An isolated nucleic acid encoding a polypeptide tag 7, the isolated polypeptide tag 7, the method of inhibiting tumor growth in mammals (options), and a method of treating cancer in an animal(options)

 

The invention relates to biotechnology and medicine and can be used to obtain the tag7 polypeptide and inhibition of tumor development. The tag7 polypeptide or an isolated nucleic acid encoding the tag7 polypeptide, is used to inhibit the development of tumors in a mammal and treatment of cancer by affecting the cell. The impact of nucleic acid, in particular, is carried out using a vector or virion. The invention allows the development of drugs for the treatment of carcinoma, melanoma, sarcoma, and leukemia. 6 N. and 29 C.p. f-crystals, 36 ill., 5 table.

The scope of the invention

The invention relates to the field of molecular biology, cancer biology and therapeutic medicine. The invention is mainly aimed at the identification of genes that inhibit the growth of cancer cells and cause them to apoptosis, and to polypeptides encoded by such genes. In particular, the invention relates to a nucleotide sequence of one of these inhibiting tumor genes, tag7, the amino acid sequence of the polypeptide encoded by tag7, antibodies that specifically bind tag7 gene product, and methods of inhibiting the development of cancer cells and cancer therapy with p the left cells is a complex process, including a complex cascade of processes. Among these processes, the proliferation of tumor cells and the blocking mechanism of apoptosis (see Harrington E. A., and others in the journal Embo J. 73:3286-3295 (1994)), the spread of tumor cells in the surrounding tissues, the penetration of tumor cells into the circulation paths of blood and lymph and the consolidation and reproduction of cancer cells in the new location (see article Schirmacher, A. E. journal of Adv.Cancer Res. 43: and Liotta L. A., and others in the journal Lab.Invest.49:636-649 (1983)). While the molecular mechanisms of induction of metastasis phenotype remain poorly studied; it is likely that when the tumor becomes metastatic, the activation and/or inactivate various regulatory and structural genes. Describes several genes whose expression is correlated with the potential ability of tumors to metastasize (see article Yasushi T. and others in the journal J. Biol.Chem. 269(37): 22958-22963 (1994); Ebralidze, A. K., and others in the journal Genetika (USSR),25(5): 932-936 (1989); Wolf S. and others in the journal Proc.Natl.Acad.Sci. USA 90:1843-1847 (1993); Bernbard E. J., and others in the journal Proc.Natl.Acad.Sci. USA 91;61-65; Sato N. and others in the journal Nature 370:61-65 (1994)).

It was assumed that the population of cells within a certain tumors may be heterogeneous in terms of their potential to metastasize (see Fidler I. J. and Natalie on the potential to metastasize differ markedly from one of the parental tumor. For example, received tumors that can be transplanted mouse and which have a variable frequency and specificity of metastasis in relation to the body, as a result of the nature of metastasis (see article V. M. Senin log Vestn.Akad.Med.Nauk.SSSR 0(5): 85-91 (1984)).

Polypeptides, inhibiting tumor

A number of polypeptides, estestvennim produced by mammalian cells, exhibit antitumor activity (i.e. induce a delay in growth, apoptosis and/or differentiation of cancer cells). For example, it is reported that combinations of certain cytokines, such as interleukins and colony-stimulating factors induce the final differentiation and concomitant delay in the growth of some types of tumor cells and cell lines (see review, this Pimental E. in Handbook of Growth Factors, Vol.1, Roca Raton, Florida: CRC Press, c.28-34 (1994)). Moreover, transforming (-growth factor (TGF-and interferons are known as potential inhibitors of the development of tumor cells under certain conditions in vivo and in vitro (see Keski-Oja J., and Moses, H. L. journal Med-Biol. 66:13-20 (1987); article Ohta M., and others in the journal Nature 329:539-541 (1987)). Other natural polypeptides mammals are diverse about the rose tumors (TNFs) (see browse this Pimental E. in Handbook of Growth Factors, Vol.3, Roca Raton, Florida: CRC Press, c.241-278 (1994)).

It was recently identified TNF family of cytokines and their receptors, whose structural properties to some extent is normal. This family includes systems of receptor-ligand of the TNF, LT-, LT-, Fas, CD27, CD40, OX-40 and growth factor nerve (NGF) (see C. Smith and others in the journal Cell 76:959-962(1994); R. J. Armitage in the journal Curr.Opin.Immunol. 6:407-413 (1994)). Except NGF, all of these TNF-a cytokines, as expected, are involved in the regulation of the immune system. TNF and lymphotoxin-alpha (LT-or TNF-) is a cytokine involved in many regulatory processes (see article Vassalli P. the journal Ann. Rev. Immunol. 10: 411-452 (1992); Paul N. and Ruddle N. journal Ann.Rev.Immunol. 6:407-438 (1988)), but their role in the immune system, although it is, without doubt, decisive, remains enigmatic (see Kossodo, S., and others in the journal of Exp.Med. 176:1259-1264 (1994)). TNF is synthesized by different cell types in response to various adverse effects; this is typically one of the primary events in the cascade of inflammatory processes, including a strong antitumor effect in mice (see Blankenstein T. and others in the journal J. Exp.Med.173:1047-1052 (1991)). AK is vorovannymi lymphocytes and a few cells of other types. On the contrary, LT-is produced only by lymphocytes and exists in membrane-bound form only through the dressing room complex with LT-(see J. Browning and others in the journal Cell 72:847-855 (1993)). LT-detects an action spectrum similar to the spectrum of TNF in in vitro systems, but weaker (see Browning and J. A. Ribolini in the journal J. Immunol. 743:1859-1867 (1989)). And TNF and LT-induce apoptosis in different systems (see J. Cohen J. and others in the journal Ann. Rev.Immunol. 10:267-293 (1992); Golstein P. and others in the journal of Immunol.Rev.121:29-65 (1991); A. Sarin and others in the journal J. Immunol. l55:3716-3718 (1995)). Recently it was reported about the inhibition of tumor growth mediated LT-(see Z. Qin and Blankenstein T. in the journal Cancer Res. 55-A747-4751 (1995)).

TNF and LT-also produced some tumor cells of various origin, such as fibrosarcoma mouse, the line of epithelial human cells as well as cells and cell lines of leukemia T-cells (see Rubin, B. Y., and others in the journal J. Exp.Med.164:1350-1255 (1986); Spriggs, D. R., and others in the journal J. Clin.Invest. 81:455-460 (1988); K. Ishibashi, and others in the journal Blood77: 2451-2455 (1991)). Genes encoding TNF, LT-and LT-P, lie at a short distance from one another A 53:8699-8702 (1986); Nedospasov, S. A., and others in the journal of Nucl.Acids Res. 14:7713-7725 (1986); S. Gardner, M. and others in the journal J. Immunol. 139:476-483 (1987)). It appears that these genes are evolutionary related and form a locus due to tandem duplications of the gene, although the opposite orientation of transcription LT-means that there may be more complex evolutionary processes. The last time was cloned and identified as inducing apoptosis of TNF-ligand (TRAIL), another new member of the TNF family (see Wiley, S. R., and others in the journal Immunity 3: 673-682 (1995)).

SUMMARY of INVENTION

The present invention mainly relates to genes and polypeptides, inhibiting the growth of tumors, and methods for treating cancer using these genes and polypeptides. Specifically, the invention provides the selected nucleic acid molecule tag7 containing a nucleotide sequence at least 65% (more preferably at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99%) identical to that used as a reference sequence selected from the group including:

(a) the nucleotide sequence presented in the second sequence, presented in SEQ ID NO:2;

(c) a nucleotide sequence encoding a Mature tag7 polypeptide having the amino acid sequence in positions 20-182 in SEQ ID NO:2;

(d) the nucleotide sequence of polynucleotide that hybridizes under stringent conditions with polynucleotide having the nucleotide sequence represented in SEQ ID NO:1;

(e) the nucleotide sequence of polynucleotide that hybridizes under certain conditions with polynucleotide having the nucleotide sequence represented in SEQ ID NO:1;

(f) a nucleotide sequence complementary to any of the sequences in (a), (b), (C), (d) or (e), or fragment.

The invention also relates to the selected nucleic acid molecule containing polynucleotide that hybridizes under stringent conditions with polynucleotides having a nucleotide sequence identical to that contained in the selected nucleic acid molecules described above, and which may or may not encode a polypeptide with tag7-activity.

The invention also relates to the selected nucleic acid molecule containing polynucleotide that hybridizes under certain conditions with polynucleotides acid, described above, and which may or may not encode a polypeptide with tag7-activity.

In the preferred embodiment of the invention relates to the selected nucleic acid molecules tag7 containing polynucleotide with:

(a) the nucleotide sequence presented in SEQ ID NO:3;

(b) a nucleotide sequence encoding a human tag7 polypeptide having the full amino acid sequence represented in SEQ ID NO:4;

(c) the nucleotide sequence of polynucleotide that hybridizes under stringent conditions of hybridization with polynucleotide having the nucleotide sequence represented in SEQ ID NO:3;

(d) the nucleotide sequence of polynucleotide that hybridizes under certain conditions, hybridization with polynucleotide having the nucleotide sequence represented in SEQ ID NO:3;

(e) a nucleotide sequence complementary to any of the sequences in (a), (b), (C) or (d), or fragment.

The invention also relates to vectors, in particular expression vectors, containing a selected nucleic acid molecules, and cells of the host, which contain these selected molecules or vectors. Preferred kletki animal (particularly mammalian cells or insect and plant cells.

The invention also relates to methods of producing the selected tag7 polypeptide, involving the cultivation of the above-described host cells under conditions enabling expression of the tag7 polypeptide and highlight it. The invention is directed also to a dedicated tag7 polypeptides produced according to these methods.

The invention relates also to a selected tag7 polypeptide having the amino acid sequence at least 65% (more preferably at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99%) identical to that used as a reference sequence selected from the group including:

(a) amino acid sequence encoded by the selected nucleic acid molecule having the nucleotide sequence represented in SEQ ID NO:1;

(b) full amino acid sequence of the tag7 polypeptide presented in SEQ ID NO:2;

(c) amino acid sequence of the tag7 polypeptide encoded by polynucleotides that hybridizes under stringent conditions of hybridization with polynucleotide having the nucleotide sequence represented in SEQ is camping under certain conditions, hybridization with polynucleotide, having the nucleotide sequence represented in SEQ ID NO:1; or a fragment.

In the preferred embodiment of the invention relates to human tag7 polypeptide having:

(a) amino acid sequence encoded by the selected nucleic acid molecule having the nucleotide sequence represented in SEQ ID NO:3;

(b) amino acid sequence of the tag7 polypeptide presented in SEQ ID NO:4; or a fragment.

The invention relates also to pharmaceutical compositions containing one or more of the above selected tag7 polypeptides or their fragments and a pharmaceutically acceptable carrier or medium for them.

The invention also concerns methods of producing selected tag7-specific antibodies, providing immunization of the animal above the selected tag7 polypeptides and selection of the animal tag7-specific antibodies. The invention is also aimed at tac7-specific antibodies produced by these methods. Antibodies according to the present invention can be monoclonal or polyclonal and can be too efficient for their detection or immobilized on a solid support.

The invention also concerns methods of inhibiting razvitomy according to the invention can provide the effects on mammal cells of the composition, containing one or more selected tag7 polypeptides, and highlighted the tag7 polypeptide has an amino acid sequence at least 65% (more preferably at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99%) identical to that used as a reference sequence selected from the group including:

(a) amino acid sequence encoded by the selected nucleic acid molecule having the nucleotide sequence represented in SEQ ID NO:1;

(b) full amino acid sequence of the tag7 polypeptide presented in SEQ ID NO:2;

(c) amino acid sequence of the Mature tag7 polypeptide having the amino acid sequence represented in terms 20-182 in SEQ ID NO:2;

(d) the amino acid sequence encoded by polynucleotides that hybridizes under stringent conditions of hybridization with polynucleotide having the nucleotide sequence represented in SEQ ID NO:1;

(e) the amino acid sequence encoded by polynucleotides that hybridizes under certain conditions, hybridization with polynucleotide, IME the tag7 polypeptide inhibits cell growth.

In the preferred embodiment, this method, a tumor of a mammal is a human tumor, and human cells are affected by the composition comprising the human tag7 polypeptide having the amino acid encoded by the selected nucleic acid molecule that has a nucleotide sequence represented in SEQ ID NO:3, or a fragment of it.

In another preferred embodiment, the invention relates to a method of inhibiting tumor growth in a mammal, providing for the introduction into the cell of a mammal molecule is a nucleic acid that contains polynucleotide having a polynucleotide sequence at least 65% (more preferably at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99%) identical to that used as a reference sequence, selected from the group including:

(a) the nucleotide sequence presented in SEQ ID NO:l;

(b) a nucleotide sequence encoding a polypeptide tag 7 with full amino acid sequence represented in SEQ ID NO:2;

(c) nucleotide placenta is SEQ ID NO:2;

(d) the nucleotide sequence of a nucleic acid molecule that encodes a polypeptide tag7 containing polynucleotide that hybridizes under stringent conditions of hybridization with polynucleotide having the nucleotide sequence represented in SEQ ID NO:l;

(e) the nucleotide sequence of a nucleic acid molecule that encodes a polypeptide tag7 containing polynucleotide that hybridizes under certain conditions, hybridization with polynucleotide having the nucleotide sequence represented in SEQ ID NO:1, with the introduction of the selected nucleic acid molecule into a cell of a mammal inhibits tumor development.

In a preferred embodiment, the invention relates to a method of inhibiting tumor development person, introducing into the cell the nucleic acid molecule that contains the human polynucleotide tag7 having the nucleotide sequence represented in SEQ ID NO:3, or its fragment.

In accordance with this invention result from the implementation of these methods can be induced in the above tumor apoptosis. Tumors of mammals, the development of which is inhibited by the methods invented by IVaS this, cell carcinoma of the liver cell carcinoma of the ovary, carcinoma cells breast carcinoma cells back of the neck, lung carcinoma cells, cells of carcinoma prostate carcinoma cells of the stomach, carcinoma cells, bladder cells, carcinoma of testis, cell carcinoma of the rectum, cells carcinoma pancreas cell carcinoma of the oral cavity cell carcinoma squamous cell carcinoma cells of the head and neck and cells teratocarcinoma), sarcoma cells (including, but not limited to, Kaposi sarcoma cells, cells fibrosarcoma and osteosarcoma cells), cells of melanoma and leukemia cells.

The invention also relates to methods for treating cancer in a suffering animals (in particular, a mammal, such as man). In one of preferred embodiments of such methods may include the impact on the specified animal of a composition containing one or more selected tag7 polypeptides, and specified the selected tag7 polypeptide has an amino acid sequence at least 65% (more preferably at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99%) identical ideatalent, encoded by the selected nucleic acid molecule having the nucleotide sequence represented in SEQ ID NO:1;

(b) full amino acid sequence of the polypeptide tag 7 are shown in SEQ ID NO:2;

(c) amino acid sequence of the Mature polypeptide tag 7 having the amino acid sequence represented in positions from 20 to 182 in SEQ ID NO:2;

(d) the amino acid sequence encoded by the molecule selected nucleic acid containing polynucleotide that hybridizes under stringent conditions of hybridization with polynucleotide having the nucleotide sequence represented in SEQ ID NO:1;

(e) the amino acid sequence encoded by the molecule selected nucleic acid containing polynucleotide that hybridizes under certain conditions, hybridization with polynucleotide having the nucleotide sequence represented in SEQ ID: 1, with said treatment inhibits the development of cancer or induces remission of cancer.

In another preferred embodiment of the present invention such methods according to the present invention can provide an introduction to the animal organism the nucleic acid molecule (s) of at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99%) identical to that used as a reference sequence selected from the group including:

(a) the nucleotide sequence presented in SEQ ID NO:1;

(b) a nucleotide sequence encoding the tag7 polypeptide having the full amino acid sequence represented in SEQ ID NO:2;

(c) a nucleotide sequence encoding a Mature tag7 polypeptide having the amino acid sequence at positions from 20 to 182 in SEQ ID NO:2;

(d) the nucleotide sequence of polynucleotide that hybridizes, under stringent conditions of hybridization with polynucleotide having the nucleotide sequence represented in SEQ ID NO:1;

(e) the nucleotide sequence of polynucleotide that hybridizes under certain conditions, hybridization with polynucleotide having the nucleotide sequence represented in SEQ ID NO:1, and said treatment inhibits the development of cancer or induces remission.

In a preferred embodiment, such methods may include the introduction of human compositions containing selected is at least one of the fragments.

In another preferred embodiment, this invention relates to methods for treating cancer in a suffering animals, introducing the animal at least one of the above compositions containing one or more of the selected tag7 polypeptides of the present invention.

In accordance with the invention, the selected tag7 polypeptides used in the above methods, mainly have the amino acid sequence at least 95% identical to the above-described sequences. Compositions containing tag7 and used in the above methods may further contain a pharmaceutically acceptable carrier or medium for the selected tag7 polypeptide.

Also in accordance with the present invention polynucleotide used in the above methods have the nucleic acid sequence of at least 65% (more preferably at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99%) identical to the above sequences, and can be contained in a vector or virion, which can be produced from adenovirus or adenosin ateneu, may be a mammal, such as man. Cancer treatable by these methods may include, but are not limited to, cancer (such as carcinoma of the liver, carcinoma of the ovary, carcinoma of the breast, carcinoma of the back of the neck, carcinoma of the lung, carcinoma of the prostate, carcinoma of the stomach, carcinoma of the bladder, carcinoma of the testis, cancer of the rectum, carcinoma of the pancreas, carcinoma of oral cavity carcinoma squamous cell carcinoma of the head and neck or teratocarcinoma), sarcoma (e.g., Kaposi sarcoma, fibrosarcoma and osteosarcoma, melanoma or leukemia.

Other preferred embodiments of the present invention will be clear to the ordinary specialist with consideration of the attached drawings and description of the invention and the claims.

BRIEF DESCRIPTION of DRAWINGS

Fig.1 depicts the nucleotide sequence of the coding segment cloned to the DNA of the tag7 (SEQ ID NO:1) and amino acid sequence (SEQ ID NO: 2) of the tag7 polypeptide encoded by this coding sequence.

Fig.2 represents a complex schedule for the different structural characteristics of the tag7 polypeptide, showing (on the basis of the primary amino acid structure of the polypeptide): probable sites of alpha-helix, areas; the hydrophilicity of a polypeptide; an indicator of the antigenicity of the polypeptide; a possible localization of the polypeptide on the cell surface.

Fig.3 is radioautography comparing the results of the analysis, identifying differences in mRNA from nematoctonus tumor cells VMR-0 (1, 3) and tumor cells VMR-L, giving metastases in the liver (lines 2, 4), cDNA was obtained from 0.2 mg RNA by reverse transcription using a reverse transcriptase of the virus leukemia from mouse Moloney (M-MuLV) in the presence of primer TAS (5'-TTTTTTTTTTTT-3') (SEQ ID NO: 5) and two different 10-base oligonucleotide primers: 5'-AATCGGGCTG-3' (SEQ ID NO:6; lines 1, 2 and 5'AGT-CAGCCAC-3' (SEQ ID NO:7; lines 3, 4). Differences in mRNA populations between two different types of cells is shown by arrows.

Fig.4 is radioautography Northern-blotting hybridization reamplification cDNA samples tag7 using total RNA derived from tumor cells VMR-0 (line 1) and tumor cells VMR-L (line 2). The relative amount of material in each line is determined by the intensity of the hybridization signal from the cDNA of the gene of glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Fig.5 is radioautography Northern blot hybridization of total RNA isolated from different organs healthy is: cells VMR-L; line 3: original liver; line 4: original goitrous gland; line 5: the original ovary; line 6: the original heart; line 7: the original brain; line 8: the original kidney; line 9: the original spleen; line 10: the original easy; line 11: the original skin. GAPDH is a labeled sample used as a standard, as in Fig.2.

Fig.6 is radioautography Northern-blot-hybridization of total RNA isolated from various cell lines mouse, processing breakdown, representing32P-labeled DNA from clone tag7. Line 1: cells CSML-0; line 1:cells CSML-100; line 3: cells VMR-0; line 4: cells VMR-L; line 5: cells VMR-Ov.

Fig.7 is radioautography Northern-blot-hybridization of total RNA isolated from various primary tumors of the mouse and the corresponding tumor cell lines mouse, processing breakdown, representing32P-labeled DNA from clone tag7.

Fig.8 is a set of photos that show the distribution of transcripts tag7 in tissues of the mouse.

(A): Radioautography Northern blot of total RNA extracted from these tissues healthy mouse.

(B-E): in situ Hybridization tissue sections of adult mouse using samples35S-labeled DNA from the clone tag 7; (): mediated and gear is predstavljaet radioautography Northern blot tag7 transcription in lymphoid and hematopoietic cells mouse cultured in media without additives or in environments containing lipopolysaccharide (LPS).

Fig.10 is a photograph of a Western blot of soluble and associated with the cell forms tag7 in various murine cells.

(A): tag7 associated with the cell. Total cell lysates and conditioned medium ("supe") LPS-induced and reinducing murine tumor cells VMR-L and VMR-0 were immunoassay with antibodies anti-tag7 and analysed using Western blotting using as a control recombinant tag7 (rtagT).

(B): Soluble tag7. The mouse splenocytes were stimulated with LPS for various lengths of time, and lysates or supernatants were immunosurgery and analysed using blotting with antibodies anti-tag7, as described above. The size of molecular weight markers is indicated by the arrow.

Fig.11 represents the combination of a line graph (A) and a photograph of agarose gel, stained with ethidium bromide (B), showing that soluble protein tag7 induces the loss and fragmentation of DNA in L929 cells.

(A) L929 Cells were cultured in the presence of tag7 (environment, air-conditioned cells VMR-L stimulated with LPS) or tumor necrosis factor (TNF) antibodies anti-tag7 or without them and test what octadecadienoate (TNF). The results are shown as the mean of five separate experiments, and error represent the average square deviation.

(B): Photograph of electrophoresis in 1.8% agarose gel, stained with ethidium bromide, DNA from L929 cells that were treated with only TNF ("control") or supernatants cells VMR-L stimulated with LPS ("Tag7 supe"). Markers of calibrating the position of the DNA to the left.

Fig.12 relates to the inhibition of the development of tumor cells in vivo using genetically modified cells VMR-0.

(A) Northern blot hybridization of total RNA isolated from transfected and parental cells using samples32P-labeled DNA from tag7.

(B): Graph of the rate of tumor development, showing the growth of cells (unfilled squares - parent tumor cells VMR-0, the shaded triangles - pseudo-transfected VMR-0, empty circles - growth suppression 4SX by injection of polyclonal antibodies anti-tag7 in the location of cells, filled squares - observed effect joint injections parent (VMR-0) and tag7 - modified tumor cells (4SX), empty triangles - speed growth of the clone 12SX, filled circles - speed growth of the clone 4SX.C - roditelskaya the size of the tumors, educated parent cells and tag7 tumor cells.

(D): Determination of tag7 protein using Western blotting (upper band) and the cytotoxicity of culture medium to the cells (lower band).

Fig.13 shows the analysis of transformed tumor cells analyzed in naked mice (lacking T-cells) and SCID mice (lacking T - and b-cells). Tumor size was monitored for 40 days.

Fig.14 is a photograph of a naked mouse which was injected cells expressing tag7 (4SX, upper band) and parental cells VMR-0 (lower band).

Fig.15: Histological analysis and electron microscopy

(A) shows a histological slice of tumors formed by parental cells (cells VMR-0), dyed with eosin/hematoxylin.

(B) shows images obtained by electron microscopy of mitotic cells in tumors formed by parental cells (cells VMR-0).

(C) shows images obtained by electron microscopy of apoptotic cells in tumors formed by cells, modified tag7 (cells 4SX).

Fig.16: Immunohistochemical analysis. Recognition of effector cells.

(A) Tumor producing tag7 (4SX).

(B) the Parent tumor (VMR-0).

Fig.17: Indus is I.

Fig.18 is radioautography Northern-blot-hybridization of total RNA isolated from various human organs using samples32P-labeled DNA from mouse clone tag 7, showing the expression of homology tag7 in various human tissues.

Fig.19 shows the definition of tag7 expressed as a fusion protein GST-tag7.

Fig.20 shows immunohistochemically analysis of lung adenocarcinoma by using antibodies anti - tac7.

DETAILED description of the INVENTION Overview

To recognize genes that detect different levels of expression in tumors at different stages of development, according to the present invention used two tumor lines adenocarcinomas of the mammary gland of the mouse (VMR-0 having a low ability to metastasize, and VMR-L, metastatic to the liver with a high frequency). Using the technology of "differences in RNA" (see R. Liang and Pardee, A. B. in the journal Science 257:967-971(1992)) was obtained not previously described gene downregulation in tumor line VMR-L, which was named tag7 and structurally characterized. Although tag7 gene was originally isolated from mouse tissues, the present invention relates also to the human homologue of tag7, which is expressed in human kitkats, means allocated tac7-molecule nucleic acid, polynucleotide, polypeptides and antibodies may be murine or human origin, and the present invention thus encompasses tog-7-molecules of nucleic acids, polynucleotides, polypeptides and antibodies of murine and human origin.

Molecules of nucleic acids

All nucleotide sequences, except where otherwise indicated, defined here by sequencing DNA molecules determined by sequencing manually, for example, dideoxy-sequencing, in accordance with methods that are conventional to a person skilled in this field (see article F. Sanger and Coulson, A. R. journal J. Mol.Biol. 94:444-448 (1975); F. Sanger and others in the journal Proc.Natl.Acad.Sci.USA 74:5463-5467 (1977)), or by automatic sequencing, for example using Automatic sequencing machine for Biosystems (Applied Biosystems Automated Sequenator), in accordance with the manufacturer's instructions. All amino acid sequences of polypeptides encoded defined here by the DNA molecules were predicted by speculative broadcast DNA sequences defined above. Therefore, as is well known in this field of knowledge in respect of any DNA posledovatelno to contain some errors. The nucleotide sequence determined by such methods, are usually identical, at least 90%, more typically at least 95% to 99.9%, the actual nucleotide sequence of the sequenced DNA molecule. As it is also known to the person skilled in the art, a single insertion or deletion in a specific nucleotide sequence compared to the actual sequence leads to a shift of frame translation of a nucleotide sequence that is predicted amino acid sequence encoded by a specific nucleotide sequence that is completely different than the amino acid sequence actually encoded by the DNA molecule, from the point of location of an insertion or deletion.

Unless specified otherwise, each "nucleotide sequence", pictured here, is represented as a sequence of deoxyribonucleotides (abbreviations A, G, C and T). However, "nucleotide sequence" of a nucleic acid molecule or polynucleotide refers to a DNA molecule or polynucleotide sequence of deoxyribonucleotides, and for an RNA molecule or polynucleotide sootvetstvuetopredelennyj sequence replaced by ribonucleotides uridine (U). For example, the mention of tag7-RNA molecule having the sequence of SEQ ID NO:1 set forth using deoxyribonucleotide abbreviations, as expected, indicates an RNA molecule having a sequence in which each deoxyribonucleotide A,G, or With the sequence SEQ ID NO:1 was replaced with the appropriate ribonucleotides a, G, or C and each deoxyribonucleotide T was replaced by ribonucleotides U.

Using this information, for example, nucleotide sequence in Fig.1, it is possible to obtain a nucleic acid molecule according to the present invention, encoding the tag7 polypeptide using standard techniques for cloning and screening, such as those used for cloning cDNA as starting material used mRNA. The term "tag7 polypeptide" as used here, means a polypeptide or its fragment that is encoded by polynucleotide containing the nucleotide sequence shown in Fig.1 (SEQ ID NO:1), or which have the amino acid sequence as shown in Fig.1 (SEQ ID NO:2). The preferred technology of cloning and screening used in the present invention include methods for cloning based on PCR (polymerase ) will be described below in the examples. In Fig.1 to illustrate the invention shows a specific nucleotide sequence of the coding segment (549 base pairs) tag7 cDNA (SEQ ID NO:1). The predicted tag7 polypeptide of 182 amino acids encoded by this coding sequence has the amino acid sequence of which is shown in Fig.1 (SEQ ID NO:2) and deduced molecular weight of about 20 KD.

The present invention also relates to the Mature form (forms) of the tag7 polypeptide according to the invention. Polypeptides, secreted by mammalian cells have a signal or secretory leader sequence that is cleaved from the Mature protein once initiated the transfer of the growing protein chain across the rough endoplasmic reticulum. The majority of mammalian cells and even cells insects decompose secreted proteins with the same specificity. However, in some cases, cleavage of the secreted protein is not entirely uniform, that is expressed in the presence of two or more Mature families of proteins. In addition, it has long been known that the specificity of cleavage of the secreted protein is ultimately determined by the primary structure of the full protein, this means that the nature of the splitting is determined predskazanny the tag7 polypeptide has an N-terminal hydrophobic region between about 10 and 30 amino acids, which is homologous to the signal sequence of some proteins, and suggests that the tag7 polypeptide may be a transmembrane or secretory protein. Therefore, the present invention relates to nucleic acid molecules coding for the Mature tag7 polypeptide having the amino acid sequence encoded by polynucleotides having the sequence of nucleic acids, shown in Fig.1 (SEQ ID NO:1). Under Mature tag7 polypeptide having the amino acid sequence encoded by polynucleotides having the sequence of nucleic acids, shown in Fig.1 (SEQ ID NO:1), is meant the Mature form (s) a polypeptide tag7 produced by expression in a cell of a mammal (e.g., COS-cell, as described below) polynucleotide having the sequence of nucleic acids, shown in Fig.1 (SEQ ID NO:1). As shown below, the Mature tag7 polypeptide may differ or not differ from the predicted "Mature" tag7 polypeptide shown in Fig.1 (SEQ ID NO:2; amino acids from about 20 to 182), depending on the accuracy of the prediction of the cleavage site based on computer analysis.

In the case of a secretory protein of the predicted site of cleavage can be prewar computer analysis. In accordance with the diagram hydrophilicity obtained for tag7 polypeptide (Fig.2), the cleavage site for tag7 is located at approximately amino acid residue 20, although depending on the accuracy of this analysis of the cleavage site, you can expect anywhere from amino acid 10 to amino acid 30. As will be clear to the person skilled in the art, the location of the cleavage site which defines the length of the signal peptide (secreted protein) or the site of attachment on the membrane (transmembrane protein), can be confirmed by N-terminal sequencing of the protein tag7 (natural or obtained through recombinant technology).

As will be understood by an ordinary specialist, because the possible sequencing errors, and changing the sites of cleavage of signal sequences in different known proteins, the actual polypetide tag7 encoded by polynucleotides depicted in Fig.1 (SEQ ID NO:1), contains about 182 amino acids, but may be anywhere in the range of about 150 to 190 amino acids; and the actual N-terminal hydrophobic signal sequence of this protein contains about 20 to 22 amino acids, but may be anywhere in the range of about 10-30 amino acids.

Molecules nock, including, for example, cDNA and genomic DNA obtained by cloning or produced synthetically. The DNA may be double-stranded or single-stranded. Single-stranded DNA or RNA may be a coding chain, also known as semantic chain, or it can be non-coding chain, also referred to as the antisense chain.

Under "isolated" molecule (molecules) refers to a molecule of nucleic acid, DNA or RNA, which has been removed from its native environment. For example, recombinant DNA molecules contained in a vector are assumed to be allocated for the purposes of the present invention. Other examples of selected DNA molecules include recombinant DNA molecules contained in heterologous cells masters, and these DNA molecules are purified (partially or substantially) from the solution, regardless of whether they are using recombinant DNA or chemical synthesis. The selected RNA molecules include RNA transcripts of the DNA molecules in vitro and in vivo according to the present invention. However, it is assumed that used here, the term "isolated" does not provide tag7 cDNA in a cDNA library or in the drug treated or highlighted genomic DNA, with Cleanaway acid according to the present invention further include genetic design containing at least one DNA sequence tag7, operatively linked with regulatory DNA sequences (which can be a heterologous regulatory sequence), for example, promoters or enhancers, as will be described below, and from the expression of these DNA sequences in cells-owners, mainly in the cells of the bacterial, fungal (including yeast), plant, or animal (including insect cells or mammalian), are produced by one or more of the tag7 polypeptides. In structures such regulatory sequences can be operatively linked to polynucleotides tag7 coding for Mature tag7 polypeptide or any of its variants, precursors, fragments or derivatives, which may include one or more nucleotides having the sequence of nucleic acids that is complementary to all or part of the nucleic acid molecules having the sequence shown in Fig.1 (SEQ ID NO:1) or shown in SEQ ID NO:3. Applied here, the term "almost all" in relation to the nucleic acid molecule or polypeptide means a stretch of nucleic acid molecule or polypeptide, which contains more than about 90%, 91%, 92%posledovatelnosti, shown in SEQ ID NO:2 or SEQ ID NO:4. Applied here, the term "site" or "fragment" of a nucleic acid molecule or peptide means a segment of polynucleotide or polypeptide containing at least 15 and preferably at least 20 contiguous polynucleotides or amino acid reference polynucleotide or polypeptide (SEQ ID NO: 1,2,3 or 4)), unless specifically agreed upon something else.

Selected molecules according to the present invention include:

(a) DNA molecules encoding the tag7 polypeptide DNA molecule having a nucleotide sequence corresponding to that shown in Fig.1 (SEQ ID NO:1) or SEQ ID NO:3; (b) a DNA molecule containing the coding sequence for the tag7 polypeptide shown in Fig.1 (SEQ ID NO:2 or in SEQ ID NO:4; (C) a DNA molecule containing a sequence substantially different from that described above but which, due to degeneracy of the genetic code, still encodes the tag7 polypeptide. Because the genetic code is well known in this field of knowledge, the usual specialist it is easy to obtain the above degenerate variants without special experimental work.

According to another aspect of the invention relates to the selected molecule nucle nucleic acid, having a sequence complementary to almost all such molecule or its plot. These selected molecules, particularly DNA molecules, are used as samples for gene mapping by in situ hybridization with chromosomes, and for detecting the tag7 gene expression in the tissues of the animal (mainly mammal, including humans), especially in tumor cells and tissues, for example, using Northern blotting.

The nucleic acid molecules according to the present invention that encode the tag7 polypeptide may include, but are not limited to, molecules themselves encoding the amino acid sequence of the Mature polypeptide; the coding sequence for the Mature polypeptide and additional coding sequences, for example, encoding a leader or secretory sequence of about 20 amino acids, such as pre-sequence and Pro-sequence, or pre-Pro-protein sequence; the coding sequence of the Mature polypeptide containing or not containing the aforementioned additional coding sequences, together with additional non-coding sequences, including, for example, introns and nekojiru sequence, which may play a role in transcription (for example, through sites linking ribosome or transcription factor), mRNA processing (e.g. splicing signals, polyadenylation) and stabilization of the mRNA; coding sequence for the Mature tag7 polypeptide operatively linked with regulatory DNA sequence, especially with the heterologous DNA sequence such as a promoter or enhancer; and the coding sequence for the Mature tag7 polypeptide associated with at least one coding sequence, which encodes amino acids with additional functions. Thus, the sequence encoding the polypeptide may be fused to a marker sequence, for example, a sequence that encodes a peptide that facilitates purification of the fused polypeptide. In some embodiments, the implementation of this aspect of the invention, the marker amino acid sequence may be a hexa-his-tag peptide, such as a tag, represented in the vector pQE (Qiagen, Inc.), to be in some other, many of which are commercially available. As described, for example, article Gentz and others in the journal Proc.Natl.Acad.Sci. USA 86:821-824 (1989), hexa-histidine ipolisa cleaning and corresponds to the epitope derived from the hemagglutinin protein of influenza virus, which are described in Wilson and others in the Cell 37:767 (1984). Another marcinm peptide used for cleaning tag7 is glutathione S-transferase (GST), encoded by the fusion vector pGEX (see, e.g., Winnacker, From Genes to Clones, New York: VCH Publishers, (1987)). As will be discussed below, other such fusion proteins include tag7 United with the immunoglobulin Fc on N-end.

Further, the present invention relates to variants of the nucleic acid molecules that encode region, analogs or derivatives of the tag7 polypeptide. Options can have a natural origin, such as a natural allelic variant. Under "allelic variant" refers to one of several alternative forms of a gene occupying a specific place on the chromosome in the body (see, for example, Lewin C., ed.., Genes II, John Wiley & Sons, New York (1985)). Options unnatural origin can be obtained using well-known specialist technology mutagenesis.

Such variants include those obtained using nucleotide substitutions, divisions or additions. In these substitutions, deletions or additions can involve one or more nucleotides. Options can be changed in the coding regions, non-coding regions or nekisnotnice replacement deletions or additions. Especially preferred among these are silent substitutions, additions and deletions that do not alter the properties and activity of the protein or its sites. Also preferred in this regard are conservative substitutions.

Other embodiments of the invention comprise an isolated nucleic acid molecule containing polynucleotide having a nucleotide sequence at least 65% identical, and more preferably at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to:

(a) the nucleotide sequence shown in Fig.1 (SEQ ID NO:l);

(b) a nucleotide sequence that encodes a full-tag7 polypeptide having the complete amino acid sequence shown in Fig.1 (SEQ ID NO:2), including the predicted signal sequence at the N-end; (C) a nucleotide sequence that encodes a Mature tag7 polypeptide (full-sized polypeptide with a remote signal sequence), which may, for example, have aminolaevulinate of polynucleotide, coding tag7, which hybridizes under stringent conditions of hybridization with polynucleotide having a nucleotide sequence identical to that found in the above-described selected nucleic acid molecules;

(e) a nucleotide sequence polynucleotide encoding tag7 which hybridizes under certain conditions, hybridization with polynucleotide having a nucleotide sequence identical to that found in the above-described selected nucleic acid molecules; or

(e) a nucleotide sequence complementary to all or a section of any of the sequences in the above paragraphs (a), (b), (C), (d) or (e)

or fragment.

Under used herein, the term "stringent hybridization conditions" refers to incubation overnight at 42With in a solution comprising: 50% formamide, 5xSSC (1X SSC=150 mm NaCL, 15 mm triacrylate), 50 mm sodium phosphate (pH of 7.6), 5x solution Denhardt'a, 10% doctranslate and 20 microgram/ml denatured, fragmented DNA, salmon sperm, after which hold the filter washing in 0.lx SSC at 65C.

Under used herein, the term "specific hybridization conditions" refers to PC EDTA), denaturation at 95With in five minutes, add the fresh Church buffer for hybridization at 55With three washing at 50C for 15 minutes each time flushing Church buffer (40 mm sodium phosphate (pH of 7.2), 1% SDS) or equivalent conditions are hybridization in SSC or SSPE, as described in standard protocols (see, for example. Molecular Cloning. A Laboratory Manual, ed.2, Sambrook J. and others, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press (1989), which in its entirety is given as a reference).

Under polynucleotides having a nucleotide sequence at least 65% "identical" is used as a reference nucleotide sequence that encodes a polypeptide tag7 is meant that the nucleotide sequence of polynucleotide identical to that used in the reference sequence except that the sequence of polynucleotide can include up to 35 point mutations per each 100 nucleotides used as a reference nucleotide sequence that encodes a polypeptide tag7. In other words, to get polynucleotide having a nucleotide sequence at least 65% identical to that used in the quality of the work, may be delegated, or substituted with another nucleotide, or a number of nucleotides up to 35% of the total amount used as a reference sequence may be embedded into use as the reference sequence. These mutations is used as the reference sequence may occur at the 5' or 3'-terminal positions is used as the reference nucleotide sequence or anywhere between those terminal positions, divided either individually among the nucleotides used as a reference sequence or in one or more contiguous groups within used as a reference sequence.

In practice, in order for standards to determine whether any of the separate molecules of nucleic acid is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence shown in Fig.1 (SEQ ID NO:l) or in SEQ ID NO:3, you can apply the well-known computer programs such as FASTA (Heidelberg, Germany), BLAST (Washington, D.C.) or BESTFIT (Wisconsin Sequence Analysis Package, version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711), which uses the algorithm of local homology (see Smith and Waterman, Advances in Applied Mania FASTA, BLAST, BESTFIT or any other program sequence alignment to determine whether a particular sequence is, for example, 65% identical to that used as a reference sequence in accordance with the present invention, such parameters that the percentage of identity is calculated over the entire length used as a reference nucleotide sequence and that was allowed gaps in homology of up to 35% of the total nucleotides in the reference sequence.

The present invention relates to nucleic acid molecules, at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequences shown in Fig.1 (SEQ ID NO:1) or SEQ ID NO:3, and their fragments, regardless of whether they encode a polypeptide with tag7-activity. Therefore, even if a particular nucleic acid molecule does not encode a polypeptide having tag7-activity, the person skilled in the art knows how to use the nucleic acid molecule, for example, as a sample by hybridization or primer polymerase chain reaction (PCR). Possible applications of the nucleic acid molecules according to the division of the tag7 gene or allelic variants in the library of the genomic DNA; (2) in situ hybridization (e.g. "FISH") to metaphase chromosomal spindle to determine the exact location of the tag7 gene on the chromosome, as described for the localization of the human gene in Verma and others, Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York (1988); and (3) Northern blotting for the registration of the tag7 mRNA expression in certain tissues.

Of course, any normal person skilled in the art will understand that, due to the degeneracy of the genetic code, a large number of nucleic acid molecules having a sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequences shown in Fig.1 (SEQ ID NO:1) or SEQ ID NO:3, and fragments will encode a polypeptide having the structure and/or activity of the tag7 polypeptide. Indeed, since all degenerate variants of these nucleotide sequences encode the same polypeptide, this specialist in this area will be clear and without performing the above-described comparative analyses. In addition, any expert will understand that from those nucleic acids that are not degenerate variants, a reasonable number will also encode a polypeptide having tag7-structure and/or activity. Considered the very incredibly to expect a significant impact on the function of the protein (in particular, replacing one aliphatic amino acid other aliphatic amino acid). For example, guidance concerning how to run phenotypically silent substitutions of amino acids are given in the article, Bowie, J. U. et al., in the journal Science 247:1306-1310 (1990) and in the reference materials.

As indicated above, the invention also relates to fragments of the described nucleic acid molecules. Preferred nucleic acid fragments according to the present invention include the selected nucleic acid molecule encoding parts of the tag7 polypeptide carrying the epitope. In particular, such nucleic acid fragments according to the present invention encode: polypeptide containing amino acid residues from about 20 to 40 in Fig.1 (SEQ ID NO:2); a polypeptide containing amino acid residues from about 55 to 75 in Fig.1 (SEQ ID NO:2); a polypeptide containing amino acid residues from about 90 to 110 in Fig.1 (SEQ ID NO:2); a polypeptide having the amino acid sequence consisting mainly of amino acid residues from about 145 to 160 in Fig.1 (SEQ ID NO:2). The inventors have also determined that the above polypeptide fragments are antigenic regions of the predicted tag7 polypeptide. Methods for determining other that the areas of human tag7 polypeptide, described in detail below.

In another aspect, the invention relates to the selected nucleic acid molecule containing polynucleotide that hybridizes under stringent hybridization conditions with practically the whole polynucleotides or area polynucleotide in the above described nucleic acid molecule, for example a nucleic acid molecule having the nucleotide sequence shown in Fig.1 (SEQ ID NO:1) or SEQ ID NO:3.

In another aspect, the invention relates to the selected nucleic acid molecule containing polynucleotide that hybridizes under certain conditions, hybridization with almost the whole polynucleotides or area polynucleotide in the above described nucleic acid molecule, for example, the nucleic acid molecule having the nucleotide sequence shown in Fig.1 (SEQ ID NO:1) or preferably presented in SEQ ID NO:3 and which encodes a polypeptide with the activity of tag7, preferably a human polypeptide tag 7.

Under the nucleotide which hybridizes with the "plot" of polynucleotide, I mean polynucleotide (as DNA and RNA) hybridization of at least about 15 nucleotides, more preferably at least primerole at least approximately 30-70 nucleotides, used as references polynucleotide. These hybridization polynucleotide used as diagnostic probes and primers as described above and will be discussed in more detail below.

Of course, polynucleotide, hybridization with a large area used as a reference polynucleotide (for example, a nucleic acid molecule containing a sequence encoding a tag7 and having the nucleotide sequence shown in Fig.1 (SEQ ID NO:1) or SEQ ID NO:3), in particular with a plot of approximately 50-500 nucleotides, or even with the entire length used as a reference nucleotide, are also used as samples according to the present invention, as well as polynucleotide corresponding to the most part, but not the entire nucleotide sequence of the nucleotide sequence shown in Fig.1 (SEQ ID NO:1) or SEQ ID NO:3. Under section polynucleotide, for example, a length of at least 20 nucleotides" refers to 20 or more contiguous nucleotides from the nucleotide sequence used as a reference polynucleotide (for example, the nucleotide sequence shown in Fig.1 (SEQ ID NO:1) or SEQ ID NO:3). As already noted, such Uch is Itachi DNA or as primers for amplification of a target sequence by polymerase chain reaction (PCR), as described, for example, in Molecular Cloning. A Laboratory Manual, ed.2, Sambrook J., Fritish E. F. and niatis T., ed. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press (1989), which in its entirety are cited as references.

As a specific nucleotide sequence encoding a polypeptide tag7 is given in Fig.1 (SEQ ID NO:1) or SEQ ID NO:3, derived polynucleotide, which hybridize with the portion of the molecule tag7 cDNA, are clear for the person skilled in the art. For example, cleavage with restriction endonuclease or destruction by ultrasonic treatment of the cDNA clone tag7 can easily be used to obtain DNA segments of various sizes, which are polynucleotide, hybridization with the portion of the molecule tag7 cDNA. On the other hand, the hybridization polynucleotide of the present invention can be obtained through synthesis by known technologies. Therefore, although the present invention relates to nucleic acid molecules tag7 and polypeptides of the mouse and human, any of the usual experts in this field can easily obtain and/or to isolate homologues of the nucleic acid molecules tag7 and polypeptides of the present invention from other organisms (particularly other mammals), and the camping, and the conventional methods of molecular biology, such as screening cDNA libraries, which are well known in this field and are described in standard protocols (see, for example, Molecular Cloning. A Laboratory Manual, ed. 2, Sambrook J. and others, ed. ld Spring Harbor, New York: Cold Spring Harbor Laboratory Press (1989)). For example, a suitable cDNA library to obtain the nucleic acid molecule that encodes a human homolog of the tag7 (hereinafter referred to as the human tag7) is a library of cDNA bone marrow. CDNA library of the bone marrow and other tissues cDNA person and genomic libraries are available commercially, for instance from Clontech (Palo Alto, California).

Vectors and cells-hosts

The present invention also relates to genetic constructs containing the selected nucleic acid molecule according to the invention, or fragments thereof, operatively associated with a regulatory DNA sequence, as will be described in detail below, the vectors that contain these genetic constructions or selected DNA molecules according to the invention, and host cells containing such vectors. In addition, the invention relates to methods for producing tag7 polypeptides or their fragments using recombinant technology using these vectors and cleto is briteney can be introduced into cells masters, using well-known methods, such as infection, transduction, transfection, electroporation and transformation. The vector may be, for example, a phage, a plasmid, virus or retrovirus, and preferably an expression vector, as described below. Retroviral vectors can be competent or replication defective. In the latter case, the replication of the virus can take place only in complementary cells of the host.

Polynucleotide can be attached to the vector containing the selected marker for propagation in a host. The plasmid vector is mainly injected into the cells of mammals or birds in the form of sediment, such as a calcium phosphate precipitate, or in a complex with a charged lipid (e.g., LIPOFESTAMINETM; Life Technologies, Inc.; Rockville, Maryland), or in complex with a virus (such as adenovirus; see US patents No. 5547932 and No. 5521291), or with components of the virus (such as viral capsid peptides). If the vector is a virus, it can be packaged in vitro using an appropriate packaging cell line and then transmoldovan in the cells of the host.

Preferred are vectors containing regulatory region cis-effect on the desired polynucleotide. Relevant factors with trans-action can be In some preferred embodiments, the implementation of this aspect, the vectors provide for specific expression, which can be induced and/or be a specific cell type. Especially preferred among these expression vectors are those that are induced by environmental factors, which can easily be controlled, such as temperature and nutritional supplements.

The expression vectors used in the present invention include vectors chromosomal, episomal or viral origin, for example, vectors derived from bacterial plasmids, bacteriophages, episomal yeast chromosomal elements, yeast, viruses such as baculoviruses, papovavirus, vaccine viruses, adenoviruses, avian syphilis, viruses pseudoleskeella and retroviruses, and vectors derived from combinations thereof, such as Comedy and family,

In one of the embodiments of the present invention the selected nucleic acid molecule according to the invention or its fragment can be operatively linked to appropriate regulatory sequence, preferably a promoter such as the promoter of lambda phage PL promoters of phage TK, T7 and SP6, lac, trp and tac promoters of E. coli, the early and late SV40 promoters and promoters of retroviral LTRS and their derivatives, and are just a few as in the initiation of transcription, termination and in the transcribed region of the binding site of the ribosome for translation. Encoding the plot of the Mature transcripts expressed by the constructs preferably includes codon of translation initiation (AUG) at the beginning of the polypeptide to be broadcast, and a termination codon (UAA, UGA or UAG), respectively located on the end of it.

As noted above, the expression vectors preferably include at least one selected marker. Such markers include genes for resistance to dihydrotetrazolo (dhfr) or neomycin (peo) for cultures of eukaryotic cells and to tetracycline (te) or ampicillin (amp) for cultured cells of E. coli and other bacteria. Typical examples of suitable hosts include, but not be limited to, bacterial cells, such as cells of Escherichia spp. (particularly E. coli), cells of Bacillus spp. (especially B. cereus, B. subtilis and B. megaterwm), cells of Streptomyces spp., cells of Salmonella spp. (in particular S. typhimirium) and cells of Xanthomonas spp.; fungal cells, including yeast cells, such as cells of Saccharomyces spp.; based on insect cells such as cells of Drosophila S2, Spodoptera Sf9 or Sf21 cells and Trichoplusa High-five; the cells of other animal (particularly mammalian cells, and most preferably human cells such as Cho, CO is liturally environment and conditions for the above-described host cells are well known in this field of knowledge.

Preferably used vectors in bacteria include pQE70, pQE60 and Q-9 supplied by Qiagen, pBS vectors, vectors Phabescript, Bluescript vectors, pNH8A, pNH16a, pNH18A, and pNH46A, supplied by Stratagene; pcDNA3, supplied by Invitrogen; pGEX, pTrxfus, pTrc99a, pET-9, pKK223-3, pKK233-3, pDR540, and pRIT5, supplied by Pharmacia. Among preferred eukaryotic of Vetrov are pWLNEO, pSV2CAT. pOG44, pXTl, pBK and pSG supplied by Stratagene; pSVK3, pBPV, pMSG and pSVL, supplied by Pharmacia. Other appropriate vectors can be easily understood by an experienced specialist.

Known bacterial promoters suitable for use in the present invention include lacI and lacZ promoters of E. coli, phage promoters, the T3,T7 and SP6, the gpt promoter, the promoter, the lambda PR and PL trp-promoter. Acceptable eukaryotic promoters include the immediate early CMV promoter, the promoter timedancing HSV (herpes simplex virus), early and late SV40 promoters, the promoters of retroviral LTRS, such as Rous sarcoma virus (RSV), and metallothionein promoters such as the mouse metallothionein-I-promoter.

The introduction of design in the cell-master can be carried out by transfection by calcium phosphate, transfection mediated by DEAE-dextran, transfection mediated by cationic lipid, electroporation, transduction, infection, bombardieri guides for laboratory work, for example, Davis and other Basic Methods In Molecular Biology (1986).

In some embodiments, implementation of the present invention selected polynucleotide according to the present invention can be operatively linked to a regulatory sequence of a gene, which may be homologous or heterologous genetic regulatory sequence (such as an enhancer, a promoter or repressor), for the formation of genetic structure. Under genetic structures in accordance with this aspect of the present invention includes not only those that contain polynucleotide encoding Mature tag7 protein, operatively linked with regulatory DNA sequence, but also those designs that contain one or more regulatory sequences operatively associated with a fragment of polynucleotide tag7, not encoding a Mature protein tag7, but containing sufficient magnitude fragment of the nucleotide sequence of the tag7 ("target fragment"), in order to target the genetic makeup of the native locus tag7 when introduced into a cell of the host, where the tag7 gene can inaktivirovanie by repression or by mutation. These constructs can be inserted into a vector, as described above, and the vector is introduced into cagraray into the genome of the host cell by homologous recombination. In the case of structures containing homologous or heterologous regulatory sequence associated with the target fragment of polynucleotide tag7, the regulatory sequence is aimed at the native locus tag7 in cell host and will amplify or derepressible (if the regulatory sequence includes, for example, a promoter or enhancer) or to inhibit or suppress (if the regulatory sequence includes, for example, a repressor or otherwise integrated into the native regulatory sequence for inhibiting or repressirovaniia (for example, "shock action")) the expression native tag7 gene in the cell-master, so the level of tag7 gene expression increases or decreases. In turn, the genetic targeting can be accomplished with the use of genetic constructs containing the above-described target fragment tag7 and in the absence of a regulatory sequence; this approach can be applied, for example, for adjustment or introduction of point mutations in the gene tag7 (see S. Steeg, M. and others in the journal Proc. Natl. Acad. Sci. USA 87(12): 4680-4684 (1990), where the description of the application of such approaches to adjust the point of mutate cells of the host by homologous recombination and receiving encoded polypeptides generally described in US patents No. 5578461; WO 94/12650 (patent application US No. 07/985586); WO 93/09222 (patent application US No. 07/911535); WO 90/14092 (patent application US No. 07/353909), the content of which in its entirety is provided in the form of links).

Transcription of DNA encoding the polypeptides according to the present invention, in higher eukaryotes can be increased by embedding in vector enhancer sequence. Enhancers are DNA elements with cis-effect, usually from 10 to 300 base pairs, the effect of which is to increase the transcriptional activity of the promoter in this cell type hosts. Examples of enhancers are the SV40 enhancer, which is localized in late region from start replication at the site 100-270 NP, enhancer of cytomegalovirus early promoter, Poliany enhancer, located in a late field from the beginning of replication and adenovirus enhancers. In another embodiment of the invention transcriptional activation of the tag7 gene can be enhanced by embedding in a vector of at least one concatenating element from native human or tag7-promoter.

For secretion of the translated polypeptide into the lumen of the endoplasmic reticulum in periplasmatic space or into the extracellular environment is to be endogenous to the polypeptide or they may represent a heterologous signals.

The tag7 polypeptide can be expressed in a modified form, such as a fusion protein, and may include not only secretion signals but also additional heterologous functional regions. For example, from N-Terminus of the polypeptide, you can add a region of additional amino acids, particularly charged amino acids, to improve the stability and preservation of efficacy in the cell-master in the cleaning process or during subsequent use or storage. To facilitate purification of the polypeptide can add parts of the peptide. Such areas can be removed before the final receipt of the polypeptide. Adding parts of the peptide in the polypeptide for excitation-secretion or excretion, to improve stability or to facilitate cleaning, and other purposes, is well-known and common practice for professionals. Preferred fusion protein contains a heterologous region from immunoglobulin that is used to solubilize proteins. For example, in EP 0464533 described fusion proteins containing different parts of the constant region (Fc) of immunoglobulin molecules together with another human protein or part thereof. In many cases, the Fc-part of the fusion protein is quite suitable to use the quality indicators (EP 0232262). On the other hand, for such use it is desirable to provide removal of the Fc portion of the fusion protein after occurred the expression of the fusion protein, its registration and clearing the previously described advantageous ways. This is the case when Fc-plot, as proved to be an obstacle for the application of the fusion protein in the treatment, diagnosis, or other industries, for example, when it should be used as antigen for immunization in obtaining antibodies.

The tag7 polypeptide can be extracted and cleaned from recombinant cell cultures by well-known methods, including precipitation with ammonium sulfate or ethanol, acid extraction, anion or cation exchange chromatography, listingdataview, gel filtration, chromatography based on hydrophobic interactions, affinity chromatography, chromatography on the basis of hydroxylapatite resins. It is most preferable to use for cleaning high-performance liquid chromatography (HPLC). The polypeptides according to the present invention include naturally purified products, products obtained by the processes of chemical synthesis and products produced by recombinant techniques from a prokaryotic or EUCA the C and higher plants. Depending on the type of master in technology recombinant obtain polypeptides according to the present invention can be glycosylated or not glycosylated. In addition, the tag7 polypeptides according to the invention may also include an initial modified methionine residue, in some cases as a result of the processes mediated by the host-cell.

The tag7 polypeptides and fragments

The invention further relates to the selected tag7 polypeptide having the amino acid sequence encoded by polynucleotides having the nucleotide sequence shown in Fig.1 (SEQ ID NO:1), to selected tag7 polypeptide having the amino acid sequence encoded by polynucleotides having the nucleotide sequence represented in SEQ ID NO:3, full amino acid sequence of Fig.1 (SEQ ID NO:2), amino acid sequence of the Mature tag7 polypeptide having the amino acid sequence represented in positions from 20 to 182 in Fig.1 (SEQ ID NO: 2), amino acid sequence encoded by polynucleotides that hybridizes under stringent conditions of hybridization with polynucleotide having the nucleotide sequence of atrial and certain conditions of hybridization with polynucleotide, having the nucleotide sequence represented in SEQ ID NO:l, or a fragment of the aforementioned polypeptides. Used herein, the terms "peptide" and "Oligopeptide" are synonymous (as is usually acknowledged), and these terms can be used interchangeably when the context requires to define a chain of at least two amino acids linked through (a) peptidyl communications (connections). The term "polypeptide" is used here to denote a chain containing at least ten amino acid residues. As usual in this area, all formulas or sequences of oligopeptides and polypeptides are written from left to right and in the direction from amino end to the carboxy-end.

An ordinary person skilled in the art it will be clear that some amino acid sequences of the tag7 polypeptide can be varied without significant effect on the structure or function of the polypeptide. If such differences in sequence are intentional, it should be remembered that the protein are critical areas that determine the structure and activity. Basically, the possible replacement of the residues that form the tertiary structure, provided that the residuals are performing politicheskoi region of the polypeptide.

Therefore, the invention further includes variants of the tag7 polypeptide, including allelic variants which exhibit significant homology with tag7 polypeptide in the structure or activity or which contain areas of tag7 polypeptide, for example the areas discussed below. Such mutants can include deletions, insertions, inversions, repeats and model of substitution (for example, hydrophilic residue, replacing the other, but usually without replacement in a high degree hydrofilm the remainder of highly hydrophobic). Small changes or "neutral" amino acid substitution have, in General, little effect on activity.

Typical conservative substitutions are the trade-offs among the aliphatic amino acids Ala, Val, Leu and Ile; interchange of hydroxylated residues Ser and Thr; replacement of the acidic residues Asp and Glu; substitution of one another emitirovannykh residues Asn and Gin, replacement of the basic residues Lys and Arg; substitution of one other aromatic residues Phe and Tight.

Thus, the fragment, derivative or analog of the polypeptide of Fig.1 (SEQ ID NO:2) or the polypeptide according to SEQ ID NO:4, or one that is encoded by polynucleotides having the sequence of nucleic acids, as shown in Fig.1 (SEQ ID NO: 1) or SEQ ID NO:3, can batusim amino acid residue (preferably a conservative amino acid residue) and such substituted amino acid residue may be encoded by the genetic code or may be an amino acid (e.g., desmosine, citrulline, ornithine, and so on), which is not encoded by the genetic code; such (ii) in which at least one of the amino acid residues includes a replacement group (for example, phosphate, hydroxyl, sulfate or other group) in addition to the normal group "R" amino acids; such (iii), in which the Mature polypeptide is connected to another connection, for example, a compound that increases the half-life of the polypeptide (for example, poliatilenglikole), or (iv) one in which additional amino acids are fused with the Mature polypeptide, such as a peptide, which is the Fc region of immunoglobulin, a leader or secretory sequence, a sequence that is used for purification of the Mature polypeptide (such as GST) or the sequence propelca. Have in mind that such fragments, derivatives or analogs are covered by the present invention and are within the experience of a specialist in this area, gained from guidelines and the state of knowledge at the time of invention.

The polypeptides according to the present invention are preferably presented in a highlighted form and preferably substantially purified. Obtained by the methods of recombinant mith and Johnson in the journal Gene 67: 31-40 (1998). The term "mainly cleared", used here, means the preparation of the tag7 polypeptide in which at least 50%, preferably at least 70%, and more preferably 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the contaminating proteins (i.e., those that are not protein tag7), removed from the drug.

The polypeptides of the present invention include those at least 65% identical, and preferably at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, 98% or at least 99% identical to the polypeptide encoded by polynucleotides having the sequence of nucleic acids, is shown in Fig.1 (SEQ ID NO:l) or in SEQ ID NO:3, the polypeptide having a full-sized amino acid sequence shown in Fig.1 (SEQ ID NO:2 or in SEQ ID NO:4, Mature tag7 polypeptide having the amino acid sequence represented in positions from 20 to 182 in Fig.1 (SEQ ID NO:2), the polypeptide encoded by polynucleotides that hybridizes under stringent conditions of hybridization with polynucleotide having the nucleotide sequence represented in SEQ ID NO:1 or the polypeptide encoded by polynucleotides that Knot, presented in SEQ ID NO:1. These polypeptides also include parts or fragments of at least 30 amino acids and more preferably at least 50 amino acids.

Under the polypeptide having the amino acid sequence at least 65% "identical" is used as a reference sequence of the tag7 polypeptide, means that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to 35 amino acid alterations per each 100 amino acids used as a reference sequence of the tag7 polypeptide. In other words, to obtain a polypeptide having the amino acid sequence at least 65% identical to that used as a reference sequence, up to 35% of amino acid residues in the reference sequence may be delegated or substituted by another amino acid or up to 35% of the total number of amino acid residues in the reference sequence can be embedded into use as the reference sequence. These changes in use as the reference sequence sledovatelnot or may be somewhere between these end positions, falling either individually among residues in the reference sequence or in at least one of the adjacent groups inside used as a reference sequence.

The polypeptides according to the present invention can be used as markers of molecular weight on the gel during electrophoresis in polyacrylamide gel with the addition of sodium dodecyl sulfate (SDS-PAGE) or molecular sieves for gel filtration columns using methods well known in this area. In addition, as will be described below, the polypeptides according to the present invention can be used to interact with polyclonal or monoclonal antibodies, which are used in the analysis to check the expression of protein tag7 as antagonists capable of inhibiting the function of a protein tag7, in therapeutic methods for inhibiting or delaying the growth of cancer metastasis or to highlight tag7 protein.

In another aspect, the present invention relates to a peptide or polypeptide containing bearing the epitope site of a polypeptide according to the invention, which can be used for interaction with antibodies, in particular monoclonal antitelomerase immunogenic or antigenic epitope of the polypeptide according to the invention. "Immunogenic epitope" means the portion of the protein, which causes an antibody response when the whole protein is immunogenic. These immunogenic epitopes, as I believe, limited to a few places on the molecule. On the other hand, a region of a protein molecule, which may be associated antibody, defined as "antigenic epitope". The number of immunogenic epitopes of the protein are generally less than the number of antigenic epitopes (see, for example, article Geysen and others in the journal Proc.Natl.Acad.Sci. USA 81:3998-4002 (1983)).

As regards the selection of peptides or polypeptides bearing an antigenic epitope (i.e., those that contain protein molecule region, which can bind antibody), it is well known in this field of knowledge that relatively short synthetic peptides that mimic part of a protein sequence, usually capable of obtaining antisera that react with partially simulated protein (see Sutcliffe J. G. et al. in the journal Science 219:660-666 (1983)). Peptides that can lead to protein-reactive sera, often presented in primerno protein sequence, can be characterized by the set of simple chemical rules and are not limited to immunodominant regions Napoule is rotably and those which consist of six or less residues, are not effective in inducing antibodies that bind with simulated protein; longer peptides, especially those containing prolinnova residues, more efficient (see Sutcliffe J. G. et al. in the journal Science 219:660-666 (1983)).

Bearing the epitope peptides and polypeptides according to the invention, prepared in accordance with the above instructions, preferably contain a sequence of at least seven, more preferably from nine, and most preferably from about 15 to 30 amino acids contained in the amino acid sequence of the polypeptide according to the invention. However, the peptides and polypeptides containing more than long stretches of amino acid sequence of the polypeptide according to the present invention containing from about 30 to about 50 amino acids, or sections of any length up to the full amino acid sequence of the polypeptide according to the invention and including her, are relateline epitope-bearing peptides and polypeptides according to the invention and can also be used to generate antibodies that react with imitirovannymi protein. Preferably the amino acid sequence of FL.E. the sequence includes relatively hydrophilic residues, and vysokolegirovannyh sequences are avoided); the sequence containing prolinnova residues, particularly preferable.

Not limiting the scope of invention examples epitope-bearing peptides or polypeptides that can be used for producing tac7-specific antibodies include the polypeptide having the amino acid sequence consisting mainly of about 20-40 amino acid residues in Fig.1 (SEQ ID NO:2), the polypeptide having the amino acid sequence consisting mainly of about 55-75 amino acid residues in Fig.1 (SEQ ID NO:2), the polypeptide having the amino acid sequence consisting primarily of approximately 90-110 amino acid residues in Fig.1 (SEQ ID NO:2), and a polypeptide having the amino acid sequence consisting mainly of about 145-165 amino acid residues in Fig.1 (SEQ ID NO:2). Other epitope-bearing polypeptides and peptides that can be used for producing tag7-specific antibodies will be apparent to an ordinary person skilled in the art based on the chart hydrophilicity of the tag7 polypeptide shown in Fig.2.

Epitope-bearing peptides and polypeptides in from combinatie ways uses of the nucleic acid molecules according to the invention. For example, a short epitope-bearing amino acid sequence can be linked with a big-largest polypeptide that acts as a carrier during recombinant production and purification, and also in the process of immunization, to obtain antipeptide antibodies. Epitope-bearing peptides can also be synthesized using known methods of chemical synthesis (see, for example, US patent No. 4 631 211; article Houghten R. A. journal Proc.Natl.Acad. Sci. USA 52:5131-5135(1985)).

As will be clear to the person skilled in the art, the tag7 polypeptides according to the present invention and the epitope-bearing fragments may be immobilized on a solid substrate using techniques that are well known and conventional. Under "solid substrate" refers to any substrate that can be immobilized peptide. Such solid substrates include, but are not limited to, nitrocellulose, diazotoluene, glass, polystyrene, polyvinyl chloride, polyethylene, dextran, sepharose, agar, nylon, beads and tablets for micrometrology. The relationship of the peptides according to the invention with the solid substrate can be achieved by attaching one or both xtkach peptide. In accordance with the present invention can also be applied multiple mount (as secondary sections and at the ends of the peptide). The attachment may be through a linking group amino acids such as primary amino group, carboxypropyl or sulfhydryl group (SH), or with groups of chemical bonding, such as bratinova communication (CNBr), and through the spacer. For non-covalent attachments can be used in addition to the peptide affinity terminal sequence, for example, GST (see Smith, D. B. and Johnson, K. S. in the journal Gene 67:31 (1988)), polyhistidine (see Hochuli E. J. journal of Chromatog. 41:11 (1987)) or Biotin. Such affine tips can be used for reversible attachment of the peptide to the substrate. Such immobilized polypeptides or fragments may be used, for example, when selecting antibodies directed against tag7, as will be described below.

As will also be clear to the person skilled in the art, the above tag7 polypeptides according to the present invention and epitopes fragments can be combined with parts of the constant domain of immunoglobulins (Ig), resulting in the chimeric polypeptides or polypeptides of the merger. These polypeptides merge oblegchil-86 (1988)).

Antibodies anti-tag7

Epitopes peptides and tag7 polypeptides according to the invention can be used for producing antibodies directed against tag7, in accordance with well-known in the field methods (see, for example, articles Sutcliffe J. G. et al. in the journal Science 219:660-666 (1983); Wilson and others in the journal Cell 37:767 (1984) and Bittle F. J., and others in the journal J. Gen. Virol 66:2347-2354 (1985). Tag7-specific antibodies may be invoked against a tag7 polypeptide or at least one of its antigenic polypeptide fragments, such as epitopes fragments above tag7. These polypeptides or fragments may be presented together with protein carrier (e.g., albumin) in the body of an animal (such as rabbit or mouse) or, if they are long enough (at least about 25 amino acids), without a carrier.

The term "antibody" (AB) used here can be replaced with the term "polyclonal antibody" or "monoclonal antibody", except in special contexts, as will be described below. These terms as they are used here, mean as whole molecules, and antibody fragments (such as Fab and F(AB')2-fragments) which are capable of specific link tag7 polypeptide or its plot. Fab and F(AB')Antibodies according to the present invention can be polyclonal or monoclonal and can be obtained by any of various methods. For example, polyclonal antibodies can be obtained by immunization of an animal with one or more of the tag7 polypeptides or parts of it (including at least one epitomise fragment tag7) according to the present invention according to standard techniques (see, for example, Harlow, E. and Lane, D. Antibodies: A Laboratory Manual, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press (1988); P. B. Kaufman and others in: Handbook of Molecular and Cellular Methods in Biology and Medicine, Roca Raton, Florida: CRC Press, pp. 468-469 (1995). In the most preferred method, the antibodies according to the present invention are monoclonal antibodies (or fragments, binding protein tag 7). Such monoclonal antibodies can be produced using hybridoma technology, which is well known in this field (see the articleand others in the journal Nature 256:495 (1975),and others in the journal Eur.J.Immunol. 6:511 (1976) andand others in the journal Eur.J.Immunol. 6:292 (1976), and Hammerling, etc. in Monoclonal Antibodies and T-Cell Hybridomas, New York:Elsevier, pp. 563-682 (1981); P. B. Kaufman and others in: Handbook of Molecular and Cel is whether their fragments, you can get in a two-step process through the use of antiidiotypic antibodies. This method is based on the fact that antibodies are themselves antigens and therefore it is possible to obtain an antibody that binds a different antibody. In accordance with this method tag7-specific antibodies are used to immunize an animal, preferably a mouse. The splenocytes of such an animal are then used to produce hybridoma cells, and the hybridoma cells are screened to detect clones which produce an antibody whose ability to bind the tag7 polypeptide can be blocked by antigen tag7 polypeptide. Such antibodies contain antiidiotypic antibodies antibody specific against the tag7 polypeptide and can be used to immunize an animal to form other antibodies specific against the tag7 polypeptide.

In another preferred embodiment of the invention, antibodies may be obtained as a chimeric antibody. In accordance with the invention, such chimeric antibodies may contain antigennegative domain (that is the domain of the antibody binding tag7), of the first type and at least one constant region of vtoro lechesa here in its entirety by reference.

It is clear that Fab, F(ab')2fragments and other fragments of the antibodies according to the present invention can also be used in the described methods. Such fragments are typically produced by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2-fragments. Alternatively, fragments, binding protein tag 7 can be obtained using the methods of production of recombinant DNA, or by chemical synthesis.

Antibodies specific to the protein tag7, according to the present invention can be too efficient for their detection, most preferably an enzyme, radioisotope, non-radioactive isotope, fluorescent, chemiluminescent label, a toxin, or a contrast agent used in the analysis using nuclear magnetic resonance (NMR). Suitable types well known to the person skilled in the art. The standard way of associating a label with the antibody described, for example, Kennedy and others in Clin.Acta 70:1-31 (1976) and Schurs and others in Clin.Acta, 81:1-40 (1977), and they all brought here in its entirety by reference.

In an additional preferred embodiment of the invention the antibodies obtained by vysheopisanym" refers to any solid substrate, which can be immobilized antibody, including, but not limited to, nitrocellulose, diazotoluene, glass, polystyrene, polyvinylchloride, polypropylene, polyethylene, dextran, sepharose, agar, starch, nylon, beads, including glass, latex, magnetic (including paramagnetic and superparamagnetic particles), and tablets for micrometrology. The relationship of the antibodies according to the invention with the solid substrate can be achieved by attaching one or both ends of the antibody to the support. The attachment can also be made on one or more internal sites of the antibody. In accordance with the present invention can also be applied multiple mount (as secondary sections and at the ends of the peptide). The attachment may be via a bridging group of the amino acids, such as primary amino group, carboxypropyl or sulfhydryl group (SH), or by chemical linking groups, for example, with bromine cyan (CNBr), as well as through Spicer. For non-covalent bindings you can use addition to antibody affinity terminal sequence, for example, GST (see Smith, D. B. and Johnson, K. S. in the journal Gene 67:31 (1988)), polyhistidine (see Hochuli E. J. journal of Chromatog. 41:11 (1987)) or Biotin. Viola is emical Co., St.Louis, Missouri), which binds to the Fc region of the antibody may be attached to a solid substrate, and the antibodies according to the present invention are attached by simple incubation of the antibody with the solid substrate containing immobilized Protein a or Protein G. These affine ends can also be used for reversible attachment of the antibodies of the present invention to the support.

The possibility of using

Selected tag7 polynucleotide, polypeptides and antibodies according to the present invention can be used in various methods, for example, in industrial, clinical, or research technology. Among these opportunities is the place and the use of these antibodies anti-tag7 to determine tag7 expression or products selected cells or tissues, or cells and tissues in the animal body by standard immunological techniques that are well known to the ordinary expert. In addition, polynucleotide and polypeptides according to the present invention can be used in therapeutic methods for inhibiting the development or progression of a tumor in an animal. Similarly these polynucleotide and polypeptides can be used for the treatment of cancer in an animal (ment of cancer and tumor cells

These polynucleotide and tag7 polypeptides can be used in the methods provided by the invention and aimed at the inhibition of the development of tumor or cancer cells. In one of the preferred aspects of polynucleotide and polypeptides of the present invention can be used for inducing apoptosis in tumor or cancer cells. The usual specialist would, however, it is clear that the inhibition of tumor development or cells may be cytotoxic mechanisms (i.e. induction of delayed development or delay the cell cycle, including the induction of differentiation, without destruction of tumor or cancer cells) or cytocidal mechanisms (i.e., induction of death, both direct and indirect, including through induction of apoptosis, cytotoxicity, cytolysis, and so on).

Methods according to this aspect of the invention can consist of one or several stages, which are designed to inhibit tumor or cancer cells in vitro, in vivo or ex vivo (i.e., in cloth, remote from the body of the animal, which can be placed or not back in the animal for further treatment of the animal to inhibit the development of tumor cleto tumor in the tumor or preferably, in the cell of a mammal, you can enter at least one molecule of nucleic acid containing polynucleotide encoding tag7. Preferred for use in this technology, the nucleic acid molecule includes a nucleic acid molecule containing polynucleotide having the sequence of nucleic acids that is at least 65% identical, and preferably at least 70%, 80%, 85%, 90%, 95%, or 99% identical to that used as a reference sequence, such as (a) the nucleotide sequence presented in SEQ ID NO:l; (b) the nucleotide sequence encoding the tag7 polypeptide having the full amino acid sequence, presented in SEQ ID NO:2; (C) a nucleotide sequence encoding a Mature tag7 polypeptide having the amino acid sequence at positions from 20 to 182 in SEQ ID NO:2; (d) the nucleotide sequence of polynucleotide that hybridizes under stringent conditions of hybridization with polynucleotide having the nucleotide sequence represented in SEQ ID NO:1; or (e) the nucleotide sequence of polynucleotide that hybridizes under certain conditions, the spine of predpochtitelnye such molecules are nucleic acids, introduction to the mammalian cell inhibits tumor development. In a particularly preferred embodiment of the present invention, this approach involves the use of nucleic acid molecules containing polynucleotide having the sequence of nucleic acids represented in SEQ ID NO:3; or (b) a nucleotide sequence encoding a polypeptide tag 7 having the amino acid sequence represented in SEQ ID NO:4.

In this approach, at least one of the above-described nucleic acid molecules can be introduced into the vector or virion, suitable for introduction of a molecule of nucleic acid into mammalian cells in need of treatment, to form a vector transferee. Suitable for this purpose, the vectors or virions include those which are derived from retroviruses, adenoviruses and adeno-associated viruses. Technology of forming vector transfection containing the nucleic acid molecule encoding a tag7, widely known in this field and mainly described in "Working Toward Human Gene Therapy", Chapter 28 in Recombinant DNA, ed.2nd, Watson J. D., and others, ed. New York: Scientific American Books, pp. 567-581 (1992), and is given here as a reference. Other suitable technologies introduction maul the villas with the use of non-viral gene such as methods based on endocytosis, receptor-mediated, as described in W093/07293, liposomes, cationic lipids, etc. In an alternative approach, the selected nucleic acid molecule can be introduced into the cell by other methods, well known to the experienced specialist, including, for example, electroporation, transduction, transformation, processing, calcium phosphate, "gene gun", the hypotonic poration and re-sealing, etc., When selecting the above-described approaches, the expression level of tag7 protein in cells affected increases, due to which inhibited the development of tumors or tumor-induced apoptosis in tumor cells.

In another preferred method according to the present invention is the development of tumors in mammals can be ingibirovalo exposed to a composition comprising at least one of the above selected tag7 polypeptide according to the invention. Selected tag7 polypeptides suitable for use in this aspect of the invention, include those that have an amino acid sequence at least 65% identical, and preferably at least 70%, 80%, 85%, 90%, 95% or 99% identical to that used in the form of links posledovati, having the nucleotide sequence represented in SEQ ID NO:1; (b) full amino acid sequence of the tag7 polypeptide presented in SEQ ID NO:2; (C) the amino acid sequence of the Mature tag7 polypeptide having the amino acid sequence located from 20 to 182 in SEQ ID NO:2; (d) the amino acid sequence of the polypeptide encoded by polynucleotides that hybridizes under stringent conditions of hybridization with polynucleotide having the nucleotide sequence represented in SEQ ID NO:1; or (e) the amino acid sequence of the polypeptide encoded by polynucleotides, which hybridizes under certain conditions, hybridization with polynucleotide having the nucleotide sequence represented in SEQ ID NO:1. On the other hand, in these methods according to the present invention can be used with success fragment of at least one of the polypeptides described above in (a), (b),(c), (d) or (e). Particularly preferred for use in these methods are tag7 polypeptides or fragments thereof, which provide inhibition of tumor development by contact of the cells of the mammal with a polypeptide or fragment.

In the preferred variablecount those which have the amino acid sequence encoded by the selected nucleic acid molecule having the nucleotide sequence represented in SEQ ID NO:3, or (b) the amino acid sequence of the tag7 polypeptide presented in SEQ ID NO:4, or fragments thereof.

Songs used in this aspect of the invention may optionally also contain one or more additional compounds, such as pharmaceutically acceptable carriers or environment suitable for use with the selected tag7 polypeptide within the composition. By "pharmaceutically acceptable carrier or medium" means a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or excipients of any kind. The media may also contain small amounts of additives such as substances that enhance isotonicity and chemical stability, which are well known in the art. Thus, the invention relates to pharmaceutical compositions containing at least one selected tag7 polypeptide according to the invention and a pharmaceutically acceptable carrier or medium for him.

When choosing the above approaches tag7 polypeptide acts NPRM transmembrane transfer or by inducing actions of at least one secondary messenger) to inhibit the growth of mammalian cells or induce apoptosis in it.

Mammalian cells, which can be treated by these methods to inhibit tumor growth or induce apoptosis of tumor cells include those derived from any mammal, including, but not limited to, mice, rats, monkeys, sheep, cows, horses, dogs, cats, Guinea pigs, rabbits, and most preferably humans. Although it is possible to inhibit the growth of any mammalian cells using the methods mentioned above, these methods are particularly effective for inhibiting the development of a tumor or other cancer cells or induce apoptosis in them. Types of tumor or cancer cells, which can inhibit using methods according to the invention include cell carcinoma (particularly cell carcinoma of the liver cell carcinoma of the ovary, carcinoma cells breast carcinoma cells back of the neck, lung carcinoma cells, cells of carcinoma prostate carcinoma cells of the stomach, carcinoma cells, bladder cells, carcinoma of testis, cell carcinoma, rectum carcinoma cells of the pancreas, cell carcinoma of the oral cavity cell carcinoma squamous cell carcinoma cells of the head and neck and the cell teratocarcinoma), kletki leukemia.

Therapeutic use

The selected molecules are nucleic acids and polypeptides according to the invention can also be used for therapeutic purposes, for example, in the treatment of cancer in them suffering animal. In these cases the role of therapeutic effect is the delay or inhibition of the development or growth of a tumor or cancer in order to delay or inhibit tumour metastasis or cancer and/or cause their remission.

Genetic therapy. In accordance with the first of these aspects of the invention have cancer animal can be treated by introducing him to one or more selected nucleic acid molecules according to the invention, containing polynucleotide encoding the tag7 polypeptide, or fragment, mainly polynucleotide, which is 90% or 95% identical to at least one used in reference to the nucleotide sequence described above. This approach, known generically as "genetic therapy", aims at increasing the level of tag7 gene expression in the cells that make up the cancer or tumor, allowing inhibited or delayed growth, development or metastasis of the cancer or tumor or induced remission. It is proved that the Academy of Sciences of the mammal, for example, cystic fibrosis (see Drumm, M. L., and others in the journal Cell 62:1227-1233 (1990); Gregory R. J., and others in the journal Nature 347:358-363 (1990); Rich, D. R., and others in the journal Nature 347:358-363 (1990)); disease Gaucher'a (see Sorge J. and others in the journal of the OEWG.Natl.Acad.Sci. USA 84:906-909 (1987); J. K. Fink and others in the journal of the OEWG.Natl.Acad.Sci. USA 87:2334-2338 (1990)), some forms of hemophilia (see Bontempo F. A., and others in the journal Blood 69:1721-1724 (1987); Palmer, T. D., and others in the journal Blood 73:438-445 (1989); Axelrod J. H., and others in the journal of the OEWG.Natl.Acad.Sci. USA 87:5173-5177 (1990); D. Armentano and others in the journal of the OEWG.Natl.Acad.Sci. USA 87:6141-6145 (1990)) and muscular dystrophy (see Partridge, T. A., and others in the journal Nature 337:176-179(1989); Law, R. K., and others in the Lancet 336:114-115 (1990); Morgan, J. E., and others in the journal J. Cell.Biol.111:2437-2449 (1990)), and in other ways to treat certain types of cancer, such as metastatic melanoma (see Rosenberg, S. A., and others in the journal Science 233:1318-1321 (1986); Rosenberg, S. A., and others in the log N. Eng.J.Med., 319:1676-1680 (1980); Rosenberg, S. A., and others in the log N. Eng.J.Med., 323:m-m (1990)).

In the preferred of these methods animal cancer patient, enter one or more selected nucleic acid molecules according to the invention, containing polynucleotide having a nucleotide sequence that is at least 90% or at least 95% identical to one used as a reference nucleotide sequences, the description for the introduction of molecules of nucleic acid into cells or tissue to be treated animal, to form the vector transfection. Acceptable for this purpose, vectors and virions include those derived from retroviruses, adenoviruses and adeno-associated viruses. On the other hand, the nucleic acid molecules according to the invention can be used in combination with molecular conjugate with a virus (such as adenovirus and adeno-associated virus or viral components (e.g., viral capsid proteins).

Technology of forming vectors and virions containing nucleic acid molecules encoding tag7, well known in this field and mainly described in "Working Toward Human Gene Therapy", Chapter 28 in Recombinant DNA, ed.2nd, Watson J. D., and others, ed. New York: Scientific American Books, pp. 567-581 (1992). In addition, the basic methods of constructing vectors for genetic therapy and the introduction of them into the affected animal for therapeutic purposes can be derived from the above-mentioned publications, the content of which is reproduced here in its entirety as a reference. In one of these basic methods, vectors containing the selected polynucleotide according to the present invention, injected directly into the cells and tissues of the affected animal, mainly by injection, inhalation, prop the Pia and "in vivo". On the other hand, cells, tissues and organs that contain cancer or tumor cells, can be removed from the patient's body of the animal and placed in culture methods, well known to the ordinary person skilled in the art; vectors containing polynucleotide tag7, you can then enter in cells or tissues by any of the above-described method for feeding selected polynucleotides tag7 in cells or tissue and, after a sufficient time for the implementation of polynucleotides tag7, cells or tissue can then re-enter a sick animal. Since the filing of the tag7 gene occurs outside the body of diseased animal, this method in General is called genetic therapy "ex vivo". One type of genetic therapy "ex vivo" can also be described as "immunotherapy" or, more accurately, "anti-cancer vaccine". It causes an immune response in exposed animal treatment and as a consequence, the destruction of tumor cells. In the experiments performed during testing of the present invention, it has been shown that vaccination of animals with tumor cells expressing tag7, protects animals against subsequent contamination of non-modified tumor cells. In a preferred embodiment, the present Sobral to be as described above, autologous, i.e., to be taken from the subject to the treatment of the body, or they can be homogeneous, i.e., from one or more organisms, for example, cells from a variety of established cell lines.

When conducting genetic therapy as "w vivo and ex vivo selected polynucleotide tag7 according to the invention can be operatively linked to a regulatory DNA sequence, which may be a promoter or enhancer tag7, or with heterologous regulatory DNA sequence such as a promoter or enhancer derived from another gene, cell or organism, for the formation of genetic structure, as described above. This genetic structure can then be built into the vector, which is then directly injected sick animal genetic therapy in vivo, for example, nutripure-left introduction (i.e. the introduction of a nucleic acid molecule or vector directly into the tumor of an animal, for example, by injection), or in cells or tissues of the affected animal ex vivo. In another preferred embodiment, the genetic construct according to the invention can be entered in cells or tissues of the animal, or in vivo, or ex vivo, in wincomponents (for example, viral capsid proteins; see WO 93/07283). On the other hand, transfected cell host, which may be homologous or heterologous, can be encapsulated in semi-permeable carrier and implant in a sick animal, providing the penetration of tag7 polypeptides in tissue and circulating it, but preventing contact between the immune system of the animal and transfected cells (see WO 93/09222). Such methods lead to increased production tag7 in the treated animal by (a) random embedding of the tag7 gene into the genome of the host cell; (b) the introduction of the tag7 gene in the nucleus of cells, where it may exist as an extrachromosomal genetic element. General description of such methods and approaches can be found, for example, in US patent No. 5578461 and WO 93/09222.

Regardless of the approaches, however, use of these methods according to the invention leads to increased production of tag7 cells and tissues of the patient animal, so that the development, growth or metastasis of the cancer and tumors slowed down or inhibited or cancer and tumors go into remission or cured.

Protein therapy. In another preferred therapeutic approach provided by nastojashego selected tag7 polypeptide according to the invention, with this introduction inhibits the development, growth or metastasis of a tumor or cancer or induces their remission. One of such ways highlighted the tag7 polypeptide is administered to the animal in the form of the above pharmaceutical compositions. Another such method introduced animal compositions can contain one or more selected tag7 polypeptide having the amino acid sequence at least 65% or at least 70%, 75%, 80%, 85%, 90%, 95% or 99% identical to at least one of the above used as a reference sequence. Therefore, this invention relates to methods for treating animals suffering from cancer, providing for the introduction of such animal a pharmaceutical composition containing a therapeutically effective amount of one or more selected tag7 polypeptides according to the invention and optionally a pharmaceutically acceptable carrier or medium for him.

The compositions containing the polypeptides tag7, should be prepared and dosed as is common in medical practice, taking into account the clinical condition of the individual patient (especially the side effects that occur during treatment Afik introduction and other factors, well-known specialists. "Therapeutically effective amount" of tag7 polypeptides for the purposes outlined here will be determined by the following considerations.

As the main proposals of the total therapeutically effective amount of the polypeptide tag 7, the input parenteral single dose should be in the range of about 0.01 μg/kg/day to 1000 mg/kg/day in relation to body weight of the patient, although, as noted above, it should be prudent from a therapeutic point of view. More preferably, this dose was at least 0.1 µg/kg/day and most preferably for humans between about 0.1 and 100 mg/kg/day as a polypeptide. During continuous reception of the tag7 polypeptide can be entered either by 1-10 injections per day or by continuous subcutaneous infusions, for example, using Minnesota. You can also use the intravenous solution in the capsule. A key factor in selecting the appropriate dose is the result, measured, for example, through increased levels of circulating tag7 or by determining the reduction of tumor growth or metastasis, as well as remission of cancer. An ordinary person skilled in the art clear other standard measuring methods of change and the interval after treatment to have a reaction to it, may vary depending on the desired effect.

The pharmaceutical compositions used in such methods include one or more selected tag7 polypeptides according to the invention and optionally may contain a pharmaceutically acceptable carrier or medium for them. The tag7 polypeptides and pharmaceutical composition according to the invention can be introduced by any means that achieve the intended purposes of delay or inhibition of the development and growth of tumors, or cancer, or metastasis in a patient animal. You can use, for example, intratumoral introduction, oral introduction, introduction to eye, ear, rectal, parenteral, subcutaneous, intravenous, intramuscular, perianalnoe, vaginal, topical (using powders, ointments, drops or transdermal patch), buccal, vnutriobolochechnoe and vnutribronhialnah path, and apply the funds sprayed in the mouth or in the nose or eye and ear drops. The term "parenteral" as used here, indicates the routes of administration, including intravenous, intramuscular, peritoneally, vnutrigrudne, subcutaneous and type of concomitant treatment, if it occurs, frequency of treatment, or the nature of the desired effect. Compositions within the present invention include all those which contain the tag7 polynucleotide or polypeptides in an amount that is effective to achieve inhibition or delay the development and growth of tumors or cancer, or metastasis, or to induce remission of the tumor or cancer, or cure them. Although individual needs of each animal can be different, the choice of optimal ranges of effective amounts of each component is within the competence of the ordinary Clinician.

The compositions containing the tag7 polypeptide, you can also enter in systems slow release. Examples of such compositions with delayed release are semi-permeable polymer matrices in the form of molded articles, in particular films, or microcapsules. Matrix with a slow release include polylactide (US patent No. 3779919; EP 0058481), copolymers of L-glutamic acid and gamma-ethyl-b-glutamate (see Sidman, U. and others in the journal Byopolimers 22:547-556 (1983)), poly(2-hydroxyethylmethacrylate) (see Langer R. and others in the journal J. Biomed. Mat. Res. 15:167-277 (1981); R. Langer in journal of Chem.Tech. 12:izlenim release of the tag7 polypeptide may also include tag7 polypeptides, enclosed in liposomes or absorbed by them, and they can be produced by any known in this region methods (see US patents No. 4485045 and US 4544545; articles Epstein and others in the journal Proc.Natl.Acad.Sci. (USA) 82:3.688-3692 (1985); Hwang and others in the journal Proc.Natl.Acad.Sci. (USA) 77:4030-4034 (1980); the patents EP 0036676; EP 0052322; EP 0088046; EP 0102324; EP 0142641; EP 0143949; DE 3218121; and JP 83-118008).

For parenteral administration, in one of the embodiments, the tag7 polypeptides are prepared generally by mixing it at the desired degree of purity in injectable form containing a single dose (solution, suspension, or emulsion) with a pharmaceutically acceptable carrier, i.e. one that is not toxic to recipients at the used doses and concentrations, and is compatible with other ingredients of the formula. For example, it is desirable that the formula did not include oxidizing agents and other compounds that are known to be damaging polypeptides.

Basically, pharmaceutical forms are obtained by uniform distribution of the tag7 polypeptides according to the present invention in liquid carriers, or finely powdered solid carriers, or both. Then, if necessary, the product formed into the desired product. Preferably the carrier is a carrier for parenteral administration, more predpochtitel the water, saline solution Ringer'and a solution of dextrose. Acceptable non-aqueous media, such as locating oil and etiloleat, and liposomes.

The tag7 polypeptide is usually found in the medium at a concentration of from about 0.01 mg/ml to 100 mg/ml, mainly from about 0.1 to 10 mg/ml, at a pH of about 3-8. It is clear that the application of some of the previously mentioned environments, carriers, or stabilizers can lead to the formation of salts of the polypeptide tag 7.

The polypeptide tag 7 used for therapeutic administration, must be sterile. Sterility is easily achieved by filtration through sterile filtration membranes (for example, 0.2 micron membranes) or irradiation with gamma rays or ultraviolet light on well-known technology specialists. Therapeutic compositions containing the tag7 polypeptide, generally placed into a container having a sterile inlet opening, for example a capsule or vial for intravenous solution, with tube, which can be punctured by a hypodermic needle for injection.

Therapeutic compositions containing the tag7 polypeptide according to the present invention typically can be stored in the container for one or multiple doses, for example, sealed ampoules or vials, service lyophilized, bubbles with a capacity of 10 ml fill in 5 ml of filtered under sterile conditions, a 1% aqueous solution of tag7 polypeptide, and the resulting mixture lyophilizer. The solution for infusion is prepared by restoring dried tag7 polypeptide, using water U. S. P., which is suitable for injection.

Different types of cancer in animals can be treated with therapeutic methods according to the invention. Cancers that can be treated by these methods include, but are not limited to, carcinoma, sarcoma, melanoma and leukemia, particularly those mentioned above. The methods according to the present invention, in particular, is well manifest itself in the treatment of any animal, preferably mammals and most preferably humans.

It is obvious to an ordinary person skilled in the art that any suitable modifications and alterations in the methods of application described here, a clear and may be made without departing from the scope of the invention or any of his incarnations.

Having now detailed description of the invention, it may be more clear from reference to the following examples, which are included only for the purpose of illustration and are not intended to limit the invention.

The main discussion

To generate the tion, was selected pair tumors of the same origin, which differ in their metastatic properties. Two subschema cancer VMR with high metastatic activity (which has a wide range affected by metastatic organs and frequency of metastasis in the liver of not more than 5%) have been allocated in accordance with previous studies (see Senin V. M. in Vestn.Acad.Med.Nauk. SSSR 0(5): 55-91 (1984)): cell line VMR-0 (frequency of metastasis in the liver of about 0%) and line VMR-L (frequency of metastasis in the liver, about 100%). In contrast to tumor lines CSML-0 and CSML-100 none of these VMR-tumor expresses not previously cloned gene mts 1, which is transcribed in most tumors (see Grigorian M. S., and others in the journal Genetika (USSR) 25(6): 993-1000 (1989)), consequently, it is advisable to look for other genes that are involved in the process of metastasis. If we consider the tumors obtained in accordance with previously proposed models (see Filder I. J., and Hart, I. R. journal Science 277:998-1001 (1982)), it is obvious that the tumor VMR-L can occur from metastases subpopulation of cells, which are presented in the original tumor VMR at a very low level and which have a very short lifetime (see Kerbell K. S., and others in the journal of Adv. Cancer Res. 55:87-131 (1990)).

of methods detect differences in RNA to identify genes associated with metastasis. In General, the genetic difference between tumors VMR-0 and VMR-L invisible, to some extent confirming their common origin. However, using this approach one can distinguish several DNA fragments corresponding to differentially expressed RNA in tumors VMR-0 and VMR-L. Analysis of selected fragments by hybridization by Northern blot with RNA from these tumors were given the opportunity to include most of the fragments to the class of repetitive sequences (element IAR and so on). However, several of the obtained fragments could not be identified and therefore are of great interest.

One of these fragments, isolated and characterized here is the tag7 gene, which demonstrates a very high level of transcription in tumor VMR-L, metastatic to the liver (see Fig.2). The sequence analysis showed that the PCR fragment flanked on both sides by the 5'-terminal primer 5'-AATCGGGCTG-3' (SEQ ID NO:4). When analyzed the nucleotide sequence of the cDNA clone of the total cDNA library VMR-L, the sequence that was homologous to this primer length eight NP was detected at a distance of 52 nucleotides from the 3' poly+ing differences in RNA instead of 3'-terminal primer 5'-terminal primers could vary; this approach probably would have reduced the number of received fragments, but at the same time would increase the resolving power of the gel.

Errors that occur in numerous cycles of PCR, can be classified as flaws in methodology. When comparing the nucleotide sequence of the fragment obtained during PCR, and cDNA clone tag7 was found that 44 of the nucleotide at the 5'end of the amplified fragment does not coincide with the same segment sequence of the cDNA clone.

Computer analysis of the full cDNA sequence of murine tag7 revealed two open reading frames (ORFs) corresponding to the polypeptides length of approximately 182 and 91 amino acids. Both start broadcast in various degrees corresponded to the average of the Kozak sequence (see Kozak, M. J. journal J. Cell.Biol. 108:229-241 (1989)). However, in case of a longer open reading frame (ORF) the number of nucleotides identical match broadcast, more than when a shorter ORF, and this probably represents the first methionine, particularly one, which is the site of translation initiation (see Kozak, M. J. journal J. Cell.Biol. 108:229-241 (1989)). But the translation of functional tag7 polypeptide may also be of iniciaron the l) is about 20 KD. To check homology with previously opisanie sequences, the nucleotide sequence of tag7 and predicted amino acid sequence of its product was analyzed in databases GENE and SWISSPROT using the search programs such as FASTA homology (Heidelberg, Germany) and BLAST (Washington, DC, USA). It was not found significant homology with previously known sequences, except for minor homology hydrophobic segment (between 2 and 12 amino acid residues) at the N-end of the predicted tag7 polypeptide with-chain receptor T-cells. This hydrophobic region is homologous to the signal sequence of some proteins (for example, precursors of calreticulin, osteocalcin and extracellular globin III). The presence of a hydrophobic region at the N-end of the predicted tag7 polypeptide suggests that this polypeptide may be a transmembrane localization or may be secreted.

No correlation was found tag7 expression with organosilicate metastasis; tag7 gene is transcribed not only in tumor cells VMR-L, metastatic to the liver, but also in tumor cells VMR-0v, metastatic to the ovaries. Among usually the high content of cells of the basal membrane. This correlation may not fully coincide, but reflects the role of the basal membrane plays in the process of metastasis (see Stetler-Stevenson W. G., and others in the journal Ann. Rev. Cell Biol. 9:541-573 (1993)). Interestingly, the level of tag7 gene expression in metastatic tumors is much higher than that of the same cells in culture. This result is the reverse of the recently reported results of studies of gene expression in primary and cultured tumor cells (see article L. Zhang and others in the journal Science 276:1268-1271 (1997)), and may represent a response to the interaction of tumor cells with cells of host basal membrane, for example, in the process of destruction of the basal membrane of metastatic tumor cells. Also we cannot exclude the involvement of stromal cells in regulating the expression of tag7 as occurs, for example, when expression of the gene stromelysin-3 (see P. Basset and others in the journal Nature 348: 699-704 (1990)).

Also of interest is the observation, showing that the level of tag7 gene transcription in tumor cells CSML-0 is several times lower than in cells VMR-L, whereas, if you take the strains of the same tumors in cultures, the picture changed considerably. In particular, after culturing these cells, the transcription level of the gene tag cells VMR-L. In cultured cells MT TC1 was slightly lower level of tag7 transcription compared with cultured cells CSML-0. This change in the level of tag7 gene transcription in cultured cells VMR-L can be explained by the fact that this culture is not monoclonal and therefore the proportion of the subpopulation of metastatic cells in culture can be quite small (see article Filder I. J., and Hart, I. R. journal Science 217:998-1001 (1982) and Senin V. M. in Vestn. Acad.Med.Nauk. SSSR 0(5): 85-91 (1984)). On the other hand, the heterogeneity of the cell culture CSML-0 set D. A. Kramer'ω (personal information). Of particular interest is the mention of the fact that the tag7 gene transcription was observed in cell cultures of those tumors that were of epithelial origin and low (5-10%) metastatic potential. However, of the 13 cell lines with different metastatic properties, which have been studied only in the cell line VMR-L transcription of the tag7 gene is correlated with a marked metastatic potential of this tumor.

Over the past decade has been studied and cloned a number of cytokines related to TNF. Proteoliticeski received form of TNF-is a well-known rastafarianism T-lymphocytes (see article Tanaka and others in the journal EMBO J. 14:1129-1135 (1995), and cell line murine thymoma, as shown, secretes a soluble CD40-ligand (see Armitage G. et al. in the journal Eur. J. Immunol. 22:2071-2076 (1992). Due to its structural similarity with other cytokines, TNF related, tag7 may be recognized as a new member of this growing family.

The location of the tag7 on chromosome allows us to understand the role of tag7 in vivo. Cytogenetic band A genetically connected with jade, similar to lupus in MRL and new Zealand hybrid system models eritematoso erythematosus (SLE) (see article L. Morel and others in the journal Immunity 1:219-229 (1994); Kono, D. H., and others in the journal Proc.Natl.Acad.Sci. USA 97:10168-10172 (1994)). Although there is no probability that the SLE involved in mutations with strong functional changes, experiments allow to penetrate into the possible role of tag7 in this pathogenic process.

Localization of RNA tag7 mainly in lymphoid organs is of interest, given the cytotoxic effect of soluble protein. It is obvious that the main step in the cascade of regulation occurs at the post transcriptional level. Even minor changes in the production of RNA tag7 lead to changes in the total amount of protein synthesized and its secretion. Therefore, it is possible, Ana forms of the ligand.

One of the biological properties of tag7 established by these studies, is its involvement in the induction of in vitro apoptosis in some cell lines. Apoptosis or programmed cell death is essential for normal development and homeostasis of the organism. Fragmentation of DNA on multimer about 180 NP one of those changes that occur during apoptosis.

It was interesting to find that the tumor VMR-0, transfected tag7, grow much more slowly than the parent tumor VMR-0. It has been shown that some cytokines are able to induce tumor rejection, if they are produced locally tumor cells after gene transfer (see Hock N. and others in the journal Proc.Natl.Acad.Sci. USA 90:2774-2778 (1993)). Various cytokines, activating heterogeneous transistor opuholepodobnoe mechanisms, but for the complete rejection of tumors are always required cells CD8+. Was recently described a strong antitumor effect of human LT-in murine experimental models (see Z. Qin and Blankenstein T. in the journal Cancer Res. 55:4747-4751 (1995)). In tumor rejection involved complex immunologic mechanism involving both T-Clete as effective as TNF (see Z. Qin and others in the journal Blood 55:2779-2785 (1995)). There was no toxic effect of cells transfected tag7, mouse, and any direct cytoxicity activity of the clones transfected design tag 7 was not detected in the L929 cytotoxicity assay. Although the activity of tag7 in air-conditioned environment of the clones below the limit of determination, the clone that produced lower amounts tag7 RNA grew faster in syngeneic mice. The inhibitory effect of locally allocated tag7 in relation to the development of tumors, most likely indirect and may be cancelled by the injection of antibodies anti-tag7. This is also proven by experience, which was subjected to monitoring tumor growth in the parental line VMR-0 and jointly injected cells 4SX. Even when were injected with double the normal number of cells, the rate of tumor growth is significantly reduced. Finally, the complete reduction of the tumor or remission can be achieved through the secretion of higher quantities of tag7.

In the inhibition of the development of tumor cells, mediated tag7 seems to be not involved in T-lymphocytes, because in the absence of T cells (for example, in naked mice) cells producing tag7, RA is e data the participation of other types of cells in the antitumor response induced tag7, cannot be excluded.

Since the transfer of the gene into tumor cells is poleznim means to assess antitumor activity of various cytokines and anti-tumor agents, was investigated antitumor activity tag7 by introducing its cDNA in tag-7-negative tumor cells. It was shown that several cytokines are able to induce tumor rejection, if they are produced locally tumor cells after gene transfer. Various cytokines activate the mechanisms of heterogeneous transistor suppression of tumors, but a complete rejection of tumors are always required cells CD8+. Was recently described a strong antitumor effect of human LT-in murine experimental models. In tumor rejection involved complex immunologic mechanism involving both T-cells and b-cells. It is shown that LT-less toxic to animals than TNF, and at least as effective as TNF. Tag7 was recently described as a protein, the secretory lymphocytes, cytotoxic against a limited number of target cells. This from brettell was unable to detect a direct cytoxicity activity of several clones, transfected tag7 design, cytotoxic analysis of L929 and had to switch to the level of tag7 mRNA. Although the activity of tag7 in air-conditioned environment of the clones below the limit of determination, the clone, which was produced lower amounts of RNA tag7 grew faster in syngeneic mice. The inhibitory effect on tumor development locally allocated tag7 likely to be indirect and may be cancelled by the injection of antibodies anti-tag7. This is also proven by experience, which was subjected to monitoring tumor growth in the parental line VMR-0 and jointly injected cells 4SX. Even when injected at twice the normal number of cells, the rate of tumor growth is significantly reduced. Finally, the complete reduction of the tumor or remission can be achieved through the secretion of higher quantities of tag7. The effect of rejection after implantation of the parent and modified cells in the same site leads to the conclusion that the action of the tag7 at least locally limited and is induced by some non-specific reaction of the host cell, which is also aimed at the exclusion of the observed tumor cells. However, temporary tag7 expression in melanoma cells M3 is f has a local restrictions and induces some specific reaction of the host, which also rejects and distant cells.

Although the inventor has not found any difference in proliferation parent VMR-0 and stably transfected clones T. vitro, the results of histological and electron microscopy showed a significant decrease in proliferation modified tumors, mainly due to apoptosis modified cells. It does not require the sensitivity of tumor cells to tag7 in vitro, because the tumor cells are resistant to secreted tag7 in culture. However, the available data do not allow sensitivity of tumor cells to Sekretareva tag7 during development in vivo.

In the suppression of tumors on the basis of tag7 apparently not part of T-lymphocytes, because in the absence of T cells (for example, naked mouse) cells producing tag7, grow even more slowly than in syngeneic mice; thus, it is most likely that T cells are not essential for the inhibitory effect. This clearly shows that the involved mechanism can effectively act on the tumor, which lack antigen exclusion is specific to tumors, and therefore it can be used to treat neoantigenic tumors.

Immunohistochemical Ana is Ino In lymphocytes although the rate of growth in SCID mouse (in the absence of b-cells) showed a significant difference only in comparison with the mouse, the negative T-cells (naked). These results mean that, obviously, tag7 restores b-cells and activates their cytotoxic activity, leading to apoptosis of tumor cells. The induction of protective immunity by tag7 allows us to come to the conclusion that the transfer of tag7 may be an effective therapeutic strategy.

Having described the invention, for clarity of understanding, supplemented with some parts with the help of illustrations and examples, any ordinary person skilled in the art will clearly realize that the same can be done through modifications and changes of the invention in a wide range equal terms, formulas, and other parameters without prejudice to the scope of the invention or any of its specific embodiments and that such modifications or changes that are assumed to be covered by the scope of the attached claims.

All publications, patents and patent applications mentioned in this description, define the level of knowledge of those who is a specialist in the area belongs to this invention, and are shown here only as a reference in the same article is shown as a link.

Examples

Materials and methods

All of the examples mainly used the following materials and methods.

Tumors and cell lines

Metastatic (VMR-L) and nemetstaticescoy (VMR-0) line cancer murine mammary gland were obtained as grafts in mouse A/Sn. In the case of VMR-0 transplantation was performed using tumor material, in the case of VMR-L-line - using cells from metastases in the liver. The tumor was 1 cm in diameter, was developed at the injection 2-3 weeks after intramuscular injection of cells 5105. The L929 cells were obtained from American Type Culture Collection (number ATCC:CRL-2148; Rockwill, Maryland). Cells from VMR-0, VMR-L, VMR-Lym (see SeninV.M. log Vestn.Akad.Med.Nauk. USSR 0(5):85-91 (1984)), CSML-0, CMSL-100 (see Senin V. M. and others in the journal of Experim. Oncol. (USSR) 5(63):35-39 (1983)), Line 1, LL Met, 10 T1/2, MT TC1, MT1 TS (see Barnett S. C. and Eccless S. A. journal Exp.Metast. 2(1):15-36 (1984)), RAC 5E, RAC, 34E, RAC, 10P, RAC 311C (see Sonnenberg A. and others in the journal Cancer Res. 46:5913-5922 (1986)) and cell line L929 were grown in an atmosphere of 5% CO2in DMEM containing 10% fetal bovine serum (FBS) and penicillin and streptomycin at 100 units/ml.

Cell line M3-mouse metastatic melanoma (ATSS CCL 53.1): Cells were cultured in medium RPMI 1640, what Itanium transfection reagent DOTAP (Boehringer Mannheim), in accordance with the manufacturer's recommendations. Cells were grown in medium containing G418 for two weeks before selection of individual clones.

Murine splenocytes, thymocytes, monocytes and peritoneal macrophages were isolated, as previously published (see Klaus, G. G. B. Lymphocytes: A Practical Approach, Klaus, G. G. B., ed. Oxford, U. K.:IRL Press, Chapter 1 (1988)). Cells were cultured in medium RPMI-1640 containing 5% FBS, 100 u/ml penicillin and streptomycin and 10 mm HEPES. In some studies, cells activated with bacterial lipopolysaccharide (LPS) in an environment free from serum during different periods of time.

Cells VMR-0 and VMR-L, LPS-stimulated, and air-conditioned environment, were obtained, as has been previously disclosed (see K. C. Sheehan and others in the journal J. Immunol. 142:3884-3893 (1989.)). Briefly, cells VMR-L was treated with LPS (6 mg/ml) for 18 hours at 37°C. in a medium free from serum that does not contain cells supernatant was purified by centrifugation and used for holding cytotoxic assays or immunological studies.

Allocation RNA

Total cellular RNA was isolated using the guanidine-isothiocyanato method (see Chomczynski P. and Sacchi N. log Anal. Biochem. 162:156-159 (1987)). Polyadenylated mRNA extracted by Harbor Laboratory Press, page 545 (1982)).

Remove chromosomal DNA from RNA preparations

50 µg of total RNA were incubated for 30 min at 37With 10 units of dnaase I and a buffer containing 10 mm TRIS-HCl, pH 8.3, 50 mm KCl and 1.5 mm MgCl2in the presence of 10 units inhibitlr human placental ribonuclease.

Identification of differences in RNA

Identifying differences in mRNA was carried out according standartnym methods (see R. Liang and Pardee, A. B. in the journal Science 257:967-971 (1992)). Briefly, cDNA was obtained from a 0.2 µ g RNA using the reverse transcription reaction using primer T12As (5'-TTTTTTTTTTTT-3') (SEQ ID NO:3) and reverse transcriptase of the virus Moloney murine leukaemia (M-Mul V). T12AC and two short random 5'- oligonucleotide primer (primer 1:5'-AATCGGGCTG-3'(SEQ ID NO:4); primer 2:5-AGTCAGCCAC-3' (SEQ ID NO:5) were used as the 3' -primers in two different combinations in the process of polymerase chain reaction (PCR). Amplificatoare cDNA was separated by electrophoresis in 6% polyacrylamide gels containing 7M urea.

Electrophoresis and hybridization

Electrophoresis of RNA was performed in 1.2% agarose gel in the presence of 6% formaldehyde and 50 mm phosphate buffer (see Maniatis T. and others, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press, page 545 (1982)). For each dotry (Hybond-N, Amersham, England) and was hybridisable with32P-labeled cDNA (see Southern E. M. journal J. Mol.Biol. 98:503-517 (1975)). Fragments EcoRI/Xhol from a clone of the longest cDNA was tagged random praimirovanie using a set of Random Primed Labeling kit (Boehringer Mannheim, Austria) according to the manufacturer's instructions and used as hybridization probes. To equalize the amount of RNA applied to each line, was carried out by hybridization with a sample of DNA GADPH. Hybridization was performed as already known (see Maniatis T. and others, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press, page 545 (1982)).

The purpose of hybridization tag7 human tissue, blot Human Immune System Multiple Tissue NorthernBlot II (Clontech), processed breakdown -32P-labeled tag7 cDNA prepared as described above. Blot contained approximately 2 μg of poly a+RNA per lane from the following human tissues: spleen, lymph node, thymus, peripheral blood leukocytes, bone marrow and liver of the embryo. Then blot hybridized under certain conditions, hybridization is as follows: held prehybridization blot at 65C for two hours in Church buffer (0.5 M sodium phosphate (pH of 7.2), 7% SDS, 1mm EDTA); the sample was denaturiruet at 95 what if 55With, and the blot washed three times with 50With each time for 15 minutes in Church-wash buffer (40 mm sodium phosphate (pH 7.2), 1% SDS). Then the blots were exposed to x-ray film for 24 hours.

Cloning and sequencing of the fragments ccnc

Amplificatoare products of polymerase chain reaction (PCR) and cloned in the vector pGEM-T (Promega, USA). The nucleotide sequence was determined by the method of Sanger (see article F. Sanger and others in the journal Proc.Natl.Acad.Sci. USA 74:5463-5467 (1977)), or automatically using an automatic sequencing machine (Automated Sequenator (Applied Biosystems) in accordance with the proposed manufacturer protocols.

Construction of cDNA library

Double-stranded cDNA was synthesized on the poly a+RNA, isolated from tumors VMR-L using the set of ZAP-cDNA Gigapack Cloning (Stratagene) according to the manufacturer's instructions and cloned intoZAP-vector at the EcoRI and XhoI sites. The cDNA fragment of 390 NP was used as a probe for Northern hybridization and screening of the library was carried out by standard methods (see Maniatis T. and others, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press, page 545 (1982)). Positive clones were purified and removed the insert as pBluescript clones, COI is of Sequenase Version 2.0 (USB-American) and synthetic oligonucleotide primers (Applied Biosystem 391 DNA Synthesizer). The genomic library was constructed inFIX II vector (Stratagene) and held a screening in accordance with standard procedures (see Sambrook J. and others, Molecular Cloning: A Laboratory Manual, ed.2. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press, (1989)). The insert was subcloned into pGEM7Z vector and partially sequenced as described above.

Were synthesized oligonucleotides corresponding to the 5' and 3'ends of the coding regions of murine tag7 gene with restriction sites Wamn and HindIII, added at the ends of the oligonucleotides. The coding region of the gene amplified with standard PCR techniques, cut by BamHI and HindIII and was built in frame read by BamHI and indIII restriction sites of expression vector pQES30 (Qiagen).

Full sized fragment tag7 cDNA was cut out of the clone pBluescript DNA restriction enzymes bI and XhoI and subcloned into the expression vector in mammals pBK-CMV (Qiagen) in sites NheI and XhoI.

Chromosomal mapping of the gene tag7

Fluorescent in situ hybridization on mouse metaphase chromosomes was performed using a commercial kit Genome Systems, Ink. (St. Louis, Missouri).

Immunological methods

Produced E. coli recombinant protein tag7 (rtag7) was expressed in M15[pREP4] (Qiagen) and purified on Ni-NTA-agarose (Qiagen), following manufacturer's recommendations.holding rtag7, immobilized in accordance with the manufacturer's recommendations. Electrophoresis in polyacrylamide gel with sodium dodecyl sulfate, immunoassay and Western blot turns were performed by standard techniques (see Sambrook J. and others, Molecular Cloning: A Laboratory Manual, ed.2. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press, (1989)).

Cytotoxic analysis of tag7 and neutralization of the cytotoxic activity

As the source of the native form of the protein tag7 used culture medium conditioned by cells VMR-L, LPS stimulated. The L929 cells were cultured in 96-well tablets at density 3104on the hole. After incubation overnight, the cells were treated with actinomycin D (1 µg/ml) for two hours at 37°C in medium containing no serum. Following this, added to the environment, air-conditioned VMR-L-stimulated LPS, or medium containing LPS, in the amount of 100 μl per well. Where indicated, added recombinant factornecrosis of human tumors (rhTNF; Sigma) with a concentration of 100 ng/ml and in the amount of 100 μg per well. To determine cell death, used the test kit Put Toch 96 Assay kit (Promega) or were stained cells Trifanova blue, and the encoded samples were calculated with pomacanchi effect of protein tag7 or rhTNF conducted using afinno-purified polyclonal antibodies tag7 from rabbit poly-clonal antibodies anti-hTNF (Sigma). Polyclonal antibodies are added to the environment, air-conditioned LPS-induced VMR-L, final concentration 2 μg/ml, and determined the cytotoxic effect, as described above.

Analysis of DNA fragmentation

Analysis of DNA fragmentation was carried out as already described (see Q. Tian and others in the journal Cell 67:629-639 (1991)), with modifications. In short, 2106the L929 cells were subjected to preincubation with actinomycin D (1 µg/ml) for 2 hours at 37With in an environment that does not contain serum, and then for 5 hours were incubated with medium conditioned LPS-induced VMR-L, or with rhTNF. The cells were collected and literally in 20 mm Tris-HCL (pH 8.0) and 10 mm EDTA (TE buffer) at a content of 0.8% Triton X-100. After centrifugation of supernatant was precipitated DNA at -20With isopropanol in the presence of NaCl. Precipitated DNA is re-suspended in TE buffer, processed RNA ASEU and the fragments were separated by electrophoresis in 1.8% agarose gel in TE buffer.

Animal studies

To study the effect of tag7 on the progression of the tumor in vivo were used mouse A/Sn aged 6 to 10 weeks. Exponentially growing cells were collected, washed in PBS and were subcutaneously injected with spinal obkak already described (see article H. Hock and others in the journal Proc.Natl.Acad.Sci. USA 90:2774-2778 (1993)). For neutralization activity tag7 in vivo with 100 µg of affinity-purified antibodies anti-tag7 were injected with subcutaneously with 106tumor cells in zero-day and then the same number of antibodies were injected with the location of the tumor dose PBS volume of 0.2 ml on the 2nd, 4th, 6th and 8th days. Control animals on the same days were injected with only PBS.

Example 1: Detection of genes differentially expressed in tumors with different ability to metastasize

In these studies for the detection of genes with different expression level in two related lines of tumors that differ in their metastatic characteristics, was used the method of "identifying differences in RNA" (see Liang, P. and Pardee, A. B. in the journal Science 257:967-971 (1992)).

Obtained by using the method of "identifying differences in RNA spectrum of cDNA fragments expressed in the murine tumors that metastasize to the liver (VMR-0) and do not metastasize to the liver (VMR-L) shown in Fig.3. It was found that the range of cDNA fragments amplified in the presence of the same pairs of primers are identical for both tumor lines. However, when analyzed large number of combinations Primero is shown in Fig.3). DNA fragments that had no counterparts in neighbouring tracks were suirvey from the gel, amplified in the presence of the same pairs of primers and cloned. The difference in levels of expression of RNA sequences analyzed in two tumor lines was examined using Northern hybridization of cloned fragments from total RNA of the two tumors. As a result of this analysis were obtained two fragments, which have in various ways been hybridizations with RNA from cells VMR-0 and from cells VMR-Liv; these fragments were identified as tag7 (Fig.4) and tag6 (data not shown). It was found that the transcript tag7 well represented in mRNA isolated from tumor lines VMR-L with high ability to metastasizing (Fig.4, lane 2), but was not determined in mRNA obtained from tumor lines VMR-0, do not possess the ability to metastasize (Fig.4, lane 1).

Based on the results of Northern hybridization, the length of the transcript tag7 identified approximately 750 nucleotides. The nucleotide sequence of murine tag7 gene (SEQ ID NO:l) was determined by sequencing on Sanger'y and automatic sequencing and shown in Fig.1. It was found that the tag7 gene planiruetsja on both sides of the same primer 5'-A the sociology of known genes (defined by the study of genetic databases Genbank and EMBL), was cloned full-size cDNA of this gene. Library of cDNA obtained by reverse transcription of total mRNA from tumor lines VMR-Liv, contained approximately 800,000 clones. Were selected 52 clone containing cDNA tag7 gene by hybridization with a fragment of tag7 gene, labeled32P. Nucleotide sequence was determined for several clones by sequencing on Sanger'y and automatic sequencing, and the coding sequence of the tag7 the longest clone is shown in Fig.1 (SEQ ID NO:l). The sequence of this clone and the fragment obtained by identifying differences, as it was found, almost identical. It was found that the nucleotide sequence of the coding segment of clone tag7 is 549 NP (Fig.1; SEQ ID NO:1) and encodes a polypeptide of the 182 amino acid residues (Fig.1; SQ ID NO:2).

Analysis of the predicted amino acid sequence of murine tag7 polypeptide (Fig.1; SEQ ID NO:2) shows that there is a long stretch of highly hydrophobic amino acids at the N end of the polypeptide, which presumably acts as a domain zakryvayushiesya in the membrane, followed by a potential secretory signal sequence (between 20 and 22 amino acid residues). obia between the tag7 polypeptide and the gene products, previously reported. Mouse genomic library was constructed in the vectorFIX II, subjected to screening, and was installed genomic structure tag7. It was found that murine tag7 gene is measured 8 Kb, consists of three exons and contains consensuses TATA-box (not shown). The start site of RNA was mapped using primer extension (data not shown), showing the two sections of initiation, separated by four nucleotides 22 NP below the chain from the TATA-box, probably due consensuses structure of the past. Computer analysis of approximately 200 base pairs of the sequence above circuit (Signal Scan) showed a number of potential binding sites for some of the known transcription factors such as Ets-1, NF-kb, Sp-1 and myoD. The order of these binding sites and the distance from the start site of mRNA were very close control region of the mouse gene LT-(see D. K. Pokholok, etc. in the journal Proc.Natl.Acad.Sci. USA 92:674-678 (1994)). Moreover, 5'-netransliruemye region tag7 mRNA, as detected is relatively short, as is typical for genes of lymphotoxin.

These similarity between genomic structures and murine tag7 LT-folds (see C. Smith and others in the journal Cell 76:959-963 (1994)). The fourth domain is found less homology, but inside the remains were still conservative. It was also found that tag7 abounds cysteine residues, as well as LT-(see Aggarwal B. B., and others in the journal J. Biol.Chem. 269:2334-2339 (1985)), contains four methioninol balance. The distance between the estimated transmembrane domain and the domain in tag7, binding the receptor, was approximately the same as the LT-(25 amino acids) and TNF-(31 amino acids).

For further clarification of the three-dimensional structure of the tag7 polypeptide and determine its relationship with cell membrane and potential antigenic regions of the polypeptide were constructed charts hydrophilicity on the Kyte-Doolittle index of antigenicity Jmeson-Wolf for tag7 polypeptide using a computer PROTEAN program (DNASTAR, Ink.; Madison, Wisconsin). As shown in Fig.2, Polipo from 1 to 20 residues), the most likely represents an N-terminal signal sequence of approximately 20 amino acids). In addition, the graph of the index of antigenicity (Fig.2) identify at least four potential epitopes areas of the tag7 polypeptide, amino acids 20-40, 55-75 amino acids, the amino acids 90-110 and amino acids 145-160, and the fifth region with potentially weak antigenicity on amino acids 120-130.

Example 2: Analysis of transcription of the murine tag7 gene in various normal and tumor cells and tissues in mice

To check the level of tag7 transcription in various normal and tumor cells and tissues from various organs healthy mice were isolated total RNA and probed by hybridization with32P-labeled DNA breakdown tag7. As shown in Fig.5, the highest level of tag7 transcription in healthy mice was observed in the spleen and lungs, and lower levels in brain and goitrous gland. It was found that the transcript tag7 all bodies have the same length - about 750 nucleotides, including coding segment 549 NP plus an additional 5' and 3'netransliruemye the field, including 3' poly a + tail (not shown). In the liver or any other organs was not observed in the expression of tag7 even after promolgated in mouse very tissue-specific.

However, when checking various tumor cell lines, as was found, the tag7 gene transcription was not limited metastatic line VMR-L. tag7 Expression was also observed in tumor lines family VMR having the greatest ability to metastasize, especially in tumors VMR-Ov (Fig.6). Tag7 gene was also transcriptionally at a low level in line CSML-OH, in which the frequency of metastasis to the lungs is about 5%.

To clarify the relation tag7 gene with the process of metastasis, RNA from different cell cultures from tumors with different ability to metastasize and specificity of metastasis in organs, as well as having different origins, were hybridized with a cDNA fragment of the gene tag7; the results are shown in table 1.

Interestingly, these results demonstrate that, when the tumor strains transformed into a line of planted crops, observed changes in the level of tag7 gene transcription in vitro: transcription of the tag7 gene significantly reduced in cell lines VMR-L, while in cell lines CSML-0 was observed moderate levels of expression tag 7. Tag7 gene was transcriptionally at a fairly high level in line MT TC1 - cultures.

For a more thorough check of the correlation between the expression of tag7 mRNA and the ability of tumors to metastasize used Northern hybridization. However, hybridization of total RNA tumor CSML-0 and CSML-100 was not observed no correlation (Fig.7). Moreover, it was discovered that the tag7 gene expression in this pair is specific for a tumor with a low ability to metastasize, CSML-0. More intriguing is to confirm the above observations that the level of tag7 mRNA changed dramatically after the formation of the primary tumor cell cultures. In other investigated cell lines from murine tumors there was no correlation between the ability to metastasize and expression of tag7 mRNA (data not shown).

To determine the tissue distribution of tag7 transcription was performed by Northern blotting and in situ hybridization. Northern hybridization of several types of tissues of the adult mouse (Fig.8A) showed the highest level of tag7 transcription in lung and spleen, the recorded level in the brain and goitrous gland and the complete absence or only a low level of mRNA expression in the other examined tissues. However, in situ hybridization on sections of selected organs gave the registration TRANS is PCIe tag7 in hematopoietic and lymphoid cells, which, as you know, are the main source of cytokines of the TNF family. Murine splenocytes and resident peritoneal macrophages showed significantly high level of tag7 mRNA (Fig.9). Stimulation of IL-2 or phytohemagglutinin not led to a significant increase in the content of tag7 mRNA in thymocytes and macrophages at the time of the survey (data not shown). In cultured with LPS mouse splenocytes level of tag7 transcription was increased during the first hours of activation (maximum 24 hours poststimulation) (Fig.9). Northern-blot cell line WEHI-231 mouse lymphoma b-cells and line LBRM-33 cell lymphoma of T-cells did not show the recorded level of tag7 transcription in the presence or absence of PMA, LPS or ionophore calcium for 20 hours (data not shown).

Example 3: Chromosomal mapping of the murine tag7

To determine the chromosomal localization of tag7 in the murine genome metaphase chromosomes were analyzed by fluorescent in situ hybridization. The total number of analyzed metaphase cells was 80, and 62 of them were found tag7-specific tagging. In these experiments it was observed specific tagging of the centromeric region of chromosome 7 (data not shown). Measuring ten spacesstore from centromeric region, the area that corresponds to band A.

Example 4: Expression of soluble murine tag7 in cell lines and lymphoid cells

To study the tag7 expression on the protein level, Western-blotting was used polyclonal rabbit antibodies raised against rtag7. While tag7 protein was not determined in cultured cells VMR-L and in the culture media conditioned by these cells in the environment, air-conditioned LPS-stimulated cells VMR-L, was registered a high level of tag7 protein (Fig.10A). These results suggest that, as well as TNF and LT-, tag7 protein can exist in two forms: soluble and associated with the cell. The proposed form of protein on the cell surface was determined in cell extracts, but most of all protein secretarials in the culture medium after LPS treatment. Although increasing levels of tag7 mRNA in the activation process slightly (data not shown), the degree of synthesis and secretion of protein tag7 relatively high. The same character of gene expression have also been observed in cell line CSML-0 expressing tag7 (data not shown). Freshly isolated mouse splenocytes contained a significant amount associated with cells the isolation of about 24 hours. Interestingly, these increased levels of expression of protein tag7 temporarily coincide with changes in the localization of the protein: while most tag7 protein was detected in the form associated with the cells in the first time after LPS stimulation, prolonged exposure to LPS to cells not only leads to increase in total protein, but also to its secretion. Differences in the amount of protein tag7 in unactivated cells VMR-L and the splenocytes (Fig.10A,B) may reflect the fact that these two cell types involve different mechanisms of activation of a gene, and/or what splenocytes were activated in vivo prior to their release from the spleen.

Example 5: the DNA Fragmentation induced soluble murine tag7

It was shown that tumor necrosis factor (TNF) induces apoptosis in vitro in different cell lines, in some cases, through synergistic interaction with actinomycin D (see Browning and J. A. Ribolini in the journal J. Immunol. 143:1859-1867; Larrick and others (1990). The similarity between the structure of the tag7 gene and cytokine belonging to the TNF and the existence of a soluble form of the protein was allowed to come to the conclusion that the tag7 polypeptide can also run the programmed death of cells.

To explore this possibility for the soluble form of tag7, glue the notches VMR-L. Destruction of target cells after incubation with 100 µg air supernatants subjected to monitoring by colouring Trifanova blue. The results presented in Fig.11A, showed that TNF, and tag7 killing of L929 cells in the presence of actinomycin D, but the death of cells induced tag7, inhibited by the addition of antibody-anti-tag7.

Since the process of apoptosis quickly causes fragmentation of DNA was verified the ability of the secreted form tag7 run apoptosis using standard methods of analysis of DNA fragmentation. L929 target cells were treated or conditioned supernatants VMR-L cells stimulated by LPS, or LPS-containing medium and recombinant TNF as controls. After five hours of incubation fragmented DNA in the cell cytoplasm re-allocated and separated using agarose gel electrophoresis. As shown in Fig.11B, L929 cells began to experience apoptosis after treatment of the soluble form of the protein tag7, as proved vnutriregionaljnoj fragmentation of DNA. In contrast, the control cells showed DNA fragmentation. These results indicate that the processing of the tag7 can induce apoptosis in some tumor kletchatkoj mammals.

Example 6: Inhibition of tumor growth induced tag7

a) Obtaining cell lines producing Tag 7

Demonstrating that tag7 can cause apoptosis in vitro, then I checked the influence of the tag7 on the development of tumors in vitro. To facilitate these biological studies full-sized copies of the cDNA of murine tag7 gene were subcloned into expression vectors mammals. Cells VMR-0, not expressing any significantly tag7 mRNA genetically transformed with these vectors to obtain tag7 mRNA; transfectants were selected for resistance to G418 and cloned. A number of clones analyzed for the level of tag7 transcription, and two clones (4SX and 12SX), distinguished by the level of tag7 mRNA, were selected for further analysis (Fig.12A). tag7 cDNA cloned in the vector pM5Gneo and held stable transfection of cells VMR-0.

Modified cells otbrali for G418-resistance, cloned and analyzed (clone 8SX). This vector allowed us to obtain a certain amount of protein determined by Western-blotting (Fig.12 D, the upper band), and cytoxicity culture medium (lower band), while when using the CMV promoter only registered tag7 mRNA (clone 12SX, 4SX). For this experience, air-conditioned environment, cloa well, containing approximately 104cells). After four hours incubation, cytotoxicity was measured by staining Trifanova Blue, using a set of Cyto Tox Kit (Promega). However, the vector pM5Gneo bearing part of the gag gene, virus, myeloproliferative sarcoma, and cells pseudotranslation this vector were significantly more immunogenic in immunodeficient animals than the control cells, transfected with the plasmid pBK/CMV. Parent cell VMR-0 and pseudotranslation cells VMR-0 Neo has not produced the recorded level of tag7 mRNA. Genetically modified cells VMR-0 significantly not different from the parent cells in morphology, and in the ability of cell proliferation in vitro.

b) the tag7 gene Expression suppresses cell growth VMR-0 in vivo in a syngeneic mouse

To determine whether tumor cells being transfected tag7, change their ability to form tumors, 106cells transfected tag7, and control cells were subcutaneously (s.c.) implanted in syngeneic mouse A/Sn. Cells expressing tag7, grew more slowly than control cells (Fig.12V: empty squares - parent tumor cells VMR-0, the shaded triangles - pseudocyst to the location of the cells, filled squares - observed effect joint injections parent (VMR-0) and tag7-modified tumor cells (4SX), empty triangles - speed growth of the clone 12SX, filled circles - speed growth of the clone 4SX.C - parent and modified (clone 4SX) tumors obtained by excision from syngeneic animals), and the rate of suppression of tumor growth correlated with the level of tag7 mRNA and protein content. In control animals there has been a progressive increase parent and pseudotranslation cells.

Fig.12C shows the tumors formed by parental cells VMR-0, then 4 weeks after injection, and tumors formed by cells 4SX, then 5 weeks after injection.

The most intriguing observation was the complete absence of hemorrhagic necrosis, even when the tumors reached a considerable size 90 days after injection, whereas the parent and pseudotranslation tumors were disappearing in less than two weeks after injection. This observation is further confirmed by histological analysis of the tumors, the formation of which is induced by injection of parental cells (cells VMR-0) and tag7-modified cells (cells 4SX). Antiproteinuric development in vitro. Indirect impact on the suppression of tumor development in vivo is confirmed by the joint implantation of cells 4SX and parental cells VMR-0 (106just 2106) subcutaneously at the same place. Although the development of the tumor is inhibited not as much as only transfected cells, it showed clearly observed effect of unmodified tumor cells. To verify that the reduced ability to form tumors were the result of secretion of tag7 were subcutaneously injected with modified tumor cells in syngeneic mice with polyclonal antibody anti-tag7. Reducing the ability of the modified tumor cells to the formation of tumors almost blocked by injection of antibodies anti-tag7 with an interval of 2 days, and cancel their introduction to the 8-th day has led to immediate recovery antiproliferative effect.

Injection tag7-bearing tumor cells did not cause any anomalies (e.g., weight loss) in mice hosts during the experiments. This observation indicates that secreted tag7 can induce antitumor effect against parental tumor cells without causing systemic toxicity.

Example 7: the Rate of development is mportant cellular mechanisms, involved in the antitumor response induced tag7, transformed tumor cells was also analyzed in naked mice (defective in T cells) and mouse SCID (defective T - and b-cells) (Fig.13). This experience is used only cells with a high level of tag7 (4SX). Tumor size was monitored for 40 days. Parent and pseudotranslation cells have exactly the same kinetics of development in naked mice and SCID mouse. The speed of development of modified tumors was suppressed in both models, however, the size of the tumor at the end of the probationary period in the SCID model was 50% more than the naked mouse. This means that the absence of b-lymphocytes may play a role in partial recovery rate of tumor growth.

Fig.14 shows a naked mouse, infected tag7-modified cells VMR-0 (top photo, clone 4SX) and parental cells (bottom photo).

Example 8: tumor Rejection is a consequence of the apoptotic process in the modified tumors

Rejection tog-7 transfectants did not depend on cytotoxic T-lymphocytes, because it was observed in naked mice defective in T cells. In order to understand the underlying cellular mechanisms, conducted histological analysis and power who has had continuous growth and Central necrotic area. The number of mitotic cells was relatively high, approximately 6-8% of the cells were in the process of mitosis and apoptotic cells in the parent tumors were rare (table 2 shows that the total difference in proliferative activity between the parent and modified cells was more than 50 times).

Modified tumor were destroyed and released from necrotic foci. Electron microscopy showed that more than 8% of tumor cells possess properties characteristic of apoptosis, since the aggregation of condensed chromatin, nuclear fragmentation, and so on, the Top picture in Fig.15A depicts a histological slice of the tumors formed by parental cells (cells VMR-0), dyed with eosin/hematoxylin. The bottom picture in Fig.15A depicts a histological slice of the tumor formed tag7-modified cells (cells 4SX), dyed with eosin/hematoxylin. Apoptotic cells are marked by arrows. Fig.15V obtained shows electron microscopy images of mitotic cells in tumors formed by parental cells (cells VMR-0); Fig.15C shows the obtained electron microscopy images of apoptotic Clete primary tumor

Although SCID mouse growth-modified tumor was also suppressed, the average size of tumors was higher than in naked mice, implying a role of b cells in apoptosis-modified tumor cells. For recognition of effector cells, we conducted immunohistological analysis of tumor tissues. Parent and tag7-modified tumor cells (4SX) were injected with in syngeneic mice subcutaneously every 3 weeks the tumor tissue was isolated and the sections were stained with antibodies anti-CD45R/B220, -Gr-1, -CD8a, -CD4, -CD11b(Mac-l). We did not observe significant difference in tumor infiltrating granulocytes, macrophages or CD4+,CD8+ (data not shown) in the parent and modified tumors. However, tumors that produce tag7, have been heavily infiltrated by cells CD45R+ (Fig.16A), i.e., preferably In lymphocytes. On the contrary, in the parent tumors CD45R+ positive cells are virtually absent (Fig.16B). The most intense infiltration is observed at the tumor borders and in areas where blood vessels.

Example 10: the Induction of protective immunity by the time tag7 expression in cells M3 mouse melanoma (preventive model)

M3-cell murine melanoma were temporarily transferir Aravali subcutaneously in syngeneic mouse DBA/2. One week after implantation of the transfected tumor cells of animals infected parent M3-cells in places that does not coincide with the places subcutaneous injection. Those animals that are implanted tumor cells transfected with a construct expressing tag7, the growth rate of the parent M3-cells were decreased. Table 3 shows the tumor size in animals that were vaccinated M3-cells, transfected as GM-CSF, and tag7 (retransferring M3-cells as a control; the number of cells used for vaccination, given in the table), and then infected with 106parent M3 melanoma cells. The size of tumors formed by parental M3-melanage cells was monitored; it is shown in the table, mm3. Experience has shown that transient expression tag7 inhibits the development of these tumors is at least as effective as GM-CSF.

Fig.17 shows the degree of survival of mouse DBA/2 in this experiment (unfilled circles: 500,000 M3-cells in the mouse: an unfilled squares: 500,000 GM-CSF-transfected M3-cells in mice; filled squares: 500,000 tag7-M3 transfected cells in mice; filled circles: 106parent M3-cells per mouse).

Example 12: the Selection and sequencing of human tag7

Northern blotting of human RNA using murine tag7 as samples showed high expression of the human homologue in the bone marrow (BM) and low expression in cells of peripheral blood (PBLs) (Example 11).

Human BM-library (Clontech the robe cDNA of murine tag7. A sample was cut from the plasmid px as a movie Xhol-EcoRI, length approximately 700 NP. The cleaned strip marked R32using set for efficient labeling (high prime labeling kit, Boehringer Mannheim, cat.no. 1585584).

110 phage plaques were subjected to screening. 25 positive clones it was possible to register in the first screening, and appropriate plaques were purified and analyzed.

DNA from these positive clones was obtained using a set of Qiagen lambda kit#12549. Insert cut out by restriction enzyme cleavage by NotI and cloned into the vector pGEM11f+. 3 clone contained human tag7 (clones #6, #12 and #13) and one of them contained a complete cDNA (# 13). Full clone #13 contained the second above cDNA cDNA tag 7, coding for MRP-8, a protein related to the factor of inhibiting the migration of macrophage (MIF), ACC..X 006234. This protein is a protein that binds calcium in macrophages. All three clones were sequenced. The fourth clone (#10) was sequenced directly from lambda DNA using amplificatoare insert by PCR before sequencing.

In the resulting sequence had an open reading frame as shown in SEQ ID NO:3, encoding tag7 according to the amino acid sequence of SEQ ID NO:4.

Human is to place a presumed signal sequence. Experienced in this field specialist common is the determination of the presence or length of such a leader sequence, respectively, by sequencing the N-terminal Mature (natural or recombinant) polypeptide tag7.

Sequence alignment of human and mouse cDNA (using cluster method using the table the weight of residue deposits) confirmed 77.2 percent of similarity. On the protein level was determined 66,1% similarity using cluster method using the table the weight of residue deposits.

Example 13: Expression of recombinant mouse and human tag7

(a) Expression of recombinant murine tag7 in E. coli

For the first series of experiments used the expression plasmids indicated tag7pDH13/12, which contains a leader sequence STII and phoA-promoter (obtained from pDH13), and the expression plasmids indicated tag7pDH15/l with a leader sequence STII and Thr-promoter (obtained from pDH15).

To obtain plasmids, leader sequence STII was fused with murine tag7 ("mutag 7") in the reaction (SOE lengthening with overlapping, "splice overlap extension"; see Norton R. M., Hunt, H. D., No S. N., Pullen, J. K. and Pease L. R. journal of Gene 77:61-68 (1989)), received XhoI- > PST fragment and cloned in vectorstar. Thr-promoter is induced by intracrinology acid. STII-leader sequence was replaced alleged leader sequence mutag7 as the first amino acid residues mutag7 were selected SEWR (starting with 24 amino acids in SEQ ID NO:2). DNA fragments that were subject to the merger, were obtained in two separate PCR reactions:

PCR1:

direct primer EBI5141: 5'GAAAGGGCCTCGTGATAC3'(SEQ ID NO:8)

reverse primer AC1=EV:

5'CAGGGCCCTCCACTCACTTGCATAGGCATTTGTAGC3'(SEQ ID NO:9)

DNA matrix was pDH 13.

PCR2:

direct primer: AC2=EW

5'GCTACAAATGCCTATGCAAGTGAGTGGAGGGCCCTG3'

(SEQ ID NO: 10),

reverse primer: EU:

5'GGCCGCTAGCCTGCAGTTATCACTCTCGGTAGTGTTCCCAG3'

(SEQ ID NO:11)

DNA matrix was px-plasmid carrying mutag7 (SEQ ID NO:l).

PCR fragments were dispersed in 1% agarose gel and purified using the Qiagen Qiaex II. Purified PCR fragments were fused in the next SOE reaction:

direct primer: EBI5141

reverse primer: EBI8203

DNA-matrix: purified PCR1 and RSR fragments.

The resulting PCR fragment was then cleaved Xhol and > PST and cloned in pDH13 and pDH15 that were split at the same fragments. pDH13 and pDH15 are the alpha fragment of human interferon as an insert, which is delegated by splitting XhoI- > PST and replaced the SOE fragment mutag7. E. coli DH5 was transformed plasmid is.

For the next experiment used the expression plasmids, designated as pGEX-2TmuTag7/clan, in order to Express the murine tag7 as GST-tag7 fusion protein.

To add a BamHl restriction enzymes cut sites to the 5'-end and EcoRII to the 3'-end cDNA mutag7 in the process of PCR reaction were used synthetic oligonucleotides. PCR reaction was conducted with px-plasmid as DNA template and the primers:

EBI8471

(contains a BamHI site) and EBI8472 (contains EcoRI site)

EBI8471: 5'GGCGGATCCGAGTGGAGGGCCCTGCCATCC3'

(SEQ ID NO:12)

EBI8472: 5'GGCGAATTCTTATCACTCTCGGTAGTGTTCS'

(SEQ ID NO:13)

The PCR fragment was purified and digested by BamHI and EcoRI and cloned into the same sites of pGEX-2T (Pharmacia). The structure of the primers were chosen so that the first remains mutag7, fused with GST-protein, were Glu Trp Arg Ala (starting with amino acid at position 25), thus excluding the assumed leader sequence. E. coli w3110 was transformed with the plasmid pGEX-2TmuTag7/clan, and the expression of CST-mouse tag7 was examined using Western blotting (Fig.19). Western blotting shows a strip approximately 44.5 KD (26 KD GST plus an 18.5 KD tag7) in line a, line b as a positive control shows murine tag7 from supernatants CSML-0 cells at a molecular mass of 18.5 KD.

(b) Expression of recombinant murine tag7 in Cho-cells

For these experiments AD-CMVl). To add the restriction sites BglII to the 5'-end and NheI to the 3'-end cDNA mutag7 in the process of PCR reaction were used synthetic oligonucleotides. PCR reaction was conducted with px-plasmid as DNA template and the primers:

EBI8233

(contains a BglII site) and EBI8203 (containing NheI site)

EBI8233: 5'GGCCAGATCTCGTCCAGCATGTTGTTTGCCTGTGCT3'

(SEQ ID NO:14)

The PCR fragment was purified and digested BglII and NheI and cloned into pAD-CMVl (ER.438), which was digested BglII-XbaI.

Were obtained from sustainable B16 and t-cell lines expressing murine tag7. Plasmid tag7+L pAD-CMVl was linearizable with FspI and cotransfection with the plasmid pCI-neo (Promega) in Cho cells. Clones expressing murine tag7, recognized by Western blot of cell culture supernatants.

For the following experiments used the expression plasmids indicated Tag7+IgL pAD-CMVl/2, with a synthetic leader sequence of the light chain of immunoglobulin (obtained from pAD-CMVl).

Synthetic leader sequence of the light chain of the immunoglobulin IN4+leader plasmid was merged with mutag7 in the SOE reaction ("splice overlapping extension"), was derived BglII-NheI fragment and cloned in the vector pAD-CMVl (WO 93/11257). Leader sequence of the immunoglobulin replaced the alleged leader sequence mutag7, and as parknig PCR reactions:

PCR1:

direct primer I: 5'GGCACCAAAATCAACGGGAC3'

(SEQ ID NO:15)

reverse primer

EBI8201: 5'CAGGGCCCTCCACTCACCATCGTGCACCTGGGC3'

(SEQ ID NO:16)

DNA matrix was INPEP4+leader sequence.

PCR2:

direct primer:

EBI8202:5'CCCAGGTGCACGATGTGAGTGGAGGGCCCTG3'

(SEQ ID NO:17),

reverse primer: EBI8203:

5'GGCCGCTAGCCTGCAGTTATCACTCTCGGTAGTGTTCCCAG3'

(SEQ ID NO:18)

DNA matrix was px-plasmid carrying mutag7.

PCR fragments were dispersed in 1% agarose gel and purified using the Qiagen Qiaex II.

Purified PCR fragments were fused in the next SOE reaction:

direct primer: EBI8143

reverse primer: EBI8203

DNA-matrix: cleaned PCR1 RSR fragments.

The resulting SOE-fragment was then cleaved BglII and NheI and cloned into pAD-CMVl, which was split BamHI and NheI.

(C) Expression of recombinant murine tag7 in Cho-cells

For these experiments used the expression plasmids indicated hutag7pAD-CMVl, with endogenous leader sequence hutag7 (obtained from pAD-CMVl).

To add the restriction sites HindIII 5'-end and EcoRI 3'-end cDNA hutag7 in the process of PCR reaction were used synthetic oligonucleotides. PCR reaction was conducted with pGem hu Bone Marrow Tag7#13/l-plasmid as DNA template and the primers: EBI8748 (contains a HindIII site) and EBI8749 (contains EcoRI site)

EBI8748: 5'GGCCAAGCTTCCACCATGTCCCGCCGCTCTATGCT3'

(SEQ ID NO:19)

EBI8749: 5'GGCCGAATTCTTATCAGGGGGA the public.

Example 14: Obtaining antisera anti-mutag7 and anmu-hutag7

We synthesized two different peptide derived from the sequence mutag7 (murine tag7), and two different peptide derived from the sequence hutag7 (human tag7):

mutag7-peptides

peptide nemu-A: RSEWRALPSECSSRLGHPY (SEQ ID NO:21)

peptide nemu-B: GEDGHVYEGRGWNIKGDHTGCY (SEQ ID NO:22) For immunization peptides were mixed (1:1).

hutag-peptides

peptide nehu-A: AQETEDPACCSPIVPRNEWKALASEY (SEQ ID NO:23)

peptide nehu-B: GEDGLVYEGRGWNFTGCY (SEQ ID NO:24)

For immunization peptides were mixed (1:1).

Rabbits were immunized with subcutaneous injection at 1 and 21 days 500 μg of the peptide mixture. On the 42nd day intramuscularly injected 250 and on the 49th day of 200 μg of the peptide mixture. On the 50th and 51st days intravenously injected with 250 μg of the peptide mixture. Blood was taken at the 63rd, 70th, 77th and 84th days.

Affinity purification of antisera anti-mutag and anti-hutag.

Affinity columns were prepared by linking the peptide mixtures mutag7 and hutag7 with separativity speakers Affi-Gel 10 (Biorad) in anhydrous binding. 20 ml of each polyclonal antisera were purified on a corresponding column, and wash buffer consisted of 0.02 M sodium phosphate, and lucindy buffer - 0.1 M glycine, pH of 2.5. Affinity-purified antisera were subjected to dialysis in PBS, filtered under sterile conditions and hnah.

Conducted immunohistochemical analysis of frozen sections of tissue in accordance with a recent publication (see Karl-Heinz Heider, JobstPetra Skroch-Angel,Hans Peter Vollmers, Peter Herrlich and Helmut Ponta "Differential expression of CD44 splice variants in intestinal and diffuse-type human gastric adenocarcinomas and normal gastric mucosa", Cancer Res. 53, 4197-4203, 1993). Briefly, frozen sections incubated with primary antibody (anticorodal anti-Tag-7, prepared as described in example 14, at 10 µg/ml) or control serum Ig rabbit in the amount of 10 μg/ml) for 1 hour at room temperature. Bound antibodies were determined using a complex system of avidin-Biotin-peroxidase (DAKO, Denmark). Evaluation of staining was carried out using a Zeiss Axioscop by subdividing the intensity of staining on the - (negative), + (weakly positive) and ++(moderate to positive in a high degree).

The expression of Tag-7-antigen in normal and neoplastic human tissues was studied using immunohistochemistry methods. In normal tissues positive staining was observed in all the samples. In the cerebellum and cerebral cortex of individual cells weakly reacted against the antibody anti-Tag-7. Lymphatic cells in a twelve is mainly limited to the cell membrane and the intracellular space. In the lung as the alveolar epithelium and vascular endothelium strongly reacted against the antibody anti-Tag-7. The results are summarized in table 4.

In all studied types of tumors were observed positive staining with the antibody anti-Tag-7 (table 5). In most cases, the staining was moderate to strong and mainly limited to tumor stroma at a diffuse pattern of staining (see Fig.1). In renal carcinoma cells is also highly reacted with the antibody anti-Tag-7 infiltra lymphocytes and vascular endothelium. Tumor cells mainly not detect the reactivity towards anti-Tag-7, except for adenocarcinoma of the colon, where part of the tumor cells were positive (not shown).

In Fig.20 shows the data immunohistochemical analysis of lung adenocarcinoma with antibodies anti-Tag-7. Arrows indicate positive staining of tumor stroma.

A General discussion

To study the genes that are selectively expressed in tumors with a high capacity for metastasis were selected two tumors of the same origin, but differ in their metastatic properties. Yu (which has a wide range of metastases in organs and the frequency of metastases in the liver is not more than 5%) (see article V. M. Senin, in the journal Vestnik. Akad. Med. Nauk. SSSR 0(5):85-9l (1984)): line VMR-0 (frequency of metastasis to the liver near 0%) and line VMR-L (frequency of metastasis in the liver, about 100%). In contrast to tumor lines CSML-0 and CSML-100 none of the tumors VMR expresses not previously cloned mts-1 gene, which is transcribed by the majority of tumors (see Grigorian M. S., and others in the journal Genetika (USSR) 25(6):993-1000 (1989)), what makes it useful to search for other genes that are involved in the process of metastasis.

If we consider the tumors obtained in accordance with previously proposed models (see Fidler I. J., and Hart, I. R. journal Science 217:998-1001 (1982)), it is obvious that the tumor VMR-L can be obtained from metastatic subpopulations of cells that are present in the primary tumor VMR in very small quantities and which have a very short lifetime (see Kerbell K. S. Adv. Cancer Res. 55:87-131 (1990)).

This is likely the same origin of the two tumors studied here offers the possibility to use the technique of "differences in RNA for detection of genes associated with the process of metastasis. In General, genetic differences between tumors VMR-0 and VMR-L minor, to a certain extent, confirming their common origin. However, using Oholah VMR-0 and VMR-L. Analysis of selected fragments using Northern hybridization with total RNA from these tumors can be attributed to most of the fragments to the class of known repetitive sequences (IAR-element, and so on). But several of the obtained fragments cannot be identified and therefore are very popular.

One of these fragments, isolated and characterized herein, represent the tag7 gene, which shows a very high level of transcription in tumor VMR-L, metastatic to the liver (see Fig.2). The sequence analysis found that the PCR-fragment was flanked on both sides by using a 5'-terminal primer 5'-AATCGGGCTG-3' (SEQ ID NO:4). When analyzed the nucleotide sequence of the cDNA clone of the total cDNA library VMR-L sequence, similar to the primer length in eight base pairs, was found at a distance of 52 nucleotides from the 3 POLYa + tail cloned cDNA. It is likely that the method of "identifying differences in RNA" you can use the standard oligo-dT-primer instead of the 3'end of the primer and 5'-end primers can vary; this approach will probably lead to a reduction of the amount of generated fragments, but at the same time increase ri attributed to the shortcomings of the methodology. When comparing the nucleotide sequence of the fragment obtained from the PCR reaction, cDNA clone tag7 was found that 44 of the nucleotide at the 5'end of the amplified fragment does not coincide with the same segment sequence of the cDNA clone.

Computer analysis of the full cDNA sequence of murine tag7 revealed two open reading frames (OFR), corresponding to the polypeptides of approximately 182 91 amino acids and amino acid. Both start broadcast in different degrees corresponded to the average of the Kozak sequence (see Kozak M. journal J. Cell. Biol. 108:229-241 (1989)). However, in case of a longer ORF number of nucleotides matching translational consensus sequence, more than when a shorter ORF, and, apparently, the first methionine testified to the presence of the site of translation initiation. In addition, the methionine in postie from +37 to +39 NP in the full-size cDNA is closer to the 5' -end and is therefore more favorable for initiation of translation (see Kozak M. journal J. Cell.Biol. 108:229-241 (1989)). However, the translation of functional tag7 polypeptide can also be initiated from the second methionine.

The molecular weight of the predicted tag7 polypeptide what elnashai, the nucleotide sequence of tag7 and predicted amino acid sequence of its product was analyzed in the databases of GENE and SWISSPROT using the search programs such as FASTA homology (Heidelberg, Germany) and BLAST (Washington, DC, USA). It was not found significant homology with previously known sequences, except for minor homology hydrophobic segment (between 2 and 12 amino acid residues) at the N-end of the predicted sequence of the tag7 polypeptide with-chain of the human T-cell receptor. This hydrophobic region is also homologous to the signal sequence of some proteins (for example, precursors of calreticulin, osteocalcin and extracellular globin III). The presence of a hydrophobic region at the N-end of the predicted tag7 polypeptide suggests that this polypeptide may be a transmembrane localization or may be secreted.

The tag7 expression, as it was discovered, is not correlated with organosilicate metastasis; tag7 gene was transcriptionally not only in cells VMR-L-tumor metastatic to the liver, but also in cells VMR-Ov-tumor metastatic to the ovary. Among normal bodies the maximum level Express the Neu membrane. This correlation may not be in full compliance, but may reflect the role of the basal membrane in the process of metastasis (see Stetler-Stevenson W. G., and others in the journal Ann.Rev.Cell Biol. 9:541-573 (1997)). Interestingly, the level of tag7 gene expression in metastatic tumors is much higher than in the same cells in culture. This result is contrary to recently published results of a study of gene expression in prevechnyj and cultured cancer cells (see article L. Zhang and others in the journal Science 276:1268-1271 (1997)) and may be a reaction to the interaction of tumor cells with cells of host basal membrane, for example, in the process of invasion of the basement membrane metastasis tumor cells. Part of stromal cells in regulating the expression of tag7, which takes place, for example, in gene expression stromatinia-3 (see P. Basset and other Nature 348:699-704 (1990)), also cannot be excluded.

Also interesting is the observation that the level of tag7 gene transcription in several times lower in tumor cells CSML-0 than in cells VMR-L, whereas the translation of strains of the same tumors in culture, the picture changed considerably. In particular, when the cultivation of these cells the level of tag7 gene transcription in cells VMR-L decreases, these cells VMR-L. Several lower level of tag7 transcription was observed in cultured cells MT TC1 in comparison with cultured cells CSML-0. Such a change in the level of tag7 gene transcription in cultured cells VMR-L can be explained by the fact that this culture is not monoclonal, and therefore the proportion of the subpopulation of metastatic cells in culture can be quite small (see Fidler I. J., and Hart, I. R. journal of Science 21:998-1001 (1982); V. M. Senin log Akad.Med.Nauk. SSSR 0(5):85-9l (1984)). On the other hand, the heterogeneity of the cell culture CMSL-0 set D. A. Kramer'ω (cleared by personal contact). In particular, it is interesting to note that the tag7 gene transcription was observed in cultures of tumour cells with epithelial origin, and has a very low (5-10%) the ability to metastasize. However, of the 13 investigated cell lines with different ability to metastasize only in the cell line VMR-L transcription of the tag7 gene is correlated with the observed ability of these tumors to metastasize.

In the last decade were detected and cloned cytokine belonging to the TNF. Well-known soluble cytokine is proteoliticeski obtained form TNF-Chromosomal localization of tag7 opens the possibility to consider the role of tag7 in vivo. Cytogenetic band A genetically associated with nephritis type of lupus in hybrid models-MRL and new Zealand (New Zealand) system eritematoso erythematosus (SLE) (see article L. Morel and others in the journal Immunity 1:219-229 (1994); Kono, D. H., and others in the journal Proc. Natl.Acad.Sci. USA 91:10168-10172 (1994)). Although there is no probability that SLE involved in the mutation with a strong functional changes, sensational experiences with the gene may shed light on the possible role of tag7 in this pathogenic process.

Of interest is the localization of RNA tag7 mainly in lymphoid organs, whereas the cytotoxic effect of soluble protein. It is obvious that the main stage in the cascade of regulation occurs at the post transcriptional level. Even minor changes in the production of tag7 mRNA lead to changes in the total amount of synthesized protein and its secretion. Therefore, the submitted is related to the membrane forms of the ligand.

One of the biological properties of tag7 established by these studies, is its involvement in the induction of in vitro apoptosis in some cell lines. Apoptosis or programmed cell death is essential for normal development and homeostasis of the organism. Fragmentation of DNA on multimer about 180 NP is one of those changes that occur during apoptosis.

It was interesting to find that the tumor VMR-0, transfected tag7, grow much more slowly than the parent tumor VMR-0. It has been shown that some cytokines are able to induce tumor rejection, if they are produced locally tumor cells after gene transfer (see Hock N. and others in the journal Proc.Natl.Acad.Sci. USA 90:2774-2778 (1993)). Various cytokines, activating heterogeneous temporary opuholepodobnoe mechanisms, but for the complete rejection of tumors are always required cells CD8+. Was recently described a strong antitumor effect of human LT-in murine experimental models (see Z. Qin and Blankenstein T. in the journal Cancer Res. 55:4747-4751 (1995)). In tumor rejection involved complex immunological mechanism, involving as T-cells, that is ü as effective as TNF (see Z. Qin and others in the journal Blood 85:2779-2785 (1995)). There was no toxic effect of cells transfected tag7, mouse, and any cytoxicity activity of the clones transfected with tag7 design not found in the L929 cytotoxicity assay. Although the activity of tag7 in air-conditioned environment of the clones below the boundary definition, a clone, which is produced in smaller quantities RNA tag7 grew faster in syngeneic mice. The inhibitory effect of locally derived tag7 in relation to tumor development is likely indirect and may be cancelled by the injection of antibodies anti-tag7. This is also proven by experience, which was subjected to monitoring tumor growth in the parental line VMR-0 and jointly injected cells 4SX. Even when injected at twice the normal number of cells, the rate of tumor growth is significantly reduced. Finally, the complete reduction of the tumor or remission can be achieved through the secretion of higher quantities of tag7.

In the inhibition of the development of tumor cells, mediated tag7 seems to be not involved in T-lymphocytes, because in the absence of T cells (for example, in naked mice) cells producing tag7, grow more slowly than in si types of cells in the antitumor response, induced tag7, cannot be excluded.

Having a full description of the present invention, the details of which are presented using illustrations and examples for clarity of understanding, an ordinary person skilled in the art will understand that you can modify or changing the invention within a wide and equivalent to the conditions, forms and other parameters without affecting the scope of the invention or its specific embodiments of, and have in mind that these modifications or changes are covered by the scope of the dependent claims.

All publications, patents and patent applications mentioned in this description, describe the prior art in the field to which the invention relates, and raised as a reference in this volume, as if each of these publications, patents and patent applications separately was intended for inclusion by reference to it.

Claims

1. An isolated nucleic acid containing a nucleotide sequence encoding the tag7 polypeptide selected from the group comprising a) a nucleotide sequence represented in SEQ ID no:1, (b) the nucleotide sequence corresponding to the amino acid sequence as the deposits from 20 to 182 in SEQ ID no:2, and g) the nucleotide sequence, presented in SEQ ID no:3.

2. An isolated nucleic acid under item 1, isolated from the mouse.

3. Isolated nucleotide acid on p. 1, isolated from man.

4. Isolated tag7 polypeptide, characterized by the sequences selected from the group comprising a) amino acid sequence encoded by the nucleotide sequence presented in SEQ ID no:1, (b) full amino acid sequence represented in SEQ ID no:2) amino acid sequence represented in positions from 20 to 182 in SEQ ID no:2, and g) the amino acid sequence represented in SEQ ID no:4.

5. Isolated tag7 polypeptide under item 4, a murine polypeptide.

6. Isolated tag7 polypeptide under item 4, a human polypeptide.

7. Method of inhibiting tumor growth in mammals, providing the impact on the cell body of a mammal a composition containing an effective amount of at least one isolated tag7 polypeptide, characterized by the sequences selected from the group comprising a) amino acid sequence encoded by the nucleotide sequence presented in SEQ ID no:1, b) p is awn, represented in positions from 20 to 182 in SEQ ID no:2, and g) the amino acid sequence represented in SEQ ID no:4.

8. The method according to p. 7, according to which the specified cell of the mammal is a human cell.

9. The method according to p. 7, according to which the specified cell of a mammal is a tumor cell.

10. The method according to p. 9, according to which the indicated tumor cell is cell carcinoma, cell sarcoma, a melanoma cell or cell leukemia.

11. The method according to p. 10, according to which the specified cell carcinoma selected from the group comprising cell carcinoma of the liver cell carcinoma of the ovary, cell breast carcinoma, cell carcinoma back of the neck, cell carcinoma lung cell carcinoma of the prostate cell carcinoma of the stomach cell carcinoma, bladder cell carcinoma of the testicle cell carcinoma of the rectum, the cell carcinomas of the pancreas, the cell carcinomas of the oral cavity cell carcinoma squamous cells, cell carcinoma of the head and neck and the cell teratocarcinoma.

12. The method according to p. 10, according to which the specified cell sarcoma selected from cells of Kaposi sarcoma, cells fibrosarcoma and osteosarcoma cells.

13. Method of inhibiting the development of tumors of the new nucleic acid, containing the nucleotide sequence encoding tag7 polypeptide selected from the group comprising a) a nucleotide sequence represented in SEQ ID no:1, (b) the nucleotide sequence corresponding to the amino acid sequence represented in SEQ ID no:2, the nucleotide sequence corresponding to the amino acid sequence at positions from 20 to 182 in SEQ ID no:2, and g) the nucleotide sequence presented in SEQ ID no:3.

14. The method according to p. 13, whereby the tumor is a human tumor.

15. The method according to p. 13 or 14, according to which the specified isolated nucleic acid contained in the vector or virion.

16. The method according to p. 15, according to which the specified vector or virion come from a retrovirus, adenovirus or adeno-associated virus.

17. The method according to p. 13, according to which the specified cell of the mammal is a human cell.

18. The method according to p. 13, according to which the specified cell of a mammal is a tumor cell.

19. The method according to p. 18, according to which the indicated tumor cell is cell carcinoma, cell sarcoma, a melanoma cell or cell leukemia.

20. Space, cell carcinoma of the ovary, cell breast carcinoma, cell carcinoma back of the neck, cell carcinoma lung cell carcinoma of the prostate cell carcinoma of the stomach cell carcinoma, bladder cell carcinoma of the testicle cell carcinoma of the rectum, the cell carcinomas of the pancreas, the cell carcinomas of the oral cavity cell carcinoma squamous cells, cell carcinoma of the head and neck and the cell teratocarcinoma.

21. The method according to p. 19, according to which the specified cell sarcoma selected from cells of Kaposi sarcoma, cells fibrosarcoma and osteosarcoma cells.

22. A method of treating cancer in a suffering animals, providing the impact on the cell body of the specified animal a composition containing an effective amount of at least one isolated tag7 polypeptide, characterized by the sequences selected from the group comprising a) amino acid sequence encoded by the nucleotide sequence presented in SEQ ID no:1, (b) full amino acid sequence represented in SEQ ID no:2) amino acid sequence represented in positions from 20 to 182 in SEQ ID no:2, and g) amino acid sequence, presented in SEQ ID but which specified the mammal is a human.

25. The method according to p. 22, according to which the specified cancer is a carcinoma, sarcoma, melanoma or leukemia.

26. The method according to p. 25, according to which the specified carcinoma selected from the group comprising liver carcinoma, carcinoma of the ovary, carcinoma of the breast, carcinoma of the back of the neck, carcinoma of the lung, carcinoma of the prostate, carcinoma of the stomach, carcinoma of the bladder, carcinoma of the testis, cancer of the rectum, carcinoma of the pancreas, carcinoma of oral cavity carcinoma squamous cell carcinoma of the head and neck and teratocarcinoma.

27. The method according to p. 25, according to which the specified sarcoma selected from Kaposi sarcoma, fibrosarcoma and osteosarcoma.

28. A method of treating cancer in a suffering animals, providing for the introduction to the animal an effective amount of an isolated nucleic acid containing a nucleotide sequence encoding a tag7 polypeptide, selected from the group comprising a) a nucleotide sequence represented in SEQ ID no:1, (b) the nucleotide sequence corresponding to the amino acid sequence represented in SEQ ID no:2, the nucleotide sequence corresponding to the amino acid sequence at positions from 20 to 182 in SEQ ID No. Aya isolated nucleic acid contained in the vector or virion.

30. The method according to p. 29, according to which the specified vector or virion come from a retrovirus, adenovirus or adeno-associated virus.

31. The method according to p. 28, according to which the specified animal is a mammal.

32. The method according to p. 31, according to which the specified mammal is a human.

33. The method according to p. 28, according to which the specified cancer is a carcinoma, sarcoma, melanoma or leukemia.

34. The method according to p. 33, according to which the specified carcinoma selected from the group comprising liver carcinoma, carcinoma of the ovary, carcinoma of the breast, carcinoma of the back of the neck, carcinoma of the lung, carcinoma of the prostate, carcinoma of the stomach, carcinoma of the bladder, carcinoma of the testis, cancer of the rectum, carcinoma of the pancreas, carcinoma of oral cavity carcinoma squamous cell carcinoma of the head and neck and teratocarcinoma.

35. The method according to p. 34, according to which the specified sarcoma selected from Kaposi sarcoma, fibrosarcoma and osteosarcoma.

 

Same patents:

The invention relates to the field of medical genetics, in particular to somatic mutations in the gene multifunctional tumor suppressor (MTS) in the case of neoplasms of human rights and the use of these mutations for diagnosis and prognosis of these diseases

The invention relates to biotechnology and Microbiology and is a method of obtaining biomass of recombinant strains of E. coli containing plasmid DNA encoding the biosynthesis of cytokines with the properties of factors, tumor necrosisand(TNF-alpha and TNF-beta), granulocyte colony-stimulating factor (G-CSF) and granulocyte-macrophage colony-stimulating factor (GM-CSF) human and bearing as a selective marker gene bla (resistance to ampicillin)

The invention relates to biotechnology

The invention relates to the field of biochemistry and biotechnology and can be used to obtain tumor necrosis factor-beta (TNF-beta)

The invention relates to cytotoxic factors, which are secreted by lymphatic cells, and to methods for their production, b cells, T cells and macrophages produce substances that exhibit cytotoxic activity against tumor cells, but which are harmless to normal cells

The invention relates to biotechnology

The invention relates to biotechnology and is intended for use in the pharmaceutical industry for the production of a stable aqueous solution of genetically engineered interferon-alpha-two, not containing albumin for injection for treatment of various viral diseases and cancer

The invention relates to medicine, in particular to chemotherapy of metastatic brain lesions

The invention relates to derivatives of 5’-deoxycitidine General formula

where R1denotes a hydrogen atom or a group which is easily hydrolyzed under physiological environments; R2denotes a hydrogen atom or a group-CO-OR4where R4denotes a saturated hydrocarbon group with a straight or branched chain, containing from one to fifteen carbon atoms, or a group of the formula -(CH2)n-Y, where Y denotes a cyclohexyl or phenyl, and n is an integer from 0 to 4; R3denotes a hydrogen atom, bromine, iodine, cyano, C1-C4alkyl group which may be substituted atom (s) halogen, vinyl or etinilnoy group which may be substituted atom (s) halogen, C1-C4by alkyl; provided that R2and R3may not simultaneously denote a hydrogen atom

The invention relates to medicine, in particular to Oncology, urology, and can be used in the treatment of patients with advanced prostate cancer with metastatic lesions of the spine

The invention relates to new compounds, metalcomplexes of carboranylporphyrins General formula I,

with antitumor activity and low toxicity, which can be used in boron neutron capture therapy had cancer

The invention relates to medicine and relates to methods of treatment of tumors and metastases using a combination of antiangiogenic therapy and immunotherapy

The invention relates to film-coated tablets comprising as active compounds cyclophosphamide and containing core tablets cyclophosphamide, one or more fillers, one or more dehumidifiers-binding except for the swollen starch, regulator fluidity and sizing

The invention relates to the field of medicine and relates to a stable form of anti-cancer drug containing paclitaxel, and how it is received by dissolving crystalline paclitaxel in a neutral organic solvent selected from the group consisting of acetonitrile, dioxane, ethanol or mixtures thereof, provided that the contents of the individual solvents in the mixture is in the range from 5 to 95%, whereas the water content is in the range from 0 to 60%, optionally filtering the resulting solution, freezing and removal of the solvent by sublimation under reduced pressure at low temperature, and optional separation of dose in terms providing sterility
Up!