Composition for treatment or prophylaxis of infection caused by microorganism neisseria

FIELD: biotechnology, medicine, infectious diseases, medicinal microbiology.

SUBSTANCE: invention relates to a composition designated for treatment and prophylaxis of infections caused by Neisseria microorganism that comprises the following components: (a) protein with amino acid sequence similar by 65% and above with the natural Neisseria protein of a single species (the first group of amino acid sequences is given in the text) and/or its fragment consisting of 10 and more amino acids and eliciting antigen properties; (b) the second protein with amino acid sequence similar by 65% and above with the natural Neisseria protein of another species (the second group of amino acid sequences with even numbers is given in the text), and/or its fragment consisting of 10 or more amino acids and eliciting antigen properties; in particular, the second protein represents NspA. The composition comprises additionally adjuvant. The composition is used both a medicinal agent and for manufacturing the medicinal agent. Applying the invention provides enhancing the effectiveness of prophylaxis or treatment due to the universal effect of the composition (vaccine). Invention can be used in medicine for treatment of infections.

EFFECT: valuable medicinal properties of composition.

8 cl, 137 dwg, 5 tbl, 12 ex

 

The scope of the invention

This invention relates to compositions containing a combination of biological molecules from the bacteria Neisseria, particularly N.meningitidis and N.gonorrhoeae.

Prior art

Neisseria meningitidis and Neisseria gonorrhoeae are fixed, gram diplococci that are pathogenic in man.

Based on the capsular polysaccharide of this organism have been identified 12 serological groups N.meningitidis. Group a is the pathogen most often the underlying epidemic diseases located in sub-Saharan Africa. Serological group b and C are responsible for the vast majority of cases in the United States and in most developed countries. Serological group W135 and Y are responsible for the remaining cases in the United States and developed countries.

Meningococcal vaccine currently used is a tetravalent polysaccharide vaccine consisting of serological groups a, C, Y and W135. However, meningococcal disease remains In the problem. This approach polysaccharide cannot be used as capsule menB polysaccharide is a polymer α(2-8)-linked N-acetylneuraminic acid, which is also present in the tissue of the mammal. One approach to menB-vaccine uses a mixture of proteins naru is Noah membrane (MRA). To overcome antigenic variability were created polyvalent vaccines containing up to nine different Parinov [for example, Poolman JT (1992) Development of a meningococcal vaccine. Infect. Agents Dis. 4:13-28]. Additional proteins for use in vaccines outer membrane proteins were proteins OPA and OPC, but none of these approaches has not been able to overcome antigenic variability [e.g., Ala’ ldeen & Borriello (1996) The meningococcal transferrin-binding proteins 1 and 2 are both exposed surface and generate bactericidal antibodies capable of killing homologous and heterologous strains. Vaccine 14 (1):49-53].

Provided that meningococcal disease during neèpidemičeskaâ periods from the population is usually caused by many strains or variants of strains [Russel et al. (1998) Abstracts of the 11thInternational pathogenic Neisseria conference, page 281] together with frequent time shifts in the prevailing strains, it seems likely that a universal vaccine against meningococcus b will require more than one species of an antigen.

Description of the invention

Protein and nucleotide sequence of Neisseria described in the following documents:

- WO 99/24578

- WO 99/36544

- WO 99/57280

- WO 97/28273

- WO 96/29412

- WO 95/03413

- Tettelin et al. (2000) Science 287:1809-1815

For ease of reference, the sequence described in these documents are cited in this application in accordance with the following table:

The documentThe numbering of the sequences in the originalThe numbering of the sequences in this application
WO 99/24578SEQ ID NO:1-892SEQ ID NO:1-892
WO 99/36544SEQ ID NO:1-90SEQ ID NO:893-982
WO 99/57280SEQ ID NO:1-3020SEQ ID NO:983-4000
WO 97/28273coding DNA Figel figures cadirola DNA Fink figures beloc figures 13SEQ ID NO:4003

SEQ ID NO:4004

SEQ ID NO:4005

SEQ ID NO:4006

SEQ ID NO:4007
WO 96/29412SEQ ID NO:1-26SEQ ID NO:4008-4033
WO 95/03413SEQ ID NO:1-23SEQ ID NO:4034-4056
Tettelin et al. (2000) Science 287:1809-15NMB0001-2160 (DNA)NMB0001-2160(encoded proteins)SEQ ID NO:4057-6216

SEQ ID NO:6217-8376

This invention is a composition containing the first biological molecule from the bacterium Neisseria and a second biological molecule from the bacterium Neisseria. The term “biological molecule” includes proteins and nucleic acids.

These compositions may also contain additional biological molecules, preferably from Neisseria, i.e. we can say that these songs contain two or more biological molecules (e.g., 3, 4, 5, 6, 7, 8 etc), at least two of which the molecules are bacteria Neisseria (e.g., 3, 4, 5, 6, 7, 8 and so on). Such compositions include compositions containing (i) two or more different proteins of Neisseria, (ii) two or more nucleic acids of Neisseria or (iii) a mixture of one or more proteins of Neisseria and one or more nucleic acids of Neisseria.

In one preferred embodiment, the first and the second biological molecules are molecules of different species of Neisseria (e.g., one of N.meningitidis and one of N.gonorrhoeae), but they can be from the same species. Biological molecules in these compositions can be of different serological groups or strains of the same species.

The first biological molecule is preferably selected from the group consisting of SEQ ID NO:1-8376. More preferably it is selected from the group consisting of SEQ ID NO:1-4002 and/or SEQ ID NO:4057-8376. Preferably, it is treated or highlighted biological molecule.

The second biological molecule is preferably selected from the group consisting of SEQ ID NO:1-8376. More preferably it is selected from the group consisting of SEQ ID NO:1-4002 and/or SEQ ID NO:4057-8376. Preferably, it is treated or highlighted biological molecule.

One or both of the first and the second biological molecule may be a biological molecule, Neisseria, which is not specifically described here and which may not be identified, described, shared, bi is a Boolean molecule or purified prior to the filing of this application.

In particular, this invention is a composition comprising one or more of the following pairs of first and second biological molecules (listed in SEQ ID NO: - see the end of the description).

Thus, the invention includes each of 35074500 possible pairs SEQ ID NO:1-8376 (1 and 2 1 and 3 1 and 4 1 and 5 1...and 8375, 1 and 8376, 2 and 3 2 and 4 2 and 5 2...and 8375, 2 and 8376, 3 and 4...1000 and 1001, 1000 and 1002...1000 and 8376...8374 and 8375, 8374, and 8376, 8375 and 8376), although because of their number they are all here in full are not listed.

The details of how can be obtained and used molecule having the sequence of SEQ ID NO:1-4056, can be found in the corresponding international applications, and there is no need to repeat these details in this application. Similar principles also apply to SEQ ID NO:4057-8376.

SEQ ID NO:1-8376 in the compositions of this invention can be supplemented or replaced by molecules containing sequences homologous (i.e. having a sequence identity) relative to SEQ ID NO:1-8376. Depending on the particular sequence, the degree of identity is preferably more than 50% (e.g., 65%, 80%, 90% or more) and include mutants or allelic variants. The sequence identity between proteins preferably determined by the search algorithm homology Smith-Waterman provided in the MPSRCH program (Oxford Molecular), using the search affine gap with a penalty for an open gap=12 and a fine extension gap=1.

SEQ ID NO:1-8376 in the compositions of this invention can be supplemented or replaced by molecules containing fragments of SEQ ID NO:1-8376. Such fragments must contain at least n consecutive monomers of these molecules, and depending on the particular sequence, n is equal to either (i) 7 or more protein molecules (e.g., 8, 10, 12, 14, 16, 18, 20 or more), preferably, for example, this fragment contains the epitope of this sequence, or (ii) 10 or more molecules of nucleic acids (e.g., 12, 14, 15, 18, 20, 25, 30, 35, 40 or more).

If this composition contains a protein that exists in different growing (emerging) and Mature forms, use preferably the Mature form of this protein. For example, there may be used a Mature form of the protein NspA (SEQ ID NO:4008-4033; WO 96/29412; figure 29)without the signal peptide.

In the case of protein Molko SEQ ID NO:1-8376 in the compositions of this invention can be supplemented or replaced by an antibody that binds to this protein. This antibody can be monoclonal or polyclonal.

In the case of nucleic acid molecules SEQ ID NO:1-8376 in the compositions of this invention can be supplemented or replaced by a nucleic acid that can gibridizatsiya with nucleic acid of Neisseria, preferably under conditions of "high stringency" (for example, 65°in the solution of 0.1×SSC, 0.5% of LTOs).

It should be clear that any nucleic acid in these compositions may take a variety of forms (for example, be single-stranded, double-stranded, be in the form of vectors, probes etc). In addition, the term "nucleic acid" includes DNA and RNA, as well as their analogues, such as analogues containing modified frames, as well as peptide-nucleic acids (NCP), etc.

In some embodiments, the composition contains molecules of different species of Neisseria, such as one or more molecules N.meningitidis and one or more molecules N.gonorrhoeae. In some embodiments, the composition may contain molecules of different serological groups and/or strains of the same species, such as strains a and b N.meningitidis. Additional options contain a mixture of one or more molecules N.meningitidis of different strains, as well as one or more molecules N.gonorrhoeae.

Many proteins are relatively conservative in various species, serological groups and strains N.meningitidis and N.gonorrhoeae (for example, SEQ ID NO:52, 54, 58). PCT/IB00/00642 includes a more detailed analysis of conserved regions in these proteins. To ensure maximum cross-recognition and reactivity between strains in the field of proteins, which are conservative in various species, serological groups and strains of Neisseria, can be used in com is Aziziyah of the present invention. Thus, this invention represents proteins that contain the sites of amino acid sequences that are common in most Neisseria, particularly N.meningitidis and N.gonorrhoeae. Thus, preferably, the composition contains a protein containing a fragment of the protein of Neisseria (preferably the protein of SEQ ID NO:1-8376 or more preferably SEQ ID NO:1-4002), and the specified fragment consists of n consecutive conservative amino acids. Depending on the specific protein n is 7 or more (e.g., 8, 10, 12, 14, 16, 18, 20 or more). This fragment preferably contains antigenic or immunogenic site of the protein of Neisseria. “Conservative” amino acid is an amino acid that is present in a particular protein in Neisseria at least x% of Neisseria (or, preferably, in at least x% of both strains of N. meningitidis and N. gonorrhoeae). The value x may be equal to 50% or more, for example 66%, 75%, 80%, 90%, 95% or even 100% (i.e., this amino acid is found in this protein in all Neisseria). To determine whether amino acid “conservative” in a particular protein of Neisseria, it is necessary to compare this amino acid residue sequences of the studied protein from a variety of different Neisseria ("reference population"). The appropriate definition of "reference population" can be found in PCT/IB00/00642. Amino acid PEFC is the different sequences of Neisseria can be easily compared using computers. Usually this comparison includes a comparison of the number of sequences using the algorithm, e.g., CLUSTAL [Thompson et al. (1994) Nucleic Acids Res. 22:4673-4680; Trends Biochem. Sci (1998) 23:403-405] or preferably a PILEUP [part of the Wisconsin GCG package, preferably version 9.0]. Conservative amino acids are easily found when comparing multiple sequences - in this amino acid position most of the mapped sequences will contain a specific amino acid. Conservative amino acids can be made more visible using a program such as BOXSHADE [available, for example, at the NIH on the Internet], PRETTYBOX [GCG Wisconsin, version 10] or JALVIEW [available at EBI, on the Internet].

Thus, specific compositions in accordance with this invention include compositions containing:

two or more biological molecules selected from SEQ ID NO:1-4002;

- one or more biological molecules selected from SEQ ID NO:1-4002, combined with one or more biological molecules selected from SEQ ID NO:4003-8376;

- one or more biological molecules selected from SEQ ID NO:1-4002, combined with protein NspA (as described in WO 96/29412; see also figure 29 here), preferably in Mature form;

- one or more biological molecules selected from SEQ ID NO:1-8376 (preferably SEQ IDNO:1-4002), combined with transferrinsgttigung protein A (b) and/or (b), for example b and b described in WO 00/25811) (or immunogenic fragments);

- one or more protein fragments selected from SEQ ID NO:1-4002, and this fragment preferably contains a plot of conservative amino acids;

- combination of different proteins, and this combination as a whole includes one or more proteins that are recognized by each strain in the reference population, although each individual protein in this combination itself is not recognized by each strain in the reference population, i.e. each member of the reference combination learns at least one protein in a given combination.

This invention is also compositions of the present invention for use as a drug (such as immunogenic compositions or vaccines) or as diagnostic reagents. It is also the use of these compositions for the production of: (i) a medicinal product for the treatment or prophylaxis of infections caused by bacteria Neisseria; (ii) a diagnostic reagent for detecting the presence of bacteria Neisseria or antibodies induced against bacteria Neisseria; and/or (iii) reagent, which can induce the production of antibodies against the bacterium Neisseria.

The invention also provides methods for the treatment of the patient, introducing this patient a therapeutically effective amount of a composition in accordance with this invention.

In addition, this invention is a method of obtaining a composition in accordance with this invention, providing the stage of combining one or more of SEQ ID NO:1-8376 with one or more of SEQ ID NO:1-8376.

Brief description of drawings

Figure 1 shows the results of electrophoresis of the LTO-page for expression of ORF 6, 7, 13, 65-1, 72, 73-1, 105-1, 137-1, 143-1 and 147-1. The left track shows the molecular mass markers (set M1).

Figure 2 shows the results of electrophoresis of the LTO-page for ORF9, (C) the position of the immunoreactive bands N.meningitidis Western-blotting in relation to the preparation of vesicles of outer membrane N.meningitidis, (C) FACS-analysis.

Figure 3 shows the results of electrophoresis of the LTO-page for expression ORF 2-1, 5-1, 22-1, 132-1 and 4. The left track shows the molecular mass markers (set M1).

Figure 4-28 shows a graph of hydrophilicity (top), antigenic index (average) and AMPHI-plots (bottom) for ORF 2, 5, 6, 7, 9, 13A, 15, 22, 23, 27, 28, 32, 65, 72, 73, 76, 79, 89, 105, 106-1, 132, 137, 138, 143 and 147.

Figure 29 shows the variability of the sequence NspA from different strains of meningococcus C. These sequences can be used as alternatives NspA WO 96/29412 (SEQ ID NO:4008-4033).

Figure 30 p. which shows the binding of polyclonal anti-rNspA using indirect fluorescence flow cytometry with encapsulated and unencapsulated public menB strains.

Figure 31 shows similar data for encapsulated strains 8047, CU385 and M (31A) and unencapsulated public strains BZ232, MS, NG3/88 and NGB165 (V).

Figure 32 shows the model of the secondary structure of the NspA.

Figure 33 shows FACS analysis of unencapsulated public strain M7 (37A) and treated with ethanol (for destruction capsules) strains 2996, N44776, MS, 1000, BZ232, BZ133, NG6/88, BZ198, NG3/88, 297-0, BZ147 and BZ169 (37V) using tetravalent mixture.

Figure 34 shows FACS analysis of strain M7 using a pentavalent mixture at dilutions of 1:400 (34A), 1:200 (34B) and 1:100 (34C).

Examples

Example 1. Experiments on the expression and purification

In ORF 6, 7, 13, 65-1, 72, 73-1, 105-1, 137-1, 143-1 and 147-1 described in WO 99/24578, expressed in E. coli and purified, as shown in table 1:

Table 1

ORFHis-hybridGST-hybridCleanMW (kDa)
6 +GST-hybrid23
7++GST-hybrid28
13 +GST-hybrid10
65-1 +GST-hybrid32
72+  His-hybrid13,5
73-1 +GST-hybrid13
105-1++His-hybrid32
137-1 +GST-hybrid31
143-1++His-hybrid23,5
147-1-+His-hybrid32

Note: ORF73-1 expressively in the form of a fragment (amino acids 41-161).

The protocols used for the expression of these ten ORF, were essentially the same as those described in WO 99/24578, using vectors pGEX and pet. Examples of PCR primers used for amplification of these ORFS listed in table 2:

The results of the electrophoresis of the LTO-page for these ten expressed ORF is shown in figure 1.

ORF-His-hybrid used for immunization of mice. These sera were used in ELISA essentially as described in WO 99/24578, and they gave positive results.

These proteins are also expressed and purified (results not shown):

ORFExpression of His-hybridExpression of GST-gibr is Yes Expressed in the form of a fragmentThe position of the amino acid fragment
ORF1 (S)---43-1087
ORF1 (β)not ODA.--1051-1457
ORF35-1--- 
ORF41not ODA.not ODA.-25-619
ORF46---25-433
ORF61not ODA.not ODA.-1-575
ORF83-1---15-313
ORF100-1not ODA.--21-376
ORF114-1not ODA.--1-1423
ORF124-1not ODA.not ODA.- 
ORF131-1not ODA.--22-135

The following PCR primers used for amplification of these ORF:

Each of these ORFS can be connected to one or more of the sequences SEQ ID N:1-8376.

Example 2. Expression and purification ORF9

ORF9, described in WO 99/24578, cloned into the vector pet and expressed in E. coli. Purified hybrid protein ORF-His were analyzed by electrophoresis in LTO-SDS page, as shown in figure 2A. Mice were immunized with purified ORF9-His and sera used for Western blot analysis (figure 2B), FACS analysis (figure 2C) and ELISA analysis. Protocols used were essentially the same as described in WO 99/24578.

These results confirm that ORF9 is a surface-exposed protein. ORF9 suitable for combining with one or more sequences of SEQ ID NO:1-8376.

Example 3. Additional experiments on the expression

Additional experiments on the expression and purification were carried out in E. coli for ORF 2-1, 5-1, 22-1 and 132-1 described in WO 99/24578, as shown in table 3:

Table 3

RFHis-hybridGST-hybridCleanMW (kDa)
2-1 +GST-hybrid26
5-1-+GST-hybrid33
22-1-+His-hybrid49
132-1-+GST-g of the brides 48

The protocols used for the expression of these four ORFS were essentially the same as those described in WO 99/24578, using vectors pGEX and pet. Examples of PCR primers used for amplification of these ORFS listed in table 4:

The results of the electrophoresis of the LTO-page for these four expressed ORF is shown in figure 3.

Each of these ORFS can be combined with one or more of SEQ ID NO:1-8376.

Example 4. Expression and purification of lipoprotein ORF4

ORF4 is described in WO 99/24578 as containing lipopeptide signal sequence (LPSS). This full ORF amplified using the following PCR primers:

ORF4-L (direct) CGCGGATCCCATATGAAAACCTTCTTCAAAACC

ORF4-L (reverse) CCCGCTCGAGTTATTTGGCTGCGCCTTC

Amplificatory the DNA fragment cloned in the vector 21b+ for expression in the form of labeled His on-end hybrid. Culture in the logarithmic phase of growth of E. coli containing pET21b-orf4-LPSS, induced with 1.0 mm IPTG for 3 h at 30°C, collected by centrifugation for 10 min at 8000 g and resuspendable in SFR. The suspension was treated with ultrasound on ice and added Triton X-114 to a final concentration of 0.6% (vol./vol.). This material was incubated on ice for 20 min, then was heated to phase separation (defined by a high degree of turbidity). After the price is ripperology for 10 min at 10000 g, the upper aqueous phase was discarded, and below the phase of the detergent was collected without disturbing the bacterial sludge. To the phase of the detergent was added 13 volumes of 20 mm histidine, 2 mm EDTA, 30 mm NaCl (pH 5.8). This material was centrifuged for 10 min at 4°and the supernatant was combined portions at 4°C for 30 min with resin Q Sepharose Fast Flow (Pharmacia). The mixture was centrifuged, the supernatant was retained, and the resin was washed in 20 mm histidine, 2 mm EDTA, 30 mm NaCl (pH 5.8), Triton X-100 and 0.3% (vol./about.) and suirable 1 M NaCl in the same buffer. The major part of lipoprotein Orf4 was detected in the supernatant obtained after binding. Final purification was performed by chromatography on a Hi-Q TrapTM (Pharmacia). The supernatant after binding was brought to pH 7.0 by addition of 0.1 M Hcl and applied to a column Hi-Q TrapTM, equilibrated with 50 mm Tris-Hcl (pH 7.0), 2 mm EDTA, 0.3% Triton X-100, 10 mm NaCl. The column was washed 5.0 ml of the buffer used for equilibration and suirable NaCl gradient from 10 mm to 1 M was Suirable two different electrophoretic forms of the protein. One in the wash solution and the other in the NaCl gradient between 150 mm and 300 mm NaCl. The protein obtained in the washing solution used for immunization of mice. This form of protein is probably completely protestirovanny, limitirovannoe molecule.

Purified lipoprotein 31 kDa presented on figure 3. ORF4 is suitable for combining with one or more placentas what telestai SEQ ID NO:1-8376.

Example 5. Computer prediction

Performed computer analysis of ORF 2, 5, 6A, 7, 9, 13A, 15, 22, 23, 27, 28, 32, 65, 72, 73, 76, 79, 89, 105, 106-1, 132, 137, 138, 143 and 147 (as described in WO 99/24578). Figure 4-28 shows, for each of these ORFS, schedule hydrophilicity (top), schedule antigenic index (average) and AMPHI-analysis (bottom). The program AMPHI used to predict T-cell epitopes [Gao et al. (1989) J. Immunol. 143:3007; Roberts et al. (1996) AIDS Res Hum Retrovir 12:593; Quakyi et al. (1992) Scand. J. Immunol. suppl.11:9] and it is available in the package DNASTAR Protean, Inc. (1228 South Park Street, Madison, Wisconsin 53715 USA).

Each of these ORFS can be a combination of one or more of the sequences SEQ ID NO:1-8376.

Example 6. Tetravalent mixture

Preparing a mixture of proteins 919 (WO 99/57280), 225 (WO 99/57280), ORF4 (WO 99/24578, example 26) and ORF40 (WO 99/36544, example 1) and was assessed using ELISA and FACS. The ELISA titers against 13 test strains were as follows:

StrainM7 conF2996MSBZ133BZ232N/761000
Title381767892172164148817945839906575
StrainBZ198NG6/88BZ169BZ147NG3/88297-0 
Title332959275--1287725640 

The FACS results are shown in figure 33. It is seen that tetravalent mixture gives excellent results, regardless of the specific strains of menB. In addition, anticavity induced against this mixture, strain 2996 is bactericidal until dilution 1:2048.

Example 7. Pentavalent mixture

Preparing a mixture of protein ORF4-L (limitirovannoe protein - see example 4 above), ORF37 (WO 99/24578, example 1), ORF40 (WO 99/36544, example 1), 502 (WO 99/52780, pages 687-690) and 8 (WO 99/57280, pages 165-167). The ELISA titers against 13 test strains were as follows:

StrainM7 conF2996MSBZ133BZ232N/761000
Title--25428-58300>109350>109350
StrainBZ198NG6/88BZ169BZ147NG3/88297-0-
Title10999109532428882832410421233996-

The FACS results are shown in F. the góra 34. Obviously, pentavalent mixture gives excellent results, regardless of the specific strains of menB. In addition, anticavity induced against this mixture, strain 2996 is bacteriostatic.

Example 8. Trivalent mixture

Protein ORF1 (for example, example 77 WO 99/24578; see also WO 99/55873), ‘287’ (for example, figure 21 WO 99/57280; SEQ ID NO:3103-3108 it) and ‘919’ (for example, figure 23 WO 99/57280 and SEQ ID NO:3069-3074 it) were combined and added as adjuvant Al(Oh)3. These proteins were from strain 2996 MenB.

This mixture was combined with polysaccharide conjugate antigen MenC [Constantino et al. (1992) Vaccine 10:691-698]. OMV were used as controls.

The mixture used in bactericidal analysis against the homologous strain and heterologous strains of MenB. The titles were as follows:

 2996BZ133BZ2321000MSNGH38
Trivalent204820484<4644
+MISP2048>3200041281024128
Control32765409681921638416384 8192

Example 9. Proteins 287, 919 and 953

Proteins 287, and 953 919 described in WO 99/57280. These proteins from strain 2996 serological group N.meningitidis expressed and experienced in bactericidal analysis with respect to the strain 2996 single and in combinations. OMV from 2996 used as a positive control.

Antigen287919953Control
Title8192204812865536
Combination287+919287+953919+953287+919+953
Title32000819281928192

Figure 35 shows FACS data for individual antigens and for the four combinations.

Obviously, mixtures of antigens are more effective than single antigens, and, in particular, that the combination 919+953 give surprisingly good results.

Individual antigens from 2996 and combinations were tested against strains a, b and C of different serological groups (i.e., heterologous stimulation). Bactericidal titers were as follows:

MenA
AntigenStrains of serological group b (Mepv)MenC
 2996BZ133BZ232MSNGH38F6124C11
2878192>40962561024204810242048
9192048-1024----
953128------
287+91932000>40965125121024512>2048
287+9538192>4096102451220482048>2048
919+9538192-8192----
Trivalent8192>2048256-1024>2048>2048
Control65536-81922048-204832768

It is obvious that these compounds antigen is applicable for cross-activity of strains.

In the second series of experiments the titles for the individual antigens were as follows:

AntigenStrains of serological group b (Mepv)MenAMenC
 2996BZ133BZ232MSNGH38F6124C11
287160002048165122048641024
91916000-2048----
9532048-16----

These three proteins used in this example, expressed and used in the following forms:

(1) protein 287 expressed in E. coli as GST - hybrid;

(2) protein 919 expressed in E. coli without its leader peptide, without his Mature N-terminal cysteine and without any hybrid partner (“919-without a label”); and

(3) protein 953 expressed using his-tag tag.

Three immunizations were performed with adjuvants's adjuvant - the first consisted of CFA, and the last two were included IFA.

Example 10. Additional p is levelentry combination

Additional combinations of antigens were tested in mice CD1:

Antigens *AdjuvantFACSELISABactericidal activity
919-his+0rf4-his+225-his+0rf40-hisThe blockers++++8192
Orf4-L+Orf37-GST+Orf40-his+502-his+8-hisThe blockers++++bacteriostatic
919-unlabeled+791-his+792-hisThe blockers++++4096
919-unlabeled+287-GST+953-hisThe blockers++++8192
919-unlabeled+281-GSTThe blockers++++32000
287-GST+953-hisThe blockers++++8192
919-unlabeled+953-hisThe blockers++++8192
919-unlabeled+Orfl-his+287-GSTAl(Oh)3++++2048
919-unlabeled+Orfl-his+287-GST+MenC glycoconj.Al(Oh)3++++2048
Orf-46.1-his+287-GSTAl(Oh)3not ODA.  128

*: "his" refers to the expression and immunization labeled histidine protein;

"ORF4-L" denotes limitirovannoe form ORF4;

"GST" means the expression and immunization GST - hybrid protein;

"919-unlabeled" means the same as in example 9;

"MISP glycoconj." denotes the MISP-glycoconjugate described in example 8.

Additional combinations of antigens were tested in Guinea pigs:

AntigensAdjuvantFACSELISABactericidal activity
919-his+287-GST+953-his+Orf46.1-hisThe blockers++4096
919-unlabeled+287-GST+953-hisThe blockers++4096
287-GST+953-hisAl(Oh)3not ODA.+256

Obviously, these combinations provide excellent immunological results.

Example 11. Combination NspA

Protein NspA described in WO 96/29412 and presented here as SEQ ID NO:4008-4033. In accordance with scientific data on this protein [Martin et al. (1997) J. Exp. Med. 185 1173-1183] this protein is highly conserved in strains of Neisseria (99% cross-reactivity of antibodies against NspA with 250 meningococcal strains a, b and C), and is also an effective protection against the harmful contamination of live bacteria. There were reports that the NspA adsorbed on alum, causes humoral response characteristic of bacterial meningococcal disease in rabbits and monkeys [Martin et al. (1998) Abstracts of the 11thInternational pathogenic Neisseria conference, page 198]. Based on these data, rNspA (recombinant NspA) developed as a vaccine for prevention of meningococcal disease caused by all serological groups.

However, despite the conservatism of the sequence, it has been unexpectedly found that the epitopes of cell surface rNspA - are only detected in 65% of strains serological groups and sensitivity to the bactericidal activity of antibodies against NspA also is smaller in comparison with the data of Martin et al. These results contradict the results of Martin et al. and assume that In meningococcal-vaccine-based rNspA should be supplemented by additional antigens to be effective.

N.meningitidis strains tested in this example were selected from patients in different countries, over a period of more than 30 years (see table on page 87 description in Russian language). These strains were subjected to selection in such a way that they are representative of widely divergent "clonal" groups, as defined by typing multiloci isoenzymes [Seiler et al. (1996) Mol. Environ. 19:841-856] and/or typing of multila usnih sequences [Maiden et al. (1998) PNAS USA 95:3140-45]. Strain M7, which is derived from strain NMB, contains the insertion of a transposon, which blocks the biosynthesis of capsular polysaccharide [Stephens et al. (1991) Infect. Immun. 59:4097-4102], but all other strains are encapsulated.

On the basis of the nucleotide sequence in Martin et al. (1997)were designed to PCR primers was amplified NspA gene from strain 8047. This sequence, including the promoter site, cloned in plasmid pSK+ (rNspA). Also used plasmid pTrc.NspA.1, protein-coding, in which part of the signal sequence was replaced polyhistidine label. Both plasmids expressed in E. coli strain BL21 (DE3) and these proteins were purified. In E. coli rNspA secreted but remains associated with the outer membrane. This protein was partially purified from culture medium by precipitation of 55% (weight/volume) ammonium sulfate and he had an approximate molecular weight (MW) of 18.6 kDa) confirmed by Western blot testing.

Two forms NspA (rNspA and denatured labeled histidine NspA) were injected with in a six-week female mice CD-1 to obtain antisera. Their ability to contact the surface strain In N.meningitidis was determined using flow cytometrical detection indirect fluorescence analysis [Granoff et al. (1998) J.Immunol. 160:5028-36]. Results for NMB strains and M7 (without the capsule mutant is NMB) is shown in figure 30. As expected, monoclonal antibody (mAb) SEAM-3 in respect of the polysaccharide group [Granoff et al.] associated only with encapsulated strain, whereas a positive control mAb against R (Horns) associated with both strains. Anticavity induced in respect rNspA able to link the two strains. However, antisera against labeled histidine NspA gave negative results. These antisera were also negative for strains 8047, CU385 and M (figure 31A), but when Western-blotting these antisera gave positive results.

These results suggest that antibodies obtained using labeled histidine NspA, recognize epitopes that are present in the denatured NspA, but not in native NspA detected on the cell surface in vivo. In contrast, antibodies raised against rNspA, apparently, recognize conformational epitopes NspA.

Running cytometrics analysis was applied to the strains shown in the table on page 87. Figure 31A shows that mouse antibodies induced against rNspA, contact surface strain 8047 (strain, which was cloned gene nspA) and strain CU385, but not M. Figure V shows similar negative results for strains BZ232, MS, NG3/88 and NGP165. However, all these negative cases, the control ol revocable mAb was positive.

The table on p.85 summarizes the results of flow cytometry. Although it was reported that the NspA is available on the surface of all tested intact strains N.Meningitides [Martin et al. (1997) J. Exp. Med. 185 1173-1183; Plante et al. (1999) Infect. Immun. 67:2855-61], only 11 of the 17 tested strains (65%) interacted with sera against rNspA. He was a significant relationship between the expression of cell surface-specific strain and classification (by serotype, subtype or electrophoretic type) or the year or country selection.

In an attempt to explain these differences in reactivity with sera against rNspA, sequenced genes nspA five of the six negative strains (VH, NG3/88, NGP165, M and M) and three positive strains (8047, CU385 and NG6/88). The sequence for the sixth negative strain (MS) was already known on the basis of the complete genomic sequence.

Sequence nspA for all ten strains were highly conserved, with a variation of at most 5 nucleotides in comparison with the sequence of the prototype by Martin et al. Most of the variant protein had only 3 different amino acids (see figure 29). With one exception, all amino acid variants included the same respective balances in individual segments of this protein. They consisted of a signal peptide, which was not present in the Mature protein, and two short segment of the 50 C-terminal residues. These differences do not explain the results obtained with antisera, as there are examples of identical variant sequences in strains that were positive, and the strains that were negative (comparison M and 8047; NG165 and NG6/88; MS and CU385).

Since neither the absence of the gene or polymorphism did not explain obtained with antisera results, determined the amount of protein NspA in the outer membranes of five strains (8047, CU385 and NG6/88 - all positive anti-rNspA; M and M - both negative). Precipitation of bacterial cells were extracted with laurylsarcosine and analyzed fraction insoluble outer membrane. The band 18.6 kDa was visible for all five strains and it was cross-reactive with anti-His-tagged-NspA according to Western-blotting. Thus, differences between strains in the expression of nspA also could not explain these results.

The ability of anti-rNspA contact with the surface of bacterial cells could influence the number present polysaccharide capsule. Therefore, the amount of capsular polysaccharide produced 17 test strains was evaluated using inhibition ELISA.

Extracts capsular polysaccharide was obtained by the method described Corn et al. [J. Infect. Dis. (1993) 167:356-64]. Individual bacterial clones were grown to OD6200,5-0,7 7 ml of broth Mul the EPA-Hinton. Bacteria were collected by centrifugation at 5000g for 15 min, washed with 0.6 ml of 10 mm HEPES, pH 8.0, and then resuspendable in 0.6 ml of the same buffer containing 10 mm EDTA, and incubated at 37°C for 1 hour. Cells were besieged at 10,000 g for 1 min and the relative amount of polysaccharide antigen of Neisseria meningitides, released in the supernatant was determined using inhibition ELISA carried out as described Azmi et al. [Infect. Immun. (1995) 63:1906-13]. Solid-phase antigen in ELISA was complex polysaccharide meningococcus B-ADH-Biotin, absorbed coated Avidya microtiter tablets [Granoff et al.]. Reactive against meningococcus polysaccharide In paraprotein LIP [Azmi et al.] used as the primary antibody (0.2 ág/ml). In the absence of inhibitor, the concentration of antibodies was sufficient to obtain OD ~0,7-1,0 after 30 min of incubation with the substrate [Azmi et al.]. The title of the polysaccharide released in the supernatant was measured by determining the dilution of the supernatant, which resulted in a 50% inhibition of antibody binding sites. The controls in this analysis included EDTA-extract obtained from strain M7, which does not produce capsular polysaccharide, purified polysaccharide of Neisseria meningitides Century To ensure that the entire capsular polysaccharide was recovered by treatment of EDTA, the same inhibitory ELIA was performed using sediment cells, resuspending in the same buffer and the volume of that and extract capsules. The observed inhibitory activity of this sediment cells was between 0 and 10% of the activity observed in extracts capsules with this sediment, with a higher percentage produced precipitation cells of strains that produce the highest number of capsules.

The results for each strain shown in table 5. On average, six negative anti-rNspA strains were produced three times more capsular polysaccharide than eleven positive strains (corresponding inverse geometric average breeding 676 224 against, p<0,05). This may explain the results obtained with anticorodal, it is clear that the presence of large quantities of capsules could interfere with the ability of anti-rNspA antibodies to contact the epitopes NspA, which are available in strains with smaller amounts of capsules.

The complement-dependent bactericidal activity of anti-rNspA antisera were tested using analysis similar to the analysis described Mandrell et al. [J.Infect. Dis. (1995) 172:1279-89]. The source of complement was human serum from a healthy adult without detected protivotarannogo antibodies to the polysaccharide of group b and without internal bactericidal activity against the tested strains. Bactericidal titers in serum were determined as razvedeni the serum, resulting in 50% decrease in CFU/ml after 60 min of incubation of bacteria in the reaction mixture, in comparison with the control CFU/ml at time 0.

Usually bacteria, inkubiruemykh with the negative control antibody was detected 150-200% increase in CFU/ml during the 60 min incubation. The positive control antibody [anticapsular IgG2a mAb SEAM12, Granoff et al.] found the complement-mediated bactericidal activity against all 17 strains. In contrast, six strains that were negative in relation to the binding of anti-rNspA antisera according to the continuous flow analysis, were stable in the absence of bactericidal or bacteriostatic effects. Ten of the remaining eleven positive strains were either killed by complement and antisera (SWZ107, J351, CU385, NG6/88, BZ198, N/76, NMB and 8047)or inhibited (N and S3446), but the strain of 1000 did not undergo any effect.

The ability of anti-rNspA antisera to confer passive protection against meningococcal-bacteremia experienced in young rats using the method described Saukkonen [J. Infect. Dis. (1988) 158:209-212]. Briefly, 6-7-day-old rats was randomly divided lactating females. Groups of 5-6 animals were infected intraperitoneally 100 ál of approximately 5000 CFU bacteria N. meningitidis group C. One strain, negative for surface epit the surface NspA (M986), and one positive strain (8047) were tested, and each of them was passively three times in young rats. Just before the introduction of the bacterial suspension was mixed with various dilutions of test or control antibody (positive control: anticapsular mAb; negative control: anti-E. coli). After 18 h after infection, blood samples were obtained from the heart. Aliquots were sown on chocolate agar and CFU/ml was determined after incubation over night at 37°With 5% CO2.

Protective activity of various jointly entered antibodies were as follows:

Treatment with antibodiesDose per rat or serum DilutionStrainBlood culture
   Positive/ total number ofCFU/ml (average x 10-3)CFU/ml (% of control)
Anticapsular mb2 mcgM0/6<1<1
Anti-rNspA1:5M6/644a45
Anti-rNspA1:25M6/693a95
Anti-.li control1:5M6/698aa
Anticapsular mb2 mcg80470/5<1<1
Anti-rNspA1:580471/60,2b2
Anti-rNspA1:2580471/50,4b4
Anti-E. coli-control1:580476/610bb

aR>0.5, and compared to the geometric average CFU/ml of the control rats.

bp<0,001 compared to the geometric average CFU/ml of the control rats.

As you can see, the dose of 2 μg per rat positive anticapsular control was protective against both strains. A dilution of 1:5 or 1:25 anti-rNspA antisera defended against bacteremia caused by strain 8047. However, none of the dilutions was not effective for the prevention of bacteremia M.

Thus, despite the positive findings of Martin et al., NspA, apparently, is not effective for prevention of infection with meningococcus Century, Approximately one third of the strains had reduced expression on the surface cllocation NspA when grown in vitro, the strains are resistant to induced anti-NspA complement-mediated bacterials and are resistant to passive immunization anticorodal. These strains produce large amounts of capsular polysaccharide and, therefore, as might be expected, have higher virulence. Thus, the ability of a vaccine containing only the NspA, to give a broad protective immunity against meningococcus, is doubtful.

Thus, compositions containing the NspA [SEQ ID NO:4008-4033; figure 29]preferably contain additional antigens. Thus, a preferred aspect of this invention is the combination of the NspA protein with one or more additional antigens of Neisseria.

Example 12. Fragments NspA

The figure 32 shows the model of the secondary structure of the NspA, containing eight transmembrane β-chains and 4 surface-exposed binding loops. This corresponds to the distribution of alternating hydrophobic and hydrophilic amino acids in the NspA, which is a characteristic of many β-cylindrical Parinov [Weiss et al. (1990) FEBS Letts 267:268-272].

The gray shaded area in this model indicate the segments that are to >40% identical and >70% relatively the same encoded amino acid sequence opacity proteins (OPA) from N.meningitidis, N.gonorrhoee, N.flavius, N. sicca and .influenzae identified in BLAST searches gene Bank CDS. Alternating sequences are predicted amphiphilic βchains; the vertical segments correspond to the transmembrane segments; the upper part of the figure corresponds to a surface-exposed segments, labeled loops 1-4.

According to Martin et al., the only significant homology between the decoded amino acid sequence NspA and sequences of other proteins are weak homology with a family of opacity proteins (OPA) in two small segments (~20 amino acids) With near-end of this protein. However, a separate comparison of N - and C-ends of the NspA with the gene Bank revealed a high degree of homology (>40% identity and >70% similarity) at the NspA protein and Ora of N.meningitidis, N.gonorrhoeae, N.flavius, N.sicca and .influenzae. It is believed that the proteins of the Er are integral membrane proteins that have the topology of eight transmembrane segments and β-cylinders in the membrane, similar to the topology porina [Merker et al. (1997) Mol. Environ. 23:281-293]. The presence of the NspA in the detergent-insoluble membrane preparations indicates that the NspA localized in the outer membrane, which is consistent with the Er-like membrane topology shown in this model. In addition, segments of the NspA, which are the most homologous relative to the segments be the Cove Ora, are possible transmembrane segments, shown in the shaded areas of figure 32.

Proteins opacity Neisseria can, under some circumstances, to induce protective antibody. However, the problems associated with the limited availability of antibodies proteins opacity in encapsulated bacteria, the variability of amino acid sequences in the exposed loop segments and the phase variation of protein expression during clinical infection was restricted in the ability of the Er to induce protective antibodies [Malorny et al. (1998) J. Infect. Dis. 172:1279-89]. In contrast, there is, apparently, a small variation or no variation in the sequence of the surface exposed loops NspA in figure 32. However, recently it was reported that a panel of monoclonal antibodies against NspA N.meningitidis, which reacted with all meningococcal investigated strains interacted only with a limited number of N.gonorrhoeae strains, even though the corresponding amino acid sequences in these two species are identical to 92%. When comparing corresponding sequences NspA meningococcal and gonococcal strains (figure 29) all relevant amino acid differences lead to changes in hydrophilicity or charge and localized in predpolozhiteln the x surface-exposed binding loops (figure 32). This discovery suggests that the binding loops in the NspA, which are highly conserved in N.meningitidis, can be an important epitopes for antibodies that bind to native NspA. Thus, these segments molecules, apparently, are of the greatest interest in relation to interaction with protective antibody. However, the estimated surface loops NspA are relatively small (10-14 amino acids) in comparison, for example, with highly immunogenic outer loops Horns and ORS (24-45 amino acids). The shorter length of these loops may limit the availability of surface epitopes NspA for binding interactions with the antibody serum, in particular, in the presence of frequent capsular polysaccharide.

Thus, this invention represents fragments of the NspA, which are exposed on the cell surface in the figure 32, namely SSSKGSAKG, NYKAPSTDFKLY, NRASVDLGGSDSFSQT and NYIGKVNTVKNVRSG, and represents the corresponding fragments of the allelic variants of the NspA. In addition, this invention is suppositionally these fragments, containing 7 or more contiguous amino acids of these fragments. The invention also provides proteins containing these fragments. Presents well as nucleic acids encoding these fragments and proteins.

These pieces NspA, proteins containing this the fragments, and nucleic acids can be used in the compositions of the present invention, in particular, as Vice full NspA. In an additional aspect, these fragments, proteins and nucleic acids can be used as a dedicated product, i.e. they should not be used in combination with other biological molecules.

It should be clear that the invention was described only as examples and that can be produced modifications while maintaining the ideas and scope of this invention.

Table 5.

The reactivity of polyclonal antisera anti-rNspA with native NspA exposed on the surface of live encapsulated bacteria Neisseria meningitidis, in terms of sensitivity to bacteriosis and education capsules

Strains of meningococci InSurface-Cell ReactivitywithNspABactericidal activitydanti-rNspA (1/titer)The production of Capsular Polysaccharide (1/titer±SE)
StrainCountryYearSerological classificationET-complex   
SWZ107aSwitzerland 19804:R104Positive≥6428±4
NG6/88aNorway1988NT:P1.1173Positive4115+23
CU385bCube19804:P1.155Positive4116±1
NFinland198615:R,16not ODA.Positive16176±61
BZ198Netherlands1986NT:P154Positive≥64362±1
NMBUSA19682b:P1.2,5not ODA.Positive16244±20
8047USA19782b:P1.2not ODA.Positive161125±50
N/76Norway197615:R,165Positive2499±16
1000aThe USSR1989NT:1.5 61Positive<4287±12
S3446bUSA197214:R,1411(A1 cluster)Positive<4 (static.=16)585±151
NbNorway197315:R11 clusterPositive<4(static.=4)656±141
BZ232aNetherlands1964NT:P1.276Negative<41493±18
NG3/88aNorway19888:RA4 clusterNegative<4498±105
MSUK198515:P1.7,16b5Negative<4627±121
M136bUSA196811:P1.15D1 clusterNegative<41056±81
M986bUSA19632A:R,2B2 clusterNegative<41442±206
NGP165Norway1974NT:P1.237Negative<4138±6

andindicates the strains that were characterized further by means of typing multiloci sequences [Maiden, 1998].

bindicates the strains obtained from the collection of the Frasch, US FDA. 8047 was obtained from W.Zollinger, Walter Reed Army Institute of Research, Washington, D.C. MC58 is a strain selected using the TIGR for genomic sequencing. J351 was obtained from .Sarvas, National Public Health Institute, Helsinki, Finland. Other strains taken from the collection described by Seiler et al. [The Seller, 1996]. THE data derived from Caugnant et al. [J.Infect. Dis. (1990) 162:867-874] and Seiler et al.

cmeasured by indirect fluorescence flow cytometry using anti-rNspA antisera.

dbreeding anti-rNspA antisera that at incubation for 60 min with bacterial cells and 20% of the human complement was given ≥50% reduction in CFU/ml compared with this value at time 0. “Static” refers to strains that were ingibirovany, but not killed in this analysis (≥50%but <100% survival at 60 min).

eThe titer is defined as the dilution of the extract capsules, giving 50% inhibition of antibody binding to the polysaccharide antigen meningo is occa In ELISA.

1. Composition for treatment or prevention of infection caused by the bacterium Neisseria, including the first protein and the second protein derived from Neisseria meningitidis, in which:

the first protein comprises the amino acid sequence which has 65% or more identical to the sequence of SEQ ID NO:2182, 2184, 2186 and/or 8348, and/or is a fragment consisting of 10 or more amino acids of SEQ ID NO:2182, 2184, 2186 and/or 8348, exhibiting the properties of antigen; and

the second protein comprises the amino acid sequence which has 65% or more identical to the amino acid sequence selected from the group consisting of SEQ ID NO:4004, SEQ ID NO:4006, SEQ ID NO:4007, SEQ ID NO:4008-4056, SEQ ID NO:6217-8347, SEQ ID NO:8349-8376 and SEQ ID NO:2-4002 with even numbers, and/or is a fragment consisting of 10 or more amino acids of SEQ ID NO:4004, SEQ ID NO:4006, SEQ ID NO:4007, SEQ ID NO:4008-4056, SEQ ID NO:6217-8347, SEQ ID NO:8349-8376, SEQ ID NO:2-2180 with even numbers and SEQ ID NO:2188-4002 with even numbers exhibiting the properties of antigen.

2. The composition according to claim 1, wherein the second protein comprises the amino acid sequence which has 65% or more identical to the sequence of SEQ ID NO:648, 650, 652, or 654, and/or is a fragment consisting of 10 or more amino acids of SEQ ID NO:648, 650, 652, or 654.

3. The composition according to claim 1, wherein the second protein comprises the amino acid sequence to the I 65% or more identical to the sequence of SEQ ID NO:6249, and/or is a fragment consisting of 10 or more amino acids of SEQ ID NO:6249.

4. The composition according to claim 1, wherein the second protein comprises the amino acid sequence which has 65% or more identical to the sequence of SEQ ID NO:3898, 3900 or 3902, and/or is a fragment consisting of 10 or more amino acids of SEQ ID NO:3898, 3900 or 3902.

5. The composition according to claim 1, wherein the second protein is a protein NspA, preferably in a Mature form.

6. The composition according to claim 1, additionally containing adjuvant.

7. Composition according to any one of claims 1 to 6, used as a drug for treatment or prevention of infection caused by the bacterium Neisseria.

8. Composition according to any one of claims 1 to 6, used for the manufacture of a medicinal product for the treatment or prevention of infection caused by the bacterium Neisseria.



 

Same patents:

FIELD: genetic engineering, immunology, medicine.

SUBSTANCE: invention relates to new antibodies directed against antigenic complex CD3 and can be used in therapeutic aims. Antibody IgG elicits the affinity binding with respect to antigenic complex CD3 wherein heavy chain comprises skeleton of the human variable region in common with at least one CD3 taken among amino acid sequences SEQ ID NO 2, 4 and 6 and their corresponding conservatively modified variants. Light chain comprises skeleton of the rodent variable region in common with at least one CD3 taken among amino acid sequences SEQ ID NO 8, 10 and 12 and their corresponding conservatively modified variants. Antibody is prepared by culturing procaryotic or eucaryotic cell co-transformed with vector comprising recombinant nucleic acid that encodes antibody light chain and vector comprising recombinant nucleic acid that encodes antibody heavy chain. Antibody is administrated in the patient suffering with malignant tumor or needing in immunosuppression in the effective dose. Invention provides preparing chimeric antibodies against CD3 that are produced by expression systems of procaryotic and eucaryotic cells with the enhanced yield.

EFFECT: improved preparing methods, valuable medicinal properties of antibody.

33 cl, 5 dwg, 1 ex

FIELD: biotechnology, microbiology, agriculture.

SUBSTANCE: the strain Lactobacillus plantarum 578/25 is obtained by method of step-by-step selection and selected by its ability to produce significant amount of crude protein and to accumulate the biomass. The strain is deposited in the VGNKI collection at number VGNKI-03.04.09.-DEP. Invention provides eliminating the pollution of environment in producing the protein fodder, to elevate the protein specific yield, to reduce energy consumptions in preparing protein fodder, to simplify and to accelerate the process of its preparing, to simplify apparatus equipment, to utilize waste in manufacturing using the natural raw.

EFFECT: valuable properties of strain.

2 tbl, 10 ex

FIELD: biotechnology, agriculture, microbiology.

SUBSTANCE: invention relates to a new isolated strain of Lactobacillus acidophilus 1660/08 as a producer of the protein fodder. The strain Lactobacillus acidophilus 1660/08 is obtained by the selection method and selected by its ability to form significant amount of crude protein and to accumulate the biomass. The strain is deposited in the VGNKI collection at number VGNKI-03.04.10.-DEP. Invention provides eliminating the environment pollution in producing the protein fodder, to enhance the specific protein yield, to reduce energy consumptions in preparing protein fodder, to simplify and to accelerate the process in its preparing, to simplify equipment fitting out and to utilize waste in manufactures using natural raw.

EFFECT: valuable properties of strain.

2 tbl, 10 ex

FIELD: fodder industry.

SUBSTANCE: invention relates to a method for preparing protein-vitamin fodder that involves solid or liquid waste in production and processing the natural raw (grains, milling waste, post-alcoholic distillery grains, beer pellets, fruit pulps or whey). Enzyme lysates are prepared from solid waste and starch waste. Cobalt salt is added to liquid waste or enzyme lysates. Prepared nutrient medium is used in incubation of lactobacillus and propionibacillus microorganisms taken by the following pairs: Lactobacillus acidophilus 1660/02 with Propionibacterium freudenreichii subsp. shermanii 103/12; or Lactobacillus acidophilus 1660/02 with Propionibacterium acnes 1450/28; or Lactobacillus plantarum 578/25 with Propionibacterium freudenreichii subsp. shermanii 103/12; or Lactobacillus plantarum 578/25 with Propionibacterium acnes 1450/28. This method provides preparing fodder enriched with vitamins and proteins and containing live cells of lactobacillus and propionibacillus microorganisms. Method enriches animal intestine microflora after feeding the prepared fodder to animals. Fodder comprises protective substances (organic acids, enzyme systems) and can be stored as crude form for the prolonged time.

EFFECT: improved preparing method, valuable properties of fodder.

13 cl, 1 tbl, 12 ex

The invention relates to the field of biotechnology, specifically to obtain protein/factor inhibiting osteoclastogenesis (OCIF), and can be used for treatment and immunological diagnosis of diseases involving bone resorption

The invention relates to biotechnology and is a purified and isolated nucleic acid molecule that encodes a protein of the bacteria Moraxella catarrhalis or immunogenic fragment transferrin receptor, as well as a method of obtaining a recombinant protein transferrin receptor

The invention relates to the medical industry and relates to antigens of Neisseria meningitidis and their compositions

The invention relates to methods of producing immunogenic proteins from genomic sequences of Neisseria, including amino acid sequences listed in the description, and the corresponding nucleotide sequence given in the description, as well as the genome sequence of Neisseria meningitidis

The invention relates to crystalline polyhydroxylated 8-cyan-1-cyclopropyl-7-(1S,6S-2,8-diazabicyclo[4.3.0]nonan-8-yl)-6-fluoro-1,4-dihydro-4-oxo-3-quinoline-carboxylic acid of formula (VI)

The invention relates to pharmaceutical compositions cefuroxime aksetila in the form of particles

The invention relates to medicine, in particular the production of medicinal substances from the funds of vegetable origin
Up!