA (SEQ ID NO: 1099); TCATTTTTATGA (SEQ ID NO: 1100);

GTTTTTTACGAC (SEQ ID NO: 1101); TCAATTTTTTGA (SEQ ID NO: 1102);

ACGTTTTTACGT (SEQ ID NO: 1103); TCGTTTTTACGA (SEQ ID NO: 1104);

TCGATTTTACGTCGA (SEQ ID NO: 1105); AATTTTTTAACGTT (SEQ ID NO:

1106); GTTTTTAACGA (SEQ ID NO: 1107); ACGTTTTTTAACGT (SEQ ID

NO: 1108); GATTTTTATCGTC (SEQ ID NO: 1109); GACGATTTTTCGTC (SEQ

ID NO: 1110); GATTTTAGCTCGTC (SEQ ID NO: 1111); GATTTTTACGTC

(SEQ ID NO: 1112); ATTTTATCGT (SEQ ID NO: 1113); AACGATTTTTCGTT

(SEQ ID NO: 1114); TCACTTTTGTGA (SEQ ID NO: 1115); TCGTATTTTA (SEQ ID NO: 1116); ACTTTTGTACCGGT (SEQ ID NO: 1117); TCGATTTTTCGACGTCGA (SEQ ID NO: 1118); ACGATTTTTCGT (SEQ ID NO: 1119); GATGATCGTC (SEQ ID NO: 1120); TCGATGTCGA (SEQ ID NO: 1121); TCATGTATGA (SEQ ID NO: 1122);

GTGTTACGAC (SEQ ID NO: 1123); TCAATGTTGA (SEQ ID NO: 1124);

ACGTGTACGT (SEQ ID NO: 1125); TCGTGTACGA (SEQ ID NO: 1126);

TCGATGTACGTCGA (SEQ ID NO: 1127); AATGTTAACGTT (SEQ ID NO:

1128);

TCGTGTTAACGA (SEQ ID NO: 1129); ACGTGTTAACGT (SEQ ID NO: 1130);

GATGTATCGTC (SEQ ID NO: 1131); GACGATGTCGTC (SEQ ID NO: 1132);

GATGAGCTCGTC (SEQ ID NO: 1133); GATGTACGTC (SEQ ID NO: 1134);

ATGATCGT (SEQ ID NO: 1135); AACGATGTCGTT (SEQ ID NO: 1136);

TCACTGGTGA (SEQ ID NO: 1137); TCGTATGA (SEQ ID NO: 1138);

ACTGGTACCGGT (SEQ ID NO: 1139); TCGATGTCGACGTCGA (SEQ ID NO:

1140); and ACGATGTCGT(SEQIDNO:1141).

The composition may optionally include a pharmaceutical carrier and/or can be prepared in the form of a device for delivery. In some implementations, the device for delivering selected from the group consisting of cationic lipids, penetrating into the cell proteins, and devices with a constant release. In one preferred implementation of the device with a constant release is a biodegradable polymer. In another implementation of the device with a constant release is a microparticle.

In another embodiment, the invention features a composition to immunostim youseo of the oligonucleotide, those having the formula : Y1N1ZN2Y2and antigen.

Another composition according to the invention is an immune-stimulating oligonucleotide having the formula Y1N1ZN2Y2and antimicrobial therapeutic agent. Preferably an antimicrobial therapeutic agent selected from the group consisting of antiviral agent, an antiparasitic agent, an antibacterial agent or antifungal agent.

Composition device for continuous release, including immune-stimulating oligonucleotide having the formula Y1N1ZN2Y2, it is proposed in accordance with another variant of the invention.

The invention also includes nutritional supplements immunostimulating oligonucleotide having the formula Y1N1ZN2Y2in the device for delivery selected from the group consisting of capsules, sublingual tablets and pills.

In another embodiment, compositions described above, also include immunostimulirutuyu nucleic acid having demetilirovanny CG dinucleotide, TG-nucleotide or a Ru-rich sequence, where immunostimulirutuyu nucleic acid having demetilirovanny CG dinucleotide, TG dinucleotide or a Ru-rich sequence has a sequence that is excellent from the oligonucleotide, includes 5'Y1N1ZN2Y23’.

In some implementations immunostimulirutuyu nucleic acid having demetilirovanny CG dinucleotide, TG dinucleotide or a Ru-rich sequence has fully fosfodiesterzy frame, and in other implementations immunostimulirutuyu nucleic acid having demetilirovanny CG dinucleotide, TG dinucleotide or a Ru-rich sequence has a modified backbone, which may not necessarily have mezhnukleotidnyh selected from the group consisting of phosphorotioate, phosphorodithioate and p-ethoxy.

In one implementation immunostimulirutuyu nucleic acid having demetilirovanny CG dinucleotide, has a formula that includes 5'X1X2CGX3X43’, where X1, X2, X3and X4represent nucleotides. In other implementations, the sequence of the immunostimulatory nucleic acid includes at least the following formula:

5'TCNTX1X2CGX3X43’, where N is a sequence of nucleic acid, consisting of about 0-25 nucleotides, where at least one nucleotide is modified mezhnukleotidnyh communication and where the nucleic acid has less than or equal to 100 nucleotides. According some of the realizations X 1X2are nucleotides selected from the group consisting of GT, GG, GA and AA, and X3X4are nucleotides selected from the group consisting of TT, ST or GT. In the preferred implementation of the X1X2represent GA, a, X3X4are the TT.

In another implementation, the sequence immunostimulatory nucleic acid having demetilirovanny CG dinucleotide, includes at least one of the following sequences:

ATCGACTCTCGAGCGTTCTC (SEQ ID No. 15); TCCATGTCGGTCCTGCTGAT

(SEQ ID No. 32); TCCATGTCGGTZCTGATGCT (SEQ ID No. 31);

ATCGACTCTCGAGCGTTZTC (SEQ ID No. 18); TCCATGTCGGTCCTGATGCT

(SEQ ID No. 28); GGGGGG (SEQ ID No. 12); TCCATGACGGTCCTGATGCT

(SEQ ID No. 35); TCCATGGCGGTCCTGATGCT (SEQ ID No. 34);

TCCATGACGTTCCTGATGCT (SEQ ID No. 7); TCCATGTCGTTCCTGATGCT

(SEQ ID No. 38); GGGGTCAGTCTTGACGGGG (SEQ ID No. 41);

TCCATGTCGCTCCTGATGCT (SEQ ID No. 37); TCCATGTCGATCCTGATGCT

(SEQ ID No. 36); TCCATGCCGGTCCTGATGCT (SEQ ID No. 33);

TCCATAACGTTCCTGATGCT (SEQ ID No. 3); TCCATGACGTTCCTGATGCT

(SEQ ID No. 7); TCCATGACGTCCCTGATGCT (SEQ ID No 39);

TCCATCACGTGCCTGATGCT (SEQ ID No. 48); TCCATGACGTTCCTGACGTT

(SEQ ID No. 10); ATGACGTTCCTGACGTT (SEQ ID No. 70);

TCTCCCAGCGCGCGCCAT (SEQ ID No. 72); TCCATGTCGTTCCTGTCGTT

(SEQ ID No. 73); TCCATAGCGTTCCTAGCGTT (SEQ ID No. 74);

TCCTGACGTTCCTGACGTT (SEQ ID No. 76); TCCTGTCGTTCCTGTCGTT

(SEQ ID No. 77); TCCTGTCGTTCCTTGTCGTT (SEQ ID No. 52);

TCCTTGTCGTTCCTGTCGTT (SEQ ID No 121); TCCTGTCGTTTTTTGTCGTT

(SEQ ID No. 208); TCGTCGCTGTTGTCGTTTCTT (SEQ ID No. 120);

TCCATGCGTTGCGTTGCGTT (SEQ ID No. 81); TCCACGACGTTTTCGACGTT

(SEQ ID No. 82); TCGTCGTTGTCGTTGTCGTT (SEQ ID No. 47);

TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID No. 46);

TCGTCGTTGTCGTTTTGTCGTT (SEQ ID No. 49);

GCGTGCGTGTCGTTGTCGTT (SEQ ID No. 56);

TGTCGTTTGTCGTTTGTCGTT (SEQ ID No. 48);

TGTCGTTGTCGTTGTCGTTGTCGTT (SEQ ID No. 84);

TGTCGTTGTCGTTGTCGTT (SEQ ID No. 50); TCGTCGTCGTCGTT (SEQ ID No.

51); and TGTCGTTGTCGTT (SEQ ID No. 85).

In another implementation immunostimulirutuyu nucleic acid having PY-rich or TG-sequence is a nucleic acid described above.

In another implementation of the invention relates to pharmaceutical compositions and kits that contain oligonucleotide having the formula Y1N1ZN2Y2and CpG-oligonucleotide (which may not necessarily be free of poly-T and TG-motives and not to be Ru-enriched), Ru-enriched and/or TG-oligonucleotide, physically separate from the oligonucleotide having the formula Y1N1ZN2Y2. Pharmaceutical drugs are effective quantities and usually include pharmaceutically acceptable carriers, and all of this is explained in detail here. The kits include at least one container containing oligonucleotide, which has the formula Y1N1ZN2Y2. The same container or in other implementations, the second container may contain oligonucleotide from the CpG-motif, which may not necessarily be free from Ru-enriched and/or TG-motifs, and/or PY-rich or TG-oligonucleotide (or some combination). The kit also contains in the e.g. for the introduction of the oligonucleotide to the subject. The kits can also include a container containing a solvent or diluent.

In General, as quoted here in full, the oligonucleotide having the formula Y1N1ZN2Y2that is physically separated from the CpG, PY-rich or TG-oligonucleotide, may be applied in conjunction with CpG, PY-rich or TG-oligonucleotides in the here described methods, compositions, and products.

In another embodiment, the invention relates to pharmaceutical compositions comprising at least two oligonucleotide according to the invention, where at least two of the oligonucleotide are different from each sequence, and a pharmaceutically acceptable carrier.

In accordance with another variant of the invention features a vaccine composition. The vaccine includes any of the compositions in combination with the antigen.

In accordance with another variant of the invention proposes a method of stimulating an immune response. The method includes the introduction of PY-rich or TG immunostimulatory nucleic acid to a subject that is not a rodent, in an amount effective to induce an immune response in the subject, which is not a rodent. Preferably Ru-enriched or immunostimulirutuyu TG-nucleic acid administered orally, topically in the device with a constant release, with isatou surface, systemic, parenteral or intramuscular injection. When Ru-enriched or immunostimulirutuyu TG-nucleic acid is administered to the mucous surface, it must be delivered in a quantity effective for the induction of immune responses in mucosal or systemic immune response. In the preferred implementation of the mucosal surface is selected from the group consisting of surfaces of the oral cavity, nasal cavity, rectal, vaginal surface and the surface of the eye cavity.

In some implementations the method includes introducing to a subject antigen, when the immune response is antigen-specific immune response. The antigen may be encoded by the vector nucleic acid, which can be delivered to a subject. In some implementations, the antigen is selected from the group consisting of a tumor antigen, a viral antigen, a bacterial antigen, a parasitic antigen and the peptide antigen.

Ru-rich and TG immunostimulatory nucleic acid can cause a wide range of immune response. For example, data immunostimulatory nucleic acids can be used to switch the immune response from Th2 to Th1. Ru-rich and TG-nucleic acids can also be used to activate immune cells, such as leukocyte, dendritic cell and NK cell. Activation which may be conducted in vivo, in vitro or ex vivo, i.e. by allocating immune cells from the subject, contacting the immune cell with an effective amount of PY-rich or TG immunostimulatory nucleic acid to activate immune cells and re-introduction of activated immune cells to the subject. In some implementations dendritic cell expresses a cancer antigen. Dendritic cell can be exposed with cancer antigen ex vivo.

The immune response caused by the PY-rich or TG-nucleic acids, may also lead to the induction of cytokine production, such as production of IL-6, IL-12, IL-18, TNF, IFN-α and IFN-γ.

In another implementation of the PY-rich and TG-nucleic acids are useful for the treatment of cancer. Ru-rich and TG-nucleic acid according to other variants of the invention are also useful in the prevention of cancer (e.g., reducing the risk of cancer) in a subject at risk of developing cancer. The cancer may be selected from the group consisting of cancer of the biliary tract, breast cancer, cervical cancer, choriocarcinoma, rectal cancer, endometrial cancer, gastric cancer, intraepithelial neoplasms, leukemia, liver cancer, lung cancer (e.g. small cell and non-small cell), melanoma, for neuroblastoma, mouth cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal RA is a, sarcoma, thyroid cancer and kidney cancer, as well as other carcinomas and sarcomas. In some important realizations cancer selected from the group consisting of bone cancer, brain and CNS cancer, cancer of connective tissue, esophageal cancer, eye cancer, Hodgkin's lymphoma, laryngeal cancer, mouth cancer, skin cancer and cancer of the testes.

Ru-rich and TG-nucleic acids can also be used to increase the response of cancer cells to a cancer therapy (e.g., cancer therapy), optional when Ru-enriched and immunostimulirutuyu TG-nucleic acid is administered in combination with anti-cancer therapy. Anti-cancer therapy may be chemotherapy, vaccination (for example, activated in vitro vaccine dendritic cells or cancer vaccine antigen) or therapy-based antibodies. This last variant treatment may also include the introduction of antibodies specific to the antigen on the cell surface, such as a cancer cell, when the immune response is manifested in the form of antigen-dependent cellular cytotoxicity (ADCC). In one implementation, the antibody may be selected from the group consisting of Robitussin, herapin, quadramet, panorex, UDEC-Y2B8, WES, S, ancalima, SMART M195, ATRAGEN, ovarex, Bexxar, LDP-03, ior t6, MDX-210, MDX-11, MDX-22, OV103, 3622W94, anti-VEGF, zenapax, MDX-220, MDX-447, MELIMMUNE-2, MELIMMUNE-1, CEACIDE, retarget, NovoMAb-G2, TNT, Gliomab-H, GNI-50, EMD-72000, LymphoCide, CMA 676, monetary, INCREASED 4 ÷ 5, ior egf.r3, ior c5, BABS, anti-FLK-2, MDX-260, ANA Ab, SMART 1D10 Ab, SMART ABL 364 Ab and ImmuRAIT-CEA.

Thus, in accordance with some variations of the invention, to a subject suffering from cancer or having cancer risk, enter immunostimulirutuyu nucleic acid and conduct anti-cancer therapy. In some implementations anti-cancer therapy selected from the group consisting of a chemotherapeutic agent, immunotherapy agent and anticancer vaccines. The chemotherapeutic agent can be selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, not containing sugar chloroethylnitrosourea, 5-fluorouracil, mitomycin C, bleomycin, doxorubicin, dacarbazine, Taxol, fragolina, meglumine GLA, valrubicin, carmustine and polifeprosan, MMI270, BAY 12-9566, RAS inhibitor falsistrellus, inhibitor falsistrellus, MMP, MTA/LY231514, L264618/lometrexol, Glavica, CI-994, TNP-470, Hycamtin/topotecan, RX, valspodar/PSC833, Novantrone/mitroxantrone, metarea/., batimastat, E, VSN-4556, CS-682, 9-AC AG3340, AG3433, Intel/VX-710, VX-853, ZD0101, ISI641, ODN 698, TA 2516/marmitta, W/marmitta, CDP 845, D2163, PD183805, DX8951f, lemonal, DP 2202, FK 317, picibanil/OK-432, AD32/valrubicin, metastron/derived strontium, Temodal/temosolomida, maceta/liposomal doxorubicin, yutakana/paclitax the La, Taxol/paclitaxel, xeloda/involving capecitabine, furtulon/doxifluridine, zaklopaca/oral paclitaxel, oral taxoid, SPU-077/cisplatin, HMR 1275/flavopiridol, SR-358 (774)/EGFR, CF-609 (754)/inhibitor of the RAS oncogene, BMS-182751/oral platinum, UFT(tegafur/uracil), ergamisol/levamisole, anyorall/S/5FU amplifier, campto/levamisole, camptosar/irinotecan, tomodachi/raltitrexed, leustatin/cladribine, Pacceka/paclitaxel, doxil/liposomal doxorubicin, zelixa/liposomal doxorubicin, Fludara/fludarabine, farmorubicin/epirubicin, Deposit, ZD1839, LU 79553/bis-naphtalimide, LU 103793/dolastatin, zelixa/liposomal doxorubicin, Gemzar/gemcitabine, ZD 0473/anormed, YM 116, balls iodine, inhibitors of CDK4 and CDK2, PARP inhibitors, D4809/exitosamente, IFES/mesnex/ifosamide, vumon/teniposide, paraplatin, carboplatin, planticola/cisplatin, Vepeside/etoposide, ZD 9331, Taxotere/docetaxel, prodrug of guayaramerin, similar taxane, nitrosomonas, alkylating agents, such as melphalan and cyclophosphamide, aminoglutethimide, asparaginase, busulfan, carboplatin, chlorambucil, tsitarabina NCl, dactinomycin, daunorubicin Hcl, sodium salt of estramustine, etoposide (VP16-213), floxuridine, fluorouracil (5-FU), flutamide, hydroxyacetone (gidroksicarbamida), ifosfamide, interferon and is LFA-2A, Alfa-2b, leuprolide acetate (analogue of LHRH-releasing factor), lomustina (CCNU), mechlorethamine Hcl (nitrogen mustard), mercaptopurine, mesna, mitotane (ortho-para’-DDD), mitoxantrone Hcl, octreotide, plicamycin, procarbazine Hcl, streptozocin, tamoxifen citrate, Tg, thiotepa, vinblastine sulfate, amsacrine (m-AMSA), azacitidine, erthropoietin, hexamethylmelamine (MMOs), interleukin 2, mitoguazone (methyl-GAG; methylglyoxal-bis-guanylhydrazone; MGBG), pentostatin (2 deoxycoformycin), semustine (methyl-CCNU), teniposide (VM-26) and vindesine sulfate, but not limited to.

Immunotherapy agent may be selected from the group consisting of ribotoxin, Herceptin, quadramet, panorex, IDEC-Y2B8, WES, S, ancalima, SMART M195, ATRAGEN, ovarex, Bexxar, LDP-03, ior t6, MDX-210, MDX-11, MDX-22, OV103, 3622W94, anti-VEGF, zenapax, MDX-220, MDX-447, MFLIMMUNE-2, MELIMMUNE-1, CEACIDE, retarget, NovoMAb-G2, TNT, Gliomab-H, GNI-250, EMD-72000, lymphocide, CMA 676, monetary, INCREASED 4 ÷ 5, ior egf.r3, ior c5, BABS, anti-FLK-2, MDX-260, ANA Ab, SMART 1D10 Ab, SMART ABL 364 Ab and ImmuRAIT-CEA, but not limited to.

Anticancer vaccine may be selected from the group consisting of EGF, antiidiotypic cancer vaccines, antigen Gp75, melanoma of the GMK vaccine, vaccine conjugate MGV ganglioside, Her2/neu, ovarex, M-Vax, O-Vax, L-Vax, STn-KHL of theratope, BLP25 (MUC-1), liposomal idiotypical vaccine, melacine, vaccines, peptide antigen vaccines, toxin remediation is/antigens, vaccines based on MVA, PACIS, BCG vaccine, TA-HPV, TA-CIN, DISC-virus and ImmuCyst/TheraCys, but not limited to.

In another implementation methods aimed at prevention or treatment of cancer, the subject can be additionally introduced interferon-α.

In other embodiments, the invention relates to methods for prevention of the disease in the subject. The method includes regular introduction to the subject of the PY-rich or TG immunostimulatory nucleic acid to maintain the response of the immune system to prevent disease in the subject. Examples of diseases or conditions that seek to prevent the use of preventive methods according to the invention include microbial infection (e.g., sexually transmitted diseases and anaphylaxis from food allergies.

In other embodiments, the invention proposes a method of natural induction of immune response by introducing the subject of the PY-rich or TG immunostimulatory nucleic acid in an amount effective to activate the natural immune response.

In accordance with another variant of the invention proposes a method of treatment or prophylaxis of viral or retroviral infection. The method includes introducing to a subject at risk of viral or retroviral infection or suffering from it, eff the subjective amount of any of the compositions according to the invention for the treatment or prophylaxis of viral or retroviral infection. In some implementations, the viral disease is caused by hepatitis virus, HIV, hepatitis b, hepatitis C, herpes virus or human papillomavirus.

In accordance with another variant of the invention proposes a method of treatment or prevention of bacterial infection. The method includes the administration to a subject at risk of the disease bacterial infection or suffering from it, an effective amount of any of the compositions according to the invention for the treatment or prevention of bacterial infection. In one implementation, the bacterial infection is caused by intracellular bacteria.

In another embodiment, the invention features a method of treatment or prevention of parasitic infection by administering to a subject having a risk of or suffering from a parasitic infection, an effective amount of any of the compositions according to the invention for the treatment or prevention of parasitic infections. In one implementation of a parasitic infection caused by the parasite is not a helminth.

In some implementations, the subject is a person, and in other implementations, the subject is a vertebrate, non-human, selected from the group consisting of dogs, cats, horses, cows, pigs, goats, fish, monkey, chicken and sheep.

In another embodiment, the invention features SP is a method for treatment or prevention of asthma by administering to a subject, with the risk of or suffering from asthma, an effective amount of any of the compositions according to the invention for the treatment or prevention of asthma. In one implementation of asthma is allergic asthma.

In another embodiment, the invention relates to a method for the treatment or prevention of Allergy. The method involves injecting a subject with a risk or suffering from allergies, an effective amount of any of the compositions according to the invention for the treatment or prevention of Allergy.

In accordance with another variant of the invention proposes a method of treatment or prevention of immunodeficiency. The method includes introducing to a subject having a risk of or suffering from an immune deficiency, an effective amount of any of the compositions according to the invention for the treatment or prevention of immunodeficiency.

In another embodiment, the invention relates to a method of induction IN immune response by administering to a subject any of the compositions according to the invention in an effective amount for inducing TN immune response.

In one implementation of the methods according to the invention include the introduction of the oligonucleotide having the formula 5'Y1N1ZN2Y23’, and the immunostimulatory nucleic acid having demetilirovanny CG dinucleotide, TG dinucleotide or T-enriched consistently the th. In the implementation of the oligonucleotide that includes a 5'Y1N1ZN2Y23’, is administered separately from the immunostimulatory nucleic acid. In some implementations oligonucleotide that includes a 5'Y1N1ZN2Y23’, and immunostimulirutuyu nucleic acid is administered in turn by week, and in other implementations oligonucleotide that includes a 5'Y1N1ZN2Y23’ and immunostimulirutuyu nucleic acid to enter the queue for two weeks.

In another embodiment, the invention features a composition that includes immunostimulirutuyu nucleic acid and the anti-cancer agent therapy, together with pharmaceutically acceptable carrier and in an effective amount for treating cancer or reduce cancer risk. In an important implementation immunostimulirutuyu nucleic acid selected from the group consisting of a T-rich nucleic acids, TG-nucleic acid and P-enriched nucleic acids.

The invention further provides a kit comprising a first container containing immunostimulirutuyu nucleic acid and at least one container (for example, the second container containing the anti-cancer agent therapy, and instruction manual. In one implementation, the kit further includes in the impact interferon-α that can be included separately in one container (for example, the third container). In an important implementation, the set includes bubbles with a constant release containing immunostimulirutuyu nucleic acid, and at least one container containing an anti-cancer agent therapy, and instruction on the mode of introduction of the agent anticancer therapy. Immunostimulirutuyu nucleic acid may be selected from the group consisting of Ru-enriched nucleic acids, TG-nucleic acid and CpG nucleic acid, where the CpG nucleic acid has a nucleotide sequence comprising SEQ ID NO: 246.

The invention further provides a method of preventing or treating asthma or allergies, which includes the introduction of immunostimulatory nucleic acids and drugs for the treatment of asthma/allergies in amounts effective for the treatment or prevention of asthma or Allergy. In an important implementation immunostimulirutuyu nucleic acid selected from the group consisting of a T-rich nucleic acids, TG-nucleic acid and P-enriched nucleic acids.

In one implementation immunostimulirutuyu nucleic acid is a T-rich nucleic acid. Related to this is the implementation of the T-rich nucleic acid has sledovatelnot nucleotides, selected from the group consisting of SEQ ID NO: 59-63, 73-75, 142, 215, 226, 241, 267-269, 282, 301, 304, 330, 342, 358, 370-372, 393, 433, 471, 479, 486, 491, 497, 503, 556-558, 567, 694, 793-794, 797, 833, 852, 861, 867, 868, 882, 886, 905, 907, 908 and 910-913. In other implementations of the T-rich nucleic acids have a sequence selected from the group consisting of SEQ ID NO: 64, 98, 112, 146, 185, 204, 208, 214, 224, 233, 244, 246, 247, 258, 262, 263, 265, 270-273, 300, 305, 316, 317, 343, 344, 350, 352, 354, 374, 376, 392, 407, 411-413, 429-432, 434, 435, 443, 474, 475, 498-501, 518, 687, 692, 693, 804, 862, 883, 884, 888, 890 and 891.

In additional related to this implementation of the T-rich nucleic acid is not a TG nucleic acid. In another implementation of the T-rich nucleic acid is a CpG nucleic acid.

In one implementation immunostimulirutuyu nucleic acid is a TG nucleic acid. In additional, specific to this implementation of TG-nucleic acid is not a T-rich nucleic acid. In another related to this implementation of TG-nucleic acid is a CpG nucleic acid.

In one implementation immunostimulirutuyu nucleic acid is a CpG nucleic acid, where the CpG nucleic acid has a nucleotide sequence comprising SEQ ID NO: 246.

In another implementation of medication for asthma/allergies is a drug selected from the group, with the standing of an inhibitor of PDE-4, bronhodilatator/beta-2 agonist, medicine for the opening of K+ channel antagonist VLA-4 antagonist neirokinina, inhibitor synthesis THU, santanina antagonist arachidonic acid, an inhibitor of 5-lipoxygenase, receptor antagonist thromboxane A2 antagonist of thromboxane A2 inhibitor 5-lipox-activator protein and the protease inhibitor, but is not limited to this. In some important realizations medication for asthma/allergies is a bronchodilator/beta-2 agonist selected from the group consisting of salmeterol on the list, salbutamol, terbutalina, D2522/formoterol, fenoterola and ortsiprenalina.

In another implementation of medication for asthma/allergies is a drug selected from the group consisting of antihistamines and inductors prostaglandins. In one implementation antihistamine selected from the group consisting of loratadine, cetirizine, buclizine, analogs cetirizine, Fexofenadine, terfenadine, desloratadine, erastamisel, epinastine, ebastine, astemizole, levocabastine, azelastina, tranilast, terfenadine, mizolastine, betatesting, CS 560 and HSR 609. In another implementation, the inductor of prostaglandins is an S-5751.

In another implementation of medication for asthma/allergies are selected from the group consisting of steroids and immunomodulators. Immunology atory can be selected from the group consisting of anti-inflammatory agents, leukotriene antagonists, Malinov IL-4, soluble receptors of IL-4, immunosuppressants, anti-IL-4 antibodies, antagonists of IL-4, anti-IL-5 antibodies, soluble receptors of IL-13-Fc hybrid proteins, anti-IL-9 antibodies, CCR3 antagonists, CCR5 antagonists, VLA-4 inhibitors and negative regulators of IgE, but not limited to this. In one implementation, a negative regulator of IgE anti-IgE.

In another implementation steroids are selected from the group consisting of beclomethasone, fluticasone, triamcinolone, budesonide and budesonide. In another implementation of the immunosuppressive drug is a vaccine tolerant peptide.

In one implementation immunostimulirutuyu nucleic acid is administered concurrently with medication for asthma/allergies. In another implementation, the subject is a subject with impaired immune systems.

Immunostimulatory nucleic acids for introduction of the subject in the disclosed here are methods related to the prevention and treatment of asthma/allergies, are as described for other methodological aspects of the invention.

In another embodiment, the invention features a kit comprising a first container containing immunostimulirutuyu nucleic acid, and at least another container (for example, the second container containing the second drug for asthma/allergies, and instructions for use. Immunostimulirutuyu nucleic acid used in the set is a described here. In an important implementation immunostimulirutuyu nucleic acid selected from the group consisting of a T-rich nucleic acids, TG-nucleic acid and P-enriched nucleic acid. In another important implementation, the set includes bubbles with a constant release containing immunostimulirutuyu nucleic acid, and at least one container containing medication for asthma/allergies, and instructions for administration of medication for asthma/allergies. Medication for asthma/allergies can be selected from the group of drugs against asthma/allergies, described in the above methods aimed at prevention or treatment of asthma/allergies.

In another embodiment, the invention features a composition that includes immunostimulirutuyu nucleic acid and medicine for asthma/allergies in composition with pharmaceutically acceptable carrier, in an amount effective for prevention or treatment of immune response associated with exposure to mediate asthma or allergies. Immunostimulirutuyu nucleic acid may be selected from the group of immunostimulatory nucleic acids described in the above methods and kompozitsiah important accomplishments immunostimulirutuyu nucleic acid selected from the group consisting of a T-rich nucleic acids, TG-nucleic acid and P-enriched nucleic acid. Medication for asthma/allergies can be selected from the group of drugs against asthma and drugs against allergies, described in the above methods and compositions.

In another embodiment, the invention features a composition that includes immunostimulirutuyu nucleic acid selected from the group consisting of SEQ ID NO: 95-136, SEQ ID NO: 138-152, SEQ ID NO: 154-222, SEQ ID NO: 224-245, SEQ ID NO: 247-261, SEQ ID NO: 263-299, SEQ ID NO: 301, SEQ ID NO: 303-4109, SEQ ID NO: 414-420, SEQ ID NO: 424, SEQ ID NO: 426-947, SEQ ID NO: 959-1022, SEQ ID NO: 1024-1093, and pharmaceutically acceptable carrier. Preferably immunostimulirutuyu nucleic acid is present in the composition in an effective amount. In one implementation immunostimulirutuyu nucleic acid is present in an effective amount for inducing an immune response. In another implementation immunostimulirutuyu nucleic acid is present in an effective amount for prevention or treatment of cancer. In another implementation immunostimulirutuyu nucleic acid is present in an effective amount for prevention or treatment of asthma/allergies. The invention also provides kits comprising compositions of any of the above described immunostimulatory nucleic acids, and instructions for application is July.

In another embodiment, the invention includes a composition immunostimulatory nucleic acid consisting essentially'M 51TCGTCGTTM23’, where at least one of C is not methylated, where M1is a nucleic acid having at least one nucleotide, where M2is a nucleic acid having from 0 to 50 nucleotides, and where immunostimulirutuyu nucleic acid has less than 100 nucleotides.

In another embodiment, the invention relates to pharmaceutical compositions immunostimulatory nucleic acid, comprising: 5'TCGTCGTT3’, where at least one of C is not methylated, where immunostimulirutuyu nucleic acid has less than 100 nucleotides and fosfodiesterzy frame, and devices for permanent release. In some implementations, the device for continuous release is a microparticle. In other implementations, the composition includes an antigen.

Each of the limitations of the invention can encompass various aspects of the invention. Therefore, it is expected that each restriction of the invention, including any element or combination of elements, can be included in each variant of the invention.

Brief description of figures

Figure 1A represents the histogram of the expression of CD86 (Y-axis) CD19+ cells is donkey exposure of these cells to the oligonucleotides, presented on the X-axis, at a concentration of 0.15 ug/ml

Figure 1B is a table with the data from figure 1A.

Figure 1C represents the histogram of the expression of CD86 (Y-axis) CD19+ cells after exposure of these cells to the oligonucleotides represented on the X-axis, at a concentration of 0.30 mg/ml

Figure 1D is a table with the data from figure 1C.

Figure 2 is a graph comparing the ability

ODN 2137, ONE 2177, ONE 2200 and ONE 2202 to stimulate proliferation of b-cells at concentrations ranging from 0.2 to 20 μg/ml

Figure 3 is a graph comparing the ability of ONE 2188, ONE 2189, ONE 2190 and ONE 2182 to stimulate proliferation of b-cells at concentrations ranging from 0.2 to 20 μg/ml

Figure 4 is a histogram describing the dose-dependent activation of b-cells, called ONE not containing CpG. PBMC blood donor were incubated with indicated concentrations of ODN 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 5126 (SEQ ID NO.: 1058) and 5162 (SEQ ID NO.: 1094) and were stained with mAb against CD19 (a marker of b-cells) and CD86 (a marker of activated b-cells, B7-2). Expression was measured by flow cytometry.

Figure 5 is a histogram describing the stimulation of b-cells by a variety of set ONE, not containing CpG. PBMC blood of one representative donor stimulated with 0.4 μg/ml, 1.0 μg/ml or 10.0 m is g/ml the following ONE: 2006 (SEQ ID NO.: 246), 2196 (SEQ ID NO.: 913), 2194 (SEQ ID NO.: 911), 5162 (SEQ ID NO.: 1094) and 5163 (SEQ ID NO.: 1095), 5168 (SEQ ID NO.: 1096) and 5169 (SEQ ID NO.: 1097), and the expression of the activation marker CD86 (B7-2) on CD19-positive b cells was measured by flow cytometry.

Figure 6 is a histogram describing the activation of b-cells, called ODN 1982 and 2041, not containing CpG. PBMC were incubated with indicated concentrations of ODN 2006 (SEQ ID NO.: 246), 1982 (SEQ ID NO.: 225) and 2041 (SEQ ID NO.: 282), and activation of b-cells (the expression of the activation marker CD86) was measured by flow cytometry.

Figure 7 is a histogram describing NK cells, activated ONE, not containing CpG. PBMC were incubated with 6 μg/ml following ONE: ODN 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 2183 (SEQ ID NO.: 433), 2194 (SEQ ID NO.: 911) and 5126 (SEQ ID NO.: 1058) and were stained with mAb against CD3 (a marker for T cells), CD56 (a marker of NK-cells) and CD69 (early marker of activation). The expression of CD69 on CD56 positive NK cells was measured by flow cytometry.

Figure 8 is a histogram showing that mediated NK cytotoxicity increases with ONE that does not contain CpG. Mediated NK lysis of target cells K-562 was measured after incubation of PBMC during the night with 6 μg/ml ODN 2006 (SEQ ID NO.: 246), 2194 (SEQ ID NO.: 911) and 5126 (SEQ ID NO.: 1058).

Figure 9 is a histogram showing that NKT cells can be activated ONE, not containing CpG. PBMC one REP the representative of the donor were incubated in the presence of 6 μg/ml ODN: 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 2183 (SEQ ID NO.: 433) and 2194 (SEQ ID NO.: 911) and 5126 (SEQ ID NO.: 1058) for 24 h and the activation of NKT cells was measured by flow cytometry after staining cells mAb against CD3 (a marker for T cells), CD56 (a marker of NK-cells) and CD69 (early marker of activation).

Figure 10 is a histogram describing the stimulation of monocytes different ODN containing CpG and not containing CpG. PBMC were incubated in the presence of 6 μg/ml 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 2178 (SEQ ID NO.: 428), 2183 (SEQ ID NO.: 433), 2194 (SEQ ID NO.: 911), 5126 (SEQ ID NO.: 1058) and 5163 (SEQ ID NO.: 1095) and stained for CD14 (a marker of monocytes) and CD80 (token activation B7-1). Expression was measured by flow cytometry.

Figure 11 is a histogram that describes the secretion of TNFα under cultivation of human cells with ONE that does not contain CpG. PBMC were cultured for 24 h with or without 6 µg/ml of the indicated ODN or with 1 μg/ml LPS as a positive control and TNFα was measured with TYPHOID.

Figure 12 is a histogram showing that the secretion of IL-6 after cultivation with ONE that does not contain CpG, has the same character as that of TNFα. PBMC were cultured specified ONE (1.0 microgram/ml)and IL-6 were measured in supernatant with TYPHOID.

Detailed description

In one embodiment, the invention includes evidence that the pyrimidine (PY)-enriched and predpochtite the flax thymidine (T)-enriched nucleic acid, as well as nucleic acids that contain TG-dinucleotide motifs, effective in mediating an immunostimulatory effects. In the prior art it was known that nucleic acids containing CpG are therapeutic and prophylactic compositions that stimulate the immune system to treat cancer, infectious diseases, allergies, asthma and other disorders, and help to protect against infections caused by conditionally pathogenic microorganisms, after cancer chemotherapy. Strong but balanced, cellular and humoral immune responses that occur due to stimulation with CpG, reflect the individual's natural protective system of the body against disease-causing pathogens and cancer cells. Sequence CpG, although relatively rare in human DNA, usually detected in the DNA of infectious organisms such as bacteria. The human immune system, were clearly moving in the direction of recognition of CpG sequences as an early warning sign of infection and initiate immediate and strong immune response against disease-causing pathogens without the development of adverse reactions commonly observed in other immunostimulatory agents. Thus, a nucleic acid containing CpG, based on the natural immune defenses of the CSOs mechanism, can be used as a unique and natural way immune therapy. Modulating effects of nucleic acids containing CpG on the immune system have been disclosed by the applicants of this patent application and are described in detail in co-filed patent applications, such as patent application U.S. serial Nos: 08/386063 registered 02/07/95 (and related to this patent PCT US 95/01570); 08/738652 registered 10/30/96; 08/960774 registered 10/30/97 (and related to this patent PCT/US 97/19791, WO 98/18810); 09/191170 registered 11/13/98; 09/030701 registered 02/25/98 (and related to this patent PCT/US 98/03678; 09/082649 registered 05/20/98 (and related to this patent PCT/US 98/10408); 09/325193 registered 06/03/99 (and related to this patent PCT/US 98/04703); 09/286098 registered 04/02/99 (and related to this patent PCT/US 99/07335); 09/306281 registered 05/06/99 (and related to this patent PCT/US 99/09863). The full content of each of these patents and patent applications incorporated herein by reference.

Data of the present invention is applicable to all the above applications of nucleic acids containing CpG, as well as any other known use of nucleic acids containing CpG. In one embodiment, the invention relates to the discovery that Ru-enriched and preferably T-rich and TG-nucleic acids have SAS are the ones with CpG-oligonucleotides immunostimulatory properties, regardless of the presence of CpG-motif. Thus, the invention is useful for any method of stimulating the immune system with the use of Ru-enriched and a TG nucleic acid. Unexpectedly, it was also revealed, in accordance with the invention, chimeric oligonucleotides that do not have a CpG-motif, are boosting and have many of the same preventive and therapeutic activities that CpG-oligonucleotides.

Ru-enriched nucleic acid is a T-rich or C-enriched immunostimulirutuyu nucleic acid. In some implementations of the T-rich nucleic acid is preferable. T-rich nucleic acid is a nucleic acid that includes at least one poly-T sequence and/or which has a nucleotide composition with more than 25% T nucleotide residues. Nucleic acid with a poly-T sequence includes at least four Tons in a number, such as 5'TTTT3’. Preferably the T-rich nucleic acid comprises more than one poly-T sequence. In the preferred implementation of the T-rich nucleic acid may be 2, 3, 4, etc. poly-T sequences, such as oligonucleotide #2006 (SEQ ID NO: 246). One of the T-rich oligonucleotides with the most is strong immunostimulating properties is a nucleic acid, consisting entirely of T nucleotide residues, for example, oligonucleotide #2183 (SEQ ID NO: 433). Other T-rich nucleic acid in accordance with the invention have a nucleotide composition of greater than 25% T nucleotide residues, but does not necessarily include a poly-T sequence. In these T-rich nucleic acids T nucleotide residues can be separated from one another other types of nucleotide residues, i.e. G, and A. In some implementations of the T-rich nucleic acids have nucleotide composition with more 35%, 40%, 50%, 60%, 70%, 80%, 90% and 99% T nucleotide residues and each whole % between them. Preferably the T-rich nucleic acids have at least one poly-T sequence and nucleotide composition of greater than 25% T nucleotide residues.

In accordance with the invention, it was revealed that the content of T ONE has a substantial effect on the immune-stimulating effect ONE and that T-rich ODN can activate many types of cells of the human immune system in the absence of any CpG motifs. Oligonucleotide having a 3 poly-T-area and 2 5'CGs, for example, ONE 2181 (SEQ ID NO: 431), has a high immunostimulatory activity. Oligonucleotide similar length, ONE 2116 (SEQ ID NO: 357), which contains two CG-dinucleotide at the 5'end and a poly-a region at the 3’-end, was also immunostim the tank, but to a lesser extent than T-rich oligonucleotide, using standard experimental conditions. Thus, while C and T are almost identical structures, their influence on the immune properties of ONE different. They are both able to induce an immune response, but in different degrees. Thus, as T-enriched and enriched oligonucleotides useful in accordance with the invention, but T-rich oligonucleotides are preferred. Moreover, if the content of T in ONE reduced by including other grounds, such as G, a or C, the immunostimulatory effects reduced (ODN #2188 (SEQ ID NO: 905), 2190 (SEQ ID NO: 907), 2191 (SEQ ID NO: 908) and 2193 (SEQ ID NO: 910).

With-enriched nucleic acid is a nucleic acid molecule that has at least one or preferably at least two poly-C region, or which consists of at least 50% of the nucleotides. Poly-region has at least four From the rest in the series. Thus, the poly-C region covered by the formula 5 SSSS’. In some implementations preferably poly-region had the formula 5 SSSSSS’. Other C-enriched nucleic acid in accordance with the invention have a nucleotide composition with more than 50% With the nucleotide residues, but does not necessarily include a poly-a sequence. In data-obogs is the R nucleic acids With nucleotide residues can be separated from one another other types of nucleotide residues, i.e. G, T and A. In some implementations of the C-enriched nucleic acids have nucleotide composition with more 60%, 70%, 80%, 90% and 99% With the nucleotide residues and each whole percentage between them. Preferably-rich nucleic acids have at least one poly-a sequence and a nucleotide composition of greater than 50% With the nucleotide residues, and in some implementations are also T-enriched.

As shown in the examples, several ONE, previously considered not having immunostimulating properties, including two ODN SEQ ID NO.:225 and SEQ ID NO.:282, previously described as not having immunostimulating properties and used mainly as a control ODN (Takahashi, T. et al 2000. J. Immunol. 164:4458), as found, are boosting. The experiments of the inventors have shown that these ONE can stimulate b-cells, although at higher concentrations compared with CpG ODN (6). Long poly-T ONE (30 members) induced, at least in some experiments, the activation of b cells, comparable in strength to the one of the most strong CpG-oligonucleotide activators In cells. These experiments also revealed unexpected evidence that even poly-WITH ONE can lead to the stimulation of b-cells.

Immunostimulation using data ONE, however, is not limited to b-cells the brow of the ESA. Various experimental tests have clearly demonstrated that additional monocytes, MK-cells and even NKT cells can be proektirovanii such do not contain CpG ODN (Fig.7-10). In contrast to poly-T and poly-C sequences, immunostimulation using poly-a sequence at least, for monocytes and NK-cells) was not achieved. Interestingly, it was found that the introduction of the CpG motif in SEQ ID NO.: 225 increased immunostimulirutuyu activity, while the elongation using poly-T extension would not increase immunostimulation. This suggests that CpG - and T-rich ODN can act through different mechanisms or pathways. It is also possible that the introduction of the poly-T motif in various positions of SEQ ID NO.: 225 may lead to changes in the immunostimulatory properties.

Used here, the term "TG-nucleic acid" or "immunostimulirutuyu TG-nucleic acid" is a nucleic acid containing at least one TpG dinucleotide (thymidine-guanine dinucleotide sequence, i.e. the "TG-DNA" or DNA containing a 5’-thymidine, followed by 3’-guanosine associated phosphate bond), which activates a component of the immune system.

In one implementation of the invention serves TG-nucleic acid represented by at least the formula:

5'N1 1TGX2N23’

where X1and X2are nucleotides and N is any nucleotide and N1and N2are sequences of nucleic acids made up of any number N, the proposed so that the total amount of N1and N2is in the range from 11 to 21. As an example, if N1is 5, then N1may be 6 (resulting in a total length of the oligonucleotide, which is 15 nucleotides). TG can be located anywhere along the length of the nucleotide, including the 5’-end, center, and 3 cones. Thus, N1it can range from zero to 21, inclusive, provided that N2choose accordingly to get the sum of n2and N1equal to 11 to 21 inclusive. Similar N2it can range from zero to 21, inclusive, provided that the total amount of N1and N2equal from 11 to 21 inclusive. In some implementations X1represents adenine,

guanine or thymidine, and X2represents cytosine, adenine or thymidine. In one preferred implementation of the X2represents thymidine. In other implementations X1represents cytosine, and X2. is a guanine. In other implementations, as discussed here, the nucleic acid may encompass other motives offered so that what they were long enough, to perform interesting feature.

In other implementations TG-nucleic acid represented by at least the formula:

5'N1X1X2TGX3X4N23’

where X1, X2, X3and X1are nucleotides. In some implementations X1X2are nucleotides selected from the group consisting of: GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, TPA and TRT; and X3X4are nucleotides selected from the group consisting of TPT, CpT, ApT, ApG, TPC, APC, CPC, TPA, ApA, and CpA; N is any nucleotide, a N1and N2are sequences of nucleic acids made up of any number of nucleotides, provided that the total amount of N1and N2is in the range from 9 to 19. In some implementations X1X2represent GpA or GpT, and X3X4represent TRT.

In other implementations X1or X2or both are purines, and X3or X4or both are pyrimidines, or X1X2are GpA and X3or X4or both are pyrimidines. In one preferred implementation of the X3X4are nucleotides selected from the group consisting of TPT, TRS and Tra.

Immunostimulirutuyu nucleic acid can b the th of any size (i.e. length), provided that has at least 4 nucleotides. In an important implementation immunostimulatory nucleic acids have a length in the range between 6 and 100. In some implementations, the length is in the range between 8 and 35 nucleotides. Preferably, TG-oligonucleotides ranged in size from 15 to 25 nucleotides.

The size (i.e. the number of nucleotide residues in length nucleic acid) immunostimulatory nucleic acid may also contribute to stimulating the activity of nucleic acids. It has been unexpectedly discovered that even for immunostimulatory nucleic acids with a high immunostimulatory activity length nucleic acid affects the degree of immune stimulation, which can be achieved. It was shown that increasing the length of the T-rich nucleic acids up to 24 nucleotides causes an increase in immune stimulation. The experiments presented in the examples show that when the length of the T-rich nucleic acid is increased from 18 to 27 nucleotides, the ability of nucleic acids to stimulate the immune response is significantly increased (compare ODN #2194, 2183, 2195 and 2196, decreasing in size from 27 to 18 nucleotides). Increasing the length of the nucleic acid to 30 nucleotides has a significant contribution to the biological properties of nucleic acids, but increased the e length above 30 nucleotides, apparently, in addition does not affect the immune-stimulating effect (for example, compare ONE with 2179 until 2006).

It has been shown that TG-nucleic acid with a length ranging from 15 to 25 nucleotides can be enhanced immunostimulatory properties. Thus, the invention features oligonucleotide, which has 15-27 nucleotides in length (i.e. oligonucleotide length in 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 nucleotides), which may be a T-rich nucleic acid or may be T-rich and TG nucleic acid. In one implementation of the oligonucleotide is neither T-rich nucleic acid or TG nucleic acid. In other implementations, the oligonucleotide does not have a CG motif. The invention offers similar oligonucleotides, which have long 15-27 nucleotides, oligonucleotides, which have a length of 18-25 nucleotides, oligonucleotides, which have long 20-23 nucleotides, and oligonucleotides, which have long 23-25 nucleotides. Any of the above accomplishments related to the oligonucleotides in length 15-27 nucleotides, also relates to oligonucleotides with different data lengths. The invention additionally encompasses the use of any of the above nucleotide in the cited here how.

Although the maximum level of immune stim the ablation is achieved with some T-rich nucleic acids, when the nucleic acid has a length of 24 to 30 nucleotide residues, as well as with some TG-nucleic acids, the length of which lies in the range from 15 to 25 nucleotides, shorter or longer immunostimulatory nucleic acids can also be applied in accordance with the methods of the invention. To accelerate the capture of cells immunostimulatory nucleic acid is the preferred minimum length of 6 nucleic acid residues. Nucleic acids of any size greater than 6 nucleotides (even longer than many TPN) is able to induce an immune response in accordance with the invention, if there is a sufficient number of immunostimulatory motifs, as larger nucleic acids are degraded inside the cell. Preferably the immunostimulatory nucleic acids are in the length range between 8 and 100 nucleotides, and in some implementations immunostimulatory nucleic acid that contains the T-enriched plots vary in length between 24 and 40 nucleotides, and the immunostimulatory nucleic acid containing TG, vary in length between 15 and 25 nucleotides.

In one implementation of the T-rich nucleic acid represented by at least the formula:

5'H1X2TTTH3X43’,

where X1, X2, X3and X 4are nucleotides. In one implementation of the X1X2are TT and/or X3X4are TT. In another implementation of the X1X2represents any one of the following nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, GT, GG, GA, and GC; and X3X4represents any one of the following nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, GT, GG, GA and GC.

In some implementations preferably the immunostimulatory nucleic acid is not contained poly-(SSSS) or poly-A (AAAA). In other implementations preferably immunostimulirutuyu nucleic acid include poly-C, poly-A, poly-G (GGGG) or multiple GG. In particular, poly-G or multiple GG motives have significant effects on some immunostimulatory nucleic acid. The effect of such does not contain T-sequences partially depends on the status of the skeleton of the nucleic acid. For example, if the nucleic acid has fosfodiesterzy frame or chimeric backbone, the inclusion of these sequences in the nucleic acid should have only minimal, if any, effect on the biological activity of the nucleic acid. If the frame is fully positivity (or other phosphate modification) or largely positivity, the inclusion d is the R sequences may have a greater influence on the biological activity or kinetics of biological activity, causing the reduction potential T-rich and TG immunostimulatory nucleic acid.

Although it was shown that C-enriched nucleic acids have immunostimulating properties, the introduction of poly-C sequences in the T-rich nucleic acid in such a way as to reduce the relative proportion of T nucleotides in the nucleic acid can make a negative contribution to the nucleic acid. Although the inventors are not bound by the alleged mechanism, it is assumed that the immune system has developed mechanisms to distinguish between nucleic acids having different nucleotide properties, perhaps due to different planting binding proteins that recognize different sequences, or specific binding proteins, which recognize all immunostimulatory sequence, but contact them with different affinity. In General, nucleic acid, comprising neetilirovannye CpG-motifs are in the highest degree stimulating, followed by T-rich nucleic acids, TG-nucleic acid and P-enriched nucleic acid. This generalization, however, has many exceptions. For example, a substantially T-rich nucleic acid that is similar to SEQ ID NO.: 886, is more of immunostimulation in some tests than some CpG sod is readie nucleic acid (e.g., phosphorotioate CpG nucleic acid containing a single CpG motifs).

It was also discovered that the addition of poly-A tail to the immunostimulatory nucleic acid may increase the activity of nucleic acids. It has been discovered that when a strong immunostimulirutuyu CpG nucleic acid (SEQ ID NO.: 246) modified by adding a poly-a tail (AAAAAA) or poly-T tail (TTTTTT), the resulting oligonucleotides were increased its immunostimulirutuyu activity. The ability of poly-a and poly-T tail to increase the immunostimulatory properties of oligonucleotide very similar. SEQ ID NO.: 246 is a T-rich oligonucleotide. It is likely that if the poly-a and poly-T tails add to the nucleic acid that is not T-enriched, it must contribute more to immunostimulirutuyu the ability of the nucleic acid. Since the poly-T tail was added to the nucleic acid, which was already high T-rich, immune-stimulating properties adding poly-T to some extent, but not completely washed away. These results are important for the application of poly-a regions. Thus, in some implementations immunostimulatory nucleic acids include poly-A region, and in other implementations, they do not include it.

Some of the immunostimulatory nucleotide sequence that is new acids according to the invention include one or more CG motifs. The presence of CG-immunostimulatory motifs in nucleic acids also influence the biological activity of nucleic acids. If the total length of the immunostimulatory nucleic acid is 20 nucleotide residues or less, CpG-motifs important for determining the immune effect of nucleic acid, and methylation of these motifs reduces the effect of immunostimulatory effects of nucleic acid. If the length of the immunostimulatory nucleic acid is increased to 24, the immunostimulatory effects of nucleic acids become less dependent on CpG-motifs and destroyed more by methylation of CpG motifs by their inversion in GC dinucleotides that gives presents here other immune-stimulating properties.

For example, ODN 2006 (SEQ ID NO: 246) is a strong immunostimulirutuyu T-rich nucleic acid of the 24 nucleotide residues in length with four CpG dinucleotides. However, ODN 2117 (SEQ ID NO: 358), in which CpG motifs are methylated, is also a strong immunostimulatory oligonucleotide. ODN 2137 (SEQ ID NO: 886), in which CpG motifs ODN 2006 is inverted to GpC, and that the result has six TG-dinucleotides, is also an immunostimulatory oligonucleotide. Immunostimulatory effects of nucleic acids, such as ODN 2117 and 2137, regulated with p the power in their content T and TG. Each of these three nucleic acid is a T-rich ODN 2137 additionally TG-enriched. If the content of T is reduced by introducing other grounds, such as A (ODN 2117 (SEQ ID NO: 358), or if the content of TG is reduced due to the replacement of TG on AG, the immunostimulatory effects to some extent reduced. In another example, nucleic acid with 24 nucleotides in length, in which all of the provisions randomized, has only moderate immune-stimulating effect (ONE 2182 (SEQ ID NO: 432)). Similarly, nucleic acid with 24 nucleotides in length with the other structures of the nucleotides is different immunostimulatory effects depending on the content of T (ONE 2188 (SEQ ID NO: 905), 2189 (SEQ ID NO: 906), 2190 (SEQ ID NO: 907), 2191 (SEQ ID NO: 908), 2193 (SEQ ID NO: 910), 2183 (SEQ ID NO: 433) and 2178 (SEQ ID NO: 428)). ONE 2190, which contains the TGT motives, is more stimulating than ONE 2202, which contains TGG motives. Thus, in some implementations TGT motives are preferred. In some implementations, it is important the number of TG-motives, because the increase in the number of TG-motives leads to increased immune stimulation. Some preferred TG-nucleic acids contain at least three TG-motive.

Examples of CpG nucleic acids include, but are not limited to, those listed in table a sequence, such as SEQ ID nos I, 3, 4, 14-16, 18-24, 28, 29, 33-46, 49, 50, 52-56, 58, 64-67, 69, 71, 72, 76-87, 90, 91, 93, 94, 96, 98, 102-124, 126-128, 131-133, 136-141, 146-150, 152-153, 155-171, 173-178, 180-186, 188-198, 201, 203-214, 216-220, 223, 224, 227-240, 242-256, 258, 260-265, 270-273, 275, 277-281, 286 and 287, 292, 295-296, 300, 302, 305-307, 309 to 312, 314-317, 320-327, 329, 335, 337-341, 343-352, 354, 357, 361-365, 367-369, 373-376, 378-385, 388-392, 394, 395, 399, 401-404, 406-426, 429-433, 434-437, 439, 441-443, 445, 447, 448, 450, 453-456, 460 to 464, 466-469, 472-475, 477, 478, 480, 483-485, 488, 489, 492, 493, 495-502, 504-505, 507-509, 511, 513-529, 532-541, 543-555, 564-566, 568-576, 578, 580, 599, 601-605, 607-611, 613-615, 617, 619-622, 625-646, 648-650, 653-664, 666-697, 699-706, 708, 709, 711-716, 718-732, 736, 737, 739-744, 746, 747, 749-761, 763, 766-767, 769, 772-779, 781-783, 785-786, 790-792, 798-799, 804-808, 810, 815, 817, 818, 820-832, 835-846, 849-850, 855-859, 862, 865, 872, 874-877, 879-881, 883-885, 888-904 and 909-913.

In some implementations of the invention, the immunostimulatory nucleic acids include CpG dinucleotides, and in other implementations immunostimulatory nucleic acid is free of CpG dinucleotides. CpG dinucleotides can be methylated or demetilirovanny. Nucleic acid containing at least one demetilirovanny CpG dinucleotide, is a molecule of nucleic acid, which contains demetilirovanny cytosine-guanine, dinucleotide sequence (i.e. "CpG DNA" or DNA containing demetilirovanny 5'-cytosine, followed by 3'-guanosine associated phosphate bond)and activates the immune system. Nucleic acid containing at least one methylated CpG dinucleotide, is nuclein the second acid, which contains methylated cytosine-guanine dinucleotide sequence (i.e methylated 5’-cytosine, followed by 3’-guanosine associated phosphate bond).

Examples of T-rich nucleic acids that are free of CpG nucleic acids, include, but are not limited to, are presented in table a, the sequence, such as SEQ ID NO: 59-63, 73-75, 142, 215, 226, 241, 267-269, 282, 301, 304, 330, 342, 358, 370-372, 393, 433, 471, 479, 486, 491, 497, 503, 556-558, 567, 694, 793-794, 797, 833, 852, 861, 867, 868, 882, 886, 905, 907, 908 and 910-913. Examples of T-rich nucleic acids, which include CpG nucleic acids include, but are not limited to, are presented in table a, such as SEQ ID NO: 64, 98, 112, 146, 185, 204, 208, 214, 224, 233, 244, 246, 247, 258, 262, 263, 265, 270-273, 300, 305, 316, 317, 343, 344, 350, 352, 354, 374, 376, 392, 407, 411-413, 429-432, 434, 435, 443, 474, 475, 498-501, 518, 687, 692, 693, 804, 862, 883, 884, 888, 890 and 891.

Immunostimulatory nucleic acids can be single and double-stranded. Usually double-stranded molecules are more stable in vivo, while single molecules have an increased immune activity. Thus, in some embodiments of the invention it is preferable that the nucleic acid was available, and in other embodiments, it is preferable that the nucleic acid was double-stranded.

Used herein, the term " T-rich nucleic acid and a TG nucleic acid-KIS the PTA relates to immunostimulatory T-rich nucleic acid and TG immunostimulatory nucleic acid, respectively, if not stated otherwise. T-rich nucleic acid sequence of the invention are those described in detail above, as well as nucleic acids presented in table a that have at least one poly-T motif and/or who have a composition with more than 25%, or preferably 35% T nucleotide residues. With-enriched nucleic acids of the invention are those that have at least one and preferably two poly-C region. TG-nucleic acids according to the invention are those described in detail above, as well as nucleic acids presented in table a that have at least one TG is the motive.

Nucleic acids according to the invention may, but not necessarily, also include a poly-G motif. Poly-G containing nucleic acids, are also boosting. In various references, including Pisetsky and Reich, 1993 Mol. Biol. Reports, 18: 217-221; Krieger and Herz, 1994, Ann. Rev. Biochem., 63: 601-637; Macaya et al., 1993, PNAS, 90: 3745-3749; Wyatt et al., 1994, PNAS, 91: 1356-1360; Rando and Hogan, 1998, In Applied Antisense Oligonucleotide Technology, ed. Kneg and Stein, p.335-352; and Kimura et al., 1994, J Biochem. 116, 991-994, also described immunostimulatory properties of poly-G nucleic acids.

Poly-G nucleic acid preferably represent a nucleic acid having the following formula:

5'X1X2 GGGX3X43’

where X1X2, X3and X4represent nucleotides. In the preferred implementation, at least one of X3and X4is a G. In other implementations both X3and X4is a G. in Another preferred implementation, the formula represents a 5'GGGNGGG3’ or 5'GGGNGGGNGGG3’, where N is between 0 and 20 nucleotides. In other implementations poly-G nucleic acid is free from neetilirovannyj CG-dinucleotides, such as nucleic acids listed below as SEQ ID NO: 5, 6, 73, 215, 267-269, 276, 282, 288, 297-299, 355, 359, 386, 387, 444, 476, 531, 557-559, 733, 768, 795, 796, 914-925, 928-931, 933-936 and 938. In other implementations poly-G nucleic acids include at least one demetilirovanny CG dinucleotide, such as nucleic acids listed above as SEQ ID NO: 67, 80-82, 141, 147, 148, 173, 178, 183, 185, 214, 224, 264, 265, 315, 329, 434, 435, 475, 519, 521-524, 526, 527, 535, 554, 565, 609, 628, 660, 661, 662, 725, 767, 825, 856, 857, 876, 892, 909, 926, 927, 932 and 937.

The terms "nucleic acid" and "oligonucleotide" are used interchangeably to refer to multiple nucleotides (i.e. molecules comprising a sugar (e.g. ribose or deoxyribose)linked to a phosphate group and exchangeable organic base, which is either a substituted pyrimidine (e.g. cytosine (C), time is n (T) or uracil (U) or a substituted purine (e.g., adenine (a) or guanine (G)). Used here, the terms are oligoribonucleotides, as well as to oligodeoxynucleotides. The terms shall also include polynucleotide (i.e. polynucleotide minus the phosphate) and any other organic base containing polymer. Molecules of nucleic acids can be obtained from existing sources of nucleic acids (e.g., genomic or cDNA), but the preferred synthetic (for example, obtained by synthesis of nucleic acids).

The terms nucleic acid and oligonucleotide also include nucleic acids or oligonucleotides with substitutions or modifications, such as at the bases and/or sugars. For example, they include a nucleic acid having backbone sugars which are covalently attached to an organic group with a low molecular weight, non-hydroxyl group 3’ position and different from the phosphate group at the 5’ position. Modified thus nucleic acid can include 2’-O-alkilirovanny robozou group. In addition, the modified nucleic acid may include sugars such as arabinose instead of ribose. Thus, the nucleic acid can be heterogeneous in composition of the skeleton, including in connection with any possible combination of polymer units, connect the R together in the form of a peptide-nucleic acids (which have the amino acid backbone with nucleotide bases). In some implementations nucleic acids are homogeneous in composition of the skeleton. Nucleic acids also include substituted purines and pyrimidines, such as C-5 propyne modified bases (Wagner et al., Nature Biotechnology 14: 840-844, 1996). Purines and pyrimidines include, but are not limited to, adenine, cytosine, guanine, thymidine, 5-methylcytosine, 2-aminopurine, 2-amino-6-globulin, 2,6-diaminopurine, gipoksantin and other existing and not existing in the nature of the nucleotide bases, substituted and unsubstituted aromatic part. Other such modifications are well known to specialists in this field.

For use in the present invention the nucleic acid according to the invention can be synthesized de novo using any of a number of procedures well known to specialists in this field. For example, b-cyanomethylphosphonate method (Beaucage, S.L., and Caruthers, M.H., Tet. Let. 22: 1859, 1981); nucleoside H-phosphonate method (Garegg et al., Tet. Let. 27: 4051-4054, 1986; Froehler et al., Nucl. Acid. Res. 14: 5399-5407, 1986,; Garegg et al., Tet. Let. 27:4055-4058, 1986, Gaffney et al., Tet. Let. 29: 2619-2622, 1988). These chemical methods can be performed using a variety of automated nucleic acid synthesizers available on the market. Data nucleic acids are referred to as synthetic nucleic acids. In the opposite version of the T-enriched and/or TG-dinuk eotide can be obtained on a large scale in plasmids, (see Sambrook, T., et al., "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor laboratory Press, New York, 1989) and separated into smaller pieces or entered in its entirety. Nucleic acids can be obtained from existing nucleic acids sequences (e.g. genomic or cDNA) using known methods, such as the use of enzymes, economies or endonucleases. The nucleic acid obtained in this way are referred to as the selected nucleic acid. The selected nucleic acid usually means a nucleic acid that is separated from components with which it is normally associated in nature. For example, isolated nucleic acid can be an acid, which is isolated from cells, nuclei, mitochondria or chromatin. Terms of Ru-rich nucleic acid and a TG nucleic acid cover both synthetic and allocated Ru-rich nucleic acid and a TG nucleic acid.

For use in vivo Ru-rich and TG-nucleic acid may not necessarily be relatively resistant to degradation (e.g., stable). "Stabilized nucleic acid molecule" shall mean a molecule of nucleic acid, which is relatively resistant to degradation in vivo (for example, under the action of Exo - and endonucleases). Stabilization may be a feature length or secondary structure of Nucleic acid, which vary in length from tens to thousands of KBP, are relatively resistant to degradation in vivo. In the case of shorter nucleic acid secondary structure can stabilize and increase their efficiency. For example, if the 3’end of nucleic acid complementary to its upper region so that it can die back and form a type of a stem loop structure, nucleic acid becomes stable and, therefore, is very active.

In the opposite case the stabilization of nucleic acids can be achieved by modifications of the phosphate backbone. Preferred stabilized nucleic acid according to the present invention have a modified backbone. It is shown that modification of the skeleton of the nucleic acid provides increased activity of Ru-rich and TG nucleic acid when introduced in vivo. Data stable patterns are preferred, since the Ru-rich and TG molecules of the invention are at least partially modified frame. Ru-rich and TG constructs with phosphorotioate communication, provide maximum activity and protect nucleic acids from degradation under the action of Exo - and endonucleases. Other modified nucleic acids include postdive the modified nucleic acid, combination fosfomifira and phosphorotioate nucleic acid, methylphosphonate, methylphosphonothioate, phosphorodithioate, p-ethoxy and combinations thereof. Each of these combinations and their particular effects on immune cells is discussed in more detail in relation to CpG nucleic acids in the published patent applications PCT PCT/US 95/01570 (WO 96/02555) and PCT/US 97/19791 (WO 98/8810), claiming priority of U.S. patent serial Nos. 08/386063 and 08/960774 registered 7 February 1995 and October 30, 1997, respectively, the full content of which is incorporated herein by reference. It is expected that these modified nucleic acids can be very stimulating activity due to increased resistance to nucleases, increased capture of cells, increased binding to proteins and/or altered intracellular localization.

Compositions according to the invention can optionally be chimeric, oligonucleotides. Chimeric oligonucleotides are oligonucleotides having the formula: 5'Y1N1ZN2Y23’. Y1and Y2represent a molecule of nucleic acid, having from 1 to 10 nucleotides. Y1and Y2each includes at least one modified mezhnukleotidnyh communication. Since at least 2 nucleotides of the chimeric oligonucleotides include the odificatio frame, data nucleic acids are an example of one type of "stabilized immunostimulatory nucleic acids".

In respect of chimeric oligonucleotides Y1and Y2treated as independent from one another. This means that each of Y1and Y2may or may not have different sequences and different one from another communication skeleton in the same molecule. Sequences vary, but in some cases Y1and Y2have a poly-G sequence. Poly-sequence means having at least 3 G in the row. In other implementations poly-sequence means having at least 4, 5, 6, 7 or 8G in a row. In other implementations Y1and Y2can be a TCGTCG, TCGTCGT or TCGTCGTT (SEQ ID NO: 1145). Y1and Y2may also be poly-C, poly-T or poly-A sequence. In some implementations Y1and/or Y2have from 3 to 8 nucleotides.

N1and N2represent molecules of nucleic acids having from 0 to 5 nucleotides, and are of such a length that N1ZN2had at least 6 nucleotides in total. Nucleotides N1ZN2have fosfodiesterzy frame and does not include nucleic acids having modified backbone.

Z represents a motif immunostimulatory nuclei the OIC acid, but does not include the CG. For example, Z may be a nucleic acid with T-enriched

sequence, for example, includes TTTT motif or sequence in which at least 50% of the bases of the sequence are T or Z can be a TG sequence.

Central nucleotides (N1ZN2) formula Y1N1ZN2Y2have phosphodieterase mezhnukleotidnyh communication and Y1and Y2have at least one, but may have more than one or even can have all modified mezhnukleotidnyh communication. In the preferred implementation Y1and/or Y2have at least two or from two to five modified mezhnukleotidnyh ties, or Y1has two modified mezhnukleotidnyh communication and Y2has five modified mezhnukleotidnyh ties, or Y1has five modified mezhnukleotidnyh ties and Y2has two modified mezhnukleotidnyh communication. Modified mezhnukleotidnyh regard, in some implementations represent phosphorotioate modified communication phosphorodithioate modified communication or p-ethoxy modified connection.

Modified hulls, such as phosphorotioate, can be synthesized using automated methods with the use of the either of phosphoramidate or H-phosphonate as chemical reagents. Aryl - and alkylphosphonate can be obtained, for example, as described in U.S. patent No. 4469863; and alkylphosphocholine (in which the charged oxygen part is alkylated, as described in U.S. patent No. 5023243 and in European patent No. 092574) can be obtained using automated solid-phase synthesis using commercially available reagents. Describes how to create other modifications of the backbone of DNA and substitutions (Uhlmann, E. and Peyman, A., Chem. Rev. 90: 544, 1990; Goodchild, J., Bioconjugate Chem. 1: 165, 1990).

Other stabilized nucleic acids include DNA analogues, such as alkyl - and arylphosphate (in which the charged phosphonate oxygen is substituted by an alkyl or aryl group), phosphodieterase and alkylphosphocholine, in which the charged oxygen part is alkylated. Nucleic acids that contain a diol, such as tetraethylene glycol or hexamethyleneimine, either on one or on both ends, as shown, are essentially resistant to degradation under the action of nucleases.

When PY-rich or TG-nucleic acid is introduced in combination with an antigen that is encoded in the vector nucleic acid, it is preferable that the skeleton of a PY-rich or TG-nucleic acid consisted of a chimeric combination of phosphodiester and phosphorotioate (or some other modification of the phosphate). You article is lgnutls with the problem of capture cell plasmid vector in the presence of fully phosphorotioate nucleic acid. When the subject is delivered as a vector and a nucleic acid, preferably a nucleic acid had a Chimera skeleton or had positivity frame, but that the plasmid was associated with the medium that delivers it directly into the cell, to avoid the need of taking cells. Such media are known in the art and include, for example, liposomes and gene gun.

Described herein are nucleic acids, as well as a control nucleic acid are presented in table a at the end of the description.

While the effects of CpG in mice is well characterized, information in relation to the systems is limited. CpG-phosphorotioate oligonucleotides with a strong stimulating activity in the mouse systems show less activity in humans and immune cells of other animals that are not rodents. In the examples described the development of the CpG motif of a man with strong activity and description of its effects and mechanisms of action on primary b-cells. DNA containing this pG motif, strongly stimulated primary b cells in relation to cell proliferation, production ML-6 and increased expression levels of CD86, CD40, CD54, and MHC II. They increased DNA-binding activity of the transcription factors NFkB and API, as well as the phosphorylation of stress-activated the om protein kinases JNK and R and the transcription factor ATF-2. Transmission signal in b cells activated with CpG DNA, different from those, which are activated through receptor In cells that have activated ERK and other isoforms of JNK, but not activated R and ATF-2. In General, data on initiated by CpG-DNA signaling coincide with those obtained in mice (H. Hacker, et al., 1998. Embo J 17:6230, Yi, A. K., and Krieg, A. M. 1998. J Immunol 161:4493).

The preferred motive for animals that are not rodents, is a 5’-TCGTCGTT-3’. Replacement bases in the most powerful 8-membered CpG motif (5’-TCGTCGTT-3’) reduced the activity of the oligonucleotide. Thymidine 5’- and 3’- positions of this motif were more important than thymidine in a Central position. Adenine or guanosine in a Central position resulting in reduced activity.

It should be noted that the study authors suggest that one CpG motif in fosfomifira the oligonucleotide (2080) is sufficient to obtain maximum effect and that additional CpG motifs (2059) not further increase the activity. Oligonucleotide with 8-membered motif 5'TCGTCGTT3’ (2080)containing two CpG-dinucleotide, was shown in the studies of greatest activity. Substitution of bases adjacent to the two CpG-dinucleotides (5 polozenie, Central position, 3 polozhenie), reduced activity of this sequence. Both CpG-dinucleotide 8-membered CpG motif was required for optimalnoe activity (2108, 2106). Methylation of cytidine in CpG dinucleotides (2095) destroyed the activity 2080, while methylation is not related to this cytidine (2094) had no effect. The addition of two CpG motifs in the sequence 2080 resulted in 2059 in an additional increase in activity phosphodieterase of the oligonucleotide. The sequence 2080 with phosphorotioate skeleton (2116) showed less activity, suggesting that additional CpG motifs are preferred for strong phosphorotioate of the oligonucleotide.

In accordance with the invention, it has been discovered that immunostimulatory nucleic acids comprise a strong immunostimulatory effects on human cells, such as NK-cells, b-cells and DC in vitro. It is shown that the in vitro tests predict efficacy in vivo as adjuvant vaccine in vertebrates, non-rodents (example 12), which implies that the immunostimulatory nucleic acids are effective therapeutic agents for the vaccination of humans, immunotherapy cancer immunotherapy asthma, an overall increase immune function, increasing the detection cells hematopoiesis after irradiation or chemotherapy for other applications immunomodulation.

Thus, the immunostimulatory nucleic acids are useful in some embodiments of the invention as a prophylactic VA who care for the treatment of a subject at risk of developing infection in an infected organism or cancer, in which identified specific cancer antigen, or allergies or asthma, in which the allergen predisposition to asthma is known. Immunostimulatory nucleic acids can also be used without antigen or allergen for a shorter protection against infection, allergies or cancer, and in this case the second dose should create longer-lasting protection. Used here, the term is the subject of having risk refers to the subject who has any risk of contact with infection caused by a pathogen or cancer, or an allergen, or the risk of cancer. For example, a subject having a risk can be a subject who is planning a trip to the area in which found the particular type of infectious agent, or it can be a subject which, because of their lifestyle or medical procedures come into contact with body fluids that contain infectious organisms, or directly with the body, or even any entity, living in the area where the identified infectious organism or allergen. "A subject having a risk of infection," also indicates the General population, for which the medical establishment recommends vaccination with antigen-specific infectious organism. If the antigen is an allergen, the subject develops an allergic response to a particular antigen, and sub the CT may be exposed to antigen, i.e. if it's flowering season, the subject has a risk of exposure to the antigen pollen. "A subject having a risk of developing allergies or asthma"refers to entities that are known to have allergies or asthma, but do not have the active disease during treatment immunostimulatory nucleic acid, as well as subjects that are considered as having a risk of developing these diseases because of genetic factors or environmental factors.

A subject having cancer risk, is one of those who has a high probability of developing cancer. This concept refers to entities which, for example, have genetic defects, the presence of which, as shown, is correlated with increased likelihood of developing cancer, and to the subjects who are faced with agents that cause cancer, such as tobacco, asbestos, or other chemical toxins, or to subjects that have previously been treated for cancer and are in a state of undeniable remission. When the subject having a risk of developing cancer, treated with antigen-specific type of cancer for which the subject has a risk of development, and immunostimulatory nucleic acid, a subject can acquire the ability to destroy cancer cells as they arise. If the subject began to form tumors, the entity should develop special the specific immune response against the tumor antigen.

In addition to the use of immunostimulatory nucleic acids for prophylactic treatment, the invention also covers the use of immunostimulatory nucleic acids for the treatment of a subject having an infection, allergies, asthma, or cancer.

A subject having an infection, is a subject who met with the infectious pathogen and has acute or chronic determine the level of the pathogen in the body. Immunostimulatory nucleic acids can be used with an antigen to enhance antigen-specific systemic immune response or answer the mucous membrane, which can reduce or destroy the infectious pathogen. Used here, the term "infectious disease" is a disease resulting from the presence in the body of an alien organism. It is especially important to develop strategies for effective vaccination and treatment to protect the mucous surfaces of the body, which are the primary gate infection.

A subject having an allergic reaction, is a subject who has an allergic reaction or the risk of its development in response to the allergen. Allergy means acquired hypersensitivity to a substance (allergen). Allergic conditions include, but are not limited to, eczema, allergic rhinitis or OS is ing rhinitis, hay fever, conjunctivitis, bronchial asthma, urticaria (hives) and food allergies, and other atopic conditions.

Currently allergic diseases are usually treated by injecting small doses of antigen, followed by further increasing the dosage of the antigen. It is believed that this procedure causes tolerance to the allergen, prevent further allergic reactions. These methods, however, can take several years to achieve effectiveness and are associated with the risk of side effects such as anaphylactic shock. The methods according to the invention have no such problems.

Allergies are caused by the generation of IgE antibodies against harmless allergens. The cytokines that are induced as a result of the introduction or the introduction of mucous immunostimulatory nucleic acids, belong

mainly to the class, called Th1 (examples are IL-12 and IFN-γ), and they induce both humoral and cellular immune responses. The types of antibodies that are associated with a Th1 response, usually have a higher protective activity, as they have a high capacity for neutralization and opsonization. The other main type of immune response that is associated with the production of cytokines - IL-4, IL-5 and IL-10, referred to as Th2 dysbalance-type immune response. Th2 dysbalance responses involve the advantage of the antibodies, and it has a smaller protective effect against infections, and some Th2 dysbalance-isotypes (e.g., IgE) associated with allergies. In General, it is assumed that allergic diseases mediated by Th2-type immune responses, while Th1 responses provide the best protection against infection, although excessive Th1 responses are associated with autoimmune disease. Based on the ability of immunostimulatory nucleic acids to shift the immune response in the subject with Th2 (which is associated with production of IgE antibodies and Allergy) to a Th1 response (which is protective against allergic reactions), to a subject to treat or prevent allergies can be introduced effective dose immunostimulatory nucleic acid for the induction of an immune response.

Thus, the immunostimulatory nucleic acids have significant therapeutic applicability in the treatment of allergic and non-allergic conditions such as asthma. The level of Th2-cytokines, especially IL-4 and IL-5 increased in the Airways of subjects with asthma. These cytokines contribute to the development of the main options asthmatic inflammatory response, including switching to the IgE isotype, chemotaxis and activation of eosinophils growth of fat cells. Th1-cytokines, especially ifn-γ and IL-12 can inhibit the formation of Th2 dysbalance-clones and the production of Th2 dysbalance of cytokines. Asthma refers to the state the of the respiratory system, characterized by inflammation, narrowing of the Airways and increased reaction of the Airways to inhaled agents. Asthma is often, though not exclusively, associated with atopic or allergic syndromes.

A subject having cancer is a subject that has defined the cancer cells. Cancers or tumors include, but are not limited to, cancer of the biliary tract; brain cancer; breast cancer; cervical cancer; horiokartsinoma; colon cancer; endometrial cancer; esophageal cancer; gastric cancer; intraepithelial neoplasms; lymphomas; liver cancer; lung cancer (e.g. small cell and non-small cell); melanoma; neuroblastomas; mouth cancer; ovarian cancer; pancreatic cancer; prostate cancer; rectal cancer; sarcomas; skin cancer; cancer of the testis, cancer of the thyroid gland and kidney cancer, as well as other carcinoma and sarcoma. In one implementation, the cancer is a leukemia retikulez, chronic myeloid leukemia, leukemia, cutaneous T-cell, multiple myeloma, follicular lymphoma, malignant melanoma, squamocellular carcinoma, cancer of the kidney cells, prostate cancer cells, bladder or rectal cancer.

The subject in accordance with the invention, is an entity that is not a rodent. The subject of the non-rodent must designate the person or monochloro animal, for example, it may be, but not limited to, a dog, a cat, a horse, cow, pig, sheep, goat, chicken, Primate such as a monkey, and fish (diluted in water)species, such as salmon, but specifically excluding rodents, such as rats and mice.

Thus, the invention can also be applied for the treatment of cancer and tumors in entities that are not human. Cancer is one of the leading causes of death of domestic animals (i.e. cats and dogs). Cancer usually affects older animals, which, if allowed, become integrated into the family. Forty-five percent of dogs over 10 years old, probably victims of the disease. The most common treatment options include surgery, chemotherapy, and radiation therapy. Other treatment options that have been applied with some success include laser therapy, cryotherapy, hyperthermia and immunotherapy. The choice of therapy depends on the type of cancer and the extent of spread. Except when malignancy growth is limited to a discrete area of the body, it is difficult to remove only the tumor tissue without influence also on normal cells.

Malignant disorders, usually diagnosciousness in dogs and cats include, but are not limited to, lymphosarcoma, osteosarcoma, mammary tumors, mastocytoma,brain tumor, melanoma, adenosquamous carcinoma, carcinoid tumor, brain tumor, bronchial gland, bronchiolar adenocarcinoma, fibroma, exohedral, sarcoma of the lung, neurosarcoma, osteoma, papilloma, retinoblastoma, abnormal Ewing sarcoma, a tumor Wilma, Burkitt's lymphoma, microglioma, neuroblastoma, osteoclastoma, neoplasia mouth, fibrosarcoma, osteosarcoma and rhabdomyosarcoma. Other neoplasia in dogs include squamocellular carcinoma genital, transmitted venericheskie tumor, a tumor of the testis, seminoma, tumor Sertoli cells, hemangiopericytoma, histiocytoma, chloroma (granulocyte sarcoma), papilloma of the cornea, squamocellular carcinoma of the cornea, hemangiosarcoma, pleural mesothelioma, basal cell tumor, thymoma, a tumor of the stomach, carcinoma of the adrenal glands, papillomatosis mouth, hemangioendothelioma and cystadenoma. Additional malignancy diagnosed in dogs include follicular lymphoma, lymphosarcoma of the intestine, fibrosarcoma and squamocellular carcinoma of the lung. It is known that a ferret, even more popular pet develops insulinoma, lymphoma, sarcoma, neuroma, a tumor of the islet apparatus of the pancreas, gastric lymphoma of MALT and adenocarcinoma of the stomach.

Neoplasia, developing the agricultural house of the community of cattle, include leukemia, hemangiopericytoma and neoplasia bulls eye (in cattle); prepucialna fibrosarcoma, ulcerative squamocellular carcinoma, prepucialna carcinoma, neoplasms of connective tissue and mastocytoma (in horses); hepatocellular carcinoma (pigs); lymphoma and lung adenomatosis (sheep); sarcoma of the lung, lymphoma, sarcoma, rous, reticuloendotheliosis, fibrosarcoma, neuroblastoma, b-cell lymphoma and lymphoid leukemia (in sheep); retinoblastoma, a neoplasia of the liver, lymphosarcoma (lymphoblastic sarcoma), plasmacytoid leukemia and sarcoma of the bladder (in fish), caseous lymphadenitis (CLA): a chronic infectious, contagious disease of sheep and goats caused by the bacterium Corynebacterium pseudotuberculosis, and the contagious lung tumor of sheep caused by jaagsiekte.

The subject exposed to an antigen. Used here, the term "exposed" refers to either an active stage of contacting the subject with an antigen or passive exposure to a subject antigen in vivo. How active exposure of the antigen to a subject are well known to specialists in this field of technology. In General, the antigen is administered directly to a subject by any method, such as intravenous, intramuscular, oral, transdermal introduction, introduction to the mucosal, intranasal, intratracheal, and the and subcutaneous administration. The antigen can be introduced systemically or topically. Methods of administration of the antigen and the immunostimulatory nucleic acid is described in more detail below. The subject is passively exposed to an antigen, for example, when entering the body of an alien pathogen or tumor cells expressing a foreign antigen on their surface.

The ways in which a subject is passively exposed to an antigen, can depend on time injection mode immunostimulatory nucleic acid. For example, in the case of a subject with cancer or an infectious disease, or an allergic or asthmatic response, the subject can be entered immunostimulirutuyu nucleic acid regularly, when the risk is greatest, i.e. within allergenic season or after a meeting with the agent causing cancer. Additionally immunostimulirutuyu nucleic acid can be introduced travelers before they travel abroad, where they risk to meet with infectious agents. In the same way immunostimulirutuyu nucleic acid may be introduced to soldiers or civilians at risk meetings with biological weapons for the induction of a systemic immune response or mucosal response to an antigen, when and if the subject will meet him.

Used here, the term "antigen" is a mole who Ulu, initiating the immune response. Antigens include, but are not limited to, cells, cell extracts, proteins, polypeptides, peptides, polysaccharides, polysaccharide conjugates, peptide and ones mimetics of polysaccharides and other molecules, small molecules, lipids, glycolipids, carbohydrates, viruses, and extracts viruses, as well as multicellular organisms, such as parasites and allergens. The term antigen in a broad sense includes any type of molecule which is recognized by the immune system of the host as alien. Antigens include, but are not limited to, cancer antigens, microbial antigens and allergens.

Used herein, the term "cancer antigen" is a molecule such as a peptide or protein that is associated with the surface of tumor or cancer cell and which is able to induce an immune response in expression on the surface of antigen-presenting cells together with the MHC molecule. Cancer antigens can be derived from cancer cells or by obtaining crude extracts of tumor cells, for example, as described by Cohen, et al., 1994, Cancer Research 54: 1055, by partial purification of antigens by recombinant means, or through de novo synthesis of known antigens. Cancer antigens include, but are not limited to, recombinante expressed antigens, their immunogen the second part or the whole tumor or cancer. Such antigens can be isolated or obtained through recombinant methods or any other methods known in the art.

Used here, the term "microbial antigen" is an antigen of a microorganism and includes but is not limited to, viruses, bacteria, parasites and fungi. Such antigens include the intact microorganism, as well as natural isolates and fragments or derivatives, and synthetic compounds, which are identical or similar to natural antigens of the microorganism and induce an immune response specific to the microorganism. The connection is similar to the natural antigen of the microorganism, if it induces an immune response (humoral and/or cellular) to the natural antigen of the microorganism. Such antigens are usually used in the art and they are well known to specialists in this field.

Examples of viruses that are found in humans include, but are not limited to, Retroviridae (e.g., the human immunodeficiency viruses, such as HIV-1 (also referred to as HTLV-III, LAV or HTLV-III/LAV, or HIV-III; and other isolates, such as HIV-LP; Picornaviridae (for example, poliovirus, hepatitis a virus; enteroviruses; Coxsackie viruses human rhinoviruses, echoviruses); Calciviridae (e.g. strains that cause gastroenteritis); Togaviridae (for example, VIR is si equine encephalitis, viruses rubella); Flaviridae (for example, dengue viruses, encephalitis viruses, viruses, yellow fever); Coronoviridae (for example, coronaviruses); Rhabdoviradae (e.g., viruses, vesicular stomatitis, rabies viruses); Coronaviridae (for example, coronaviruses); Rhabdoviradae (e.g., viruses, vesicular stomatitis, rabies viruses); Filoviridae (for example, viruses, Ebola); Paramyxoviridae (for example, parainfluenza viruses, mumps virus, measles virus, respiratory virus syncytium); Orthomyxoviridae (for example, influenza viruses); Bungaviridae (for example, Hantaan virus, viruses bunga, phlebovirus and Nairo viruses); Arena viridae (hemorrhagic fever viruses); Reoviridae (e.g., reovirus, orbivirus and rotaviruses); Birnaviridae;

Hepadnaviridae (hepatitis b virus); Parvoviridae (parvoviruses); Papovaviridae (papilloma viruses, viruses polyoma); Adenoviridae (most adenoviruses);

Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella zoster virus, cytomegalovirus (CMV), herpes virus; from the poxviridae (viruses smallpox, cowpox viruses, poxviruses); and Iridoviridae (e.g., virus African swine fever); and unclassified viruses (for example, the agents causing spongiform encephalitis, the agent of Delta hepatitis (assumed, which is the virus-the satellite of hepatitis b virus), the agents of hepatitis non-a, non-b (class 1 = transmitted through the internal organs; class 2 = parenterally transmitted (i.e. hepatitis C); Norwalk virus and related to ningirsu, and astroviruses).

In vertebrates antigens serve as gram-positive and gram-negative bacteria. Such gram-positive bacteria include, but are not limited to, species, Pasteurella species are Susceptible and Streptococcus species. Gram-negative bacteria include, but are not limited to, Escherichia coli, Pseudomonas species, and Salmonella species. Specific examples of infectious bacteria include but are not limited to, Helicobacter pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps (e.g. M. tuberculosis, M. avium, M. intracellulare, M. kansaii, M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes. Streptococcus pyogenes (Streptococcus group a), Streptococcus agalactiae (Streptococcus group b), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic species), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp., Haemophilus infiuenzae, Bacillus antracis, corynebacterium diphtheriae, corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringers, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides sp., Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema pallidium, Treponema pertenue, Leptospira, Rickettsia and Actinomyces israelli.

Examples of fungi include Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans.

Other infectious organisms (i.e. simplest) include Plasmodium spp., such as Plasmodium falciparum, Plasmodium malariae, Plasmodium ovale and Plasmodium vivax, Toxoplasma gondii. Parasites of the blood, bones and/or tissues include Plasmodium spp., Babesia microti, Babesa divergens, Leishmania tropica, Leishmania spp., Leishmania braziliensis, Leishmania donovani, Trypanosoma gambiense and Trypanosoma rhodesiense (African sleeping sickness), Trypanosoma cruzi (Chagas disease’) and Toxoplasma gondii.

Other related medicine microorganisms are described in detail in the literature, for example, see C.G.A Thomas, Medical Microbiology, Bailliere Tindall, Great Britain 1983, the full contents of which are incorporated herein by reference.

Although many of microbial agents, described above, are related to human diseases, the invention is also useful for the treatment of other vertebrate, non-human. Vertebrate, non-human, can also be infection that can be prevented or cured disclosed here-boosting nucleic acids. For example, in addition to the treatment of infectious diseases, the methods of the invention are useful for the treatment of infections in animals.

Used here, the terms "treat", "treated", "treating" when used in relation to infectious diseases, mean prophylactic treatment which increases the resistance of the subject (subject having a risk of infection to infection caused by a pathogen or, in other words, decreases the likelihood that the subject will become infected with the pathogen, as well as a treatment after the subject (a subject that is infected) becomes positive, so that b is to fight infection, for example, to reduce or eliminate the infection or prevent it from hardening.

Many vaccines for the treatment of vertebrate, non-human, are disclosed, Benett, K. Compendium of Veterinary Products, 3rd ed. North American Compendiums, Inc., 1995. As discussed above, antigens include infectious microbes, such as a virus, parasite, bacteria and fungi and their fragments, which are derived from natural or synthetic sources. Infectious viruses of vertebrates, both parties and non-human, include retroviruses, RNA-type viruses and DNA-type viruses. This group of retroviruses includes both simple retroviruses, and complex retroviruses. Simple retroviruses include a subgroup of retroviruses type b retroviruses type C and d type retroviruses example of a retrovirus type is a virus In breast tumor mice (MMTV). Retroviruses type include subgroups of type (including rous sarcoma virus (RVS), leukosis virus of birds (ALV) and the virus myeloblastosis birds (AMV)and group type (including virus feline leukemia (FeLV), leukosis virus apes - Gibbon (GALV), virus, spleen necrosis (SNV), the virus reticuloendotheliosis (RV) and simian sarcoma virus (SSV)). The type D retroviruses include the monkey virus Mason-Pfizer (MPMV) and simian retrovirus type 1 (SRV-1). Complex retroviruses include subgroups Lenti is Urusov, viruses leukemia T cells and foaming viruses. Lentiviruses include HIV-1, but also include HIV-2, SIV, Visna virus, feline immunodeficiency virus (FIV) and the virus equine infectious anemia (EIAV). Viruses leukemia T cells include HTLV-1, HTLV-II virus T-cell leukemia monkey (STLV) and leukosis virus cows (BLV). Foaming viruses include foaming virus man (HFV), foaming monkey virus (SFV) and foaming virus cows (BFV).

Examples of other RNA-type viruses that are antigens in vertebrate animals include, but are not limited to, members of the family Reoviridae, including the genus Orthoreovirus (multiple serological types of retroviruses as mammals and birds), the genus Orbivirus (Bluetongue virus, the virus Eugenangee, Kemerovo virus, a virus disease African horse and virus Colorado tick fever), the genus Rotavirus (human rotavirus, a virus diarrhea calves Nebraska, simian rotavirus, rotavirus cows or sheep, rotavirus birds); the family Picornaviridae, including the genus Enterovirus (poliovirus, virus And and In Coxsackie, enteric cytopathic orphan human viruses (ECHO), hepatitis a virus, simian enteroviruses, viruses encephalomyelitis mice, poliovirus muris, enteroviruses cows, enteroviruses pigs, the genus Cardiovirus (virus encephalomyocarditis (EMC), mengovirus), the genus Rhinovirus (human rhinoviruses including at least 11 subtypes, other rhinoviruses), the genus Apthovirus (disease of the mouth and feet (FMDV); the family Calviviridae, including the virus of vesicular exanthema of swine virus sea lion San Miguel, feline picornavirus and Norwalk virus; the family Togaviridae, including the genus Alphavirus (virus Eastern equine encephalitis virus, Semliki forest virus, Sindbis virus, Chikungunya virus, O ' Nyong-Nyong virus, Ross river virus, Venezuelan equine encephalitis virus Western equine encephalitis virus), the genus Flavirjus (the virus is transferred by mosquitoes yellow fever, dengue virus, Japanese encephalitis virus, the virus encephalitis St. Louis, the virus encephalitis Murray Valley, West Nile virus, Kunjin virus, a virus, a portable Central European mite, virus, portable far Eastern mite, virus, Kyasanur forest virus, Louping III virus, Powassan virus, Omsk hemorrhagic fever), the genus Rubivirus (virus; rubella virus), the genus Pestivirus (virus diseases of the mucous membranes, the virus cholera swine virus border status), family Bunyaviridae, including the genus Bunyvirus (Bunyamwera and related viruses, a group of viruses, California encephalitis virus), the genus Phlebovirus (Sicilian virus fever, portable sand fly, the virus of rift valley fever), the genus Nairovirus (haemorrhagic fever Crimean-Congo virus disease of sheep in Nairobi and the family Uukuvirus (Uukuniemi and related viruses); the family Orthomyxoviridae, including the genus influenza virus (influenza virus type a, many

p is dtype person); influenza virus of swine influenza viruses of sheep and horses; influenza type b (many subtypes of person), and influenza type C (possible separate genus); the family Paramyxoviridae, including the genus Paramyxovirus (parainfluenza virus type I, Sendai virus, the virus haemadsorption, parainfluenza viruses types 2 to 5, Newcastle disease virus, mumps virus), the genus Morbillivirus (measles virus, virus, subacute sclerosing panencephalitis virus, canine plague, rinderpest virus of cattle), the genus Pneumovirus (respiratory virus syncytium (RSV), a virus of the respiratory syncytium cows and virus pneumonia); the family Rhabdoviridae, including the genus Vesiculovirus (VSV), Chandipura virus, virus, Flanders-Hart Park), the genus Lyssavirus (rabies virus), rhabdovirus fish and two probable rhabdoviruses (Marburg virus and Ebola virus); the family Arenaviridae, including virus limfotsitov of choriomeningitis (LCM), a complex of Tacaribe viruses and Lyssavirus; family Coronoviridae, including infectious bronchitis virus (IBV), hepatitis, coronavirus human intestinal and virus feline infectious peritonitis (feline coronavirus).

Examples of DNA-type viruses that are antigens in vertebrate animals include, but are not limited to, the collection from the poxviridae, including the genus is classified in the genus orthopoxvirus (smallpox large, small pox, pox Vaccinia monkeys, cowpox, smallpox Buffalo pox rabbits, Ectomelia), the genus Leporipoxvirus (myxoma, fibroma), the genus Avipoxvirus (pox in poultry, other poxviruses p is CI), the genus Capripoxvirus (pox sheep pox, goat), the genus Suipoxvirus (pox swine), the genus Parapoxvirus (virus contagious postular dermatitis, pseudoeph cows, virus papular stomatitis cows); the family Iridoviridae (virus African swine fever viruses frogs 2 and 3, the virus limfotsisty fish); the family Herpesviridae, including the alpha herpes viruses (herpes simplex types 1 and 2, encircles chickenpox, the virus abortions horses, herpes virus horses 2 and 3, the virus pseudoleskeella, the virus of infectious keratoconjunctivitis cows, the virus of infectious bovine rhinotracheitis cows, virus feline rhinotracheitis, the virus of infectious laryngotracheitis viruses herpes-beta (human cytomegalovirus and cytomegalovirus pigs and monkeys); the herpes viruses-gamma (Epstein-Barr (EBV), a virus disease Marek'a, herpes saimiri, herpesvirus ateles, herpesvirus sylvilagus, herpes Guinea pigs, virus, Lucke tumor); the family Adenoviridae, including the genus Mastadenovirrus (subgroups person a, b, C, D, E and ungrouped; simian adenoviruses (at least 23 serotypes), virus, infectious canine hepatitis, and adenoviruses of cattle, pigs, sheep, frogs and many other species, the genus Aviadenovirus (adenoviruses birds) and not amenable to cultivation adenoviruses; family Papoviridae, including the genus Papillomavirus (human papilloma virus, the virus of papilloma of the cows, the human papilloma virus Shope rabbit and irony various pathogenic papilloma other species), the genus Polyomavirus (virus polyoma, vacuolating agent monkey (SV-40), vacuolating agent rabbit (RKV), K-virus, BK virus, JC virus and other viruses polyoma primates, such as virus lymphotropism papilloma); the family Parvoviridae including the genus adeno-associated viruses, the genus Parvovirus (panleukopenia virus feline, parvovirus cows, canine parvovirus, a virus disease of the Aleutian mink and so on). Finally, DNA-new viruses include viruses, which do not belong to the above family, such as viruses disease, Kuru and Creutzfeldt-Jacob and chronic infectious neuropathic agents (Chinese virus).

Each of the above lists is illustrative and should not be considered as limiting. In addition to the use of immunostimulatory nucleic acid for the induction of antigen-specific immune response in human ways, the preferred implementation is particularly well suited for the treatment of birds, such as hens, chickens, turkeys, ducks, geese, quail and pheasants. Birds are the primary targets for many types of infections.

Hatched birds are exposed to pathogenic organisms shortly after birth. Although these birds are initially protected from pathogens by antibodies received from the mother, this protection is only temporary, and his own immature immune si is theme of birds should begin to protect the bird from pathogens. It is often desirable to prevent infection in young birds when they are most receptive. It is desirable also prevent infection in old birds. Especially when birds are kept indoors, which leads to a rapid spread of the disease. Thus, it is desirable to introduce immunostimulirutuyu nucleic acid and adjuvant according to the invention, which is not a nucleic acid, birds to increase antigen-specific immune response when the antigen is present.

Example of common infections in chickens is infectious anemia virus of chickens (CIAV). CIAV was first isolated in Japan in 1979 in the study breaks vaccination in disease Marek'a (Yuasa et al., 1979, Avian Dis. 23:366-385). Since that time, CIAV was discovered in selling poultry in all countries, the main producers of poultry (van Bulow et al., 1991, pp.690-699) in Diseases of Poultry, 9th edition, Iowa State University Press).

The CIAV infection causes clinical disease characterized by anaemia, haemorrhage and immunosuppressive in young susceptible chickens. Characteristic of CIAV infection is also atrophy of the thymus and bone marrow and related injuries in CIAV infected chickens. Reduction of lymphocytes in the thymus and sometimes in fabriciano bag leads to immunosuppression and increased susceptibility to secondary VI is usnam, bacterial or fungal infections, which are then complicate the disease. Immunosuppressive can cause worsening of the disease after infection with one or more disease viruses Marek'a (MDV), infectious virus bursitis, virus reticuloendotheliosis, adenovirus or reoviruses. It was found that the pathogenesis of MDV increases under the action of CIAV (DeBoer et al., 1989, R In Proceedings of the Western Poultry Diseases Conferece, Tempe, Ariz.). Moreover, it was shown that CIAV exacerbates the symptoms of infectious bursitis (Rosenberger et al., 1989, Avian Dis. 33:707-713). Chicks develop age-related resistance to experimentally induced disease caused by the CAA. It essentially ends at 2 weeks of age, but the old birds are still susceptible to infection (Yuasa, N. et al., 1979 above; Yuasa, N. et al., Arian Diseases 24, 202-209, 1980). However, if the chickens twice to infect the CAA and immunosuppressive agent (IBDV, MDV and the like), age-related resistance to disease is reduced (Yuasa, N. et al., 1979 and 1980 above; von Bulow V. et al., J. Veterinary Medicine 33, 93-116, 1986). Characteristics of CIAV, which can enhance the transmission of the disease include high resistance to inactivation in the environment and some ordinary disinfecting agents. Economic impact of CIAV infection on the production of poultry clear from the fact that from 10 to 30% of infected birds during outbreaks of the die is so

Vaccination of birds, as well as other vertebrates, can be done at any age. Typically vaccination is carried out before the age of 12 weeks in the case of living organisms and between 14-18 weeks in the case of inactivated

microorganism or other type of vaccine. In the case of vaccination in egg vaccination can be carried out in the last quarter of embryonic development. The vaccine can be given subcutaneously, using a spray, oral, eye space, vnutritrahealno, intranasal or by using the here described methods of delivery through other mucous membranes. Thus, the immunostimulatory nucleic acid according to the invention can be introduced birds and other vertebrate, non-human, with the use of conventional vaccination, and the antigen can be entered after an appropriate period of time, as described here.

Cattle and livestock are also susceptible to infection. Diseases that affect these animals, can cause severe economic damage, especially in the case of cattle. The methods according to the invention can be applied to protect against infection of livestock, such as cows, horses, pigs, sheep and goats.

Cows can be infected by viruses cows. Virus diarrhoea cows (BVDV) is a virus with a positive chain of the NC and a small shell and classified together with the virus, cholera pigs (HOCV) and virus boundary condition of the sheep (BDV) the genus pestivirus. Although pestivirus were previously classified as belonging to the family Togaviridae, some studies have proposed to change its classification, and referred to the family Flaviviridae, together with groups of flavivirus and hepatitis C virus (HCV) (Francki et al., 1991).

BVDV, which is an important pathogen of cattle, can be divided on the basis of the analysis of cell culture on cytopathogenic (CF) and nicitating (NCP) biotypes. The NCP biotype is more widely distributed, although both biotype can be found in cattle. If a pregnant cow becomes infected with a strain of the NCP, the cow might give birth to constantly infected and specifically immunotolerance calf, which will spread the virus in their lifetime. Constantly infected cattle may become a victim of the disease of the mucous and then both biotype can be isolated from the animal. Clinical manifestations may include abortion, teratogenesis and problems with Airways disease mucosa and mild diarrhoea. It also describes severe thrombocytopenia associated with epidemic herds, which can lead to the death of the animal, and the strains associated with the disease, obviously, more virulent than the classic BVDV.

Herpes viruses horses (EHV) include a group of different antigens biologist the economic agents, which cause many infections in horses from subclinical to fatal forms of the disease. They include herpes virus-1 horses (EHV-1), a ubiquitous pathogen in horses. EHV-1 is associated with epidemics of miscarriages, respiratory tract diseases and disorders of the Central nervous system. Primary infection of the upper respiratory tract of young horses leads to a feverish state, which lasts for a period of 8 to 10 days. Immunological Mature mares can be re-infected through the respiratory tract without obvious symptoms, so a miscarriage usually occurs without warning circumstances. Neurological syndrome associated with respiratory disease or cancer and can affect animals of either sex at any age, which leads to loss of coordination, weakness and paralysis of the hind part of the body (Telford, E. A. R. et al., Virology 189, 304-316, 1992). Other EHV include EHV-2 or cytomegalovirus horses, EHV-3, virus koitalel exanthema, and EHV-4, previously classified as subtype 2 EHV-1.

Sheep and goats can be infected by many harmful microorganisms, including visna-maedi.

Primates, such as apes, monkeys and macaques can be infected by simian immunodeficiency virus. Vaccine of inactivated cells with cell-free virus and vaccine virus simian immunodeficiency how about arozena, able to create protection in macaques (Stott et al. (1990) Lancet 36: 1538-1541; Desrosiers et al. PNAS USA (1989) 86: 6353-6357; Murphey-Corb et al. (1989) Science 246: 1293-1297; and Carlson et al. (1990) AIDS Res. Human Retroviruses 6: 1239-1246). Vaccine recombinant HIV gp 120, as found, creates protection in chimpanzees (Berman et al. (1990) Nature 345: 622-625).

Cats, both domesticated and wild, are susceptible to infection by many pathogens. For example, feline infectious peritonitis is a disease that occurs in domestic and wild cats, such as lions, leopards, cheetahs and jaguars. When it is desirable to prevent infection data or other types of pathogenic organisms in cats, may be applied to the methods of the invention for the vaccination of cats to protect them from infection.

Domestic cats can be infected by several retroviruses, including, but not limited to, virus feline leukemia (FeLV), feline sarcoma virus (FeSV), endogenous type oncornavirus (RD-114) and syncytium-forming virus feline (FeSFV). Among them the most significant pathogen is FeLV, causing a variety of symptoms, including lymphoreticular and myeloid neoplasia, anemia, disorders, mediated by the immune system and the syndrome of immunodeficiency, which is similar to the syndrome of acquired immunodeficiency syndrome (AIDS). Recently it was discovered that a particular mutant with FeLV replication defect, the convoy is acaemy as FeLV-AIDS, more closely associated with immunosuppressive properties.

The opening of a T-lymphotropic lentivirus cat (referred to as the feline immunodeficiency virus) was first demonstrated by Pedersen et al. (1987) Science 235: 790-793. Characteristics of FIV described by Yamamoto et al. (1988) Leukemia, December Supplement 2: 204S-215S; Yamamoto et al. (1988) Am. J. Vet. Res. 49: 1246-1258; Ackley et al. (1990) J. Virol. 64: 5652-5655. Cloning and sequence analysis of FIV described Olmsted et al. (1989) Proc. Natl. Acad. Sci. USA 86: 2448-2452 86: 4355-4360.

Infectious peritonitis feline (FIP) is a sporadic disease, unpredictable, affecting domestic and wild Felidae. Although FIP is primarily a disease of domestic cats, he was diagnosed with lions, leopards, cheetahs and jaguars. Smaller wild cats who are suffering from FIV include steppe lynx and lynx, sand cat, Pallas ' cat. In domestic cats, the disease occurs mainly in young animals, although susceptible cats of all ages. Maximum cases were between the ages of 6 to 12 months. Reducing the cases seen in age from 5 to 13 years, followed by an increase of cases in cats aged 14 to 15 years.

Viral, bacterial and parasitic diseases in fin fish, molluscs or other aquatic forms of life constitute a serious problem for the industry, processing of aquatic organisms. the C of the high density of animals in cages-ponds or enclosed areas and marine farms infectious diseases can affect a large part of the herd, for example, it is easy to hit fin fish, molluscs or other aquatic forms. Disease prevention is more desirable treatment for fish than intervention at a time when the disease has already begun. Vaccination of fish is the only way to prevent that can create long-lasting immune protection. Vaccination on the basis of nucleic acids are described in, U.S. patent No. 5780448, issued in the name of Davis.

The immune system of fish has many characteristics similar to the immune system of mammals, such as the presence of b cells, T cells, lymphokines, complement and immunoglobulins. Fish are subclasses of lymphocytes, whose role seems to be in many respects similar to that of b - and T-cells in mammals. Vaccines can be introduced by dipping (in them) or oral.

Water industrial types include, but are not limited to, fin fish, shellfish and other aquatic animals. Fin fish include fish-vertebrates, which can be bony or cartilaginous fish, such as salmon, carp, catfish, yellowtail, sea bream and sea bass. Salmon are part of a series of finned fishes that includes trout (including rainbow trout), salmon and Arctic char trout. Examples of mollusks include, but are not limited to, sea is Mollusca, lobster, shrimp, crab and oyster. Other industrial water types, but are not limited to, eel, squid and octopus.

The polypeptides of viral pathogens industrial water species include, but are not limited to, glycoprotein (G) or nucleoprotein (N) virus viral hemorrhagic septicemia (VHSV); G or N proteins of the virus of infectious hemorrhagic necrosis (IHNV); VP1, VP2, VP3 or N structural proteins of the virus infectious pancreatic necrosis (IPNV); G protein of spring viremia of carp (SVC); and is associated with a membrane protein, a protein shell or capsid protein glycoprotein of the virus channel catfish (CCV).

Typical parasites infecting horses are Gasterophilus spp.,; Eimeria leuckarti, Giardia spp.; Tritrichomonas equi; Babesia spp. (Air force ), Theileria equi; Trypanosoma spp., Klossiella equi; Sarcocystis spp.

The main parasites infecting pigs are Eimeria bebliecki, Eimeria scabra, Isospora suis, Giardia spp.; Balantidium coli; Entamoeba histolytica; Toxoplasma gondii and Sarcocystis spp., and Trichinella spiralis.

The main parasites in beef and dairy cattle include Eimeria spp., Cryptosporidium sp., Giardia spp.; Toxoplasma gondii; Babesia bovis (RBC), Babesia bigemina (RBC), Trypanosoma spp. (plasma), Theileria spp. (RBC); Theileria parva (lymphocytes); Tritrichomonas foetus; and Sarcocystis spp.

The main parasites predators include Trichomonas gallinae; Coccidia (Eimeria spp.); Plasmodium relictum Haemosporidian danilewskyi (owls), Haemoproteus spp., Trypanosoma spp.; Histomonas; Cryptosporidium meleagridis, Cryptosporidium baileyi, Giardia, Eimeria; Toxoplasma./p>

Typical parasites infecting sheep and goats include Eimeria spp., Cryptosporidium sp., Giardia sp.; Toxoplasma gondii; Babesia spp. (RBC), Trypanosoma spp.

(plasma), Theileria spp. (PNC); and Sarcocystis spp.

Typical parasitic infection in poultry include coccidiosis caused by Eimeria acervulina, E. necatrix, E. tenella, Isospora spp. and Eimeria truncata; histomonas caused by Histomonas meleagridis and Histomonas gallinarum; trichomoniasis, caused Th1chomonas gallinae; and hexamita caused by Hexamita meleagridis. Poultry can be infected with Emeria maxima, Emeria meieagridis, Eimeria adenoeides, Eimeria meleagrimitis, Cryptosporidium, Eimeria brunetti, Emeria adenoeides Haemosporidian spp., Plasmodium spp., Hemoproteus meleagridis, Toxoplasma gondii and Sarcocystis.

The methods according to the invention can also be applied to the treatment and/or prevention of parasitic infections in dogs, cats, birds, fish and ferrets. Typical parasites of birds include Trichomonas gallinae; Eimeria spp., Isospora spp., Giardia; Cryptosporidium; Sarcocystis spp., Toxoplasma gondii, Haemoproteus/Parahaemoproteus, Plasmodium spp., Haemosporidian/Akiba, Atoxoplasma, Trypanosoma spp. Typical parasites infecting dogs include Trichinella spiralis; Isopora spp., Sarcocystis spp., Cryptosporidium spp., Hammondia spp., Giardia duodenalis (dog); Balantidium coli, Entamoeba histolytica; Hepatozoon canis; Toxoplasma gondii, Trypanosoma cruzi; Babesia canis; Leishmania amastigotes; Neospora caninum.

Typical parasites infecting species of felids include Isospora spp., Toxoplasma gondii, Sarcocystis spp., Hammondia hammondi; Besnoitia spp., Giardia spp.; Entamoeba histolytica; Hepatozoon canis, Cytauxzoon sp., Cytauxzoon sp., Cytauxzoon sp. (erythrocytes, RE cells).

A typical pair is the ITA, infecting fish include Hexamita spp., Eimeria spp.; Cryptobia spp., Nosema spp., Myxosoma spp., Chilodonella spp., Trichodina spp.; Plistophora spp., Myxosoma Henneguya; Costia spp., IchthyophiTh1rius spp. and Oodinium spp.

Typical parasites of wild mammals include Giardia spp. (carnivores, herbivores), Isospora spp. (carnivorous), Eimeria spp. (carnivores, herbivores); Theileria spp. (herbivores), Babesia spp. (carnivores, herbivores), Trypanosoma spp. (carnivores, herbivores); Schistosoma spp. (herbivores); Fasciola hepatica (herbivores), Fascioloides magna (herbivores), Fasciola gigantica (herbivores), Trichinella spiralis (carnivores, herbivores).

Parasitic infection in zoos can also be a serious problem. Typical parasites of the family Bovidae (white-fronted Hartebeest, Impala, banteng, Eland, Gaur, antelope fell, antelope-jumper, forest antelope, Gazelle) include Eimeria spp. Typical parasites of the family Pinnipedae (seal, sea lion) include Eimeria phocae. Typical parasites of the family Camelidae (camels, llamas) include Eimeria spp. Typical parasites of the family Giraffidae (giraffes) include Fimeria spp. Typical parasites of the family Elephantidae (African and Asian) include Fasciola spp. Typical parasites lower primates (chimpanzees, orangutans, monkeys, baboons, macaques, monkeys) include Giardia sp.; Balantidium coli, Entamoeba histolytica, Sarcocystis spp., Toxoplasma gondii; Plasmodim spp. (RBC), Babesia spp. (RBC), Tiypanosoma spp. (plasma), Leishmania spp. (macrophages).

The polypeptides of bacterial Pato is ENES include, but not limited to, adjustable iron outer membrane protein (IROMP), a protein of the outer membrane (MRA) and protein Aeromonis salmonicida which causes furunculosis, P57 protein Renibacterium salmoninarum which causes bacterial kidney disease (BKD), the main associated with surface antigen (msa), expressed on the surface of the cytotoxin (mpr), expressed on the surface of the hemolysin (ish), and flagellar antigen Yersiniosis; an extracellular protein (ECP), adjustable iron outer membrane protein (IROMP), and a structural protein of Pasteurellosis; an MRA and a flagellar protein of Vibrosis anguillarum and V. ordalii; flagellar protein, protein MRA, AGOA and purA Edwardsiellosis ictaluri and E. tarda; and surface antigen Ichthyophhirius; and a structural and regulatory protein of Cytophaga columnari; and a structural and regulatory protein of Rickettsia.

The polypeptides of parasitic antigens include, but are not limited to, surface antigens Ichthyophthirius.

Allergen called substance (antigen), which may cause allergic or asthmatic response in a susceptible subject. The list of allergens is huge and can include pollens, insect venoms, dangerous animal dust, fungal spores and drugs (e.g. penicillin). Examples of natural animal and plant antigens include, but are not limited to proteins specific to the following genera: Canine (Canis familiaris); Dermatophagoides (n is an example, Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia (Ambrosia artemusfolia; Lolium (e.g., Lolium perenne or Lolium Polygonum); Cryptomeria (Cryptomeria japonica); Alternaria (Alternaria alternata); Alder; Alnus (Alnus gultinoasa); Betula (Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa); Artemisia (Ariemisia vulgaris); Plantago (e.g., Plantago lanceolata); Parietaria (for example, Parietaria officinalis or Parietaria judaica); Blattella (e.g., Blattella germanica); Apis (for example. Apis Polygonum); Cupressus (e.g., Cupressus sempervirens, Cupressus arizonica and Cupressus macrocarpa); Juniperus (e.g., Juniperus sabinoides, Juniperus virginiana, Juniperus communis and Juniperus ashei); Thuya (for example, Thuya orientalis); Chamaecyparis (e.g., Chamaecyparis obtusa); Periplaneta (e.g., Periplaneta americana); Agropyron (for example, Agropyron repens); Secale (e.g., Secale cereale); Triticum (e.g., Triticum aestivum); Dactylis (e.g., Dactylis glomerata); Festuca (e.g., Festuca elatior); Poa (e.g., Poa pratensis or Poa compressa); Avena (e.g., Avena sativa); Holcus (e.g., Holcus lanatus); Anthoxanthum (e.g., Anthoxanthum odoratum); Arrhenatherum (e.g., Arrhenatherum elatius); Agrostis (e.g., Agrostis alba); Phleum (e.g., Phleum pratense); Phalaris (e.g., Phalaris arundinacea); Paspalum (e.g., Paspalum notatum); Sorghum (for example, Sorghum halepensis); and Bromus (e.g., Bromus inermis).

The antigen can be an antigen that is encoded by the vector nucleic acid, or it may not be encoded by the vector nucleic acid. In the first case, the vector nucleic acid is administered to the subject, and the antigen is expressed in vivo. In the second case, the antigen can be introduced directly to the subject. Used here, the term "antigen is not encoded by the vector nucleic KIS is the notes", refers to any type of antigen that is not a nucleic acid. For example, in some embodiments of the invention the antigen is not encoded by the vector nucleic acid is a polypeptide. Minor modifications of primary amino acid sequence of polypeptide antigens can also give a polypeptide that is essentially equivalent antigenic activity compared to the unmodified original polypeptide. Such modifications may be deliberate, as in the case of site-directed mutagenesis, or may be spontaneous. All of the polypeptides produced as a result of these modifications are included in this invention, if there is still antigenicity. The polypeptide can be, for example, a viral polypeptide.

Used herein, the term "essentially purified" refers to a polypeptide that is essentially free of other proteins, lipids, carbohydrates or other materials with which it is associated in nature. Specialist in the art can purify viral or bacterial polypeptides using standard methods of protein purification. Essentially pure polypeptide often gives output in the form of a single major band on a non-polyacrylamide gel. In the case of partially treated glycosylamine polypeptides or the ex, which have multiple start codons may be detected several bands on non-polyacrylamide gel, but they must be specific to the polypeptide. The purity of the viral or bacterial polypeptide can also be determined by analysis of the amino-terminal amino acid sequence. Other types of antigens that are not encoded by the vector nucleic acid, such as polysaccharides, small molecules, mimetics, etc. described above and included in the invention.

The invention also apply polynucleotide encoding antigenic polypeptides. It appears that the antigen may be delivered to a subject in a molecule of nucleic acid, which is encoding the antigen so that the antigen can be expressed in vivo. Such antigens are delivered to the subject in the vector nucleic acid, refers to antigens encoded by the vector nucleic acid. Nucleic acid encoding the antigen operatively linked to expressing the gene sequence that controls expression of the nucleic acid antigen in eukaryotic cells. Expressing the gene sequence is any regulatory nucleotide sequence, such as a promoter sequence or combination of promoter and enhancer, which accelerates the effective Tr is scriptio and translation of nucleic acid antigen, to which it is operatively connected. Expressing the gene sequence may, for example, be a promoter of the virus or of a mammal, such as a constitutive or inducible promoter. Constitutive mammalian promoters include, but are not limited to, the promoters for the following genes: hypoxanthineguanine (HPTR), adenozindezaminazy, pyruvate kinase, the promoters β-actin and other constitutive promoters. Examples of viral promoters that function in eukaryotic cells as constitutive include, for example, the promoter of the cytomegalovirus (CMV), simian virus (e.g., SV40), human papilloma virus, adenovirus, human immunodeficiency virus (HIV), rous sarcoma virus, cytomegalovirus, the long terminal repeats (LTR) virus Moloney leukemia and other retroviruses, and the promoter timedancing of herpes simplex virus. Other constitutive promoters known to specialists in this field of technology. Promoters suitable as expressing the gene sequences also include inducible promoters. Inducible promoters are expressed in the presence of an inducing agent. For example, metallothioneins the promoter is induced to stimulate transcription and translation in the presence of certain metal ions. Other inducible shall rotatory well-known specialists in this field of technology.

In General expressing the gene sequence must include as essential elements of 5’-retranscribing and 5’-noncoding sequences that are involved in the initiation of transcription and translation respectively, such as TATA box, copy the sequence SAAT sequence, and the like. In particular, to such 5’-retranscribing sequences include the promoter region, which contains a promoter sequence for transcriptional control of the operatively linked nucleic acid antigen. Sequence expressing the gene does not necessarily include, if necessary, enhancer sequences or upstream activator sequences.

Nucleic acid antigen operatively linked to a sequence expressing the gene. In the invention States that the nucleic acid sequence of the antigen and the sequence expressing the gene, operatively linked when they are covalently linked such that the expression or transcription and/or translation of the sequence that encodes the antigen is placed under the influence or control sequence, expressing the gene. They say that the two DNA sequences operatively linked if induction of a promoter in the 5’-expressing the Yong sequence leads to transcription of the antigen sequence and if the nature of the bond between the two DNA sequences (1) does not lead to the introduction of mutations shift the reading frame, (2) does not interfere with the ability of the promoter region to control the transcription of the sequence of the antigen, or (3) does not interfere with the ability of the corresponding RNA transcript to be broadcast in the protein. Thus, the sequence expressing the gene must be operatively linked to the nucleic acid sequence of the antigen, if the sequence expressing the gene can affect the transcription of a given nucleic acid sequence of the antigen in such a way that the resulting transcript is translated into the desired protein or polypeptide.

Nucleic acid antigen according to the invention can be delivered to the immune system alone or in Association with a vector. In the broadest sense of the vector represents any medium that is capable of accelerating the transfer of nucleic acid antigen in cells of the immune system to the antigen could be expressed and presented on the surface of immune cells. The vector is usually transports nucleic acid to immune cells with reduced degradation compared with the degree of degradation, which should be in the absence of the vector. The vector optionally includes the above expressing the gene sequence for enhancing expression of a nucleic acid of the antigen in the immune cells. In General, vectors, especially what's in the invention, include, but are not limited to, plasmids, phagemid, viruses, other carriers originating from viral or bacterial sources that can be manipulated by insertion or incorporation of sequences of nucleic acid antigens. Viral vectors are a preferred type of vector and include, but are not limited to, nucleic acid sequences from the following viruses: retrovirus, such as a virus leukemia mice Moloney, sarcoma virus of mice Harvey, virus, tumors of the mammary gland of mice and rous sarcoma virus; adenovirus, adeno-associated virus; virus type SV40; viruses polyoma; viruses Epstein-Barr; papilloma viruses; herpes virus; virus vaccination; smallpox cows; poliovirus; and RNA-type viruses such as retrovirus. Everyone can easily use other vectors, is not named but is known in this technical field.

Preferred viral vectors are based on recitations eukaryotic viruses in which non-essential genes replaced by the gene of interest. Recitations viruses include retroviruses, life cycle which involves reverse transcription of viral genomic RNA into DNA, followed proberley integration into the cellular DNA of the host. Retroviruses are approved for testing gene of therapieklinik. The most useful are those of retroviruses, which are deficient for replication (i.e. able to synthesize the desired protein, but not capable of producing infectious particles). Such genetically modified retroviral expression vectors are characterized by General applicability for highly efficient transduction of genes in vivo. The standard recipe of obtaining scarce replication of retroviruses (including the stage of incorporation of exogenous genetic material into a plasmid, transfection packaging cell line with plasmid, production of recombinant retroviruses packing line cells, selection of viral particles from tissue culture media, and infection of target cells with viral particles) are provided in Kriegler, M., Gene Transfer and Expression, A Laboratory Manual, W. H. Freeman C.O., New York (1990) and Murry, E.J.Methods in Molecular Biology, vol.7, Humana Press, Inc., Cliffton, New Jersey (1991).

Preferred virus for certain applications is the adeno-associated virus, a virus with double-stranded DNA. Adeno-associated virus can be constructed as deficient in relation to replication and capable of infecting a wide range of cell types and species. He has additional benefits, such as stability against heat and lipid solvents; high frequency transduction in cells of various lines including hematopoietic cells; and no braking superinfection that allows multiple series transduction. Reportedly adeno-associated virus can integrate into the cellular DNA of human site-specific manner, which minimizes the possibility of mutagenesis during inserts and variability inserted expressing the gene characteristics of retroviral infections. Additionally, infection, adeno-associated virus wild type, was performed in tissue culture for more than 100 passages in the absence of selection effects, which implies that the genomic integration of adeno-associated virus is relatively stable. Adeno-associated virus can also function extrachromosomal way.

Other vectors include plasmid vectors. Plasmid vectors are widely described in the art and well known to specialists. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989. In the last few years it was found that plasmid vectors is particularly advantageous for delivery of genes to cells in vivo due to their ability to replicate and integrate into the host genome. These plasmids, however, having a promoter that is comparable with the host-cell can Express the peptide with gene, operatively encoded in the plasmid. Some the commonly used plasmids include pBR322, pUC18, pUC19, pRC/CMV, SV40, and pBlueScript. Other plasmids are well known to specialists in this field of technology. In addition, plasmids can be designed to order with the use of restriction enzymes and ligation reactions for removal and addition of specific DNA fragments.

It was recently revealed that the plasmids carrying the genes can be delivered to the immune system with the use of bacteria. Modified forms of bacteria, such as Salmonella, can be transliterowany the plasmid and used as carriers for delivery. Bacterial delivery system, you can enter the subject of the master of oral or other routes of administration. Bacteria deliver plasmid to immune cells, such as b-cells, dendritic cells, probably through the barrier of the gastrointestinal tract. When applying this methodology revealed high levels of immune protection. Such methods of delivery are useful for variants of the invention, applying systemic delivery of antigen, the immunostimulatory nucleic acid and/or other therapeutic agent.

Thus, the immunostimulatory nucleic acids are useful as adjuvants in vaccines. Previously it was found that CpG-oligonucleotides are excellent adjuvants for vaccines. It was also shown, however, that CpG ODN, which are magnificent hell the guys vaccines in mice are not preferred adjuvants in animals that are not rodents. In order to identify the best immunostimulatory nucleic acid for use as adjuvant vaccines in humans and other animals that are not rodents, was screened various nucleic acids in vivo for this purpose. Developed several in vitro tests for mice to predict their value as adjuvant activity in mice in vivo. During this study was identified test in vitro to predict their effectiveness in vivo. Quite unexpectedly it has been discovered that activation of both b-cells and NK-cells are particularly well correlated with the ability of the immunostimulatory nucleic acid to increase the immune response against the antigen in vivo.

A good degree of prediction of activation In cells on the activity of the adjuvant vaccine in vivo is most likely associated with the Central role of b cells in the organization of specific immune response. Polyclonal proliferation of b-cells (induced boosting of nucleic acids) increases the probability of occurrence of a combination of antigen-specific b-cell/T-helper cells. Moreover, increased expression of co-stimulatory molecules CD86 on b cells, exposed to polyclonal expansion, enable the no antigen-specific T-helper cells. B-cells in response to immunostimulatory nucleic acids also increase their expression of CD40, improving the ability of activated T-helper cells expressing CD40L, to stimulate b cells. Increased synthesis of ICAM-1 on b cells promotes intercellular contacts. Thus, the activity status of b-cells plays a crucial role in the initiation of specific antibody responses.

The contribution activity of NK-cells in the formation of specific antibodies were, however, unexpected. NK cells are part of the natural immune system and involved as those in the front line of defence against pathogens. It is most likely that the pattern of cytokines produced by NK cells upon activation, closely associated with the initiation of specific immune response. Thus, in one embodiment, the invention relates to a method for the identification of adjuvant using the definition of the activation of NK-cells. Testing the activation of NK-cells may be performed as described below in the examples or using other known methods for determining the activity of NK cells. Preferably, however, was applied to a mixed population of cells, such as RPMS, because the probability that the activation of NK cells is an indirect effect. Testing is preferably useful for the identification of immunostimulatory nucleic acids that prigodnim as adjuvants in humans and other animals, non-rodents.

It was also found that important in the prediction of adjuvant activity in vivo is the induction of cytokines. Although sensitivity to endotoxin primary monocytes in humans by 2 orders of magnitude higher than in mice, however, some caution to avoid contamination by endotoxins immunostimulatory nucleic acids used for tests on systems man (Hartmann G., and Krieg A.M 1999. Gene Therapy 6:893). Because TNF-α, IL-6 and IL-12 are produced by human monocytes in response to even low amounts of endotoxin, their value to test high-throughput in vitro is limited. On the other hand, b cells and NK-cells undergo only minor activation by endotoxin and thus much more useful for testing the immunostimulatory activity.

Stimulation of cell function in either NK or b cells (i.e. lytic activity, proliferation) requires stronger immunostimulatory nucleic acid than induction on their surface activation markers (CD69, CD86). For both cell types, the use of markers of activation on the cell surface showed higher non-specific background due to phosphorotioate skeleton, compared to functional tests. This high sensitivity of surface markers requires the use of low con is entrace immunostimulatory nucleic acids for optimal discrimination immunostimulating activity between nucleic acids with similar activity. Thus, the use of surface markers makes it possible to compare immunostimulatory nucleic acids with weak activity, while functional tests are preferred for comparison of immunostimulatory nucleic acids with high activity. It should be noted that the optimal concentration of immunostimulatory nucleic acids to stimulate b-cells and NK-cells are different. While the concentration of 0.6 μg/ml ODN already for maximum stimulation of b-cells, optimal activation of NK-cells may require 6 μg/ml ODN. As activation of b-cells, and the functional activity of NK-cells was measured with a newly allocated RVMS. Previously it was found that highly purified primary b-cells are activated by CpG-DNA. The existence of a direct effect of CpG-DNA on NK cells is less obvious and in CpG-induced functional activity of NK cells can contribute to the secondary mechanism, mediated by another cell type within RVSM.

Nucleic acids according to the invention it is possible to introduce the subject with an antimicrobial agent. Used herein, the term "antimicrobial agent" refers to an existing in nature or synthetic compound which is able to destroy infectious microorganisms or to inhibit their action. Type of antimicrobial agent useful in accordance with the tvii with the invention, should depend on the type of microorganism, where the subject is infected or at risk to become infected. Antimicrobial agents include, but are not limited to, antibacterial agents, antiviral agents, antifungal agents and antiparasitic agents. Such expressions as "anti-infective agent", "antibacterial agent", "antiviral agent", "antifungal agent", "anti-parasitic agent" and "agent that destroys parasites are well known to specialists in the art and are defined in the standard medical guidelines. Briefly antimicrobial agents kill bacteria or inhibit their activity and include antibiotics, as well as other synthetic or natural compounds that have similar functions. Antibiotics are molecules with low molecular weight that are produced as secondary metabolites such cells as organisms. In General, antibiotics interfere with one or more bacterial functions or structures that are specific for the microorganism that are not present in host cells. Antiviral agents can be isolated from natural sources or synthesized, and are useful for destroying viruses or inhibiting their activity. The antifungal agents used for treatment of p. the surface of fungal infections, and infections caused by opportunistic fungi, and primary systemic fungal infections. Antiparasitic agents destroy parasites or inhibit their activity.

Examples of anti-parasitic agents, also referred to as agents that destroy parasites that are applicable to the introduction of the person include, but are not limited to, albendazole, amphotericin b, benznidazol, bithionol, chloroquine Hcl, chloroquin phosphate, clindamycin, dehydroemetine, diethylcarbamazine, diloxanide frankenboob acid, eflornithine, furazolidon, glucocorticoids, halofantrine, iodohydrin, ivermectin, mebendazole, mefloquine, meglumin, antimonial, melarsoprol, metrifonate, metronidazole, niclosamide, nifurtimox, complementary, paromomycin, pentamidine of isothionate, piperazine, prashanta, primaquine phosphate, proguanil, Pyrantel pamoate, pyrimethamin-sulfonamides, pyrimethamin-sulfadoxine, chinacan Hcl, quinine sulfate, quinidine gluconate, spiramycin, stibogluconate sodium (sodium glucuronate-antimony), suramin, tetracycline, doxycycline, thiabendazol, tinidazole, trimetroprim-sulfamethoxazole and tryparsamide, some of which are used separately or in combination with others.

Agents that destroy parasites used in entities that are not human, include piperazine, diethylcarbamazine, tiab nasal, the fenbendazol, albendazole, oxfendazole, oxibendazole, febantel, levamisole, Pyrantel tartrate, Pyrantel, pamoate, dichlorvos, ivermectin, doramectin, milbemycin the oxime, eprinomectin, moxidectin, chloride n-butyl, toluene, thiacetarsamide sodium salt of hygromycin In, melarsomine, praziquantel, epsiprantel, benzimidazole, such as fenbendazol, albendazole, oxfendazole, clorsulon, albenza, amprolium; dechent, lasalocid sulfadimetoksin; sulfamethazine, sulfoxidation, metronidazole.

Agents that destroy parasites used in horses include mebendazole, oxfendazole, febantel, Pyrantel, dichlorvos, trichlorfon, ivermectin, piperazine; for S.westeri: ivermectin, benzimidazole, such as thiabendazole, cambendazole, oxibendazole and fenbendazol. Useful agents that destroy parasites used in dogs include milbemycin of oxen, ivermectin, Pyrantel, pamoate and the combination of ivermectin and Pyrantel. Treatment of parasites in pigs can include the use of levamisole, piperazine, Pyrantel, thiabendazole, dichlorvos and fenbendazol. In sheep and goats anthelminthic agents include levamisole or ivermectin. Chaparala demonstrated some efficacy in the treatment of D. immitis (helminth parasites in heart) cats.

Antibacterial agents kill or inhibit the growth of Il the functions in bacteria. A large class of antibacterial agents are antibiotics. Antibiotics that are effective in destroying or inhibiting the activity of a wide range of bacteria that belong to a wide range of antibiotics. Other types of antibiotics are effective mainly against bacteria of the class of gram-positive or gram-negative. These types of antibiotics are narrow spectrum antibiotics. Other types of antibiotics that are effective against one organism or disease and is not directed against other types of bacteria, refer to a limited range of antibiotics. Antibacterial agents are sometimes classified based on their primary mode of action. In General, antibacterial agents are inhibitors of cell wall synthesis, inhibitors of cell membranes, inhibitors of protein synthesis, inhibitors nucleic acid synthesis inhibitors or functions, and competitive inhibitors.

Antibacterial agents used in the invention include, but are not limited to, natural penicillins, semi-synthetic penicillin, clavulanic acid, cephalosporin, bacitracin, ampicillin, carbenicillin, oxacillin, azlotillin, mezlocillin, piperacillin, methicillin, ciclacillin, nafcillin, cephalothin, cephapirin, cephalexin, zetandel, cefaclor, CE is azolin, cefuroxim, cefoxitin, Cefotaxime, cefsulodin, cefetamet, cefixime, Ceftriaxone, cefoperazone, ceftazidime, moxalactam, carbapenems, imipenem, monobactam, aztreonam, vancomycin, polymyxin, amphotericin b, nystatin, imidazoles, clotrimazole, miconazole, ketoconazole, Itraconazole, fluconazole, rifampin, ethambutol, tetracyclines, chloramphenicol, macrolides, aminoglycosides, streptomycin, kanamycin, tobramycin, amikacin, gentamicin, tetracycline, minocycline, doxycycline, chlortetracycline, erythromycin, roxithromycin, clarithromycin, oleandomitsin, azithromycin, chloramphenicol, quinolones, cotrimoxazole, norfloxacin, ciprofloxacin, enoxacin, Kalinicheva acid, temafloxacin, sulfonamides, gantrisin, trimethoprim; acedapsone; acetosolv sodium; Alamein; alexidine; amdinocillin; amdinocillin pivoxil; ampicillin; amifloxacin; amifloxacin mesilate, amikacin; amikacin sulfate; aminosalicylic acid; aminosalitsilata sodium; amoxicillin; ambomycin; ampicillin; ampicillin sodium salt; apalcillin; apalcillin sodium salt; apramycin; aspartocin; astromicin sulfate; avilamycin; avoparcin; azithromycin; azlotillin; azlocillin sodium salt; bacampicillin hydrochloride; bacitracin; methylenedianiline bacitracin; bacitracin zinc; bambermycin; benzoles calcium; eritromicin; the bet is the CIN sulfate; biapenem; Binyamin; biennia hydrochloride; respiration marsulex; bottacin; butirosin sulfate; capreomycin sulfate; carbadox; carbenicillin disodium salt; carbenicillin of inanimate; carbenicillin of FamilyTree; carbenicillin potassium salt; carumonam sodium salt; cefaclor; cephalo-Smoking; cefamandole; cefamandole nitrate; cefamandole sodium salt; cefipra; cefatrizine; ceasefire sodium salt; Cefazolin; Cefazolin sodium salt; cefbuperazone; cefdinir; cefepime; cefepime hydrochloride; Safetica; cefixime; cefmenoxime hydrochloride; cefmetazole; cefmetazole sodium salt; cefonicid one-deputizing sodium salt; cefonicid sodium salt; cefoperazone sodium salt; ceforanide; Cefotaxime sodium salt; cefotetan; cefotetan disodium salt; cefotiam hydrochloride; cefoxitin; tsefoksitina sodium salt; cefpimizole; cefpimizole sodium salt; affirmed; cefpiramide sodium salt; cefpirome sulfate; cefpodoxime proxetil; cefprozil; cefoxitin; cefsulodin sodium salt; ceftazidime; ceftibuten; ceftizoxime sodium salt; Ceftriaxone sodium salt; cefuroxime, cefuroxime axetil; cefuroxime pivoxil; cefuroxime; cefacetrile sodium salt; cephalexin; cephalexin hydrochloride; cephaloglycin; tsefaloridin; tsefalotina Natrii the Yu salt; cefapirin sodium salt; cefradine; tetacycline hydrochloride; cytopenia; chloramphenicol, chloramphenicol palmitate; chloramphenicol-Pantothenate complex; chloramphenicol sodium succinate; chlorhexidine, fastenrath; chloroxylenol; the chlortetracycline bisulfate; chlortetracycline hydrochloride; cinoxacin; ciprofloxacin; ciprofloxacin hydrochloride; cirolemycin; clarithromycin; clinafloxacin hydrochloride; clindamycin; clindamycin hydrochloride; clindamycin palmitate hydrochloride; clindamycin phosphate; clofazimine; of the cloxacillin benzathine; cloxacillin sodium salt; Lokshin; colistimethate sodium salt; colistin sulfate; Copernican; komaritsine sodium salt; ciclacillin; cycloserine; dalfopristin; Dapsone; daptomycin; demeclocycline; demeclocycline hydrochloride; dimeticon; denaturing; diacerein; dicloxacillin; dicloxacillin sodium salt; dihydrostreptomycin sulfate; deperation; dirithromycin; doxycycline; doxycycline calcium salt; doxycycline phosphates; doxycycline hyclat; dioxazine sodium salt; enoxacin; ampicillin; epitetracycline

hydrochloride; erythromycin; erythromycin acistrate; erythromycin estolate; erythromycin ethylsuccinate; erythromycin gluceptate; erythromycin lactobionate; erythromycin propionate; erythromycin stearate; ethambutol hydrochloride; ethionamide; FL is oxazin; floxacillin; flutolanil; flanagin; fosfomicin; fosfomicin tromethamine; amoxicillin; pyrazole chloride; pyrazole tartrate; fusidate sodium salt; fucicola acid; gentamicin sulfate; pokemona; gramicidin; haloprogin; hetacillin; hetacillin potassium salt; hexadien; ibafloxacin; imipenem; isoconazole; isepamicin; isoniazid; josamycin; kanamycin sulfate; kitasamycin; levomoramide; levopropicillin sodium salt; lexitropsin; lincomycin; lincomycin hydrochloride; lomefloxacin; lomefloxacin hydrochloride; lomefloxacin mesilate; loracarbef; mafenide; meclocycline; meclocycline sulfosalicylate; megalomicin potassium phosphate; megadox; Meropenem; metatsiklina; metatsiklina hydrochloride; methenamine, methenamine hippurate; methenamine mandelate; methicillin sodium salt; methoprim; metronidazole hydrochloride; metronidazole phosphate; mezlocillin; mezlocillin sodium salt; minocycline; minocycline hydrochloride; mirincamycin hydrochloride; monensin; monensin sodium salt; nafcillin sodium salt; nalidixic sodium salt; nalidixic acid; natamycin; nebramycin; neomycin palmitate; neomycin sulfate; neomycin undecylenate; netilmicin sulfate; neutralizing; nifuratel; nifuraldezone; nifuratel; nifuratel; nifuratel; nishime;

nifurpirinol; nifurpirinol; laforteza; NITR the cyclin; nitrofurantoin; nitromed; norfloxacin; novomicin sodium salt; ofloxacin; ormetoprim; oxacillin sodium salt; oxymoron; oxygonum sodium salt; oxolinic acid, oxytetracycline, oxytetracycline calcium salt; oxytetracycline hydrochloride; pallidity; parachlorophenyl; paulaitis; pefloxacin; pefloksatsina mesilate; pennicillin; penicillin G benzathine; penicillin G potassium salt; penicillin G procaine; penicillin G sodium salt; penicillin V benzathine; penicillin V hydrobasin; penicillin V potassium salt; pentosidine sodium salt; phenylimidazoline; piperazillina sodium salt; pirbenicillin sodium salt; pyridinoline sodium salt; pirlimycin hydrochloride; pivampicillin hydrochloride; pivampicillin pamoate; pivampicillin probent; polymyxin b sulfate; porfiromycin; propagatin; pyrazinamide; pyrithione zinc; indecline acetate; inupristin; receptical; ramoplanin; rankinen; elemicin; rapamycin; rifabutin; rifabutin; REFLEXIL; rifled; rifampin; rifapentine; rifaximin; rolitetracycline; rolitetracycline nitrate; rosaramicin; rosaramicin butyrate; rosaramicin propionate; rosaramicin sodium phosphate; rosaramicin stearate; rosoxacin; roxarsone; roxithromycin; canticles; sanfetrinem sodium salt; carboxyllic; carpinelli; scopadulin; cytomic is n; the sizomitsin sulfate; sparfloxacin; spectinomycin hydrochloride; spiramycin; stallonezone hydrochloride;

steffimycin; streptomycin sulfate; streptokinase; sulfameth; sulfabenzamide; sulfacetamide; sulfacetamide sodium salt; sulfation; sulfadiazine; sulfadiazine sodium salt; sulfadoxine; sulfalen; sulfamerazine; sulfamate; sulfamethazine; sulfamethizole; sulfamethoxazole; sulfamonometoksin; sulfamoxole; sulfanilate-zinc; sulfanitran; sulfasalazin; sulfanomides; sulfathiazole; sulfosalt; sulfisoxazole; acetilsalicilico; sulfisoxazole; selfmixing; sulopenem; sultamicillin; Santillana sodium salt; talampicillin hydrochloride; teicoplanin; temafloxacin hydrochloride; temocillin; tetracycline; tetracycline hydrochloride; tetracycline phosphate complex; tetrasodium; thiamphenicol; tigecycline potassium salt; tikarcillin of cretinetti; tikarcillina disodium salt; tikarcillina one-deputizing sodium salt; Tilton; Titania chloride; tobramycin, tobramycin sulfate; toolboxitem; trimethoprim; trimethoprim sulfate; trisulfonated; troleandomycin; trospectomycin sulfate; tyrothricin; vancomycin, vancomycin hydrochloride; virginiamycin and zorbamycin.

Antiviral agents are compounds that prevent INFI the licensing of cells by viruses or viral replication in the cell. There are far fewer antiviral drugs compared to antibacterial drugs, as a replication of the viruses are so closely associated with DNA replication in the host cell that nonspecific antiviral agents can often be toxic to the host. There are several stages of virus infection, which can be blocked or ingibirovany using anti-virus agents. Data stage include the attachment of the virus to the host cell (immunoglobulin or binding peptides), decapitation virus (e.g., amantadine), synthesis or translation of viral mRNA (e.g., interferon), replication of viral RNA or DNA (e.g., nucleoside analogues), maturation of new virus proteins (e.g., protease inhibitors) and active viral replication and release of the virus.

Nucleotide analogs are synthetic compounds, which are similar to nucleotides, but which are incomplete or unusual desoxyribose or ribozol group. As soon as nucleotide analogs enter the cell, they fosfauriliruyutza obtaining trifosfatnogo forms that compete with normal nucleotides for incorporation into viral DNA or RNA. As soon as trifosfatnogo form of the nucleotide analogue is included in the growing chain of nucleic acid, it causes niobra emuu Association with the viral polymerase and as a result, the elongation of the chain ends. Nucleotide analogs include, but are not limited to, acyclovir (used to treat infections with herpes simplex virus and varicella-zoster virus), ganciclovir (used to treat cytomegalovirus infections), idoxuridine, ribavirin (used to treat virus infections of the respiratory syncytium), dideoxyinosine, dideoxycytidine and zidovudine (azidothymidine).

Interferons are cytokines that are secreted by cells infected with a virus, and immune cells. Interferons act as a result of binding with specific receptors on the cells adjacent to infected cells, causing changes in the cell that protects it from infection by a virus αand β-interferon also induces the expression of MHC molecules of class I and class II on the surface of infected cells, leading to increased antigen presentation to immune recognition by the host's cells, αand β-interferons are available as recombinant forms and used to treat infections in chronic hepatitis b and C. In dosages that are effective for antiviral therapy, interferon have severe side effects, such as fever, malaise and weight loss.

Therapy with immunoglobulin is used to prevent viral infections. Therapy immunoglob the disciplines of viral infections similar to that of bacterial infections, because, being rather specific to the antigen, immunoglobulin therapy acts by binding to extracellular virions and protects them from binding to cells and penetration into cells that are susceptible to viral infection. Therapy is useful for the prevention of viral infection during the period of time when the antibodies are present in the host. In General there are two types of immunoglobulin therapy, therapy with immunoglobulins present in the norm, and therapy hyperprolactinemia immunoglobulins. When treatment with immunoglobulins present in the normal, or antibody-based test is used, the product obtained from pooled serum of normal blood donors. This combined product contains low titers of antibodies to a wide range of human viruses, such as hepatitis a And parvovirus, enterovirus (especially in newborns). When therapy hyperprolactinemia immunoglobulins using antibodies obtained from the serum of individuals who have high titers of antibodies to a particular virus. These antibodies are then used against a particular virus. Examples hyperproducers antibodies include immunoglobulin shingles (used for the prevention of varicella in children and infants with immunodeficiency, immunoglobulin basin the Batwa people (used for post-exposure prophylaxis of a subject, attacked by a rabid animal), hepatitis b immunoglobulin (used in the prevention of infection by hepatitis b virus, especially in the subject exposed to the virus and RSV immunoglobulin (used to treat infections caused by virus respiratory syncytium).

Another type of therapy with immunoglobulins is active immunization. It includes antibodies or fragments of antibodies against surface proteins of the virus. Two types of vaccines that are available for active immunization against hepatitis b include originating from serum antibodies and recombinant hepatitis b antibody hepatitis C. Both derived from HbsAg. The antibody is administered in three doses to subjects with a high risk of infection with hepatitis b virus, such as health workers, sexual partners of chronic carriers and children.

Thus, antiviral agents applicable to the invention include, but are not limited to, immunoglobulins, amantadine, interferon, nucleoside analogues and protease inhibitors. Specific examples of antiviral agents include, but are not limited to, acemannan; acyclovir; acyclovir sodium; adefovir; alovudine; alercet sudotox; amantadine hydrochloride; arrotin; eildon; atevirdine; atevirdine mesilate; avidin; cidofovir; cipamfylline; cytarabine hydrochlor is d; delavirdine mesilate; desciclovir; didanosine; disoxaril; edoxudine; envirogen; enviroxime; famciclovir; figotin hydrochloride; filterin; fialuridine; Pasarela; foscarnet sodium; Postnet sodium; ganciclovir; ganciclovir sodium; idoxuridine; ketocal; lamivudine; lobucavir; memoty hydrochloride; methisazone; nevirapine; penciclovir; pirodavir; ribavirin; rimantadine hydrochloride; shinaver mesilate; amantadine hydrochloride; sorivudin; statlon; stavudine; tilorone hydrochloride; trifluralin; valacyclovir hydrochloride; vidarabine phosphate; vidarabine sodium phosphate; viroxyn; zalcitabine; zidovudine and enviroxime.

Antifungal agents useful for the treatment and prevention of infection by fungi. Antifungal agents are sometimes classified by their mechanism of action. Some antifungal agents that act as inhibitors of the cell wall using braking glucosaminidase. They include, but are not limited to, basigin/ERUs. Other antifungal agents act by destabilizing the membrane integrity. They include, but are not limited to, imidazole, such as clotrimazole, sertaconazole, fluconazole, Itraconazole, ketoconazole, miconazole and voriconazol and FK 463, amphotericin b, BAY 38-9502, MK 991, bradikinin, UK 292, butenafine and terbinafine. Other Antifungal agents act p is the destruction of chitin (for example, chitinases) or immunosuppressive (ointment 501). Some examples of commercially available agents are presented in table C.

Table
CompanyBrandGeneric nameReadingsThe mechanism of action
PHARMACIA &UP JOHNPNU 196443PNU 196443antifungalNot Izv.
LillyLY 303366Basiungin/ECBFungal infectionsAntifungal/inhibitor of cell wall synthase inhibitor glucose
BayerCanestenClotrimazoleFungal infectionsDestablizer integrity of membranes
FujisawaFK 463FK 463Fungal infectionsDestablizer integrity of membranes
MylanSertaconazoleSertaconazoleFungal infectionsDestablizer integrity of membranes
GenzymeThe chitinaseThe chitinaseFungal infections, systemicDestruction of chitin
LiposomeAbelcetAmphotericin b, liposomal Fungal infections, systemicDestablizer integrity of membranes
SequusAmphotecAmphotericin b, liposomalFungal infections, systemicDestablizer integrity of membranes

BayerBAY 38-9502BAY 38-9502Fungal infections, systemicDestablizer integrity of membranes
PhizerDiflucanFluconazoleFungal infections, systemicDestablizer integrity of membranes
Johnson & JohnsonSporanoxItraconazoleFungal infections, systemicDestablizer integrity of membranes
SepracorItraconazol (2R, 4S)Itraconazol (2R, 4S)Fungal infections, systemicDestablizer integrity of membranes
Johnson & JohnsonNizoralKetoconazoleFungal infections, systemicDestablizer integrity of membranes
Johnson & JohnsonMonistatMiconazoleFungal infections, systemicDestablizer integrity of membranes
MerckMK 991MK 991Fungal infections, systemicDestablizer integrity of membranes
Bristol Myers Sq'bOl azimycinProgenitinFungal infections, systemicDestablizer integrity of membranes

PfizerUK-292,663UK-292, 663Fungal infections, systemicDestablizer integrity of membranes
PfizerVoriconazoleVoriconazoleFungal infections, systemicDestablizer integrity of membranes
MylanCream 501Cream 501Inflammatory fungal conditionImmunosuppression
MylanMentaxButenafineNail fungusDestablizer integrity of membranes
Schering PloughAntifungalAntifungalOpportunistic infectionsDestablizer integrity of membranes
AlzaTablet mycelexClotrimazoleThrush of the mouthThe stabilizer integrity of membranes
Novartis LamisilTerbinafineSystemic fungal infections, onychomycosisDestablizer integrity of membranes

Thus, antifungal agents usable in this invention include, but are not limited to, imidazoles, FK 463, amphotericin b, BAY 38-9502, MK 991, bradikinin, UK 292, butenafine, chitinase, cream 501, Grisactin, Ambruticin, Amorolfine, Amphotericin b; Azaconazole; Azaserine; Baseborn; Bifonazol; Biennia hydrochloride; Bispyridine megaflex; Butoconazole nitrate; Undecylenate calcium; Candicidin; Carbol-fuchsin; Loganton; Ciclopirox; Ciclopirox alamin; Cilofungin; Ciscoasa; Clotrimazole; Cupronickel; Denaturing; Deperation; Docosanol; Econazole; Econazole nitrate; Enilconazole; Itonama nitrate; Fenticonazole nitrate; filipin; fluconazole; Flucytosine; Fungisil; Griseofulvin; Gamitin; Isoconazole; Itraconazole; Kalafungin; Ketoconazole; Amaturen; Lidamycin; Mepartricin; Miconazole, Miconazole nitrate; Monensin; Monensin sodium; Naftifine hydrochloride; Neomycin undecylenate; Nifuratel; Nifurmerone; Nitrosamine hydrochloride; Nystatin; Caprylic acid; Oronasal nitrate; Oxiconazole nitrate; Oxypurine hydrochloride; Paranasal hydrochloride; Partricin; potassium Iodide; Prolinol; Pyrithione zinc; Pyrrolnitrin; Rutamycin; Sanguinary chloride; the personsal; Scopadulin; Sulfur selenium; Sinefungin; Sulconazole nitrate; Terbinafine; Terconazole; Thiram; Tilton; Tioconazole; Tolciclate; Calendat; Tolnaftate; Triacetin; Treafurer; Undecylenoyl acid; Viridifolia; Undecylenate zinc and Sinonasal hydrochloride.

Immunostimulatory nucleic acids can be combined with other therapeutic agents such as adjuvants to enhance immune responses. Immunostimulirutuyu nucleic acid and the other therapeutic agent can be administered simultaneously or separately. When other therapeutic agents are administered simultaneously, they can be administered in the same or separate formulations, but they are introduced at the same time. Other therapeutic agents are administered sequentially with one another and with immunostimulatory nucleic acid, when the introduction of other therapeutic agents and the immunostimulatory nucleic acid is separated in time. The separation in time between the introduction of these compounds can be measured by minutes or longer. Other therapeutic agents include, but are not limited to, adjuvants, cytokines, antibodies, antigens, etc.

Immunostimulatory nucleic acids suitable as adjuvants for the induction of a systemic immune response. Therefore, any of them can be administered to the subject, eksponirovannoi antigen, to stimulate enhanced immune response to the antigen.

In addition to the immunostimulatory nucleic acids of the composition of the present invention can be administered with adjuvants other than nucleic acids. Non-nucleic acid adjuvant is any molecule or compound, except as described here immunostimulatory nucleic acid, which can stimulate humoral and/or cellular immune response.

Non-nucleic acid adjuvants include, for example, adjuvants that create a depot effect, immunostimulatory adjuvants, adjuvants that create a depot effect and stimulate the immune system.

Adjuvant that creates a depot effect, apply here as adjuvant that provides slow release of antigen into the body, thereby prolonging the exposure of immune cells to the antigen. This class of adjuvants includes but is not limited to, alum (e.g., aluminum hydroxide, aluminum phosphate); or compositions based on the emulsion, including mineral oil, remineralise oil, emulsion, water in oil and oil-water emulsion in oil, emulsion oil in water, such as a number of adjuvants Seppic Montanide ISA (e.g., Montanide ISA 720, AirLiquide, Paris, France); MF-59 (emulsion of squalene in water, stabilized Span 85 and tween 80; Chiron Corporation, Emeryville, CA; and POVAX (the oil-water emulsion, containing stabilizing surfactant to form micelles agent; IDEC, Pharmaceuticals Corporation, San Diego, CA).

Immune-stimulating adjuvant is an adjuvant, causing the activation of cells of the immune system. He may, for example, to induce the production and secretion of cell cytokines. This class of adjuvants includes but is not limited to this, saponins purified from the bark of the tree Q. Saponaria, such as QS21 (a glycolipid that eluted in the 21st peak with HPLC fractionation; Aquila Biopharmaceuticals, Inc., Worcester, MA); poly[di(carboxymethoxy)fosfato (RSRR polymer; Virus Research Institute, USA); derivatives of lipopolysaccharides such as monophosphoryl A (MPL; Ribi ImmunoChem Research, Inc., Hamilton, Mt), muramyldipeptide (MDP; Ribi) and travelmartindia.com (t-MDP; Ribi); OM-174 (glucosaminidase associated with the lipid A; OM Pharma SA, Meyrin, Switzerland); and the factor of Leishmania elongation (a purified Leishmania protein); Corixa Corporation, Seattle, WA).

Adjuvants that create a depot effect and stimulate the immune system, are compounds that have both above defined functions. This class of adjuvants includes but is not limited to this, ISCOMS (immunostimulating complexes that contain mixed saponins, lipids and form particles the size of viruses with pores, which can retain the antigen; CSL, Melbourne, Australia); SB-AS2 (SmithKline Beecham, adju is based system #2, representing an oil-water emulsion containing MPL and QS21: SmithKline Beecham Biologicals [SBB], Rixensart, Belgium); SB-AS4 (SmithKline Beecham adjuvant system #4, contains alum and MPL; SBB, Belgium); non-ionic block copolymers that form micelles such as CRL 1005 (which contains a linear chain of hydrophobic polyoxypropylene, planbureau chains of polyoxyethylene; Vaxcel, Inc., Norcross, GA); and Syntex Adjuvant Formulation (SAF, emulsion oil in water containing tween 80 and non-ionic block-copolymer; Syntex Chemicals, Inc., Boulder, CO).

Immunostimulatory nucleic acids can be used as mucosal adjuvants. Previously it was found that mucosal delivery of CpG nucleic acids is induced both systemic and mucosal immunity. Induced in response to CpG nucleic acids systemic immunity included both humoral and mediated by cells in response to specific antigens, which themselves when applied to the mucosa were not able to induce systemic immunity. Moreover, CTL induced as a CpG nucleic acid, and cholera toxin (CT, mucosal adjuvant, inducing Th2-like response). It was amazing, because in systemic immunization, the presence of Th2-like antibodies are usually associated with the absence of CTL (Schirmbeck et al., 1995). On the basis of the results presented here are expected immunostimulatory nucleic acid to the must act in a similar manner.

In addition, immunostimulatory nucleic acids induce a mucosal response both locally (e.g. in the lungs), and distant (for example, in the lower part of the digestive tract). Immunostimulatory nucleic acids induce significant levels of IgA antibodies in distant areas of the mucosa. ART is seen as a highly effective mucosal adjuvant. As previously reported (Snider 1995), P induces predominantly antibody isotype IgGI, which serve as an indicator of response Th2 dysbalance-type. On the contrary, immunostimulatory nucleic acids to a greater extent are addressed with Th1 predominant IgG2a antibodies, especially after supporting immunization or a combination of the two adjuvants. Antibodies Th1-type in General have better neutralizing activity, and, therefore, the Th2 response in the lung is extremely undesirable because it is associated with asthma (KAU, 1996, Hogg, 1997). Thus, the use of immunostimulatory nucleic acid has advantages that are unreachable for other mucosal adjuvants. Immunostimulatory nucleic acids according to the invention can be used as mucosal adjuvants for the induction of both systemic and mucosal immune response.

Mucosal adjuvants, referred to as mucosal adjuvants other than nucleic acids, can also the be together with boosting nucleic acids. The non-nucleic acid mucosal adjuvant is an adjuvant, non-immunostimulatory nucleic acid, which is able to induce mucosal immune response in the subject when applied to the surface of the mucous together with the antigen. Mucosal adjuvants include, but are not limited to, bacterial toxins such as cholera toxin (CT), derivative ART, including, but not limited to this subunit IN ARTICLE (CTV) (Wu et al., 1998, Tochikubo et al., 1998); CTD53 (Val Asp) (Fontana et al., 1995); CTK97 (Val to Lys) (Fontana et al., 1995); CTK104 (hard Lys) (Fontana et al., 1995); CTD53/K63 (Val Asp, Ser to Lys) (Fontana et al., 1995); CTH54 (Arg to His) (Fontana et al., 1995); CTN107 (His to Asn) (Fontana et al., 1995); CTE114 (Ser to Glu) (Fontana et al., 1995); CTE112K (Glu to Lys) (Yamamoto et al., 1997a); CTS61F (Ser to Phe) (Yamamoto et al., 1997a, 1997b); CTS106 (Pro Lys) (Douce et al., 1997, Fontana et al., 1995); and STC (Ser to Lys) (Douce et al., 1997, Fontana et al., 1995), the toxin Zonula occludens, zot, thermo-labile enterotoxin of Escherichia coli labile toxin (LT), derivatives of LT, including, but not limited to, a subunit of LT (LTB) (Verweij et al., 1998); LT7K (Arg to Lys) (Komase et al., 1998, Douce et al., 1995); LT61F (Ser to Phe) (Komase et al., 1998); LT112K (Glu to Lys) (Komase et al., 1998); LT118E (Gly to Glu) (Komase et al., 1998); LT146E (Arg to Glu) (Komase et al., 1998); LT192G (Arg to Gly) (Komase et al., 1998); LTK63 (Ser to Lys) (Marchetti et al., 1998, Douce et al., 1997, 1998, Di Tommaso et al., 1996); and LTR72 (on Ala Arg) (Giuliani et al., 1998), pertussis toxin, RT. (Lycke et al., 1992, Spangler BD, 1992, Freytag and Clemments, 1999, Roberts et al., 1995, Wilson et al., 1995), including PT-9K/129 (Roberts et al., 1995, Cropley et al., 1995); derivative of the toxin (see below) (Holmgren et al., 1993, Verweij et al., 1998, Rappuoli et al., 1995, Freytag and Clements, 1999); derivatives of lipid A (for example, monophosphorylated lipid A, MPL) (Sasaki et al., 1998, Vancott et al., 1998; derivatives muramyldipeptide (MDP) (Fukushima et al., 1996, Ogawa et al., 1989, Michaiek et al., 1983, Morisaki et al., 1983); proteins of the outer membrane of bacteria (for example, the protein And the outer surface (OspA) lipoprotein of Borrelia burgdorferi, outer membrane protein of Neisseria meningitidis)(Marinaro et al., 1999, Van de Verg et al., 1996); emulsion of oil in water (e.g., MF59) (Barchfield et al., 1999, Versehoor et al., 1999, O Hagan, 1998); aluminum salts (Isaka et al., 1998, 1999); and saponins (e.g., QS21) Aquiia Biopharmaceuticals, Inc., Worster, MA) (Sasaki et al., 1998, MacNeal et al., 1998), ISCOMS, MF-59 (emulsion of squalene in water, stabilized Span 85 and tween 80; Chiron Corporation, Emeryville, CA); series Seppic ISA adjuvants Montanide (e.g., Montanide ISA 720; AirLiquide, Paris, France); PROVAX (an oil-water emulsion containing a stabilizing surfactant to form micelles agent; IDEC Pharmaceuticais Corporation, San Diego, CA); adjuvant composition Syntext (SAF; Syntex Chemicals, Inc., Boulder, CO); poly[di(carboxymethoxy)fosfato (RSRR polymer; Virus Research Institute, USA) and a factor of Leishmania elongation (Corixa Corporation, Seattle, WA).

Immune responses can also be induced or enhanced by joint boosting nucleic acids introduction or parallel the expression of cytokines (Bueler &Mulligan, 1996; Chow et al, 1997; Geissler et al., 1997; Iwasaki et al., 1997; Kirn e al., 1997) or co-stimulating molecules-7 (Iwasaki et al., 1997; Tsuji et

al., 1997). Cytokines can be entered directly with boosting nucleic acids or in the form of vector nucleic acid encoding a cytokine, resulting in cytokine can be expressed in vivo. In one implementation, the cytokine is administered in the form of a plasmid expression vector. The term "cytokine" is used here as a generic name for a heterogeneous group of soluble proteins and peptides that act as humoral regulators at concentrations ranging from nano - to picomolar, and which in normal or pathological situations modulate the functional activity of individual cells and tissues. Data proteins also directly mediate interactions between cells and regulate the processes taking place in the extracellular environment. Examples of cytokines include, but are not limited to, IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-15, IL-18, colony stimulating factor granulocyte-macrophage (GM-CSF), colony stimulating factor, granulocyte (G-CSF), interferon-γ (γ-IFN), IFN-α: tumor necrosis factor (TNF), TGF-(3, ligand, FLT-3 and CD40 ligand.

Cytokines play an important role in the orientation of the T-cell response. Helper T cells (CD4+) organize the immune response of mammals through the formation of soluble factors, which action is comfort to other cells of the immune system, including other T cells. Most Mature CD4+ helper T cells expresses one of the two profiles of cytokines: Th1 or Th2. The Th1 subset stimulates delayed-type hypersensitivity, cell-mediated immunity and switching to immunoglobulin class IgG2a. Subgroup induces Th2 humoral immunity by activating b cells, stimulation of antibody formation and induction switch on education IgG1and IgE. In some implementations preferably, the cytokine was a Th1 cytokine.

Nucleic acids can also be used for switching the direction of the immune response from a Th2 immune response to a Th1 immune response. Redirection of the immune response from Th2 to Th1 immune response can be determined by measuring the levels of cytokines produced in response to nucleic acid (e.g., by inducing the production of Th1 cytokines, including IL-12, ifn-γ and GM-CSF, monocytes and other cells). Switching orientation or a change in the balance of the immune response from Th2 to Th1 response is particularly useful for the treatment or prevention of asthma. For example, effective for the treatment of asthma can be so many that are suitable for switching Th2 dysbalance-immune response, which is associated with asthma, Th1-type response. The level of Th2 cytokines, particularly IL-4 and IL-5 was increased in the Airways of subje the tov, suffering from asthma. These cytokines cause the main elements of the asthmatic inflammatory response, including induction of IgE isotype, chemotaxis and activation of eosinophils and growth of fat cells. The Th1 cytokines, especially IFN-γ and IL-12 can inhibit the formation of Th2 clones and the production of cytokines Th2 dysbalance. Immunostimulatory nucleic acids according to the invention cause an increase of Th1 cytokines, which contribute to the change in the balance of the immune system, preventing or reducing adverse effects associated with the dominance of Th2 dysbalance immune response.

Nucleic acids can be used to improve the survival, differentiation, activation and maturation of dendritic cells. Immunostimulatory nucleic acids have a unique ability to stimulate the survival, differentiation, activation and maturation of dendritic cells. Precursors of dendritic cells isolated from the blood using immunomagnetic of sorting cells show morphological and functional properties of dendritic cells during the two-day incubation with GM-CSF. Without GM-CSF these cells undergo apoptosis. Immunostimulatory nucleic acids surpass GM-CSF to stimulate the survival and differentiation of dendritic cells (expression of ICSU II, the size of cells, the granularity). Immunostimulatory nucleic acid that is also induce maturation of dendritic cells. Because dendritic cells form a link between the innate and acquired immune system by presenting antigens, as well as by the expression of their receptors, recognize the pattern, which determine the microbial molecule type LPS in their local environment, the ability of immunostimulatory nucleic acids to activate dendritic cells, promotes the application of this based on the use of immunostimulatory nucleic acids, strategies for immunotherapy in vivo and ex vivo diseases such as cancer and allergic or infectious diseases. Immunostimulatory nucleic acids are also suitable for activation and induction of maturation of dendritic cells.

Immunostimulatory nucleic acids also enhance the lytic activity of cells - natural killer cells and dependent antibodies cell-mediated cytotoxicity (ADCC). ADCC can be achieved with the use of immunostimulatory nucleic acid in combination with an antibody specific target cells, such as cancer cells. When immunostimulirutuyu nucleic acid is administered to a subject together with the antibody, the stimulation of the immune system of the subject for the destruction of tumor cells. Antibodies suitable for the procedure ADCC include antibodies that interact with the cell in the body. Many of t is such antibodies, specific target cells, have been described in the art and many are commercially available. Examples of such antibodies are listed below in the list of immunotherapy of cancer.

Immunostimulatory nucleic acids can also enter together with anti-cancer therapy. Means anticancer therapy include anti-cancer drugs, radiation and surgical procedures. Used here, the term “anticancer drug” refers to an agent that is administered to a subject to treat cancer. Used here, the term “cancer treatment” includes preventing the development of cancer, suppression of the symptoms of cancer and/or inhibition of growth of existing cancer. In other embodiments, the anticancer drug is administered to a subject having cancer risk, with the aim of reducing the risk of developing cancer. The following describes the various types of drugs for cancer treatment. For the purposes of this description anticancer drugs are classified as chemotherapeutic agents, immunotherapy agents, cancer vaccines, hormonal therapy and biological modulators of the response.

Used here, the term “anticancer drug” refers to an agent that is administered to a subject to treat cancer. Used here, the term “cancer treatment” includes preventing the development of cancer, suppression of Shem, the volume of cancer and/or inhibition of growth of existing cancer. In other embodiments, the anticancer drug is administered to a subject having cancer risk, with the aim of reducing the risk of developing cancer. The following describes the various types of drugs for cancer treatment. For the purposes of this description anticancer drugs are classified as chemotherapeutic agents, immunotherapy agents, cancer vaccines, hormonal therapy and biological modulators of the response. In addition, the methods of the invention are intended to include the use of more than one anticancer drugs along with boosting nucleic acids. For example, when it is shown to be immunostimulatory nucleic acid can be entered as a chemotherapeutic agent, and immunotherapy agent. In another embodiment, the anticancer drug may include immunotherapy agent and a cancer vaccine or chemotherapeutic agent and a cancer vaccine or chemotherapeutic agent, immunotherapy agent and a cancer vaccine, which collectively impose a single subject for the treatment of a subject suffering from cancer or having cancer risk.

Anticancer drugs are in many ways. Some anticancer drugs is focused on the physiological mechanisms that are specific for tumor cells. Examples include directed action is and the specific genes and the products of these genes (i.e. mainly proteins), which mutate to cancer. Such genes include, but are not limited to, oncogenes (e.g. Ras, Her2, bcl-2), genes are tumor suppressors (e.g., EGF, p53, Rb), and targets the cell cycle (e.g., CDK4, P21, telomerase). In another embodiment, anti-cancer drugs can be directed towards the holding signal and the molecular mechanisms that change in cancer cells. The use of monoclonal antibodies provides a focus on the cancer cells by means of epitopes expressed on the surface of such cells. The last type of anti-cancer drugs is commonly referred to here as immunotherapy.

Other anti-cancer drugs are for cells other than cancer. For example, some drugs will primesouth the immune system to attack tumor cells (i.e. cancer vaccine). Another type of drugs called angiogenesis inhibitors, works by damaging the blood supply to solid tumors. Because most malignant cancers are able to metastasize (i.e. existence in place of the primary tumor and spreading to distant tissues, thereby forming a secondary tumor), drugs that prevent such metastasis, also suitable for cancer treatment. Mediators of angiogenesis include basic FGF, VEGF, angiopoetin, angio who Tatin, endostatin, TNFα, TNP-470, thrombospondin-1, platelet factor 4, CAI and some members of the family integranova proteins. One of the categories of this type of drugs is a metalloproteinase inhibitor, which inhibits the enzymes used by tumor cells to maintain the existence of the primary tumor and other tissue.

Some cancer cells are antigenic and thus can be the subject of the action of the immune system. In one embodiment, co-administration of immunostimulatory nucleic acids and cancer drugs, especially those that are classified as anti-cancer immunotherapy, suitable for stimulating a specific immune response against the antigen of the cancer. Used herein, the term “cancer antigen” refers to a connection, such as a peptide, associated with the surface of tumor or cancer cell, and which is able to provoke an immune response when the expression on the surface of antigen-presenting cells in the context of MHC molecules. Cancer antigens, such as represented in cancer vaccines, or those used to obtain anti-cancer immunotherapy can be obtained from crude extracts of cancer cells, as described Cochen, et al., 1994, Cancer Research 54:1055, or by partial purification of antigens with the use of R is combinatii technology or de novo synthesis of known antigens. Cancer antigens can be applied in the form of immunogenic parts specific antigen, or in some cases as an antigen can be applied to a cell or a tumor mass. Such antigens can be isolated or obtained by recombinant means or by any other method known in this technical field.

theory of immune surveillance is that the primary function of the immune system is the detection and destruction of neoplastic cells to cancer. The fundamental principle of this theory is that cancer cells are antigenically different from normal cells and thus cause an immune reaction similar to those that cause immunological rejection of incompatible allografts. Studies have confirmed that tumor cells differ qualitatively or quantitatively by expression of antigens. For example, “tumor-specific antigens are antigens associated with specific tumor cells but not normal cells. Examples are specific for tumor antigens are viral antigens in tumors induced by DNA or RNA viruses. Associated with tumors of the antigens are both in tumor and in normal cells, but tumor cells are presented in some or other form. Examples of such antigens are oncofetal antigens (e.g., carcinoembryonic antigen), differentiation antigens (e.g., antigens of T and TA) and the products of oncogenes (e.g., HER/neu).

Identified different types of cells that can cause the death of tumor targets in vitro and in vivo: cells - natural killer cells (NK-cells), cytolytic T-lymphocytes (CTL)that is activated by lymphokines killer cells (LAK) and activated macrophages. NK cells are able to induce the death of tumor cells without prior sensitization to specific antigens, and this activity does not require the presence of antigens class I, encoded by the major histocompatibility complex (MHC)on target cells. Suppose that NK cells participate in the control of emerging tumors and control of metastatic growth. In contrast to NK cells, CTL can cause the death of tumor cells only after sensitization to tumor antigen when the antigen target is expressed on a tumor cell that expresses and MHC class I Believe that CTL serve as effector cells in the rejection of transplanted tumors and tumors caused by DNA viruses. LAK cells are a subset of lymphocytes zero, different from the populations of NK and CTL. Activated macrophages can cause cell death, therefore, is that after activation it does not depend on antigen neither of the MNF. It is believed that activated macrophages also slow the growth of tumors, in which they infiltrate. In the in vitro identified and other immune mechanisms, such as dependent antibody mediated cell cytotoxic reactions and lysis under the action of antibody plus complement. However, as I believe, these immune effector mechanisms are less important in vivo no comparison with the functions NK, CTL, LAK and macrophages in vivo (as a review see Piessens, W.F., and David, J., "Tumor Immunology", in: Scientific American Medicine, Vol.2, Scientific American Books, N.Y., pp.1-13, 1996.

The goal of immunotherapy is to increase the immune response of the patient to the already existing cancer. One way of immunotherapy involves the use of adjuvants. Adjuvant substances derived from microorganisms such as Bacillus Calmette-Guerin, enhance the immune response and increase the resistance to tumors in animals.

Immunotherapy agents are drugs derived from antibodies or fragments of antibodies that specifically bind or recognize a cancer antigen. Used herein, the term "cancer antigen" in the broad sense is defined as the antigen expressed by a cancer cell. Preferably, the antigen expressively on the cell surface of a cancer cell. Even more preferably, the antigen was that not expressive is by normal cells or at least not expressed at the same level, as in cancer cells. Based on the antibody immunotherapy may act by binding to cell surface of a cancer cell, thereby stimulating the attack of the endogenous immune system against cancer cells. Another way that works is based on the antibody-therapeutic agent is a system-specific targeted delivery of toxic substances to cancer cells. Antibodies usually kongugiruut with toxins such as ricin (for example, from castor beans), calicheamicin and maytansinoid, radioactive isotopes, such as iodine-131 and yttrium-90, with chemotherapeutic agents (as described here) or modulators of the biological response. In this way toxic substances can be concentrated in the area of cancer, and non-specific toxicity to normal cells can be minimized. In addition to the use of antibodies that are specific against cancer antigens, the invention is also suitable antibodies that are associated with the vasculature, such as antibodies, to bind to the endothelial cells. This is reasonable since usually the survival of solid tumors depends on newly formed blood vessels, and therefore the majority of tumors are able to recruit and stimulate the growth of new blood vessels. The result is one of the strategies of many anticancer drugs is an attack on the supply of the tumor blood vessels and/or connective tissue (or stroma), supporting these blood vessels.

The use of immunostimulatory nucleic acids in combination immunotherapy agents such as monoclonal antibodies, can improve long-term survival through a number of mechanisms, including a significant increase in ADCC (as discussed above), activation of cells-natural killer cells (NK) and increasing the level of IFNa. Nucleic acid when used in combination with monoclonal antibodies are used to reduce the dose of antibody required to achieve biological result.

Examples of anti-cancer immunotherapy, which are currently in use or which are under development are listed in table C.

Table
Anticancer immunotherapy in development or commercially available
SoldBrand (generic name)Reading
IDEC/Genentech, Inc./Hoffmann-LaRoche (first monoclonal antibody licensed for the treatment of cancer in the United States)Rituxan™ (rituximab, MabThera) (IDEC-SW, hybrid mouse/human anti-D20 Mab)Not-jackinsky lymphoma
Genentech/Hoffmann-La Rohe Herceptin, anti-Neg hMAbBreast cancer/ovarian
Cytogen Corp.Quadramet (CYT-424), a radiotherapy agentBone metastases
Centocor/Glaxo/AjinomotoPanorex ® (17-1A) (mouse monoclonal antibody)Adjuvant therapy of colorectal cancer (Dukes C)
Centocor/AjinomotoPanorex ® (17-1A) (hybrid mouse monoclonal antibody)Cancer of the pancreas, lungs,

  breast, ovarian
I DECIDEC-Y2B8 (mouse anti-D20 Mab labeled with yttrium-90)Not-jackinsky lymphoma
ImClone SystemsWAS (anti-idiotypic Mab, mimics the epitope GD3) (with BCG)Small cell lung cancer
ImClone SystemsS (hybrid monoclonal antibody against the receptor for epidermal growth factor (EGFr))Cancer cells of the kidney
Techniclone International/Alpha TherapeuticsAnkrim (Lym-1 monoclonal antibody, United with iodine-131)Not-jackinsky lymphoma
Protein Design LabsSMART M1 95 Ab, close to humanAcute myeloid leiko the
Techniclone Corporation/Cambridge Antibody Technology131I! LYM-1 (ancoli™)Not-jackinsky lymphoma

Aronex Pharmaceuticals, Inc.ATRAGEN®Acute promyelocytic leukemia
ImClone SystemsC225 (hybrid monoclonal antibody against EGFr) + cisplatin or radiationHead and neck cancer, non-small cell lung cancer
Altarex, CanadaOvarex (V, anti-idiotypic SA, mouse Mab)Ovarian cancer
Coulter Pharma (clinical results were positive, but was set associated with significant drug toxicity in the bone marrow)Bexxar (anti-D20 Mab labeled with131I)Not-jackinsky lymphoma
Aronex Pharmaceuticals, Inc.ATRAGEN®Kaposi's sarcoma
IDEC Pharmaceuticals Corp./GenetechRituxan™ (Mab against CD20) pan-B Ab in the package with chemotherapyB-cell lymphoma



LeukoSite/Ilex Oncology
LDP-03, huMAb against leucocytes antigen SAMRATChronic lymphocytic leukemia (CLL)
Center of Molecular Immunologyior t6 (anti-D6, ichinoe Mab) CTCL Cancer
Medarex/NovartisMDX-210 (close to human anti-NEK-2 bespecifically antibody)Breast cancer, ovarian
Medarex/NovartisMDX-210 (close to human anti-NECK.-2 bespecifically antibody)Prostate cancer, non-small cell lung cancer, pancreatic cancer, breast cancer
MedarexMDX-11 (complement-activating receptor (CAR) monoclonal antibody)Acute myelogenous leukemia (AML)
Medarex/NovartisMDX-210 (close to human anti-NEUVE.-2 bespecifically antibody)Kidney cancer and colon

Aronex Pharmaceuticals, Inc.


Medarex
MDX-11 (complement-activating receptor (CAR) monoclonal antibody)Purification of bone marrow ex vivo in acute myelogenous leukemia (AML)
MedarexMDX-22 (close to human bespecifically antibody conjugates Mab) (activators of the complement cascade)Acute myeloid leukemia
CytogenOV103 (labeled with yttrium-90 antibody)Ovarian cancer
CytogenOV103 (labeled with yttrium-90 antibody)Prostate cancer
ATRAGEN®Not-jackinsky lymphoma
Glaxo Wellcome pie3622W94 Mab, which binds to EGP40 (17-1A) antigen pancarcinoma on adenocarcinomasNon-small cell lung cancer, prostate cancer (adjuvant)
GenentechAnti-VEGF, RhuMAb (inhibits angiogenesis)Lung cancer, breast cancer, prostate cancer, colorectal

  cancer
Protein Design LabsZenapax (SMART anti-TAC (the receptor for IL-2) Ab, close to human)Leukemia, lymphoma
Protein Design LabsSMART M1 95 Ab, close to humanAcute promyelocytic leukemia
ImClone SystemsS (hybrid anti-EGFr monoclonal antibody) + TaxolBreast cancer
ImClone Systems (license from RPR)S (hybrid anti-EGFr monoclonal antibody) + doxorubicinProstate cancer
ImClone SystemsS (hybrid anti-EGFr monoclonal antibody) + adriamycinProstate cancer
ImClone SystemsWAS (anti-idiotypic Mab, mimics the epitope GD3) Melanoma
MedarexMDX-210 (close to human anti-NER-2 bespecifically antibody)Cancer
MedarexMDX-220 (bespecifically for tumorsLung cancer, colon

 which Express TAG-72)colon, prostate, ovary, endometrium, pancreas and stomach
Medarex/NovartisMDX-210 (close to human anti-NER-2 bespecifically, antibody)Prostate cancer
Medarex/Merck KgaAMDX-447 (close to human bespecifically, the antibody against the EGF receptor)Cancers associated with EGF receptor (head and neck, prostate, lung, bladder, cervical, ovarian)
Medarex/NovartisMDX-210 (close to human anti-NEK-2 bespecifically antibody)Combined with G-CSF therapy of various cancers in ladies. -

MELIMMUNE-1 (therapeutic vaccine murine monoclonal antibodies)
  breast cancer
IDECMELIMMUNE-2 (therapeutic vaccine murine monoclonal antibodies)Melanoma
I DECMelanoma
Immunomedics, Inc.CEACIDE™ (1-131)Colorectal cancer and other
NeoRxPrecharge™ radioactive antibodiesNot-jackinsky b-cell lymphoma
Novopharm Biotech, Inc.NovoMAb-G2 (Ab-specific pancarcinoma)Cancer
Techniclone Corporation/Cambridge Antibody TechnologyTNT (hybrid Mab against histone antigens)Brain cancer
Techniclone International/CambridgeTNT (hybrid Mab against histone antigens)Brain cancer

Antibody Technology  
NovopharmGlioma-N (monoclonal - close to human Abs)Brain cancer, melanoma, neuroblastoma
Genetics Institute/AHPGNI-250 MAbColorectal cancer
Merck KgaAEMD-72000 (hybrid antagonist EGF)Cancer
ImmunomedicsLimtied (close to human antibody LL2)Not-jackinsky b-cell lymphoma
Immunex/AHPCMA 676 (conjugate monoclonal antibody)Novopharm Biotech, Inc.Monoform-Cancer of the colon, lung, pancreas
Novopharm Biotech, Inc.INCREASED 4 ÷ 5 anti-idiotypic ABMelanoma, small cell lung cancer
Center of Molecular Immunologyior egf/r3 (anti-EGF-R close toRadioimmunotherapy

 human Ab) 
Center of Molecular Immunologyior c5 (mouse Mab colorectal) for radioimmunotherapyColorectal cancer
Creative BioMolecules/ChironBABS (the binding site biosynthetic antibody) proteinsBreast cancer
IbClone Systems/ChugaiFLK-2 (monoclonal antibody against fetal liver kinase-2 (FLK-2))Associated with tumor angiogenesis
ImmunoGen, Inc.The approximate conjugate to human MAG/small medicationSmall cell lung cancer
Medarex, Inc.MDX-260 bespecifically, directs GD-2Melanoma, glioma, neuroblastoma
Procyon Biopharma, Inc.ANA AbCancer
Protein Design LabsSMART 1D10 Ab B-cell lymphoma
Protein Design Labs/NovartisSMART ABL 364 AbCancer of the breast, lung, colon
Immunomedics, Inc.ImmuRAIT-CEAColorectal cancer

Other types of chemotherapeutic agents that may be used in accordance with the invention, include aminoglutetimid, asparaginase, busulfan, carboplatin, chlorambucil, cytarabine Hcl, dactinomycin, daunorubicin Hcl, estramustine sodium, etoposide (VP16-213), floxuridine, fluorouracil (5-FU), flutamide, hydroxyurea (hydroxycarbamide), ifosfamide, interferon Alfa-2A, Alfa-2b, leuprolide acetate (LHRH analoga-releasing factor), lomustin (CCNU), mechlorethamine Hcl (nitrogen mustard), mercaptopurine, mesna, mitotane (O.P’-DDD), mitoxantrone Hcl, octreotide, plicamycin, procarbazine model HC1, streptozocin, tamoxifen citrate, tioguanin, thiotepa, vinblastine sulfate, amsacrine (m-AMSA), azacytidine, erthropoietin, hexamethylmelamine (MMOs), interleukin 2, mitoguazone (methyl-GAG; metalgearsolidringtoneso; MGBG), pentostatin (2 deoxycoformycin), semustine (methyl-CCNU), teniposide (VM-26) and vindesine sulfate.

Cancer vaccines are medicines for stimulating an endogenous immune response against cancer cells. Currently produced vaccinepreventable activate the humoral immune system (i.e. dependent antibody immune response). Other vaccines that are currently under development, aimed at activation mediated by immune system cells, including cytotoxic T-lymphocytes that are able to cause the death of tumor cells. Cancer vaccines usually improve the presentation of cancer antigens for antigen-presenting cells (e.g. macrophages and dendritic cells) and/or other immune cells such as T cells, b cells and NK-cells.

Although cancer vaccines can take one of several forms, as discussed below, their purpose is the delivery of cancer antigens and/or antigens associated with cancer, to antigen-presenting cells (APC) to facilitate endogenous processing of such antigens ARS and final presentation antigen presentation on the cell surface in the context of MHC molecules of class I. One of the forms of a cancer vaccine is the vaccine of intact cells, which is a drug of cancer cells, which were isolated from a subject, treated ex vivo and then re-introduced to the subject in the form of whole cells. As a cancer vaccine to produce an immune response can also be applied to lysates of tumor cells. Another form of a cancer vaccine is a peptide vaccine in which to activate T cells applied specificity is haunted for cancer or associated with cancer of the small proteins. Associated with cancer proteins are proteins that are expressed not only by cancer cells (i.e. other normal cells can also Express these antigens). However, the expression associated with cancer antigens usually steadfastly increases in cancers of a specific type. Another form of cancer vaccine is the vaccine of dendritic cells, which includes the entire dendritic cells that have been exposed to the cancer antigen or associated with cancer

antigen in vitro. As cancer vaccines can also be applied lysates and membrane fractions of dendritic cells. Vaccine of dendritic cells can directly activate antigen-presenting cells. Other cancer vaccines include ganglioside vaccine, vaccines, heat shock proteins, viral and bacterial vaccines and vaccine nucleic acids.

The use of immunostimulatory nucleic acids in combination with cancer vaccines provides improved specific antigen mediated humoral and cell mediated immune response in addition to the activation of NK-cells and endogenous dendritic cells and enhance IFNα. This increase allows the use of the vaccine with reduced antigen dose to achieve the same favorable action. In some cases, the cancer vaccine m which should be used in conjunction with adjuvants, such as described above.

Used here, the terms “cancer antigen” and “tumor antigen” are used interchangeably to refer to antigens that are differentially expressed in cancer cells and because of this can be applied to directional effects on cancer cells. Cancer antigens are antigens that are potentially capable of stimulating obviously specific tumor immune responses. Some of these antigens are encoded, although not necessarily expressed, normal cells. These antigens may be characterized as those that usually are silent (i.e., not expressed in normal cells, which is expressed only at certain stages of differentiation and are temporarily expressed, such as embryonic and fetal antigens. Other cancer antigens are encoded mutant cellular genes, such as oncogenes (e.g., activated ras oncogene), suppressor genes (e.g., mutant p53), genes and hybrid proteins that occur because of internal deletions or chromosomal translocations. One more cancer antigens are encoded by viral genes, such as those transferred RNA and DNA tumor viruses.

Other vaccines take the form of dendritic cells that have been exposed to cancer ant the genes in vitro, subjected antigen processing and is able to Express the cancer antigens on their cell surface in the context of MHC molecules for efficient antigen presentation to other immune system cells.

In one embodiment of the invention, the immunostimulatory nucleic acid is used in combination with cancer vaccines based on dendritic cells. Dendritic cell is a specialized for antigen presentation cell. Dendritic cells form a link between the innate and acquired immune system by presenting antigens and by the expression of their receptors in the recognition of a pattern that determine microbial molecules like LPS, in their local environment. Dendritic cells effectively internalized, is subjected to the processing and presenterat soluble specific antigen with which they are exhibited. The process of internalization and antigen presentation causes a rapid increase in the expression of major histocompatibility complex (MHC) and co stimulatory molecules, the formation of cytokines and migration in the direction of the lymphatic organs, where they are believed to be involved in the activation of T cells.

Table D lists the many cancer vaccines, which are currently in use or under development.

Table D
Developed or commercially available cancer vaccine
SoldBrand (generic name)Reading
Center of Molecular ImmunologyEGFCancer
Center of Molecular Immunology Ganglioside cancer vaccine
Center of Molecular ImmunologyAnti-idiotypicalCancer vaccine
ImClone Systems/Memorial Sloan-Kettering Cancer CenterAntigen Gp75Melanoma
ImClone Systems/Memorial Sloan-Kettering Cancer CenterAnti-idiotypical AbsCancer vaccine
Progenies Pharmaceuticals, Inc.GMK melanoma vaccineMelanoma
Progenies Pharmaceuticals, Inc.MGV vaccine conjugate gangliosideLymphoma, colorectal cancer, lung cancer
CorixaHer2/neuBreast cancer

  ovarian
AltaRexOvarexOvarian cancer
AVAX Technologies Inc.M-Vax, autologous whole cellMelanoma
AVAX Technologies Ic. O-Vax, autologous whole cellOvarian cancer
AVAX Technologies Inc.L-Vax, autologous whole cellLeukemia-AML
Biomira Inc./ChironTertop, STn-KLHBreast cancer, colorectal cancer
Biomira Inc.BLP25, MUC-1 peptide vaccine encapsulated in a liposomal delivery systemLung cancer
Biomira Inc.BLP25, MUC-1 peptide vaccine encapsulated in a liposomal delivery system + liposomal IL-2Lung cancer
Biomira Inc.Liposomal idiotypical vaccineLimp Ohm cancer that develops In cells

Ribi ImmunochemMelanin, cell lysateMelanoma
CorixaPeptide antigens, microsperma delivery system and adjuvant LeIFBreast cancer
CorixaPeptide antigens, microsperma delivery system and adjuvant LeIFProstate cancer
CorixaPeptide antigens, microsperma delivery system and adjuvant LeIFOvarian cancer
CorixaPeptide antigens, microsperma the delivery system and adjuvant LeIF Lymphoma
CorixaPeptide antigens, microsperma delivery system and adjuvant LeIFLung cancer
Virus Research InstituteToxin/antigen recombinant delivery systemAll types of cancer
Apollon Inc.Genevax-TCRT-cell lymphoma
Bavarian Nordic Research Institute A/SA vaccine based on MVA (cowpox virus)Melanoma

BioChem Pharma/BioChem VaccineRACES IS, BCG vaccineBladder cancer
Cantab PharmaceuticalsTA-HPVCervical cancer
Cantab PharmaceuticalsTA-CINCervical cancer
Cantab PharmaceuticalsDISC-virus immunotherapyCancer
Pasteur Merieux ConnaughtImmucyst®/Terzis®-All immunotherapy (Baccilus Calmette-Guerin/Connaught), for intravesical treatment of superficial bladder cancerBladder cancer

Used here chemotherapeutic agents cover all other forms of anticancer drugs that do not fall under the category of immunotherapy agents, or cancer vaccines. Used here chemotherapeutic AG the options include chemical, and biological agents. These agents are directed to the inhibition of cellular activity, which depends on continued survival of a cancer cell. Categories of chemotherapeutic agents include alkylating/alkaloid agents, antimetabolites, hormones or hormone analogues and various antineoplastic drugs. Most, if not all, of these agents are directly toxic to the cancerous cells and not in need of immune stimulation. The combination of chemotherapy with the introduction of the immunostimulatory nucleic acid increases the maximum tolerated dose chemotherapy.

Chemotherapeutic agents that are currently being developed or applied in a clinical setting, are presented in table E.

Table E
Developed or commercially available anti-cancer medication
SoldBrandGeneric nameReading
AbbottTNP 470/AGM 1470FragilisAnti-angiogenesis in cancer
TakedaTNP 470/AGM 1470FragilisAnti-angiogenesis in cancer
Scota Meglumin GLAMeglumin GLABladder cancer
MedevaValstarValrubicinBladder cancer - resistant in situ carcinoma
MedevaValstarValrubicinBladder cancer - papillary cancer
Rhone PoulencGliadel waferCarmustin + polifeprosanThe brain tumor
Warner LambertUnknown cancer (b)Unknown cancer (b)Cancer
Bristol Myers SquibInhibitor farnesyltransferase RASInhibitor farnesyltransferase RASCancer

NovartisMMI 270MMI 270Cancer
BayerBAY 12-9566BAY 12-9566Cancer
MerckInhibitor farnesyltransferaseInhibitor farnesyltransferaseCancer (solid tumor of the pancreas, colon, lung, breast)
PfizerPFEMMDCancer, angiogenesis
PfizerPFETyrosinekinaseCancer, angiogenesis
LillyMTA/L 231514 MTA/LY 231514Cancer solid tumor
LillyLY 264618/lometrexolLometrexolCancer solid tumor
ScotiaGlomalesLiGLA (Li-gamma linolenic)Cancer pancreatic, breast, colon
Warner LambertCI-994CI-994Cancer, solid tumor/leukemia
Schering AGAngiogenesis inhibitorAngiogenesis inhibitorCancer/heart
TakedaTNP-470Not Izv.Malignant tumor
Smithkline BeechamHycamtinTopotecanMetastatic ovarian cancer

NovartisPCK 412PCK 412Cancer, resistant to many medications
NovartisValspodarPSC 833Myeloid leukemia/cancer ovarian
ImmunexNovantroneMitoxantroneThe pain associated with resistant to the hormone prostate cancer
Warner LambertMetartSur AminProstate cancer
Genentech Anti-VEGFAnti-VEGFProstate cancer/ breast cancer, colorectal cancer/ cancer NSCL
British BiotechBatimastatBatimastat (W)Parigi
EisaiE 7070E 7070Solid tumor
Biochem PharmaVSN-4556VSN-4556Solid tumor
SankyoCS-682CS-682Solid tumor
AgouronAG2037AG2037Solid tumor
IDEC Pharma9-AC9-ACSolid tumor

AgouronInhibitors VEGF/b-FGFInhibitors VEGF/b-FGFSolid tumor
AgouronAG3340AG3340Solid tumor/macular finally.
VertexIntelVX-710Solid tumor - IV
VertexVX-853VX-853Solid tumor - oral
ZenecaZD 0101 (inj)ZD 0101Solid tumor
NovartisISI 641ISI 641Solid tumor
Novartis ODN 698ODN 698Solid tumor
Tanube SeiyakuTHAT 2516MarimastatSolid tumor
British BiotechMarimastatMarimastat(BB-2516)Solid tumor
CelltechCDP 845The inhibitor arakaneseSolid tumor/breast cancer
ChiroscienceD2163D2163Solid tumor/metastases
Warner LambertPD-183805PD-183805 
DaiichiDX8951fDX8951fCancer
DaiichiLemonal DP 2202Lemonal DP 2202Cancer

FujisawaFK 317FK 317Anticancer antibiotic
ChugaiPicibanilOK-432Against malignant tumors
Nycomed AmershamAD 32/valrubicinvalrubicinBladder cancer - resistant in situ carcinoma
Nycomed AmershamMetastronDerived strontiumBone cancer (adjuvant therapy, pain)
TemodalTemozolomideBrain tumor
Schering PloughTemodalTemozolomideBrain tumor
LiposomeMazetDoxorubicin, liposomalBreast cancer
Nycomed AmershamTaxanPaclitaxelBreast cancer late-stage, late stage ovarian cancer
Brisyol Myers SquibTaxolPaclitaxelBreast cancer late-stage, late stage ovarian cancer, NSCLC
RocheXelodaCapecitabineBreast cancer

   colorectal cancer
RocheFurtulonDoxifluridineBreast cancer, colorectal cancer, stomach cancer
Pharmacia & Upj ohnAdriamycinDoxorubicinBreast cancer, leukemia
IvaxCyclopacPaclitaxel oralBreast cancer/ovarian
Rhone PoulencOral taxoidPeror the local taxoid A wide range of cancers
AHPNovantroneMitoxantroneCancer
SequusSPI-077Cisplatin, secretiveCancer
HoechstHMR 1275FlavopiridolCancer
PfizerCP-358,774EGFRCancer
PfizerCF-609,754Inhibitor of RAS oncogeneCancer
Brisyol Myers SquibBMS-182751Oral platinumCancer (lung, ovarian)

Brisyol Myers SquibUTF (tegafur/uracil)UTF (tegafur/uracil)Cancer oral
Johnson & JohnsonErgamisolLevamisolCancer therapy
Glaxo 11 We comeEniluracil/S5FU enhancerCancer, sustainable solid and colorectal cancer
Johnson & JohnsonErgamisolLevamisolColon cancer
Rhone PoulencCamptoIrinotecanColorectal cancer, cervical cancer
Pharmacia &Up JohnCamptosarIrinotecanThe color is orbital cancer, cervical cancer
ZenecaThat deckRaltitrexedColorectal cancer, lung cancer, breast cancer
Johnson & JohnsonLeptinCladribineHairy cell leukemia (leukemic retikulez)
IvaxPaxenPaclitaxelKaposi's sarcoma

SequusDoxilDoxorubicin, liposomalKS/cancer
SequusThe rear sightDoxorubicin, liposomalKS/cancer
Sobering AGFludaraFludarabineLeukemia
Pharmacia &Up JohnFarmorubicinEpirubicinLung cancer/breast cancer
ChironDepositDepositNeoplastic meningitis
ZenecaZD1839ZD1839Non-small cell lung cancer, pancreatic cancer
BASFLU 79553Bis-naphtalimideOncology.
BASFLU 103793DolastatinOncology
Schering PloughZetex Doxorubicin-liposomeOvarian cancer/breast cancer
LillyGemzarGemcitabinePancreatic cancer, non-small cell lung cancer, breast cancer, bladder and ovarian cancer

IFEX/mesnex
ZenecaZD 0473/anormedZD 0473/anormedNSCL platinum-based ovarian cancer, etc.
YamanouchiYM 116YM 116Prostate cancer
Nycomed AmershamGrain/1-125 fast StGrains of iodineProstate cancer
AgouronInhibitors of cdk4/cdk2Inhibitors of cdk4/cdk2Solid tumor
AgouronPARP inhibitorsPARP inhibitorsSolid tumor
ChiroscienceD4809TaxifoliaSolid tumor
Brisyol Myers SquibUFT (tegafur/uracil)UFT (tegafur/uracil)Solid tumor
SankyoChristeningChristeningSolid tumor
Asta MedicaIFEX/mesnexIfosamideSolid tumor
Brisyol Myers SquibIfosamideSolid tumor
Brisyol Myers SquibWomanTeniposideSolid tumor
Brisyol Myers SquibParaplatinCarboplatinSolid tumor

Brisyol Myers SquibPlatinolCisplatin, secretiveSolid tumor
Brisyol Myers SquibPlatinolCisplatinSolid tumor
Brisyol Myers SquibVepesidEtoposideSolid tumors, melanoma
ZenecaZD 9331ZD 9331Solid tumors, colorectal cancer late stage
ChugaiTaxotereDocetaxelSolid tumors, breast cancer
Rhone PoulencTaxotereDocetaxelSolid tumors, breast cancer
Glaxo WellcomeThe prodrug guayarminaThe prodrug arabinosideT-cell leukemia/lymphoma and b-cell neoplasm
Brisyol Myers SquibSimilar texanaSimilar texanaEnds of fees the scrap

In one implementation of the methods according to the invention is used immunostimulatory nucleic acids as a replacement therapy with IFNα in the treatment of cancer. Currently, some regimens include the use of IFNα. Because IFNα formed after introducing some of immunostimulatory nucleic acids, these nucleic acids can be applied for endogenous education IFNα.

The invention also includes a method of inducing non-specific in relation to antigen innate immune activation and call the sustainability of a wide range to infections with the use of immunostimulatory nucleic acids. Used herein, the term " non-specific in relation to antigen innate immune activation refers to the activation of immune cells other than b cells, and may, for example, include the activation of NK cells, T cells or other immune cells that can respond regardless of the antigen, or some combination of these cells. The challenge of sustainability to a wide range of infections induced by the fact that immune cells are in the active form and premirovany to answer any incorrect connection or microorganism. Cells should not be specifically premirovany against a specific antigen. This is especially valuable when bio is practical war and other above-described circumstances, such as traveling.

The stimulation index specific immunostimulatory nucleic acid can be determined through various tests with immune cells. Preferably, the stimulation index immunostimulatory nucleic acid in relation to the proliferation of b-cells was equal to at least about 5, preferably at least about 10, more preferably at least about 15, and most preferably at least about 20, when determining the inclusion of3H uridine in a murine b-cells in culture exposed to 20 μm nucleic acid for 20 h at 37°With, then received pulse label 1 µci3H uridine; gathered and used for counting of radioactivity after 4 h, as described in detail in PCT Published patent applications PCT/US 95/01570 (WO 96/02555) and PCT/US 97/19791 (WO 98/18810) priority application U.S. serial Nos. 08/386063 and 08/960774 registered 7 February 1995 and October 30, 1997, respectively. For use in vivo, for example, it is important to immunostimulatory nucleic acids were able to induce an immune response, such as, for example, the formation of antibodies.

Immunostimulatory nucleic acids effective in vertebrates other than rodents. Various immunostimulatory nuclein what s acid can induce an optimal immune stimulation, depending on the subject type and sequence immune-stimulating nucleic acid. It was found that many vertebrates according to the invention is sensitive to the same class of immunostimulatory nucleic acids, sometimes referred to as specific for human immunostimulatory nucleic acid. Rodents, however, respond to other nucleic acids. As shown here, immunostimulirutuyu nucleic acid that causes the optimal stimulation in humans, usually can not induce optimal stimulation in mice, and Vice versa. Immunostimulirutuyu nucleic acid that causes the optimal stimulation in humans, however, often causes the optimal stimulation in other animals, such as cow, horse, sheep and other Specialist in the art can determine the optimal sequence of nucleic acids that are suitable for specific species, using conventional assays described herein and/or known in the art, with the use here of the manual.

Immunostimulatory nucleic acids can be entered directly to a subject or can be entered together with the complex delivery of nucleic acids. Complex delivery of nucleic acids to identify a nucleic acid molecule that is associated (e.g., associated deionno or covalently bound to; or encapsulated within) with the means of the directed delivery (for example, Molek is Oh, providing the binding of cell-target with higher affinity (for example, the surfaces of b-cells) and/or increased capture of target cells). Examples of complexes of delivery of nucleic acids include nucleic acids that are associated with a Sterol (e.g. cholesterol), a lipid (e.g., a cationic lipid, virosome or liposome), or specifically bind to cell-targeted agent (e.g., a ligand recognized by specific receptor target cells). Preferred complexes can be largely stable in vivo to prevent significant decomposition to the internalization of cell-target. However, the complex can be cleaved under suitable conditions in the cell, resulting nucleic acid is released in a functional form.

A delivery means or device delivery of antigen and nucleic acids to surfaces have been described. Immunostimulirutuyu nucleic acid and/or antigen and/or other therapeutic agents can be administered separately (e.g., in saline or buffer) or using any delivery vehicles known in the art. For example, have been described following means of delivery: cochleata (Gould-Fogerite et al., 1994, 1996); aalami (Vancott et al., 1998, Lowell et al., 1997); ISCOMs (Mowat et al., 1993, Carlsson et al., 1991, Hu et., 1998, Morein et al., 1999); liposomes (Childers et al., 1999, Michaiek et l., 1989, 1992, de Haan 1995a, 1995b); live bacterial vectors (e.g., Salmonella, Escherichia coli, Bacillus calmatte-guerin, Shigella, Lacto bacillus) (Hone et al., 1996, Pouwels et al., 1998, Chatfield et al., 1993, Stover et al., 1991, Nugent et al., 1998); live viral vectors (e.g., vaccinia virus, adenovirus. Herpes Simplex) (Gallichan et al., 1993, 1995, Moss et al., 1996, Nugent et al., 1998, Flexner et al., 1988, Morrow et al., 1999); microspheres (Gupta et al., 1998, Jones et al., 1996, Maloy et al., 1994, Moore et al., 1995, O Hagan et al., 1994, Eldridge et al., 1989); vaccine nucleic acid (Fynan et al., 1993, Kukin et al., 1997, Sasaki et al., 1998, Okada et al., 1997, Ishii et al., 1997); polymers (e.g., carboxymethylcellulose, chitosan) (Hamajima et al., 1998, Jabbal-Gill et al., 1998); polymer rings (Wyatt et al., 1998); calpaine (Vancott et al., 1998, Lowell et al., 1988, 1996, 1997); sodium fluoride (Hashi et al., 1998); transgenic plants (Tacket et al., 1998, Mason et al., 1998, Haq et al., 1995); virosome (Gluck et al., 1992, Mengiardi et al., 1995, Cryz et al., 1998); virus-like particles (Jiang et al., 1999, Leibi et al., 1998). In the technique known and other means of delivery, and below in the discussion of vectors are available for more examples.

The term "effective amount of the immunostimulatory nucleic acid" refers to the amount necessary or sufficient to implement the desired biological effect. For example, the effective amount of the immunostimulatory nucleic acid for the induction of mucosal immunity is the number required for the induction of occurrence of IgA in response to antigen after expos the AI with the antigen while the number required for the induction of systemic immunity, represents the amount required to induce the appearance of IgG in response to antigen

after exposure to the antigen. Based on a combination here of instructions, selecting from the various active compounds and weighing factors such as efficacy, bioavailability, patient body weight, severity of adverse side-effects and preferred mode of administration can be planned effective prophylaxis or therapeutic treatment, which does not cause substantial toxicity and at the same time fully effective for treating a particular patient. The effective amount for any particular application can vary depending on such factors as subject to treatment of a disease or condition, subject to the imposition of specific immunostimulirutuyu nucleic acid, antigen, the size of the subject, the severity of the disease or condition. Ordinary specialist in the art can empirically determine the effective amount of the specific immunostimulatory nucleic acid and/or antigen and/or therapeutic agent without undue experimentation.

Doses of the compounds described herein for mucosal or local delivery to a subject is usually the variation is the comfort of approximately from 0.1 μg to 10 mg per introduction, depending on the application, which can be given daily, weekly, or monthly and any other amount of time between injections. More typical mucosal or local doses ranging from about 10 μg to 5 mg per introduction, and most typically

from about 100 μg to 1 mg, with 2-4 introductions, separated from each other for days or weeks. More typical are the doses of stimulant in the range from 1 μg to 10 mg per introduction, and most typically from 10 μg to 1 mg daily or weekly introduction. Doses of the compounds described herein for parenteral delivery to a subject with the purpose of inducing specific antigen immune response when connections are introduced together with the antigen, but without the other therapeutic agent, usually in 5-10000 times higher input effective mucosal dose of vaccine adjuvant or immunostimulant, more typically from 10 to 1000 times higher, and most typically from 20 to 100 times higher. Doses of the compounds described herein for parenteral delivery for the purpose of inducing an innate immune response or for increasing ADCC or for the induction of specific antigen immune response, when the immunostimulatory nucleic acid is administered in combination with other therapeutic agents or special means of delivery, typically vary from about 0.1 mg to 0 mg / introduction, depending on the possibilities daily, weekly or monthly drawing and any other period of time between injections. More typically, when parenteral doses for these purposes range from about 10 μg to 5 mg per introduction, and most typically from about 100 μg to 1 mg, with 2-4 introductions, separated from each other for days or weeks. In some implementations, however, parenteral doses for these purposes can be used in the range from 5 to 10,000 times above normal dose.

For any compounds described herein therapeutically effective amount can be determined on the basis of the original models on animals. A therapeutically effective dose can also be determined on the basis of data received on the person for CpG-oligonucleotides, are tested in humans were initiated clinical trials on humans), and for compounds for which it is known that they possess a similar pharmacological activity, such as mucosal adjuvants, such as LT and other antigens for vaccination purposes, for mucosal or local injection. For parenteral administration require large doses. Enter the dose may be adjusted based on the relative biological availability and effectiveness of the introduced compound. Selection of doses to achieve the max is th efficiency based on the methods described above and other methods, such as well known in the art, in fact, is in the competence of the ordinary skilled specialist.

The compositions of the invention are administered in pharmaceutically acceptable solutions, which typically may contain pharmaceutically acceptable concentrations of salt, sautereau agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients.

For use in therapy, an effective amount of immunostimulatory nucleic acids can be introduced to a subject by any method that provides for the delivery of nucleic acids to the desired surface, such as mucosal, systemic. Introduction the pharmaceutical compositions of the present invention can be carried out by methods known to experienced specialist. Preferred routes of administration include, but are not limited to, oral, parenteral, intramuscular, intranasal, intratracheal, inhalation, ocular, vaginal, and rectal.

For oral administration, the compounds (i.e immunostimulatory nucleic acids, antigens and other therapeutic agents) can be easily prepared by combining the active compounds(compounds) with pharmaceutically acceptable carriers well known in the art. Such media provide the prob is the possibility of making compounds of the invention in the form of tablets, pills, pills, capsules, liquids, gels, syrups, test, suspensions and the like for oral consumption subject to treatment of a subject. Pharmaceutical preparations for oral use can be obtained in the form of a solid filler with optional grinding the resulting mixture and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or content drops. Suitable fillers are, in particular, such fillers as sugars, including lactose, sucrose, mannitol or sorbitol; preparations of cellulose, such as, for example, corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum, methylcellulose, hypromellose, carboxymethylcellulose sodium and/or polyvinylpyrrolidone (PVP). If so desired, can be added loosening agents, such as poperechnyy polyvinylpyrrolidone, agar or alginic acid or their salts, such as sodium alginate. Oral compositions can be optionally prepared in saline or buffers to neutralize acidic internal conditions or can be entered without any media.

The contents of the pills are offered with suitable coatings. For this purpose, can be applied concentrated R. the leaves of sugar, which may not necessarily contain the Arabian gum, talc, polyvinylpyrrolidone, carboloy gel, polyethylene glycol and/or titanium dioxide, solutions glaze and suitable organic solvents or solvent mixtures. To tablets or shell beans can be added dyes or pigments for recognition or to characterize different combinations of doses of active compounds.

Pharmaceutical preparations which can be used orally include adapted to push the capsule made of gelatin, and also soft sealed capsules made of gelatin or plasticizer, such as glycerol or sorbitol. Pushed capsules can contain the active ingredients in a mixture with fillers, such as lactose, binders, such as starches, and/or lubricating agents such as talc or magnesium stearate, and optionally stabilisers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, can be added stabilizers. Can also be applied to the microspheres prepared for oral administration. Such microspheres have been well characterized in the art. All formulations for oral administration must be formah doses, suitable for such an introduction.

For hominids introduction of the composition can be prepared in the form of tablets or pellets, made in the traditional way.

For administration by inhalation the compounds to be used according to the present invention, can be traditionally delivered in the form of an aerosol spray from the package under pressure or nebulizer with the use of a suitable propellant, e.g. DICHLORODIFLUOROMETHANE, trichloromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of an aerosol under pressure, the unit dose can be determined by providing a valve to allocate a certain amount. Capsules and capsules, e.g. of gelatin for use in an inhaler or duvalle can be written in the form of a powder mix of the compound and a suitable powder base, such as lactose or starch.

When the desired systemic delivery of compounds, they can be formulated for parenteral administration by injection, for example bolus injection or continuous infusion. Formulations for injection may be presented in the form of a unit dose, for example in ampoules or containers with multiple doses, with added preservative. The compositions can be presented in the form of suspensions, solutions or emulsio in oil or water is rastvoritelyakh and may contain components agents, such as suspendida, stabilizing and/or dispersing agents.

Pharmaceutical compositions for parenteral administration include aqueous solutions of the active compounds in water-soluble form. In addition, suspensions of the active compounds can be obtained in a form suitable for injection of oil suspensions. Suitable lipophilic solvents or carriers include fatty oils such as sesame oil, or synthetic esters of fatty acids, such as etiloleat or triglycerides, or liposomes. Aqueous suspension for injection may contain substances which increase the viscosity of the suspension, such as carboxymethylcellulose sodium, sorbitol, or dextran. Suspension may also optionally contain suitable stabilizers or agents which increase the solubility of the compounds to ensure that highly concentrated solutions.

In another embodiment, the active compounds can be in powder form for connection with a suitable vehicle, e.g. sterile, free from pyrogen water, before use.

Connections can also be made in rectal or vaginal compositions such as suppositories or held enemas, e.g. containing conventional basis suppositories, such as cocoa butter or other glycerides.

The AOC is e described above compositions the compounds can also be prepared in the form of deposited drug. Such long acting formulations may be prepared using suitable polymeric or hydrophobic materials (for example, as an emulsion in an acceptable oil) or ion exchange resin or membrane not easily soluble derivatives, for example in the form of a membrane not easily soluble salts.

Pharmaceutical compositions may also comprise suitable solid or gel carriers or fillers. Examples of such carriers or excipients include, but are not limited to, calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.

Suitable solid or liquid pharmaceutical forms of the product are, for example, water or saline solution for inhalation, enclosed in microcapsules, coil deposited on microscopic gold particles, contained in liposomes, sprayed in aerosol form, are pills for implantation into the skin or dried to a tack to vasyanya in the skin. The pharmaceutical compositions also include granules, powders, tablets, coated tablet, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds that commonly used excipients and additives and/or auxiliary components, such as razril the teli, binder, covering agents, swelling agents, lubricants, flavors, sweeteners or soljubilizatory, as described above. Pharmaceutical compositions suitable for use in many systems of drug delivery. For a brief overview of methods of drug delivery, see Langer, Science 249: 1527-1533, 1990, an article, which is incorporated herein by reference.

Immunostimulatory nucleic acid and optional other drugs and/or antigens may be introduced as such (in pure form or in the form of pharmaceutically acceptable salts. Used in medicine the salts should be pharmaceutically acceptable, but for their pharmaceutically acceptable salts may be suitable pharmaceutically unacceptable salts. Such salts include, but are not limited to, those derived from the following acids: hydrochloric, Hydrobromic, sulfuric nitric, phosphoric, maleic, acetic, salicylic acid, para-toluenesulfonic acid, tartaric, citric, methansulfonate, formic, malonic, succinic, naphthalene-2-sulfonic acids and benzosulfimide. In addition, these salts can be obtained in the form of salts of alkali or alkaline earth metals, acids.

Suitable buffering agents include: acetic acid and a salt (1-2% wt./about); citric acid and a salt (1-3% wt./about); boric acid and the l (0.5 to 2.5% wt./about); and phosphoric acid and a salt (0.8 to 2% wt./about). Suitable preservatives include benzalkonium chloride (0.003 to 0.03% of wt./about); chlorobutanol (0,3-0,9% wt./about); parabens (0.01 to 0.25 wt./V) and thimerosal (0.004 percent to 0.02% wt./about).

The pharmaceutical compositions according to the invention contain an effective amount of the immunostimulatory nucleic acid and optionally an antigen and/or other therapeutic agents optionally included in a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" means one or more solid or liquid fillers, diluents or encapsulating substances that are suitable for administration to humans or other spinal animal. The term media means organic or inorganic ingredient, natural or synthetic, with which connect the active ingredient to facilitate application. The components of the pharmaceutical compositions can also be mixed with the compounds according to the invention and with each other in such a manner that there is no interaction which would substantially reduce the desired pharmaceutical efficiency.

Suitable in the invention immunostimulatory nucleic acid can be delivered in mixtures with other additional(and) adjuvant(adjuvants), other therapeutic means or antigen(antigens). Compounds which may consist of several adjuvants in addition to immunostimuliruyushhim and nucleic acid or multiple antigen or other therapeutic agents.

For the introduction of suitable many ways. The choice of method should depend, of course, on the particular selected adjuvant or antigen specific condition to be treated, and the dosage required for therapeutic efficacy. The methods of this invention, generally speaking, can be done using any method of administration, which is acceptable from the standpoint of medicine, which means that any method that causes the effective immune response without inducing clinically unacceptable side effects. Preferred methods of administration are discussed above.

The composition can be traditionally presented in a dosage form and may be obtained by any means known in the art of pharmacy. All methods include the stage of introducing the compounds into contact with a carrier that includes one or more accessory ingredients. In General, the composition is produced by uniform and close the introduction connections in communication with a liquid carrier, a finely ground solid carrier or both, followed, if necessary, shaping the product. Liquid unit doses represent the vials or ampoules. Solid unit dose are tablets, capsules or suppositories. For treatment of the patient may require a different dose depending on Akti the particular connection, the method of administration, purpose of immunization (preventive or curative), nature and severity of the disease, age and body weight of the patient. The introduction of this dose can be made both by single administration in the form of an individual unit dose, or as multiple smaller doses. Multiple dose separated by certain intervals of time, the components of weeks or months, it is usual to maintain a specific response to an antigen.

Other delivery system may include a delivery system with a release time, delayed release or permanent release. Such systems may allow the avoidance of repeated introductions connections, increasing convenience to the subject and the physician. Available and known to experts in the art many types of delivery systems with release. These include systems based on polymers, such as poly(lactide-glycolide), topeliuksenkatu, polycaprolactones, polyetherimide, polyarteritis, polyhydroxyalkanoic acid and polyanhydride. Microcapsules of the above polymers containing drugs, is described, for example, in U.S. patent 5075109. Delivery systems also include polimernye systems that are lipids, including sterols such as cholesterol esters cholesterol and fatty acids, and neutral is e fats, such as mono-, di - and triglycerides; hydrogel system release; elastique system; system-based peptides; wax coatings; compressed tablets using conventional binders and excipients; implants with limited solubility; and the like. Specific examples include, but are not limited to, (a) erosional systems in which the agent of the invention contains in the form contained in the matrix, such as described in U.S. patent Nos. 4452775, 4675189 and 5736152, and (b) diffusional systems in which an active component permeates controlled rate from a polymer such as described in U.S. patent Nos. 3854480, 5133974 and 5407686. In addition, can be applied based on the pumps technical delivery systems, some of which are adapted for implantation.

The present invention is further illustrated by the following examples which in no way should be construed as an additional constraint. The full contents of all references (including literature references, published patents, published patent applications and patent application pending), cited in this application is, therefore, clearly included as a reference.

EXAMPLES

Materials and methods:

Oligodeoxynucleotide: natural phosphodieterase and phosphorylate derived ONE was is obtained from the Oregon Technologies (Alameda, CA) and Hybridon Speciality Products (Milford, MA). ONE was tested for endotoxin using the LAL test (LAL-assay BioWhittaker, Walkersville, MD; lower limit of detection of 0.1 EU/ml). For in vitro ODN were dissolved in buffer TE (10 mm Tris, pH 7.0, 1 mm EDTA) and stored at -20°C. To apply in vivo ODN were dissolved in phosphate buffered saline (0.1 M SFR, pH of 7.3) and stored at 4°C. All breeding produced with the use of reagents, devoid of pyrogenic activity.

Selection RVMS human and cell culture:

Mononuclear cells from peripheral blood (RVMS) were isolated from peripheral blood of healthy volunteers by centrifugation in a gradient of Ficoll-Paque (Histopaque-1077, Sigma Chemical Co., St. Louis, MO)as described (Hartmann et al., 1999 Proc. Natl. Acad. Sci USA 96:9305-10). Cells suspended in culture medium RPMI 1640 with the addition of 10% (V/V) V / V heat inactivated (56°S, 1 h) FCS (fetal calf serum) (HyClone, Logan, UT), 1.5 mm L-glutamine, 100 units/ml penicillin and 100 µg/ml streptomycin (all from Gibco BRL, Grand Island, NY) (complete medium). Cells (final concentration 1×106cells/ml) were cultured in complete medium in a humidified CO2incubator at 37°C. as incentives used ODN and LPS (lipopolysaccharide) (from Salmonella typhimurium, Sigma Chemical Co., St. Louis, MO) or anti-IgM. To measure lytic activity of NK (natural killer cells) human RVMS inquire the Ali 5× 106/well in 24-hole plates. The culture was harvested after 24 hours and cells were used as effectors in a standard 4-hour test selection51SG cells against targets C, as described previously (Ballas et al., 1996 J. Immunol. 157:1840-1845). To assess the proliferation of b-cells for 18 hours prior to collection was added 1 µci3H-thymidine, and the number of enabled3H-thymidine was measured using a scintillation account on day 5. The standard deviation in three holes was <5%.

Flow cytometry RVMS person: surface antigens RVMS primates were stained as described previously (Hartmann et al., 1998 J. Pharmacol. Exp. Ther. 285:920-928). Monoclonal antibodies against CD3 (UCHT1), CD14 (ME), CD19 (V), CD56 (V), CD69 (FN50) and CD86 (2331 [FUN-1]) were obtained from Pharmingen, San Diego, CA. To control for nonspecific staining was used IgG1,K(MORSE-21) and IgG2b(Hartmann et al., 1999 Proc. Natl. Acad. Sci USA 96:9305-10). The NK cells were identified by expression of CD56 negative for CD3, CD14 and CD19 cells and b-cells identified by expression of CD19. Data of flow cytometry for 10000 cells per sample were obtained using FACScan (Beckton Dickinson Immunocytometry Systems, San Jose, CA). Cell viability in the selector FSC/SSC used for analysis, estimated using iodide staining propidium (2 μg/ml)was higher than 98%. The results were analyzed using the computer program FlowJo (version 2.5.1, Tree Star, Inc., Stanford, CA).

The results:

Example 1: Dependent upon CpG stimulation In human cells depends on the methylation and the length of ONE

RVMS person received from healthy donors and were cultured for five days at 2×105cells/well with the specified concentrations of the indicated ODN sequences. As shown in table F, the proliferation RVMS person exceeds the basal level under cultivation with many containing CpG ODN, as well as some proliferation even in the presence of ONE, containing no CpG motifs. The importance neetilirovannyj CpG motifs for optimal immune stimulation data ONE demonstrates that ONE 1840 (SEQ ID NO. 83) induces the inclusion 56603 pulse3H-thymidine, while equally enriched T, ONE methylated CpG motifs (CpG), 1979 (SEQ ID NO. 222), induces a smaller, although still greater than the basal level activity (only 18618 pulses) at the same concentration, equal to 0.6 µg/ml). Reduced proliferation at high concentrations ONE may be an artifact of cells depleted under these experimental conditions, or may reflect some cytotoxicity large concentrations of ODN. Interestingly, shorter ODN containing CpG motifs, such as 13 to 14-membered 2015 and 2016, have less stimulating effect, despite the fact that their molar con who entrace was actually higher because ONE was added on a mass basis, not polyarnosti. This suggests that the length of the ODN may be an important determinant in the immune effects of ODN. Non-CpG ODN, with the exception of enriched T ONE (approximately 30% T) 1982 (SEQ ID NO. 225), caused only a slight increase in proliferation of cells above the basal level.

Table F
The concentration of the oligonucleotide
ODN#0.15 ug/ml0.6 ág/ml2 mcg/ml
The basal level of the signal648837799
1840 (SEQ ID NO. 83)57445660331787
2016 (SEQ ID NO. 256)768460720497
1979 (SEQ ID NO. 222)9711861829246
1892 (SEQ ID NO. 135)7871007822850
2010 (SEQ ID NO. 250)849207418054
2012 (SEQ ID NO. 252)25866295552462
2013 (SEQ ID NO. 253)10434796047231
2014 (SEQ ID NO. 254)27005070846625
2015 (SEQ ID NO. 255) 10592323936119

The numbers represent the number of pulses/min includeCH-thymidine for crops RVMS man, which led, as described above.

Example 2. Dependent on the concentration stimulation of NK activity of human cells enriched thymidine ONE

PBMCs person were cultured for 24 hours with a number of different CpG and non-G-ONE in two concentrations, and then tested on their ability to cause the death of target cells to NK, as described previously (Ballas et al., 1996

J. Iminunol. 157:1840-1845). Loss expressed in units of lysis or L.U. FROM the donor used in this experiment, the basal level was 3,69 L.U., which was increased to 180,36 L.U. when applying a positive control, IL-2. CpG-oligonucleotide 2006 (SEQ ID NO. 246) induced the highest increase lizinoj functions NK at low concentrations, equal to 0.6, and to a lesser extent at a concentration of 6.0. It was unexpectedly found that enriched T ONE in which the CpG motifs 2006 were methylated (ODN 2117 (SEQ ID NO. 358) or converted to GpC (ODN 2137 (SEQ ID NO. 886)), retains a strong immunostimulirutuyu function at higher concentrations of ODN, as shown in table G. the Data is dependent on the concentration of immune-boosting effects are not common property phosphorotioate frame, as described below, experiments show that poly-AND one which does not cause stimulation, greater than the basal level. Some stimulation is observed with ONE long 24 grounds in which all provisions of the grounds randomized so that a, C, G and T are frequency of 25% in each of the positions of the bases (ONE 2182 (SEQ ID NO. 432)). However, the stimulatory effect of such 24-membered ODN significantly increased if it is pure poly-T, and in the latter case, the stimulation is also observed at the lowest concentration of 0.6 μg/ml (ONE 2183 (SEQ ID NO. 433)). Indeed, stimulating the activity of ODN SEQ ID NO. 433 with such a low concentration is higher than the activity of any ONE tested at this low concentration, excluding optimal in relation to human immune-stimulating ODN SEQ ID NO. 246. Indeed, at higher concentrations of ODN SEQ ID NO. 433 stimulated greater activity of NK than any other phosphorotioate ONE, except for strong CpG-ODN 2142 (SEQ ID NO. 890), whose activity was slightly higher. If the content of G-ODN SEQ ID NO. 246 increases relative to T by introducing additional G, this leads to a decrease immunostimulating action ONE, the corresponding decline in the share of T-nucleotides (see ARF 2132 (SEQ ID NO. 373)). Thus, the content of T in ONE is an important determinant immunostimulating action. Although from a non-CDs-ONE poly-TOWN is the most powerful stimulant, other reasons are also important for immunostimulating action He-CpG-ODN. ONE 2131 (SEQ ID NO. 372), in which slightly more than half of the bases represented by T and in which there are no G, is immune stimulator at a concentration of 6 µg/ml, but its activity is much lower than the activity of enriched T ONE. If you replace 6 in ONE 2131 (SEQ ID NO. 372) 6 G, immunostimulating effect ONE may increase (see ARF 2130 (SEQ ID NO. 371)).

23.79
Table G
PBL man, cultured overnight with oligonucleotide -
MR3605      
SR256      
%SR7.11      
The EFFECTOR0.631.252.505.0010.0020.00 
CONTROL [RM]     L.U.
NO ADDITIVES2.655.4510.1517.6529.9239.983.69
+ IL2(100 units/ml)35.9557.6686.26100.3999.7193,64180.36
+ 1585(0.6 MNG/ml)3.756.1012.1423.7036.0643.985.48
+ 1585(6.0 µg/ml)15.4231.0947.0773.3494.2997.7335.85
+ 2006(0.6 µg/ml)6.7115.9926.9244.7564.1268.8316.96
+ 2006 (6.0 µg/ml)6.198.1816.1324.35At 39.3556.078.04
+ 2117(0.6 µg/ml)4.544.739.5618.0428.5739.853.49
+ 2117(6.0 µg/ml)7.0310.7616.9030.5952.1459.4610.96
+ 2137(0.6 µg/ml)4.615.3510.0415.1637.862.57
+ 2137(6.0 µg/ml)7.9910.3716.5532.3249.7860.3011.01
+ 2178(0.6 µg/ml)2.884.5211.4716.05At 24.8534.272.37
+ 2178(6.0 µg/ml)4.215.0311.1616.3928.22At 36.452.94
+ 2182(0.6 µg/ml)2.426.5710.4919.7326.5535.302.89
+ 2182(6.0 µg/ml)4.117.9814.6026.5640.4051.987.59

+ 2183 (0.6 µg/ml)3.738.4615.52At 24.4837.7856.777.80
+ 2183(0.6 µg/ml)8.8612.8923.0841.4966.2675.8516.57
+ 2140(0.6 µg/ml)3.785.2712.3020.7935.7545.625.40
+ 2140(6.0 μg/ml)/td> 6.5613.2421.26At 37.9660.80At 73.0514.82
+ 2141 (0.6 µg/ml)2.636.3410.2117.73At 30.93At 43.574.29
+ 2141 (6.0 µg/ml)4.9815.30At 25.2237.8858.4769.1214.83
+ 2142(0.6 μg/ml) + 2142(6.0 µg/ml)3.18 7.083.66 15.806.99 25.6514.62 41.7219.68 68.0932.52 73.141.56 17.11
+ 2143 (0.6 µg/ml)4.126.9010.77At 22.96At 35.7842.945.19
+ 2143 (6.0 µg/ml)3.168.4012.3821.6934.8054.216.64
+ 2159(6.0 µg/ml)5.0511.7621.6741.12At 51.6865.4713.19
+ 2132(6.0 µg/ml)4.236.0610.5018.7432.6844.064.61
+ 2179(6.0 µg/ml)6.149.4921.0642.4860.12 71.8714.54
+ 2180(6.0 µg/ml)2.378.5715.4429.6644.3561.319.47
+ 2133 (6.0 µg/ml)6.5312.5823.1038.0361.1668.3614.62
+ 2134(6.0 µg/ml)7.5112.1421.1432.46At 54.4767.1212.98
+ 2184(6.0 µg/ml)5.229.19Is at 17.5430.7645.3563.5510.42
+ 2185(6.0 µg/ml)8.1114.77At 26.2740.3155.6170.6515.60
+ 2116(6.0 µg/ml)5.5810.5416.7737.8259.80At 66.3313.07
+ 2181 (6.0 µg/ml)4.439.8517.5527.0553.1669.1611.43
+ 2130 (6.0 µg/ml)3.818.0717.1127.1742.0453.738.27

+ 2131 (6.0 2.296.737.3018.0232.7349.065.08
µg/ml)       
4 - 2156(0.32.505.268.2015.95At 26.6433.072.31
µg/ml)       
+ 2156(1.05.9110.9917.3126.9750.6463.7810.84
µg/ml)       
+ 2157 (0.32.364.006.6512.9424.1338.862.58
µg/ml)       
+ 2157(1.03.729.5517.1534.5552.2765.3311.58
µg/ml)        
+ 2158 (0.31.252.366.9016.3915.6329.821.17
µg/ml)       
+ 2158(1.04.737.2611.0715.5530.80At 43.714.16
µg/ml)       
+ 2118(0.61.553.386.8513.3620.1527.711.13
µg/ml)       
+ 2118(6.02.653.889.2912.19At 22.4728.991.34
µg/ml)       

Example 3: nuccia proliferation of b-cells enriched T non-CDs-ONE.

To assess the ability of enriched T ODN to activate the proliferation of b-cells RVMS man stained with the dye cytoplasm CSFE, incubated for five days with the indicated ODN at a concentration of 0.15 or 0.3 μg/ml and then analyzed using flow cytometry. B cells were identified by selection of cells positive in relation to the marker line CD19. CpG-ODN 2006 was a strong inducer of proliferation of b-cells, and this effect was reduced when methylation of CpG motifs or their treatment in the GpC, as shown in figures 1A, b, C and D at a concentration of ODN 0.3 ág/ml of the Composition of ONE reason, apparently, important to determine the immunostimulating action. The decrease in the content of T in ONE significantly reduces the immunostimulatory effects, as illustrated by the example of ONE 2177 (SEQ ID NO. 427), in which 6 T available in ODN 2137 (SEQ ID NO. 886), were replaced with A, resulting in immunostimulating effect was significantly reduced. The importance of T for immunostimulating action ONE is also evident when comparing ONE 2116 (SEQ ID NO. 357) and ONE 2181 (SEQ ID NO. 431), which differ at the 3’-end of the ODN. ONE 2181, in which the 3’-end is a poly-T, is a stronger stimulant than ONE 2116, in which the 3’-end is a poly-C, despite the fact that both contain ONE TCGTCG at the 5’-end.

Example 4: the Proliferation of b-cells, the Indus is carovana oligonucleotide-TG

The stimulating effect of the TG motifs are shown in figure 2. ODN 2137 possesses identical with ODN 2006 the composition of the bases, but the CG motifs were inverted in GC, which gave not contain CG nucleic acid. However, ONE contains 6-TG dinucleotides. In ONE 2177 all TG dinucleotides ODN 2137 were replaced by AG. Although ONE 2177 contains only 6 adenine, he almost never has a stimulating action at a concentration of 0.2 µg/ml For comparison ONE length 24 of the base, in which each position is randomized with respect to any of the four bases (ONE 2182) induces the proliferation of >12% In cells at a concentration of 0.2 μg/ml these results indicate that the stimulatory effects of ODN 2137 are not simply effects phosphorotioate frame and associated with the presence of TG dinucleotides.

In order to determine the influence of changes in the number of dinucleotide motifs TG, compared ONE 2200 and ONE 2202, as shown in figure 2. Both contain ONE 18 T 6 G, but in ONE 2200 all G arranged in series, so that there is only one dinucleotide TG, whereas in ONE 2202 G separated in the form of GG dinucleotides around ONE, the result of which has three dinucleotide TG. ONE 2202 has a much more stimulating effect compared with ONE 2200, which corresponds to the model, according to which the optimal stimulating activity necessary for men is our least three TG motif in ONE. Probably an even greater level of stimulation could be obtained if the motives TG were optimized so as teach here.

Example 5: Comparison of the actions of TTG and motives TTG.

The figure 3 shows the results of experiments conducted to examine the relation between the content of TG in terms of the relationship of level T to level G and a stimulating ONE. The figure shows that ONE in which all bases randomized between T and G (ONE 2188 (SEQ ID NO. 905)), not stimulating action at a concentration of 0.2 μg/ml, as ONE in which all bases randomized between a and G (ONE 2189 (SEQ ID NO. 906)). However, at higher concentrations of 2 μg/ml, randomized T/G ONE 2188 has a much more stimulating effect. The stimulation level of the latter is still lower than that which occurs with completely randomized ODN (ODN 2182 (SEQ ID NO. 432)). The greatest stimulation at low concentrations is observed with ONE in which half of the bases are fixed as T, and the other half of the reason is randomized between T and G (ONE 2190 (SEQ ID NO. 907)). Because each second base is fixed as T, no motives TG can not arise. The data of figure 3 show that the increase in the content of TG in ONE improves stimulating activity.

In other experiments, the results are not presented here in the form of the Rafikov, ONE 2190 (SEQ ID NO. 907) showed stimulatory NK activity, comparable to that ONE 2188 (SEQ ID NO.905) or ONE 2189 (SEQ ID NO.906).

Examples 6-8

Introduction:

Above, the applicants have shown that the sequence of poly-T is capable of enhancing the stimulation of b - and NK-cells. Here, the applicants examined the influence of many non-CpG-enriched T ODN and poly-ODN in terms of their ability to stimulate b-cells, NK-cells and monocytes.

Materials and methods:

Oligonucleotides: Modified phosphorotioate ODN were obtained from the ARK Scientific GmbH (Darmstadt, Germany). Applied sequence: 1982: 5’-tccaggacttctctcaggtt-3’ (SEQ ID NO.: 225), 2006: 5’-tcgtcgttttgtcgttttgtcgtt-3’ (SEQ ID NO.: 246), 2041: 5’-ctggtctttctggtttttttctgg-3’ (SEQ ID NO.: 282), 2117: 5’-tzgtzgttttgtgtzgttttgtzgtt-3’ (SEQ ID

NO.: 358), 2137: 5’-tgctgcttttgtgcttttgtgctt-3’ (SEQ ID NO.: 886), 2183: 5’-ttttttttttttttttttttt-3’ (SEQ ID NO.: 433), 2194: 5’-ttttttttttttttttttttttttttt-3’ (SEQ ID NO.: 911), 2196: 5’-tttttttttttttttttt-3’ (SEQ ID NO.: 913), 5126: 5’-ggttcttttggtccttgtct-3’ (SEQ ID NO.: 1058), 5162: 5’-tttttttttttttttttttttttttttttt-3’ (SEQ ID NO.: 1094), 5163: 5’-aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa-3’ (SEQ ID NO.: 1095), 5168: 5’-cccccccccccccccccccccccccccccc-3’ (SEQ ID NO.: 1096) and 5169: 5’-cgcgcgcgcgcgcgcgcgcgcgcgcgcgcg-3’ (SEQ ID NO.: 1097). Most ODN were tested for LPS content analysis LAL (BioWhittaker, Belgium) (lower limit of detection of 0.1 EU/ml), as described here. For all analyses ODN were dissolved in THE buffer and kept at -20°C. All cultivation was carried out using the deprived pyrogen reagents.

Cell proliferation and glue the internal culture: RVMS person was isolated from peripheral blood of healthy volunteers, received the German Red Cross (Ratingen, Germany)as described in example 1, but all materials were obtained from Life Technologies, Germany, and were tested for endotoxin. To analyze the activation of b-cells, NK-cells and monocytes, RVMS were cultured in complete medium at a concentration of 2×106cells/ml in 200 μl in 96-well round-bottom tablets in a humidified incubator at 37°C. as incentives were added various ODN, LPS (Sigma) or IL-2 (R&D Systems, USA). At the indicated time points cells were collected for flow cytometry.

Flow cytometry: for staining of surface antigens was used MAbs against CD3, CD14, CD19, CD56, CD69, CD80 and CD86 (all obtained from Pharmingen/Becton Dickinson, Germany). In the case of monocyte Fc receptors were blocked with human IgG (Myltenyi, Germany)as described previously (Bauer, M et al 1999 Immunology 97:699). The results of flow cytometry for at least 1000 cells specified populations (b cells, monocytes, NK cells, NKT-cells or T-cells) were obtained using FACSCalibur (Becton Dickinson). Data were analyzed using the CellQuest program (Becton Dickinson).

Mediated NK cytotoxicity: RVMS were cultured overnight in the absence or in the presence of 6 μg/ml ODN or 100 units/ml IL-2 at 37°C, 5% CO2. The next morning, the target cells K-562 were labeled with a fluorescent dye CFSE as previously described for human cells (Hartmann, G., and A. M. Krieg. 000 J. Immunol. 164:944). RVMS were added in different ratios (50:1, 25:1 and 12.5:1) to 2×105target cells and incubated for 4 h at 37°C. the Cells were collected and incubated with specific DNA dye 7-AAD (Pharmingen) to identify apoptotic cells. The results were measured using flow cytometry.

TIFA: RVMS (3×106cells/ml) were cultured with the indicated concentrations of ODN or LPS for 24 h (IL-6, IFNγ and TNFα) or 8 hours (IL-1β) in 48-hole tablets in a humidified atmosphere at 37°C. Collected supernatant, and cytokines were measured using OPTeia kits TYPHOID (Pharmingen) for IL-6, IFNγ and TNFαor Eli-pair TYPHOID (Hoelzel, Germany) for IL-1β in accordance with the protocols of the manufacturer.

Example 6: activation of b-cells, induced ONE, not containing CpG motifs.

In the above-described experiments of example 3, the applicants have demonstrated that an enriched T ONE is able to activate b cells. Here these experiments have been extended with additional ONE and different sources of cells and reagents. In the first series of experiments, applicants compared the activating potential of various non-CpG-enriched T, ONE known for a very strong CpG ODN 2006 (SEQ ID NO.: 246). RVMS (2×106cells/ml) blood donor (n=2) were incubated with indicated concentrations of ODN 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 58), 2137 (SEQ ID NO.: 886), 5126 (SEQ ID NO.: 1058) and 5162 (SEQ ID NO.: 1094). Cells were incubated for 48 hours at 37°Since, as described above, and were stained with mAb against CD19 (marker of b-cells) and CD86 (token activation of b-cells, B7-2). Expression was measured using flow cytometry.

Applying different concentrations of ODN, the inventors have shown (figure 4), which is enriched T ONE, not containing CpG motif, can induce stimulation In human cells. ONE 5126 (SEQ ID NO.: 1058), which contains only one sequence poly-T, but in which the content of T above 50%, caused a high level of activation In human cells. Although this ONE has some similarity with SEQ ID NO.: 246

(for example, more than 80% of the content of the T/G), it just does not contain any of the known immunostimulatory CpG motifs. It was unexpectedly found that for all tested enriched T ONE the greatest rate of stimulation is detected at concentrations between 3 and 10 µg/ml Of the tested ONE of the greatest stimulation index was achieved with CpG/-enriched T ODN SEQ ID NO.: 246 at 0.4 µg/ml Interestingly, the activity decreased at high concentrations.

Were synthesized and tested for biological activity sequence poly-A, poly-C and poly-So RVMS (2×106cells/ml) from one typical donor (n=3) were stimulated as described above, and 0.4 μg/ml, 1.0 μg/ml or 10.0 μg/ml following ONE: 200 (SEQ ID NO.: 246), 2196 (SEQ ID NO.: 913) (poly-T, 18 bases), 2194 (SEQ ID NO.: 911) (poly-T, 27 bases), 5162 (SEQ ID NO.: 1094) (poly-T, 30 bases), 5163 (SEQ ID NO.: 1095) (poly-A, 30 bases), 5168 (SEQ ID NO.: 1096) (poly-C, 30 bases) and 5169 (SEQ ID NO.: 1097) (poly-CG, 30 bases). The expression of the activation marker CD86 (B7-2) on CD19-positive b cells was measured by flow cytometry.

Figure 5 shows that the length of the sequence of at least ONE poly-T makes a significant contribution to their activity. The sequence of the poly-T containing only 18 bases (SEQ ID NO.: 913), as shown, has a lower stimulatory effect compared with the sequence of the 27 bases (SEQ ID NO.: 911) or 30 bases (SEQ ID NO.: 1094) with a clear ranking of stimulation; SEQ ID NO.: 1094> SEQ ID NO.: 911> SEQ ID NO.: 913. Sequence poly-A (SEQ ID NO.: 1095) or poly-CG (SEQ ID NO.: 1097), in contrast, do not induce activation of human cells. Unexpectedly, it was also discovered that the sequence of poly-C (SEQ ID NO.: 1096) can be activated In human cells at high concentrations (10 μg/ml) (figure 5).

Two other enriched T ONE, namely, 1982 (SEQ ID NO.: 225) and 2041 (SEQ ID NO.: 282)that do not contain CpG motifs were tested for their effect on In-human cells. RVMS (n=2) were incubated with indicated concentrations of ODN 2006 (SEQ ID NO.: 246), 1982 (SEQ ID NO.: 225) and 2041 (SEQ ID NO.: 282), as described above. Activation of b-cells (the expression of the activation marker CD86) was measured proton the th cytometry.

Figure 6 demonstrated that the enriched T non-CpG ODN are Immunostimulants at concentrations above 1 µg/ml. the Inclusion of CpG motif in 1982 increased immunostimulirutuyu activity. Lengthening using poly-T did not increase immunostimulirutuyu activity of this already enriched T ONE, and, on the contrary, slightly reduced the activating potential.

Example 7: Immunostimulation non-CpG ODN is reflected in the increased activation of NK, NK cytotoxicity and activation of monocytes

NK-cells and monocytes were tested for their response to non-CpG ODN. RVMS (2x106cells/ml) were incubated with 6 μg/ml following ODN (n=4): 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 2183 (SEQ ID NO.: 433), 2194 (SEQ ID NO.: 911) and 5126 (SEQ ID NO.: 1058). After 24 hours of cultivation at 37°the cells were collected and stained with mAb against CD3 (a marker of T cells), CD56 (marker of NK-cells) and CD69 (early marker of activation)as described above. The expression of CD69 on CD56-positive NK cells was measured by flow cytometry.

7 shows that for poly-T can be obtained effects similar to those described in figure 5. Stimulation of NK-cells and b-cells, can influence the length of the ODN. The measurement results increased expression of the early marker CD69 activation, ONE 2183 (SEQ ID NO.: 433) (21) induced activation of NK-cells, but to a lesser extent than the longer ONE 2194 (SEQ ID NO.: 911) (27 bases). ONE 5126 (SEQ ID NO.: 105), as has been shown, also activates NK-cells (Fig.7).

I think that the antitumor activity of CpG ODN can be assessed by the ability of ARF to raise mediated NK cytotoxicity in vitro. It was shown that ONE containing the 5’- and 3’-ends of the sections of the poly-G, cause the greatest induction of cytotoxicity (Ballas, Z. K., et al. 1996 J. Immunol. 157:1840). To investigate the impact of non-CpG-enriched T ONE on the cytotoxicity of NK, applicants analyzed the effect of ONE 2194 (SEQ ID NO.: 911) and 5126 (SEQ ID NO.: 1058) mediated NK lysis (Fig). Mediated NK lysis of target cells K-562 was measured after incubation over night RVMS with 6 μg/ml ODN 2006 (SEQ ID NO.: 246), SEQ ID NO.: 911 (SEQ ID NO.: 911) (poly-T, 27 bases) and 5126 (SEQ ID NO.: 1058), as described above. SEQ ID NO.: 1058 caused a small increase in lysis under the action of NK cells compared with that observed in the absence of ODN. SEQ ID NO.: 911 and SEQ ID NO.: 246 increased the cytotoxicity of NK-cells even more.

In previous reports it was shown that not only NK cells, and NKT cells serve as conductors of cytotoxic responses to tumor cells (14). Therefore, applicants examined the increased activation of NKT-cells of a person under the influence of enriched T, non-CpG ODN. RUMS from one typical donor (n=2) were incubated with 6 μg/ml ODN 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 2183 (SEQ ID NO.: 433), 2194 (SEQ ID NO.: 913) and 5126 (SEQ ID NO.: 1058) in those who tell 24 hour as explained above. Activation of NKT cells was measured by flow cytometry after staining cells mAb against CD3 (a marker of T cells), CD56 (marker of NK-cells) and CD69 (early marker of activation). Readings represent the expression of CD69 on CD3 and CD 56-double-positive cells (NKT cells).

As shown in figure 9, SEQ ID NO.: 911 as SEQ ID NO.: 1058 stimulated NKT cells. As in the case of NK cells, SEQ ID NO.: 911 (poly-T) was more active than SEQ ID NO.1058.

In addition, as described above for b-cells and NK-cells, the length of ONE has an effect on immune-stimulating potential, and the longer ONE has a much stronger effect on NKT cells. Similar results were observed for T-cells.

Another type of immune system cells involved in fighting infections, are monocytes. These cells after activation secrete many cytokines and can develop into dendritic cells (DC), specializing as antigen-presenting cells (Roitt, I., J. Brostoff, and D. Male. 1998. Immunology. Mosby, London). Figure 10 shows the activation of human monocytes after cultivation RUMS with a different ONE. RVMS (2x106cells/ml) were incubated with 6 μg/ml 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO 30.: 886), 2178 (SEQ ID N0.:1096), 2183 (SEQ ID NO.: 433), 2194 (SEQ ID NO.: 911), 5126 (SEQ ID NO.: 1058) and 5163 (SEQ ID NO.: 1095) over night at 37°Since, as described above (n=3). The cells were collected and okras the Wali on CD14 (a marker of monocytes) and CD80 (B7-1, the activation token). Expression was measured by flow cytometry.

As in the above cases of NK - and b-cells, enriched T-sequence (e.g. SEQ ID NO.: 433, SEQ ID NO.: 911) of different length, induce stimulation of monocytes, but have different levels of activity, for example, SEQ ID NO.: 433> SEQ ID NO.: 911. Sequence poly-A (SEQ ID NO.: 1095), and poly-C (SEQ ID NO.: 1096 (2178), in contrast, did not cause activation of monocytes as measured by stimulation of CD80 at a concentration of ODN 6 µg/ml).

Example 8: Induction allocation of cytokines under the action of non-CpG ODN

Then tested the ability of various enriched T ONE to influence the cytokine environment. RVMS (3×106cells/ml) were cultured for 24 h in the absence or in the presence of 6 μg/ml of the indicated ODN or 1 μg/ml LPS as a positive control (n=2). After incubation collected supernatant, and TNFα was measured with TYPHUS, as described above, and the results are shown figure 11. RVMS were cultured with the indicated ODN (1.0 microgram/ml), as described in 11, and IL-6 were measured in supernatant with TYPHUS, as described above, and the results are shown in Fig.

Figure 11 and 12 shows that the enriched T, non-CpG and enriched T/CpG ODN can induce the secretion of Pro-inflammatory cytokines TNFα and IL-6. In most analyses, it was found that for both cytokines ONE 5126 (SEQ ID NO.: 1058) which is equally effective, as ONE 2194 (SEQ ID NO.: 911). It is known that CpG ODN affect the ratio of Th1/Th2 due to the preferential induction of Th1 cytokines (Krieg, A. M. 1999 Biochemica et Biophysica Acta 93321:1). To determine cause of enriched T ONE similar shift towards Th1 cytokines were measured products RVMS IFNγ. In the first series of experiments it was shown that, as in the cases described for IL-6 and TNFα, ODN SEQ ID NO.: 1058 and SEQ ID NO.: 911 induce selection of similar quantities of this Th1 cytokine IFNγ. In addition, it was shown that another proinflammatory cytokine, IL-1βis emitted during the cultivation RVMS with these two ONE. Although the number of these cytokines induced by enriched T ONE, not containing CpG motifs, was lower than when using CpG ODN SEQ ID NO.: 246 induced enriched T ONE number were significantly higher than in control.

Examples 9-11

Introduction:

Here we describe the CpG motif that is optimal for activation of the immune system in vertebrates other than rodents. It was found that fosfodiesterzy oligonucleotide containing this motif, strongly stimulates the expression of CD86, CD40, CD54 and MHC II synthesis of IL-6 and proliferation of primary b-cells. These effects required the internalization of the oligonucleotide and the maturation of the endosome. This CpG motif is associated with prolonged induction of heterodimer NFkB P50/P65 and protein-1,activating the complex of transcription factors (AP-1). Activation of transcription factors under the action of CpG-DNA is preceded by increased phosphorylation of stress kinase c-jun, NH2terminal kinase (JNK) and R and activating transcription factor-2 (ATF-2). In contrast to CpG signaling through the receptor In cells leads to activation of the kinase extracellular receptor (ERK) and the phosphorylation of different isoforms of JNK.

Materials and methods:

Oligonucleotides: unmodified (phosphodieterase, D) and modified, resistant to nucleases (phosphorotioate, PS) ODN were obtained from Operon Technologies (Alameda, CA) and Hybridon Specialty Products (Milford, MA). Applied sequence presented in table N. DNA of E. coli and the DNA of calf thymus obtained from Sigma Chemical Co., St. Louis, MO. Samples of genomic DNA was purified by extraction with a mixture of phenol-chloroform-isoamyl alcohol (25/24/1) and precipitation with ethanol. DNA was purified from endotoxin by repeated extraction with Triton X-114 (Sigma Chemical Co., St. Louis, MO) and were tested for endotoxin using analysis LAL (LAL-assay BioWhittaker, Walkersville, MD; lower limit of detection of 0.1 EU/ml) and high-sensitivity analysis of endotoxin described earlier (lower limit of detection 0,0014 EU/ml) (Hartmann G., and Krieg, A. M. 1999. CpG DNA and LPS induce distinct patterns of activation in human monocytes. Gene Therapy 6:893). The content of endotoxin in DNA samples was below 0,0014 IU/ml E. coli DNA and calf thymus before application was made single-stranded by boiling for 10 minutes posleduyushim cooled on ice for 5 minutes. DNA samples were diluted in buffer THOSE using deprived of pyrogen reagents.

Obtaining cells and cell culture: mononuclear cells of peripheral blood (RVMS) were isolated from peripheral blood of healthy volunteers by centrifugation in density gradient Ficoll-Paque (Histopaque-1077, Sigma Chemical Co., St. Louis, MO)as described (Hartmann G., et al 1996 Antisense Nucleic Acid Drug Dev 6:291)). Cells suspended in culture medium RPMI 1640 with the addition of 10% (V/V) V / V heat inactivated (56°S, 1 h) FCS (HyClone, Logan, UT), 1.5 mm L-glutamine, 100 U/ml penicillin and 100 µg/ml streptomycin (all from Gibco BRL, Grand Island, NY) (complete medium). All connections have been checked for endotoxin. Viability was determined before and after incubation with ONE exception Trypanosoma blue (traditional microscopy) or exclusion of propidium iodide (analysis flow cytometry). In all experiments, from 96% to 99% RVMS were viable. Cells (final concentration 1×106cells/ml) were cultured in complete medium in 5% CO2in a humidified incubator at 37°C. as incentives used different oligonucleotides (see table I, at concentrations indicated in the legends to the figures), LPS (from salmonella typhimurium, Sigma Chemical Co., St. Louis, MO) or anti-IgM. To block endosomal maturation/acidification when anjali chloroquin (5 μg/ml; Sigma Chemical Co., St. Louis, MO). At the indicated time points cells were collected for flow cytometry as described below.

To examine the conduct of the primary signal In human cells was isolated using immunomagnetic sorting cells with application of the device VARIOMACS (Miltenyi Biotec Inc., Auburn, CA)as described by the manufacturer. Briefly RVS obtained from light layer of blood clots blood of healthy donors (Elmer L. DeGowin Blood Center, University of Iowa), incubated with microspheres conjugated with antibody against CD19, and passed through a column of positive selection. The purity of b cells was more than 95%. After stimulation received extracts of whole cells for Western blot turns) and nuclear extracts (EMSA) to investigate the conduct of the signal.

To study the CpG binding proteins Ramos cells (cell line b-cell lymphoma human Burkitt, ATCC CRL-1923 or CRL-1596; Intervirology 5: 319-334, 1975) were grown in complete medium. Collected raw cells were extracts cytosolic protein and analyzed for the presence of proteins, CpG binding using EMSA and UV cross-linkage, as described below.

Flow cytometry: the antigens were determined as described previously (Hartmann G. et al. 1998 J Pharmacol Exp Ther 285:920). Monoclonal antibodies against HLA-DR were obtained from Immunotech, Marseille, France. All other antibodies were obtained from Pharmingen, San Diego, CA: mAB against CD19 (B43), CD40 (5C3), CD54 (HA58), CD86 (2331 (FUN-1)). IgG1,K/sub> (MOPC-21) and IgG2bused to control the specificity of the staining. The intracellular staining for cytokine IL-6 was performed as described (Hartmann G., and Krieg, A. M. 1999. CpG DNA and LPS

induce distinct patterns of activation in human monocytes. Gene Therapy 6:893). Briefly RVMS (final concentration 1×106cells/ml) were incubated in the presence of brefeldin A (final concentration 1 μg/ml, Sigma Chemical Co., St. Louis, MO). After incubation, the cells were collected and stained with FITC labeled mAB against CD19 (V), labeled RE Tav rats against IL-6 person (MQ2-6A3, Pharmingen) and a set of Fix and Perm Kit (Caltag Laboratories, Burlingame, CA). The results of flow cytometry to 5000 cells per sample were evaluated on a FACScan (Beckton Dickinson Immunocytometry Systems, San Jose, CA). Nonviable cells were excluded from analysis colouring iodide propidium (2 μg/ml). Data were analyzed using the computer program FlowJo (version 2.5.1, Tree Star, Inc., Stanford, CA).

Analysis of proliferation: CFSE (5-(and 6-) carboxyfluorescein diacetate Succinimidyl ether. Molecular Probes, USA) is an intracellular fluorescent label is fluorescein derivative, which is evenly distributed between daughter cells during cellular division. Staining cells with CFSE provides a quantitative assessment and immunophenotyping (labeled with phycoerythrin antibodies) proliferating cells in a mixed cell suspension. Briefly RVMS twice about ivali in SFR, resuspendable in SFR containing CFSE at a final concentration of 5 μm, and incubated at 37°C for 10 minutes. Cells were washed three times SFR and incubated for five days, as indicated in the legends to the figures. Proliferiruyuchei D19-positive b-cells identified by a reduced content of CFSE flow cytometry.

Getting protein extracts of whole cells, nuclei and cytosol: for Western blot turns received extracts of whole cells. Primary b cells were treated with medium, phosphodieterase oligonucleotide-2080 (SEQ ID NO.: 321) or 2078 (SEQ ID NO.: 319) at a concentration of 30 μg/ml or anti-IgM (10 μg/ml). Cells were collected, washed twice with cooled on ice SFR containing 1 mm Na3VO4, resuspendable in the buffer for lysis (150 mm NaCl, 10 mm Tris pH 7.4, 1% NP40, 1 mm Na3VO4, 50 mm NaF, 30 mg/ml leupeptin, 50 mg/ml Aprotinin, 5 mg/ml antipain, 5 mg/ml pepstatin, 50 μg/ml of phenylmethylsulfonyl (PMSF)), incubated for 15 min on ice and centrifuged at 14000 rpm for 10 min. the Supernatant was frozen at -80°C. To obtain nuclear extracts of primary b cells resuspendable in hypotonic buffer (10 mm HEPES/KOH (pH 7.9), 10 mm KCl, and 0.5% NP40, 1.5 mm MgCl2, 0,5 mm dithiothreitol (DTT), 0.5 mm PMSF, 30 mg/ml leupeptin, 50 mg/ml Aprotinin, 5 mg/ml antipain, 5 mg/ml pepstatin). After 15 minutes incubation on ice was suspensionerythromycin at 1000× g for 5 minutes. Besieged kernel resuspendable in the buffer for extraction (20 mm HEPES (pH 7.9), 450 mm NaCl, 50 mm NaF, 20% glycerol, 1 mm EDTA, 1 mm EGTA, 1 mm dithiothreitol (DTT), 1 mm PMSF, 30 mg/ml leupeptin, 50 mg/ml Aprotinin, 5 mg/ml antipain, 5 mg/ml pepstatin) and incubated on ice for one hour. The nuclear suspension was centrifuged for 10 minutes at 16000 g at 4°C. the Supernatant was collected and stored at -80°C. Cytosolic extracts for research CpG binding proteins were obtained from unstimulated cells Ramos, who was literally using hypotonic buffer as described to obtain nuclear extract. After centrifugation the supernatant was separated as the cytoplasmic fraction and stored at -80°C. the protein Concentration was measured using analysis of protein by Bradford (Bio-Rad, Hercules, CA) according to the manufacturer's instructions.

The Western blot turns: protein extracts of whole cells with equal concentration (25 µg/lane) were boiled in buffer for sample DDS-Na (50 mm Tris-HCl, pH 6.8; 1% (β-mercaptoethanol; 2% DDS-Na; 0,1% bromophenol blue; 10% glycerol) for 4 min before electrophoresis in 10% polyacrylamide gel containing 0.1% DDS-Na (DDS-Na-IIAAr). After electrophoresis proteins were transferred to Immobilion-P-Laden membranes (Millipore Corp. Bedford, MA). The prints were blocked by 5% non-fat dry milk. Used the Spa is specific antibodies against the phosphorylated forms of the kinase extracellular receptors (ERK), NH2-terminal kinases c-jun (JNK), R and activating transcription factor-2 (ATF-2) (New England BioLabs, Beverly, MA). The prints showed enhanced chemiluminescence reagent (ECL; Amersham International, Aylesbury, UK) according to manufacturer's recommended procedure.

The analysis of changes in electrophoretic mobility (EMSA):

To determine the DNA-binding activity of the transcription factor activating protein-1 (AP-1 and NFkB nuclear extracts (1 μg/lane) was analyzed using EMSA using dodn 5’ GAT HUNDRED GTG ATG AGT CAG CCG GAT 3’ (SEQ ID NO.: 838)containing binding AP-1 sequence, and NFKB URE of the promoter region from-ICC 5’ - TGC AGG AAG TCC GGG TTT TCC CCA ACC CCC 3’ (SEQ ID NO.: 1142) as probes. ONE was labeled using T4-polynucleotide kinase (New England Biolabs) and (γ-32P) ATP (Amersham, Arlington Heights, IL). Binding assays were performed with 1 μg nuclear protein extract buffer for DNA binding (10 mm Tris-Hcl pH 7.5), 40 mm MgCl2, 20 mm EDTA, 1 mm dithiothreitol, 8% glycerol and 100-400 ng of poly (dI-dC) with 20000-40000 pulse/min labeled ODN in a total volume of 10 µl. The specificity of the bands NFkB confirmed by research competition with unlabeled oligonucleotide corresponding to the binding sites unrelated transcription factor (10-100 ng). For analysis of supersavage in the reaction mixture was added to 2 μg of specific antibody against c-Re, p50 and P65 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) for 30 min before the addition of the radioactively labeled probe. After incubation for 30 minutes at room temperature was added a buffer for drawing, and the samples were subjected to electrophoresis in 6% polyacrylamide gel in Tris-borate-EDTA buffer for separation (90 mm Tris, 90 mm boric acid, 2 mm EDTA, pH 8.0). Gels were dried and then subjected autoradiography.

Cross stitching UV and denaturing electrophoresis

protein: nuclear extracts were incubated with labeled fosfomifira the oligonucleotide, as described for EMSA. Complexes of DNA-protein cross was sewn using UV irradiation in a Stratalinker apparatus (Stratagene) for 10 minutes. The samples were mixed with DDS-Pas-sample buffer, boiled for 10 minutes and put on a 7.5% VAT-Ka-PAG electrophoresis. The gel was dried on Whatman paper and autoradiographically. By delaying the distance against the molecular weight marker proteins were obtained standard curve, which was used to calculate the approximate molecular weight of a transverse cross-linked protein complexes-ONE. To get the size of this value subtracted the molecular weight of the oligonucleotide.

Example 9: determination of the optimal CpG motif for use separately or in combination with enriched T ONE

The immune cells of the human phosphorotioate oligonucleotides containing special is specific for mouse CpG motif GACGTT (SEQ ID NO.: 1143) (for example, 1826 (SEQ ID NO.: 69)) and applied in concentrations that are active against b-cell mouse (Yi, A. K., Chang, M., Peckham D. W., Krieg, A. M., and Ashman, R. F. 1998. CpG oligodeoxyribonucleotides rescue mature spleen In cells from spontaneous apoptosis and promote cell cycle entry. J Immunol 160:5898), showed weak immunostimulirutuyu activity or lack thereof. At high concentrations this oligonucleotide showed a stimulatory effect on b-cells.

In the previous studies on the activation of b-cells mouse was found that CpG dinucleotide, fenceroy two 5’ purines and two 3’ pyrimidines, and preferably 6-membered motif 5’ GACGTT 3’ (SEQ ID NO: 1 143) is optimal for activity phosphodieterase of the oligonucleotide (Krieg, A.M., et al. 1995 Nature 374: 546, Yi, A. K., Chang, M., et al.. 1998 J Immunol 160: 5898).

To determine the optimal motive to stimulate the immune response in humans and vertebrates other than rodents, applicants have created a number of ONE and tested their activity. First, applicants have created a 20-membered fosfodiesterzy oligonucleotide with a TC dinucleotide 5’-end of the optimal CpG motif mouse GACGTT 3’ (SEQ ID NO.: 1143) and subsequent poly-C-tail (2079: 5’ TCG ACG TTC CCC CCC CCC CC 3’ (SEQ ID NO.: 320)). If this oligonucleotide was added to the primary In-human cells under the same conditions that were found are optimal for E. coli DNA (re-adding after 0 hours, 4 hours and 18 is aces; 30 µg/ml for each time point), it stimulated a high level of CD86 expression on primary b-cells after two days. To determine the relationship between the structure and function of CpG motifs applicants were replaced by the base adjacent to CpG dinucleotides while maintaining the sequence of the two CpG dinucleotides. Replacement of adenine, located between the two CpG dinucleotides, thymidine (2080 (SEQ ID NO.: 321), resulted in a small increase in activity. Replacement guanosine (2100 (SEQ ID NO.: 341)) or cytidine (2082 (SEQ ID NO.: 323)in this situation has not caused significant changes compared to 2079 (SEQ ID NO.: 320). At the same time, the replacement of thymidine from 3'-end of the second CpG-dinucleotide the purine-guanosine (2099 (SEQ ID NO.: 340)) or adenine (2083 (SEQ ID NO.: 324)) led to a significant drop in activity of the oligonucleotide, whereas the pyrimidine citizen caused only a small decrease. Important was also thymidine, directly adjacent to the 5’-end of the first CpG-dinucleotide. Replacement of thymidine on any other basis (2105 (SEQ ID NO.: 346), guanosine; 2107 (SEQ ID NO.: 348), adenine; 2104 (SEQ ID NO.: 345), citizen) resulted in a significant reduction in the activity of the oligonucleotide. Deleting the first (2108 (SEQ ID NO.: 349)) or the second (2106 (SEQ ID NO.: 347)) CpG-dinucleotide also partially reduced the activity.

Add an additional 5'GTCGTT3’ (SEQ ID NO.: 1144) CpG motifs to fosfodiesterasa the oligonucleotide containing the him to 8-membered duplex CpG motif (5'TCGTCGTT 3’ (SEQ ID NO:1 145), 2080 (SEQ ID NO.: 321)), did not cause an additional increase of CD86 expression on b cells (2059 (SEQ ID NO.: 300)). The oligonucleotide with the same sequence, and 2080 (SEQ ID NO.: 321), but with phosphorotioate skeleton, showed no activity above background (2116 (SEQ ID NO.: 357)). This was unexpected because, as reported, positivity frame significantly stabilizes the oligonucleotides and increases induced by CpG stimulation (Krieg A. M., Yi, A., Matson, S., Waldschmidt TJ, Bishop G.A., R. Teasdale, G.A. Koretzky, and Klinman D.M. 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374:546). Therefore, the applicants conducted an additional structural-functional analysis phosphorotioate oligonucleotides containing 5'GTCGTT3’ (SEQ ID NO: 1 144) and 5'TCGTCGTT3’ (SEQ ID NO:1145) motifs, which showed that additional motifs (CpG 2006 (SEQ ID NO.: 246)contribute to the increased activity phosphorotioate oligonucleotides.

Purified b cells isolated from peripheral blood using immunomagnetic sorting cells activated by CpG-DNA to the same extent as untreated b cells in RWMS. Thus, activation of b-cells is a primary response, and not a secondary response induced by cytokines secreted by other cells.

In addition to co-stimulatory molecules CD86 functional stage b-cells characterize and other surface markers. For example, activated helper T-cells stimulate b-cells and legirovaniem CD40, molecule 1 intercellular adhesion (ICAM-1, CD54), mediates binding to other immune cells, and the main complex II histocompatibility (MHC II) responsible for the presentation of antigen. Applicants have discovered that the expression of CD40, CD54, and MHC II-cells stimulated with CpG-oligonucleotide 2080 (SEQ ID NO.: 321). He-CpG control oligonucleotide 2078 (SEQ ID NO.: 319) did not show activity compared with the activity of the same environment.

When RPMS were incubated for 5 days in the presence 2080 (SEQ ID NO.: 321) (added after 0 hours, 4 hours, 18 hours and each subsequent morning), surprisingly found that a subpopulation of lymphocytes increases in the size of cells (FSC) and becomes more granular (SSC). To study the question is not whether a given population of proliferating cells, the applicants were stained freshly isolated VRMS with CFSE (5-(and 6-) carboxyfluorescein diacetate Succinimidyl ether) at day 0 and incubated them for 5 days 2080 (SEQ ID NO.: 321), as described above. CFSE is a fluorescent molecule that binds irreversibly to cellular proteins. Each cell division reduces the coloration of CFSE by 50%. It was found that slightly coloured CFSE cells (proliferating cells) are mainly CD19-positive b cells. Oligonucleotide 2080 (SEQ ID NO.: 321) induced proliferation of 60 to 70% of CD19-positive the x-cells within 5 days. The control oligonucleotide 2078 (SEQ ID NO.: 319) induced the proliferation of less than 5% of b-cells. Proliferating b cells (with low CFSE) had large cell (FSC) and greater granularity.

Proliferating b cells expressed CD86 on a higher level compared to deproliferation cells (not shown). In accordance with this observation, a set of oligonucleotides tested above on the subject of induction of the expression of CD86, caused a nearly identical pattern of cell proliferation In cells. Replacement of the 3’ thymidine reduced activity to a greater extent than replace thymidine in the middle position.

Example 10: To activate b-cells must maturation/acidification of the endosome

Previously it was shown that chloroquine, an inhibitor of acidification of the endosome, blocks mediated CpG stimulation of murine antigen-presenting cells and b cells, but no effect on LPS mediated effects (H. Hacker, et al 1998 Embo J 17:6230, Yi, A. K. et al 1998 J Immunol 160:4755, Macfarlane D.E., and Manzel L. 1998, J Immunol 160: 1122). Applicants have found that addition of 5 μg/ml of chloroquine completely blocks mediated CpG induction of CD86 expression on primary b cells (CD86 MFI: 2006 (SEQ ID NO.: 246), 4,7 1,4 against; DNA E. coli, against 3.4 1,4; one environment to 0.9; n=4). Moreover, chloroquine completely inhibited the induction of proliferation In cells under the action of phosphorotioate of the oligonucleotide (SEQ ID NO.: 246), measured with the help of the analysis of cell proliferation using CFSE, as well as a standard way. These results suggest that, as in the case of mouse cells, activation of b-cells under the action of CpG-DNA required the capture DNA in endosome and subsequent acidification of the endosome.

Example 11: Analysis of subcellular events that occur after stimulation of human cells optimalnim ONE person

Since the requirements of the CpG motif for maximum activation of b-cells differ significantly for the mouse (GACGTT) (SEQ ID NO: 1143) and man (TCGTCGTT) (SEQ ID NO: 1145), applicants interested in comparable whether the major intracellular events conduct the signal. Earlier in murine b cells and macrophages was detected rapid induction of binding activity HFkB (Stacey, K. J., et al 1996, J Immunol 157:2116, Yi A. K et al 1998 J Immunol 160: 4755). To study the response HFkB on CpG-DNA in human primary b-cells were isolated from peripheral blood using immunomagnetic sorting cells and incubated with CpG-oligonucleotide 2080 (SEQ ID NO.: 321), non-Als control oligonucleotide 2078 (SEQ ID NO.: 319) or environment. At the indicated time points the cells were collected and received nuclear extracts. In the presence of CpG-oligonucleotide binding activity HFkB increased within one hour and remained elevated for up to 18 hours (the most remote investigated the time). He-CpG control oligonucleotide 2078 (SEQ ID NO.: 319) not until the al increased activity of NFKB in comparison with cells, incubated with the same medium. The band NFkB identified through competition of unlabeled probe,

and with supersavage it was shown that it consists of subunits P50 and P65.

A transcription factor activating protein-1 (AP-1), participates in the regulation of immediate early genes and the expression of cytokines (Karin M. 1995. The regulation of AP-1 activity by mitogen-activated protein kinases. J Biol Chem 270:16483). In murine b cells binding activity of AP-1 is induced in response to CpG-DNA (Yi, A. K., and Krieg, A. M. 1998. Rapid induction of mitogen-activated protein kinases by immune stimulatory CpG DNA. J Immunol 161:4493). To determine whether this is induced by the transcription factor under the action of CpG-DNA and also the man, applicants examined the DNA-binding activity of AP-1 in primary In human cells. Cells were incubated with CpG-oligonucleotide 2080 (SEQ ID NO.: 321) or with a control oligonucleotide 2078 (SEQ ID NO.: 319). Received nuclear extracts, and binding activity of AP-1 was analyzed using EMSA. Binding activity of AP-1 was increased within one hour and increased to 18 hours (the most remote investigated the time), indicating a long-term answer.

Because the activity of AP-1 is induced by many stimuli (Angel P., and Karin, M. 1991. The role of Jun, Fos and the AP-1 complex in cell-proliferation and transformation. Biochim Biophys Acta 1072:129), the applicants were interested in ways to conduct the signal above the R-1.

Transcription factor AP-1 integrates various ways mitogen-activated protein kinase (MARK) (Karin M. 1995. The regulation of AP-1 activity by mitogen-activated protein kinases. J Biol Chem 270:16483). The Western blot turns was performed using extracts of whole cells from primary b cells, incubated with CpG-oligonucleotide 2080 (SEQ ID NO.: 321), control 2078 (SEQ ID NO.: 319), or one environment. Used specific antibodies against the phosphorylated forms of JNK, R, ATF-2 and ERK. After 30 min and 60 min exposure to CpG-DNA was detected in a strong induction of the phosphorylation of JNK, whereas non-G-oligonucleotide showed no activity above background. Protein kinase R, another stress-activated protein kinase (SAPK), was also fosforilirovanii in response to CpG-DNA within 60 minutes ATF-2, the substrate for R and JNK (Gupta, S., Campbell D., Derijard Century, and Davis R.J. 1995. Reduced factor ATF2 regulation by the JNK signal transduction pathway. Science 267:389) and the complex AP-1, showed a weak phosphorylation after 30 min and increased phosphorylation after 60 minutes of CpG-DNA induced significant phosphorylation of ERK. In contrast, anti-IgM, stimulating the receptor In cells, launched the phosphorylation of ERK. Anti-IgM activated JNK isoforms, non-activated CpG-DNA.

Example 12: the Analysis of adjuvant activity in vivo

Was developed a screening of in vitro assays to identify ONE suitable adjuvant in vivo in human the and other, non-rodent animal. Since the applicants have observed not only quantitative but also qualitative differences in the activity of different CpG ODN in mice, applicants first subjected to a screening of a set of CpG and non-CpG control ODN on murine cells for detection methods of analysis in vitro with a clear and strong correlation with adjuvant activity in vivo using surface antigen of hepatitis b (HbsAg). After that, the applicants were systematically tested a set of more than 250 ONE in the corresponding analyses for a person to identify sequences with immunostimulatory activity in vitro. Then applicants are checked, trigger do ONE with the most activity in these tests on humans, the proliferation of b-cells in chimpanzees and monkeys, and, finally, have activity as adjuvants with HbsAg among chimpanzees and squirrel monkeys in vivo. These studies showed that immunostimulirutuyu activity of CpG phosphorotioate ONE is affected by the sequence number and the beat spacing of individual CpG motifs. ONE with a TC dinucleotide at the 5’-end and the subsequent three 6-membered CpG motifs (5'GTCGTT3’), separated by TT dinucleotides, has consistently demonstrated the highest activity against leukocyte humans, chimpanzees and rhesus monkeys. Among chimpanzees or monkeys, once vaccinated against hepatitis b of adjuva is that CpG ODN, developed titers of antibodies against HB, 15 times higher than those who received only the vaccine.

Materials and methods

Oligonucleotides: modified phosphorotioate ONE was obtained from Operon Technologies (Alameda, CA) and Hybridon Specialty Products (Milford, MA). ONE was tested for endotoxin analysis LAL (LAL-assay BioWhittaker, Walkersville, MD; lower limit of detection of 0.1 EU/ml). For in vitro ODN were dissolved in buffer TE (10 mm Tris, pH 7.0, 1 mm EDTA) and stored at -20°C. To apply in vivo ODN were dissolved in saline solution, phosphate buffered (0.1 M SFR, rn,3) and kept at 4°C. All cultivation was carried out using free of pyrogens reagents.

Cell culture mouse spleen: the spleen was removed from 6-12-week-old female BALB/c mice (The Jackson Laboratory), 2×106the splenocytes were cultured with 0.2 μm ODN within 4 hours (TNFα) or 24 hours (IL-6, IFN-γ, IL-12), and cytokines were determined using TYPHOID, as described previously (Yi A.K., Klinman D.., Martin .L., Matson, S., and Krieg, A.M. 1996. Rapid immune activation by CpG motifs in bacterial DNA. Systemic induction of IL-6 reduced through an antioxidant-sensitive pathway. J Immunol 157:5394). To assess CpG induced proliferation of b-cells from the spleen cells were removed T-cells using anti-hy-1.2 and complement and centrifugation on lympholyte M®(Cedariane Laboratories, Homby, ON, Canada), were cultured for 44 hours with the specified ONE, then propecial pulse label 1 µci3H time is on for 4 hours, as previously described (Krieg A. M., Yi, A., Matson, S., Waidschmidt T.J., G.A. Bishop, R. Teasdale, G.A. Koretzky, and Klinman D.M. 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374: 546). To evaluate lytic activity of NK-cells from the spleen cells of the mouse was removed In cells using magnetic beads coated with goat antibodies against mouse Ig, as described in detail previously (Ballas, Z. K., and Rasmussen W. 1993. Lymphokine-activated killer cells. VII. IL-4 dosage an NK1.1+CD8 α+β-TCR-αβ B220+lymphokine-activated killer subset. J Immunol 150:17). Cells were cultured in 5×106/well in 24-hole tablets and collected after 18 hours for use as effector cells in a standard 4-hour test selection51SG cells against target YAC-1. One unit (LU) took the number of cells required for the induction of 30% specific lysis.

Immunization of mice against HbsAg and evaluation of humoral response: groups of 6-8-week-old female BALB/c mice (n=5 or 10, Charles River, Montreal, QC) were immunized against HbsAg as described previously (Davis, H. L., et al 1998 J Immunol 160:870). Briefly, each mouse received a single injection of 50 µl SFR containing 1 μg of recombinant HbsAg (Medix Biotech, Foster City, CA) and 10 μg CpG ODN or non-CpG ODN as the sole adjuvant or in combination with alum (Alhydrogel "85", Superfos Biosector, Vedbaek, Denmark; 25 mg Al3+/mg HBsAg). Control mice were immunized HbsAg without adjuvant or alum. Through different per the odes of time after immunization of mice received plasma, and AT that are specific to HbsAg (anti-HBs)were quantitatively determined by end-assisted breeding TYPHUS (in three Parallels), as described previously (Davis H.L et al 1998 J Immunol 160:870). Endpoint titers were determined as the highest dilution of plasma, providing the magnitude of the absorbance (OD450), twice that of non-immune plasma, at a cutoff value of 0.05.

Selection RVMS primates and cell culture:

Mononuclear cells from peripheral blood (RVMS) were isolated from peripheral blood of healthy volunteers, chimpanzees and squirrel monkeys using centrifugation in density gradient Filoll-hypaque (Histopaque-1077, Sigma Chemical Co., St. Louis, MO)as described (Hartmann G., et al 1996 Antisense Nucleic Acid Drug Dev 6:291). Cells suspended in culture medium RPMI 1640 with the addition of 10% (V/V) V / V heat inactivated (56°S, 1 h) FCS (HyClone, Logan, UT), 1.5 mm L-glutamine, 100 units/ml penicillin and 100 µg/ml streptomycin (all from Gibco BRL, Grand Island, NY) (complete medium). Cells (final concentration 1×106cells/ml) were cultured in complete medium in a humidified incubator with 5% CO2and 37°C. as incentives used ODN and LPS (from Salmonella typhimurium, Sigma Chemical Co., St. Louis, MO) or anti-IgM. To measure lytic activity of NK human RVMS incubated in 5×106/well in 24-hole plates. The culture was harvested after 24 hours and cells used in casestemperatures in standard 4-hour test selection 51SG cells against targets C, as described previously (Ballas, Z. K., Rasmussen, W. L., and Krieg, A. M. 1996. Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J Immunol 157:1840; Ballas, Z. K., and Rasmussen W. 1993. Lymphokine-activated killer cells. VII. IL-4 dosage an NKl.1+CDS α+β-TCR-α,β B220+lymphokine-activated killer subset. J Immunol 150:17). For proliferation of b-cells for 18 hours prior to collection was added 1 µci3H-thymidine, and the number of enabled3H thymidine was determined using a scintillation account on day 5. The standard deviation in three parallel wells were <5%.

Flow cytometry RVMS primates: Surface antigens RVMS primates were stained as described previously (Hartmann G et al 1998 J Pharmacol Exp Ther 285:920). Monoclonal antibodies against CD3 (UCHT1), CD14 (ME), CD19 (V), CD56 (V), CD69 (FN50) and CD86 (2331 (FUN-1)) were obtained from Phariningen, San Diego, CA. IgG1,K(MORSE-21) and IgG2b(Hartrnann G et al 1999 PNAS 96:9305) was used to control for nonspecific staining. NK cells were identified by expression of CD56 negative for CD3, CD14 and CD19 cells and b-cells identified by expression of CD19. Data of flow cytometry for 10000 cells per sample were obtained using FACScan (Beckton Dickinson Immunocytometry Systems, San Jose, CA). The viability of cells used for the analysis of the case of FSC/SSC was determined by the color of iodine propidium (2 μg/ml), and she was above 98%. The results were analyzed with application of the computer program FlowJo (version 2.5.1, Tree Star, Inc., Stanford, CA).

Immunization of chimpanzees and squirrel monkeys against HbsAg and evaluation of humoral response: fourteen squirrel monkeys (2.0 to 3.5 kg) were immunized children's dose of Engerix-B (SmithKline Beecham Biologicals, Rixensart, BE)containing 10 μg of HbsAg adsorbed on alum (25 mg Al3+/mg HBsAg). Obtained was injected alone (n=5), or in combination with CpG ODN 1968 (n=5, 500 μg) or CpG ODN 2006 (SEQ ID NO.: 246) (n=4, 150 µg). Four chimpanzees (10-20 kg) were immunized in the same way, and two received the control vaccine (only Engerix-B), and two received an experimental vaccine (Engerix-B plus 1 mg CpG ODN 2006). All vaccines were injected I/m in the right anterior thigh in a total volume of 1 ml Monkeys were kept in conditions for animals Primate Research Center (Bogor, Indonesia), and chimpanzees contained in Bioqual (Rockville, MD). Animals were daily controlled experts on animal welfare. Symptoms of General ill health or local adverse reactions at the injection site. Plasma was obtained in the/in a puncture before and after different time intervals after immunization and stored frozen (-20° (C) until analyzed for antibodies. Antibodies against Hbs were determined using a commercially available set of TYPHUS (Monolisa Anti-HBs; Sanofi-Pasteur, Montreal, QC), and titers were expressed in mIU/ml on the basis of comparison to the standards defined by the who (Monolisa Anti-HBs Standards; Sanofi-Pasteur 30).

Results

Identify the situation of CpG ODN with different profiles of immune activity in vitro: studies of the applicants showed what specific grounds on the 5’- and 3’-ends of dinucleotide CpG the CpG motif may have a significant impact on the level of immune activation synthetic ONE, but it was unclear whether different CpG motifs induce different immune effects. To investigate this question, applicants have tested a set of motives CpG ODN in terms of their ability to induce the lytic activity of NK, the proliferation of b-cells and stimulate the synthesis of TNFα, IL-6, IFN-γ and IL-12 in the spleen cells of the mouse. Immunostimulirutuyu activity is ONE that does not contain motifs (CpG ODN 1982 (SEQ ID NO.: 225), ONE 1983 (SEQ ID NO.: 226)) was negative or weak compared with CpG ODN. ONE with suboptimal motifs (CpG ODN 1628 (SEQ ID NO.: 767), ONE 1758 (SEQ ID NO.: 1)) were less active than ODN containing CpG motifs, FRANKENWEENIE two 5’purines and two 3’pyrimidines (ODN 1760 (SEQ ID NO.: 3), ODN 1826 (SEQ ID NO.: 69), ONE 1841 (SEQ ID NO.: 84)). ODN 1826, containing two optimal murine CpG motif (5’ GACGTT 3’) (SEQ ID NO: 1143), had the greatest activity against 5 of the 6 measured output parameters. Except for ONE 1628, all ONE showed a generally similar profile of activity (mediated NK cell lysis, proliferation of b-cells, IL-12, IL-6, TNFα, IFN-γ). It should be noted that ONE 1628, which is unique in this set there are two G enriched regions, showed a preferred induction IFN-γ and relatively low stimulation other activities.

Identification of in vitro, which correlated with adjuvant activity in vivo: as adjuvant activity is the final effect in vivo, applicants were interested in the identification of in vitro tests that would account for adjuvant activity of CpG ODN in vivo. Therefore, the same ONE that was used for end effects in vitro, were tested for their adjuvant activity for immunization against HbsAg. This analysis was performed with one ODN and ODN in combination with alum, as in the previous studies was shown a pronounced synergism for CpG ODN and alum adjuvants (published patent application PCT WO 98/40100).

Mouse BALB/c mice immunized with HbsAg without adjuvant, gave only low titers of anti-s to 4 weeks, and a control ODN had no effect on this indicator. In contrast, the addition of CpG ODN increased the titers of anti-s in 5-40 times, depending on the sequence used. Adding alum titers of anti-s were approximately 6 times higher than when using only HbsAg. It is essential that these titles were not changed in the presence of a control ODN and raised in 2-36 times different CpG ODN. The results obtained with a different ONE, taken separately, are very well correlated (r=0,96) with the results obtained with the same ONE plus Kwanzaa was conducted linear regression, discovered a very high degree of correlation between certain in vitro and increased anti-HBs titers in vivo. From all analyzed end-effects in vitro greatest correlation with adjuvant activity in vivo showed induction of lytic activity of NK (without alum, r=0.98; with alum, r=0,95; p<0.0001). Good correlation regarding adjuvant activity was obtained also for the stimulation of b-cells (r=0.84 and 0.7), and secretion of TNF-α (r=0,9 and 0.88), IL-12 (r=0.88 and 0,86) and IL-6 (r=0,85 and 0,91). The only analysis in vitro, which did not correlate well with the results in vivo, represented the secretion of IFN-γ (r=0.57 and 0.68). These results show that the in vitro lytic activity of NK, activation of b-cells and production of TNF-α, IL-6 and IL-12 give valuable information in vitro to predict adjuvant activity of this ODN in vivo.

Screening set phosphorotioate ONE in relation to the activation of NK-cells: in previous studies, applicants have found that the synthesis of inflammatory cytokines RVMS person is induced by extremely low amounts of endotoxin (induced secretion of TNF-α detected already at 6 PG/ml of endotoxin, sensitivity to 2 orders of magnitude higher than the sensitivity of immune cells in the mouse). At the same time, activation of b-cells and the induction of the lytic activity of NK-cells e is the oxin low even at high concentrations of endotoxin. Based on these results, the applicants have chosen the activation of NK-cell lytic activity and expression of CD69) and b-cell proliferation and the expression of CD86) as the most highly specific and reproducible results with low interregional variability and applied data analysis for in vitro screening of set ONE.

First of all, applicants investigated the effect phosphorotioate ONE containing various combinations and permutations of CpG motifs, mediated NK cell lysis of target cells. For clarity and ease of presentation shows only the data from individual typical CpG, kontrolnie ONE. RVMS person incubated with various phosphorotioate ONE (6 μg/ml) for 24 hours and tested for their ability to lyse labeled51SG cells C. ONE with two 6-membered CpG motifs (or 5'GACGTT3’ (SEQ ID NO.: 1143), or 5'GTCGTT3’ (SEQ ID NO.; 1144)) in combination with TRS at the 5’end of the ODN (ODN 1840 5'TCCATGTCGTTCCTGTCGTT3’ (SEQ ID NO.: 83), ONE 1851 5'TCCTGACGTTCCTGACGTT3’ (SEQ ID NO.: 94) or with at least three 6-membered motives without TRS at the 5’-end (ONE 2013 (SEQ ID NO.: 253)) showed moderate activity. High activity was detected when 5’ TRS was directly preceded by a 6-membered CpG motif of man (5'TCGTCGTT 3’ (SEQ ID NO.: 1145)and was accompanied by two 6-membered motifs (ONE 2005 (SEQ ID NO.: 245), ODN 2006 (SEQ ID NO.: 246) and ODN 2007 (SEQ ID NO.: 247)). The best results were for the scientists, when 6-membered CpG motifs were separated from each other and from 5’ to 8-membered CpG motif with TRT (ODN 2006 (SEQ ID NO.: 246)).

Expression of the activation marker CD69 rising rapidly on the surface of NK cells after stimulation. To obtain results on the basis of the analysis of the lysis of NK-cells, RVMS were incubated for 18 hours with ODN (2 μg/ml). The expression of CD69 was determined positive for CD56 NK cells (negative for CD3, CD14 and CD19). Although the induction of CD69 expression was less limited by sequence comparison with the stimulation of functional activity of NK-cells, control ODN (ODN 1982, ONE 2116, ODN 2117, ONE 2010) showed only low activity, similar to background values. ONE with two CpG motifs person, divided 5’-TTTT-3’ (ODN 1965 (SEQ ID NO.: 208)), or four CpG motifs person without beat spacing (ONE 2013 (SEQ ID NO.: 253)) were relatively more active in the induction of CD69 expression in comparison with the stimulation of lytic activity of NK-cells. Optimal functional activity of NK-cells, and the expression of CD69 was obtained with ONE containing dinucleotide TRS prior to the CpG motif of man, and the additional motives of the person in the sequence (ODN 2006 (SEQ ID NO.: 246), ODN 2007 (SEQ ID NO.: 247)).

Activity phosphorotioate ONE in relation to the stimulation of human cells: in preliminary experiments, the applicants have discovered, is the percentage of proliferating b-cells (analysis of CFSE, see section methods) correlated with the surface expression of co-stimulating CD86 on b cells, measured by flow cytometry. Therefore, the applicants have applied the expression of CD86 on b cells for screening set ONE against their immunostimulating activity. RVMS incubated with 0.6 ág/ml ODN. The expression of CD86 (mean fluorescence intensity, MFI) was determined on CD19 positive b cells. Poly-ODN (ODN 2017 (SEQ ID NO.: 257)or ODN without CpG dinucleotides (ODN 1982 (SEQ ID NO.: 225)) were unable to stimulate In-human cells under these experimental conditions. Positivity ODN (ODN 2116 (SEQ ID NO.: 256)) with one optimal CpG motif of a man, preceded TRS (51-TCGTCGTT-3' (SEQ ID NO.: 1145))had low activity. The presence of one 6-membered ring motif CpG person (5’-GTCGTT-3’(SEQ ID NO.: 1144)) did not trigger actions. Two such CpG motif in the sequence did not show (ONE 1960 (SEQ ID NO.: 203), ONE 2016 (SEQ ID NO.: 256)) or showed a modest (ONE 1965 (SEQ ID NO.: 208)) activity, depending on the context sequence. If ONE was built from three or four copies of this motif (ONE 2012 (SEQ ID NO.: 252), ONE 2013 (SEQ ID NO.: 253), ONE 2014 (SEQ ID NO.: 254)), it was possible to detect moderate activity on b cells. The combination of 8-membered motif CpG person at the 5’end of the ODN with two 6-membered motifs (CpG ODN 2005 (SEQ ID NO.: 245), ODN 2006 (SEQ ID NO.: 246), ODN 2007 (SEQ ID NO.: 247)) ON THE N 2102 (SEQ ID NO.: 343), ONE 2103 (SEQ ID NO.: 344)) led to a significant improvement in the ability of the ODN to stimulate b cells. Important was the beat spacing between the individual motifs. Division of CpG motifs using TRT was preferred (ODN 2006 (SEQ ID NO.: 246)) compared with undivided motifs (CpG ODN 2005 (SEQ ID NO.:); compare also ONE 1965 (SEQ ID NO.: 208) with ONE 1960 (SEQ ID NO.: 203)). 6-membered motif CpG person (5’-GTCGTT-3’) was better than the optimal 6-membered CpG motif mouse (5’-GACGTT-3’(SEQ ID NO.: 246)) when combined with the 8-membered motif CpG person on the 5’-end (ODN 2006 against ONE 2102 (SEQ ID NO.: 343) and ONE 2103 (SEQ ID NO.: 344)). ONE (TCC)poly was inactive or only low activity, as ODN containing CpG dinucleotides, flanked by guanine or other dinucleotides (CpG ODN 2010 (SEQ ID NO.: 250)). Taken together, the results for NK-cells and b-cells clearly showed that tested ONE of the greatest immunostimulatory activity on immune cells has ODN 2006 (SEQ ID NO.: 246).

Comparative analysis of the effectiveness of CpG phosphorotioate ONE among various primates: different CpG motifs are optimal for the activation of immune cells in mouse and man. Moreover, in mouse and man different number and localization of CpG motifs in the active phosphorotioate ONE.

Applicants interested in the question are CpG phosphorotioate ONE similar activity in different species of primates. Applicants have compared n the boron CpG ODN on their ability to induce the proliferation of b-cells in humans, chimpanzees and rhesus or squirrel monkeys. The ability of the ODN to stimulate the proliferation of b-cells (table J) correlated well with their ability to induce the expression of CD86 on b cells. ODN 2006 (SEQ ID NO.: 246), which showed the greatest activity on b cells and NK-cells, was also the most active in stimulating the proliferation of b-cells chimpanzee and macaque-rhesus (table J). ONE 1968 (SEQ ID NO.: 211) and ODN 2006 (SEQ ID NO.: 246) caused the greatest activation In cells squirrel monkeys in vitro (SI 25 and 29, respectively, with 6 μg ODN/ml). Suddenly, CpG ODN 2007 (SEQ ID NO.: 247), which showed similar optimal ODN 2006 (SEQ ID NO.: 246) high activity in human cells does not stimulate the proliferation of b-cells rhesus or chimpanzee, and ONE 1968 (SEQ ID NO.: 211) shows low activity. CpG ODN, the source revealed high activity in mouse (ODN 1760 (SEQ ID NO.: 3), ODN 1826 (SEQ ID NO.: 69)), showed low activity in monkeys (table J).

Table J

Proliferative response RVMS on phosphorotioate CpG ODN in primates
 PeopleChimpanzeesRhesus
Without additives0,5+-0,10,5+-0,10,5+-0,0
One 176023+-70,3+-0,10,5+-0,3
(SEQ ID NO.:3)   
One 18260,8+-0,10,4+-0,10,6+-0,1
(SEQ ID NO.:69)   
One 196835+-920,0+-3,81,9+a-0.7
(SEQ ID NO.:221)   
One 19829,7+-1,12,5+-1,10,7+-0,1
(SEQ ID NO.:225)   
One 200658+-827,4+8.9bn6,3+-3,3
(SEQ ID NO.:246)   
One 200747+-110,5+-0,10,4+-0,2
(SEQ ID NO.:247)   

RVMS were obtained from peripheral blood and incubated with ODN (0.6 ág/ml), as indicated, for five days. Proliferation was measured by incorporation of3H/thymidine (counts/min/1000) during the last 18 hours. According to the data obtained by analysis of CFSE, more than 95% prooperirovavshim cells represented In cells. Tested four basis of reliable paternal man, six chimpanzees and two rhesus.

Adjuvant activity of CpG Odnp vivo in chimpanzees and squirrel monkeys: to assess whether CpG ODN with high stimulating effect in vitro on cells of primates measurable adjuvant activity in vivo, squirrel monkeys and chimpanzees were immunized Engerix B, which includes HBsAg adsorbed to alum alone or with added ODN 1968 (500 μg) or ODN 2006 (SEQ ID NO.: 246) (1 mg), respectively. Compared to control animals not treated with CpG ODN, anti-s-titers 4 weeks after premirovany and 2 weeks after the second immunization were respectively 66 and 16 times higher in monkeys and 15 and 3 times higher in chimpanzees (table K). Thus, there has been a clear adjuvant effect of CpG ODN, and this was especially pronounced after a single immunization.

1. The method of stimulation of the immune response, including samawatie immunostimulatory nucleic acid other than rodents to the subject in number, effective for the induction of an immune response in a subject other than rodents, where the nucleic acid is an enriched by thymidine (T) nucleic acid which contains more than 60% of T.

2. The method according to claim 1, where the T-enriched immunostimulirutuyu nucleic acid is a poly-T-nucleic acid containing 5 TTTT’.

3. The method according to claim 2, where the poly-T-nucleic acid contains 5'H1X2TTTH3X43’, where X1, X2, X3and X4represent nucleotides.

4. The method according to claim 2, where the T-enriched immunostimulirutuyu nucleic acid contains many motifs poly T nucleic acids.

5. The method according to claim 3, where X1X2is a TT.

6. The method according to claim 3, where X3X4is a TT.

7. The method according to claim 3, where X1X2selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA and GC, where a represents adenine, C corresponds to the cytosine, G corresponds to a guanine, and T corresponds to thymidine.

8. The method according to claim 3, where X3X4selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA and GC.

9. The method according to claim 1, where the T-enriched immunostimulirutuyu nucleic acid has a nucleotide composition, more than 80% consists of Tons

10. The method according to claim 1, where immunostimulirutuyu nucleic acid is the acid comprises at least 20 nucleotides.

11. The method according to claim 1, where immunostimulirutuyu nucleic acid contains at least 24 nucleotides.

12. The method according to claim 1, where immunostimulirutuyu nucleic acid has the nucleotide backbone that includes at least one backbone modification.

13. The method according to item 12, where the backbone modification is phosphorotioate modification.

14. The method according to claim 1, where immunostimulirutuyu nucleic acid contains a cytosine-goinnovate dinucleotides (CpG).

15. The method according to 14, where immunostimulirutuyu nucleic acid contains CpG dinucleotides only methylated state.

16. The method according to claim 1, where immunostimulirutuyu nucleic acid is free from CpG.

17. The method according to claim 1, where immunostimulirutuyu nucleic acid has a nucleotide composition, more than 25% consisting of cytosine (C).

18. The method according to claim 1, where immunostimulirutuyu nucleic acid has a nucleotide composition, more than 25% consisting of adenine. (A).

19. The method according to claim 1, where the subject is additionally subjected to the action of antigen and where the immune response is a specific antigen immune response.

20. The method according to claim 1, further comprising allocating immune cells from a subject, contacting the immune cell with an effective activation of immune cells by the number of immunostimulatory well Lanovoy acid and the introduction of activated immune cells back to the subject.

21. The method according to claim 1, where the subject has asthma or there is a risk of developing asthma and method is a method for the treatment or prevention of asthma in the subject.

22. The method according to claim 1, where the subject has an Allergy or there is a risk of developing allergies and method is a method for the treatment or prevention of Allergy.

23. The method according to claim 1, where the subject has a cancer and the method is a method of cancer treatment.

24. The method according to claim 1, where immunostimulirutuyu nucleic acid optionally comprises TG-motive.

25. The method according to claim 1, where TG is a nucleic acid containing 5'N1X1TGX2N23’, where N indicates the sequence of the nucleic acid and X is any nucleotide, including uracil.

26. Composition containing oligonucleotide having a nucleic acid sequence TCG TCG TTT TGA CGT TTT GTC GTT (SEQ ID NO: 343).

27. Method for the treatment or prevention of Allergy or asthma, comprising introducing the composition of p needy in this subject other than rodents, in an amount effective for treatment or prevention of Allergy or asthma.

Post priorities:

25.09.1999 according to claims 1-21, 24-27;

23.08.2000 on PP and 23.



 

Same patents:

The invention relates to medicine, specifically to pharmacology

The invention relates to pharmaceutical
The invention relates to medicine, in particular to Pediatrics, Allergology and pulmonology

The invention relates to the field of medicine and relates to a spontaneously dispersible pharmaceutical composition for oral administration comprising (2R,4S)-N-(1 -(3,5-bis(trifluoromethyl)benzoyl)-2-(4-Chlorobenzyl)-4-piperidinyl)quinoline-4-carboxamide as an antagonist of substance P and the carrier medium containing a hydrophilic component and a surfactant, and methods of treatment using the composition of CNS disorders, including depression and fear of society, and respiratory diseases, such as asthma and chronic bronchitis

The invention relates to new compounds of General formula

which have the properties of receptor antagonists neirokinina-1(NK-1)

The invention relates to medicine, in particular the creation of far metologicheskikh drugs with anti-allergic effect

The invention relates to N-substituted indole-3-glycinamide General formula I, possess Antiasthmatic, antiallergic and immunosuppressive/immunomodulatory action

where R is hydrogen, (C1-C6)alkyl, and the alkyl group optionally contains one phenyl substituent, which, in turn, optionally contains at least one Deputy, selected from the group comprising halogen, methoxy, ethoxy, (C1-C6)alkyl; R1means phenyl cycle containing at least one Deputy, selected from the group comprising (C1-C6)alkoxy, hydroxy, nitro, (C1-C6)alkoxycarbonyl one or fluorine, or R1represents the balance of the pyridine of the formula II

where the carbon atoms 2, 3 and 4 of the remaining pyridine optionally have the same or different substituents R5and R6and R5and R6denote (C1-C6)alkyl or halogen, or R1presents arylamination-2-methylprop-1-ilen group, or R and R1together with the nitrogen atom to which IGN="ABSMIDDLE">

where R7denotes phenyl or pyridinyl; R2means (C1-C6)alkyl, which optionally contains a phenyl residue, which, in turn, optionally substituted with halogen, methoxy group or ethoxypropane, or related to R2(C1-C6)alkyl group optionally substituted 2-, 3 - or 4-pyridinium residue; R3and R4are the same or different substituents and represent hydrogen, hydroxy, (C1-C6)alkoxy, (C1-C3)alkoxycarbonyl or (C1-C3)alkoxycarbonyl(C1-C3)alkyl, or R3is cyclopentanecarbonitrile; Z denotes Oh, and alkyl, alkoxy or alkylamino mean as an unbranched group, such as methyl, ethyl, n-propyl, n-butyl, n-hexyl and branched alkyl groups such as isopropyl or tert-butylene group; halogen means fluorine, chlorine, bromine or iodine and alkoxygroup means methoxy, propoxy, butoxy, isopropoxy, isobutoxy or phenoxypropan, and their pharmaceutically acceptable salts with acids

The invention relates to the field of pharmaceutical industry and relates to nasal ointment for the prevention of inhalant allergic reactions

The invention relates to medicine, namely to Allergology, and can be used for the treatment of atopic dermatitis

The invention relates to the field of medicine, can be used in the treatment of allergic diseases and autoimmune diseases and relates to pharmaceutical compositions intended for use as an inhibitor of Th2-differentiation, comprising the compound of formula (I)

FIELD: medicine, immunology.

SUBSTANCE: invention proposes an agent enhancing the immunogenic properties of tetanus anatoxin (adjuvant). Invention proposes the vegetable triterpenic compound miliacin as an agent enhancing immunogenic properties of tetanus anatoxin. Agent enhances the immune response value in its applying as a vaccine preparation of tetanus anatoxin. The agent miliacin elicits its stimulating effect for both the first and repeated administration of vaccine that allows suggesting its possible applying for prophylactic vaccinations with tetanus anatoxin. Taking into account the high tolerance of miliacin in the broad range of its doses it is suggested its practical applying as an agent promoting to the enhanced formation of vaccinal immunity in prophylactic vaccinations with tetanus anatoxin.

EFFECT: valuable medicinal properties of agent.

6 tbl

Immunostimulant // 2228175
The invention relates to new biologically active substances from the class of derivatives acids alkenylboronic

The invention relates to medicine, specifically to methods of producing aqueous-alcoholic compositions on the basis of walnuts milky-wax ripeness and honey, with the addition of pollen and glycine, and can be used in the prevention of diseases associated with metabolic disorders, to enhance immunity and reduce stress, eliminate iodine deficiency, as antiviral, antihelminthic and antifungal agent

The invention relates to the processing of reindeer products, in particular to a method for producing a biologically active extract of tinned tails deer antler

The invention relates to the use of aminoadamantane derivatives, as immunoregulators, in particular, to regulate and modulate already activated neutrophils

The invention relates to veterinary medicine
Up!