Neurotrophic growth factor (human) (inulin) encoding a molecule of nucleic acid, vector (options), the pharmaceutical composition (options), antibody detection of growth factor, kit, method for identifying agonist or antagonist (options)

 

The invention relates to biotechnology and can be used to obtain derived neurotrophic factor human growth (inulin). An isolated nucleic acid molecule encoding enovin, built in expressing vector. Vector or growth factor (inulin) is used to produce pharmaceutical compositions for the treatment and prevention of disorders of the nervous system. Growth factor found in the sample with antibodies which are able to bind growth factor. The identification of an agonist or antagonist of neurotrophic growth factor is carried out by interaction of biological material, expressing the growth factor receptor, with the test compound in the presence of the indicated growth factor. The invention allows the development of drugs for prevention and treatment of neurodegenerative diseases. 11 N. and 15 C.p. f-crystals, 27 ill., table 4.

The present invention relates to neurotrophic factor, particularly for cloning and expression of a new member of the family of neurotrophic factors GDNF, called "inulin" (EVN).

Background of the invention

Neurotrophic factors are involved in differentiation, development, and ware the s cells, so they are potential drugs for the treatment of neurodegenerative diseases. Neurotrophic factor selected from the line glial cells (GDNF), was the first member of the ever-increasing sub-family of neurotrophic factors, which differ structurally from the neurotrophins. GDNF is a transforming growth factor(TGF-), a member of the superfamily of growth factors, characterized by a specific structure of the seven highly conserved cysteine residues in the amino acid sequence (Kingsley, 1994). GDNF was originally selected by using a method based on the ability of this factor to preserve the viability and functionality of dopaminergic neurons in the middle ventricle of the brain of the embryo in vitro (Lin et al., 1993). Other types of nerve cells in the Central (CNS) or peripheral (PNS) nervous system is also responsive to the action of GDNF, aimed at preserving their viability (Henderson et al., 1994, Buj-Bello et al., 1995, Mount et al., 1995, Oppenheim et al., 1995). Cells produce GDNF in the inactive Pro-form, which is specifically cleaved at the site of recognition Purina RXXR with the formation of active (Mature) GDNF (Lin et al., 1993). Echtheitszertifikat violations characterized by loss of up to 70% of dopaminergic cells in the black substance of the brain (Beck et al., 1995, Tomac et al., 1995, Gash et al., 1996, Choi-Lundberg et al., 1997, Bilang-Bleuel et al., 1997).

Recently discovered new neurotrophic factors GDNF family. Neurturin (NTN) isolated from the conditioned medium containing the cells of the Chinese hamster ovary (Cho), using a method based on the ability of this factor to stimulate the vitality of sympathetic neurons in culture (Kotzbauer et al., 1996). Protein Mature NTN 57% homologous to the Mature GDNF. Persephin (PSP) detected by cloning using degenerate priming for polymerase reaction synthesis chain (PCR) with genomic DNA as template. Mature PSP like Mature GDNF promotes the survival of dopaminergic neurons of the middle ventricle of the brain and motor neurons in culture (Milbrandt et al., 1998). Homology protein Mature PSP with Mature GDNF and NTN is approximately 50%. Artemin (ARTN) was detected by screening DNA database and is a factor in the survival of sensory and sympathetic neurons in culture (Baloh et al., 1998b).

GDNF, NTN, PSP and ARTN require a heterodimeric receptor complex to implement intracellular signal transduction in �p://img.russianpatents.com/chr/945.gif">; The nomenclature Committee, 1997), membrane protein, associated glycosylphosphatidylinositol (glycosyl-PtdIns) (Jing et al., 1996, Treanor et al., 1996, Sanicola et al., 1997). Complex GDNF/GFR-1 then binds and activates protooncogen cRET, the membrane-bound tyrosinekinase (Durbec et al., 1996, Trupp et al., 1996), which leads to phosphorylation of tyrosine residues in cRET and subsequent activation of the transduction of the signal in the lower pane (Worby et al., 1996). Were investigated, and several other family members GFRlandscapebased receptors (Baloh et al., 1997, Sanicola et al., 1997, Klein et al., 1997, Buj-Bello et al., 1997, Suvanto et al., 1997). GFR2 and GFR-3 (Jing et al., 1997, Masure et al., 1998, Woby et al., 1998, Naveilham et al., 1998, Baloh et al., 1998a) identified a number of research groups. GFR-1 and GFR-2 widely expressed in almost all tissues, and their expression can be regulated (Sanicola et al., 1997, Widenfalk et al., 1997).

GFR-3 missing in developing and Mature Central nervous system, but is widely expressed in several developing and Mature sensory and sympathetic ganglia of the peripheral nervous system (Widenfalk et al., 1998, Naveilhan et al., 1998, Baloh et al.GFRa-l is the preferred receptor for GDNF, while GFR-2 preferably binds NTN (Jing et al., 1996, Treanor et al., 1996, Klein et al., 1997). GFR-4 chicken forms a functional receptor complex for PSP in combination with cRET (Enokido et al., 1998). Found that cells expressing both GFR-3 and cRET, do not respond to GDNF, NTN or PSP (Worby et al., 1998, Baloh et al., 1998a). Recently found that ART transmits a signal using cRET using GFR-3 as the preferred landscapebased receptor (Baloh et al., 1998b). Communication between neurotrophic factors and receptors GFRit is possible in vitro, as GDNF can communicate with GFR-2 or GFR-3 in the presence of cRET (Sanicola et al., 1997, Trupp et al., 1998) and NTN can communicate with GFR-1 low affinity (Klein et al., 1997). In short, GDNF, NTN, PSP and ART are part of neurotrophic signaling system by which different landscapemode subunit (GFR-1 - GFR-4) can interact with the subunit tyrosine kinase (cRET). The physiological significance of these findings in vitro, was recently demonstrated in a session is about GDNF interacts with GFR-1 in vivo, while NTN is the preferred ligand for GFR-2.

The authors of the present invention have identified, cloned, expressed, localized in the chromosome and explored inulin (EVN), the fourth member of the GDNF family. The idea of the Mature protein EVN were greatly enhanced by the discovery of different functional and non-functional playerowner variants of mRNA. In addition, the authors of this invention obtained data about the expression, binding EVN with GFR-3, the influence of in vitro EVN on axonal growth and protection caused by Taxol neurotoxicity in differentiated by staurosporine cell culture human neuroblastoma SH-SY5Y.

The invention

Objects of the present invention is a nucleic acid molecule encoding a new neurotrophic factor human growth enovin" expressing a vector containing the specified nucleic acid molecule, a host cell transformed by the specified vector, neurotrophic growth factor, encoded by the specified molecule nucleic acid selected enovin, compounds that are agonists or antagonists ENOVIA, and pharmaceutical compositions containing this The first object of the present invention is a nucleic acid molecule, encoding a neurotrophic growth factor (human), here called Envenom, which has the amino acid sequence shown in Fig.21, or encoding a functional equivalent, derivative or biological precursor of specified growth factor. This molecule nucleic acid is preferably DNA, and even more preferably a cDNA molecule.

Nucleic acid according to this invention preferably has a sequence that corresponds to the provisions 81-419 in the sequence shown in Fig.1, more preferably the provisions 81-422 and even more preferably reprezentirovannoe sequence shown in Fig.1.

It is believed that a molecule of nucleic acid, the corresponding provisions 81-419 encodes the sequence of the Mature protein ENOVIA after processing of the Pro forma of this protein on the website processing RXXR available in a sustainable proforma specified protein ENOVIA.

This invention relates to antisense molecule capable of hybridizing with any sequences of nucleic acids according to this invention in very strict conditions, which should be well known to experts in this field.

Strict conditions hibri is passed. The stability of hybrids is reflected in the melting temperature (Tm) of the hybrid. Tm can be approximately represented by a formula

81,5With-of 16.6(log10[Na+]+0,41(%G&C)-600/l

where l is the length of the hybrids in nucleotides. Tm is reduced by about 1-1,5With every 1% decrease in homology sequences.

The nucleic acid molecule according to this invention can be successfully used for the expression of neurotrophic factor human growth according to this invention in the cell-master or similar microorganism using acceptable expressing vector.

Expressing the vector according to this invention is a vector that can Express the DNA operatively linked with regulatory sequences, such as promoter region, which is able to Express such DNA fragments.

Required for expression regulatory elements are promoter sequences that bind RNA polymerase and sequence that initiates transcription intended to bind ribosomes. For example, bacterial expressing the vector may contain a promoter, as the lac promoter, the sequence of the Shine-Dalgarno for inici to contain a heterologous or homologous promoter for polymerase II RNA, the polyadenylation signal in the lower pane, the initiating AUG codon and the termination codon for the Department of ribosomes. Such vectors can be purchased commercially or assembled from sequences using methods that are well known in this field.

Thus, expressing the vector is a recombinant vector DNA or RNA, such as a plasmid, a phage, recombinant virus or other vector which, when introduced in a suitable cell host causes the expression of the DNA fragments or RNA. Acceptable expressing vectors is well known to specialists in this field and include vectors that can replicate in eukaryotic and/or prokaryotic cells, vectors that remain epitanime, or vectors that are introduced into the genome of the host cell.

Antisense molecule capable of hybridizing with nucleic acid according to this invention, can be used as a probe drug or pharmaceutical compositions.

The nucleic acid molecules according to this invention can be introduced into vectors, with antisense orientation to produce antisense RNA. Antisense RNA, or other antisense nucleic acid can produce sintetiziranja or infected expressing vector according to this invention, which is preferably a eukaryotic cell and more preferably a mammal cells.

The introduction of cloned DNA into acceptable expressing vector for subsequent transformation of the specified cells and selection of transformed cells is well known in this field and described in the Handbook Sambrook et al. (1989), Molecular Cloning, A Laboratory Manual, Cold Spring Harbour Laboratory Press.

Another object of the present invention is a nucleic acid molecule having at least 15 nucleotides, preferably from 15 to 50 nucleotides.

These sequences can be successfully used as probes or anticipated for the initiation of replication or the like. Such nucleic acid molecules can be obtained by methods well known in this field, such as recombinant DNA or method of synthesis. They can also be used in diagnostic kits, devices, or similar devices for detecting nucleic acids according to this invention. These tests usually include the contacting of the probe with the sample under conditions of hybridization and detecting any duplex formed between the probe and any nucleic acid in the sample.

In accordance with this izopet is how many probes can be simultaneously hybridizing one biological sample. These probes can be applied to a matrix or to synthesize in situ in the matrix. (See Lockhart et al., Nature Biotechnology, vol. 14, December 1996 "Expression monitoring by hybridisation into high density oligonucleotide arrays". One matrix can contain more than 100, 500 and even 1000 different probes in different places.

The nucleic acid molecules according to this invention can also be produced using methods of recombinant DNA or methods of synthesis, such as, for example, mechanisms cloned using polymerase reaction synthesis chain (PCR), which usually include obtaining two seed containing about 10-50 nucleotides in the gene region intended for cloning, the contacting of these seeds with mRNA, cDNA or genomic DNA from a human cell, performing a polymerase reaction synthesis circuit in terms of providing amplification of the target region, the allocation of the amplified region or fragment and receiving the amplified DNA. Such methods are well known in this field and described in the Handbook Sambrook et al. (Molecular Cloning: a Laboratory Manual, 1989).

Nucleic acids or oligonucleotides according to this invention can have a label that facilitates detection. Acceptable labels include radioisotopes, such as32P or35S, enzymatic labels or drie acids or oligonucleotides according to this invention and can be detected using known methods.

Allelic variants or polymorphisms of the DNA molecule man in this invention it is possible to successfully identify, for example, by probing cDNA libraries or genomic libraries created with the involvement of a wide range of subjects, such as different populations. In addition, nucleic acid probes of this invention can be used for sequencing the genomic DNA of patients by methods well known in this area, such as a method of termination detoxicate Sanger, through which you can successfully identify any predisposition of the patient to specific violations caused by the growth factor in this invention.

Another object of the present invention is a transgenic cell, tissue or organism containing the transgene, is able to Express the neurotrophic factor human "inulin" according to this invention.

The term "transgene able to Express the" value used here means any acceptable sequence of nucleic acids, which causes the expression of a neurotrophic factor that perform the same function and/or having the same activity as derived neurotrophic factor in this invention. This transgene may contain, naprimer cDNA, integrated into the chromosome or extrachromosomal space.

The transgene preferably has a vector according to this invention, which contains a nucleic acid molecule encoding specified neurotrophic factor, or a functional fragment of a specified nucleic acid molecule. "Functional fragment" of a specified nucleic acid means a fragment of a gene or cDNA encoding specified neurotrophic factor or its functional equivalent, which can be expressed with the aim of producing functional neurotrophic growth factor according to this invention. Thus, fragments of neurotrophic growth factor according to this invention, which correspond to specific amino acid residues that interact with specific receptor, are also the object of the present invention and can serve as agonists, activating the appropriate growth factor receptor according to this invention, which allows to identify its permanent impact on the growth and viability of cells. The object of this invention are also differentially splanirowannya isoforms and the sites of initiation of transcription of the nucleic acid according to this invention.

In saatettu, but nucleic acid with any minor changes reasons, including, in particular, the replacement of grounds, leading to the formation of identical codon (another codon that defines the same amino acid residue), thanks vyrozhdennom code in the replacement of conservative amino acids. The term nucleic acid molecule also means complementary sequence to any single-stranded sequence obtained by replacement of the grounds.

Another object of this invention is selected neurotrophic growth factor (human), encoded by the above nucleic acid molecule. This growth factor preferably contains an amino acid sequence corresponding to positions 27-139, the amino acid sequence shown in Fig.1, its functional equivalent, derivative or biological predecessor.

The term "functional equivalent" used here is the mean growth factor, which has all the properties and functional characteristics, charactername for growth factor called Envenom. "Derived" ENOVIA used here is meant the polypeptide, in which some amino acids and the activity ENOVIA and/or can interact with antibodies, obtained using ENOVIA according to this invention as the stimulating antigen.

In the scope of the present invention include hybrid and modified forms ENOVIA, including fused proteins and their fragments. Hybrid and modified forms receive, modifying or replacing certain amino acids, for example, using the point heteroplasmy of a mutation, and these modifications still allow you to get the protein that retains the biological activity ENOVIA according to this invention. Specific nucleic acid sequences can be changed by obtaining a growth factor, possessing the same or almost the same properties as inulin.

As is well known in this area, many proteins are produced in vivo by using (pre)signal sequence at the N-Terminus of the protein. In addition, such proteins may contain one proposedvalue, which is a stable precursor of the Mature protein. Such pre - and proposedvalue usually not needed to achieve biological activity. Molecule ENOVIA according to this invention contains not only reprezentirovannoe sequence shown in Fig.21, but the sequence position 27-139, which according to the Mature sequence ENOVIA.

To said protein, polypeptide or amino acid sequences according to this invention are not only identical amino acid sequences, and their isomers, as well as sequences with a slight alteration of the amino acids derived from the natural amino acid sequence, allowing the replacement of conservative amino acid substitution amino acid, related her side chains). In the scope of this invention also includes amino acid sequences that differ from the natural amino acids, but allow you to get the polypeptide, which in immunological respect of identical or similar to a polypeptide encoded by a natural sequence.

Proteins or polypeptides according to this invention further includes variants of such sequences, including natural allelic variants that are essentially homologous to the specified proteins or polypeptides. In this description, the term "substantial homology" refers to sequence that has at least 70%, preferably 80%, 90% or 95% amino acid homology with proteins or polypeptides, encoded by nucleic acid molecules according to this invention.

Neurotrophic f is bretania.

The present invention further relates to the inhibition of neurotrophic growth factor according to this invention in vivo method of antisense molecules. Method antisense molecules can be used to control gene expression through the creation of a triple helix or antisense DNA or RNA, both of these methods are based on binding of polynucleotide with DNA or RNA. For example, part of the DNA sequence that encodes a Mature protein of the present invention, is used to design oligonucleotide antisense RNA in length from 10 to 50 base pairs. Oligonucleotide DNA construct so that it was complementary region of the gene involved in transcription (triple helix - see Lee et al. Nucl. Acids. Res., 6:3073 (1979); Cooney et al., Science, 241:456 (1988); and Dervan et al., Science, 251:1360 (1991), thereby preventing transcription and the production of ENOVIA. Oligonucleotide antisense RNA hybridized to the mRNA in vivo and blocks translation of the mRNA molecule with the formation of ENOVIA.

Due to the similarity of the sequences of the described growth factor and previously identified growth factors GDNF family, it is believed that enovin also able to promote the viability and growth of cells and to eliminate violations arising from d is s acids or derived neurotrophic factor in this invention can be used for treatment or prevention of disorders of the nervous system in need of a subject by introducing a specified subject the nucleic acid molecules or growth factor according to this invention in sufficient concentration to alleviate symptoms such violations. Thus, the nucleic acid molecule according to this invention can be used to maintain and improve the viability of nerve cells, as well as for treatment of nervous system diseases or neurodegenerative disorders, including Parkinson's disease, Alzheimer's disease, peripheral neuropathy, amyotrophic lateral sclerosis, injuries to peripheral and Central nervous system or the defeat of neurotoxins.

Neurotrophic growth factor according to this invention has a neurotrophic or neuroprotective effect on nerve cells or population of cells, particularly nerve cells or population of cells, podverzhdenie apoptosis. Nucleic acid or a growth factor called Envenom, according to this invention can additionally be used for the treatment of neurodegenerative disorders, such as stroke, Huntington's disease, peripheral neuropathy, acute brain injury, tumors of the nervous system, multiple sclerosis, amyotrophic lateral sclerosis, injury of the peripheral nervous system, damage caused by neurotoxins, multiple endocrine neoplasia system, congenital disease Hirshsprung, preinsolvency disease, disease of Creutzfeldt-Jakob disease, by introducing or prevention of the symptoms described here diseases of the nervous system.

In addition, as described in detail in the following example, inulin accelerates the compensation of the deficit of sensory neurons, which suggests the possibility of its use for the treatment or relief of pain syndromes caused neurogenic disorders of the peripheral or Central nervous system, rheumatic/inflammatory diseases and disorders conductivity by introducing ENOVIA needy subject in sufficient concentration to reduce or prevent symptoms of these disorders.

An alternative method of treating the above disorders of the nervous system includes the implantation of the cells of the subject expressing neurotrophic factor human growth according to this invention, such as described herein transgenic cells.

Molecules of nucleic acids and neurotrophic growth factor according to this invention can also be included in pharmaceutical compositions together with pharmaceutically acceptable carrier, diluent or excipient.

Antibody-derived neurotrophic factor according to the present invention can be obtained by methods well known in this area. For example, polyclonal antibodies can be obtained, inocula animal host, such as a mouse, factortame, in particular those which are described R. Kohler and Milstein C., Nature (1975) 256, 495-497.

Antibodies according to this invention can be successfully used in carrying out the method of detecting growth factor according to this invention, which includes the interaction of the antibody with the sample and identification of the protein associated with the indicated antibody. In the scope of this invention includes a kit for performing this method, which comprises the antibody according to this invention and a device for implementing the interaction of antibodies with the specified pattern.

In the scope of the present invention also includes a kit or device for detecting in a sample derived neurotrophic growth factor according to this invention, which includes the above antibody and a device for communicating the specified antibodies with the specified pattern.

Proteins that interact with neurotrophic factor according to this invention, for example the corresponding cell receptor can be identified by examining protein-protein interactions using two-hybrid vectors, which is well known to experts in the field of molecular biology (Fields & Song, Nature 340:245, 1989). The basis of this method lies functional recovery in vi is ith a host cell with the vector DNA, containing a reporter gene under the control of a promoter regulated by a transcription factor having a DNA-binding domain and an activating domain, expressing in the cell-host sequence first hybrid DNA that encodes a first fusion of a fragment or the entire sequence of the nucleic acid according to this invention and the DNA binding domain or activating domain of the transcription factor, expressing in the cell the owner of at least one sequence of the second hydrino DNA available in the library or similar store, encoding a putative investigated binding proteins with DNA-binding or activating domain of the transcription factor, which was not included in the first merger; detecting binding of the proteins with the protein according to this invention by detecting the product of the reporter gene in the cell-master; optional selection sequence of the second hydrino DNA that encodes a binding protein.

An example implementation of this method is the use of the GAL4 protein in yeast. GAL4 is a transcriptional activator of galactose metabolism in yeast and has a separate domain for binding to activators top from regulatory genes, which contains nucleotide residues, encoding the DNA binding domain of GAL4. These residues binding domain can be fused with the formation of known protein coding sequence, such as, for example, a nucleic acid according to this invention. Another vector contains the remains of encoding the binding protein domain of GAL4. The merger of these balances get residues encoding the subject protein, preferably on the path of signal transduction considered vertebrate animal. Any interaction between neurotrophic factor, encoded by nucleic acid according to this invention, and the test protein activates the transcription of re-portenoy molecules in a yeast cell, GAL-4 transcription failure, in which the vectors were transformed. Reporter molecule, such as-galactosidase, preferably activated by recovery of gene transcription of galactose metabolism in yeast.

The authors of the present invention found that the receptor ENOVIA is GFR3. Therefore, it is possible to perform analyses, identifying agonists or antagonists ENOVIA. This analysis is also applicable to other neurotrophic growth factor and corresponding Retz the AK Parkinson's disease, Alzheimer's disease, neurodegenerative disorders, caused by an increase of the sequences polyglutamine, such as Huntington's disease, peripheral neuropathy, acute brain damage, tumors of the nervous system, multiple sclerosis, amyotrophic lateral sclerosis, injury of the peripheral nervous system, damage caused by neurotoxins, multiple endocrine neoplasia system, congenital disease Hirshsprung, preinsolvency disease, disease of Creutzfeldt-Jakob disease, stroke, pain syndromes with severe neurogenic disorders of the peripheral or Central nervous system, rheumatic/inflammatory diseases, and disturbances of conduction, by introducing needy entity specified agonist or antagonist in a sufficient concentration to prevent or treat these diseases of the nervous system. Such compounds can also be included in pharmaceutical compositions together with pharmaceutically acceptable carrier, diluent or excipient.

Agonists or antagonists of growth factor (such as, for example, inulin) can be identified in accordance with one embodiment of the invention, by contacting the tvii this growth factor, and comparing the degree of activation of RET in the specified cell, tissue or organism with a control sample which was subjected to contacting with the specified test connection.

An alternative method of implementing this invention relates to a method of identifying agonists or antagonists of neurotrophic growth factor, which includes contacting the cell tissue or organism expressing an appropriate vector specified growth factor and cRET, with the test compound in the presence of the indicated growth factor, a measurement of the degree of activation of signaling kinases in the pathway of signal transduction, a constituent element of which is specified receptor, after addition of antibodies specific to the indicated signal kinase, conjugated with a reporter molecule, and comparison with the cell tissue or organism, which was not subjected to contacting with the specified connection.

Another object of this invention is the use of compounds, which, as established, is an antagonist according to this invention, for manufacturing a medicinal product intended for the treatment of diseases of the gastrointestinal tract or disorders caused increased parisino successfully used to enhance the motility of the gastrointestinal tract, therefore, they can be useful for the treatment of diseases due to difficult or disturbed by the passage of contents through the GI tract.

In addition, such compounds can be used effectively for the treatment of warm-blooded animals, including humans, suffering from difficult or impaired gastric emptying and in a broader sense difficult or disturbed by the passage of contents through the GI tract. Thus, the present invention relates to a method of treatment of diseases such as gastroesophagal reflux, dyspepsia, gastroparesis, postoperative ileus and pseudoprobability intestines.

Dyspepsia means dysfunction of the digestive system, which may be accompanied by the symptom of a primary dysfunction of the gastrointestinal tract, in particular dysfunction of the gastrointestinal tract, due to increased muscle tone, or complication caused by other disorders, such as appendicitis, gallbladder disease or malnutrition. Symptoms of dyspepsia are, for example, lack of appetite, feeling of heaviness, quick satiety, nausea, vomiting and bloating.

Gastroparesis may occur in the region of the ary diabetes, progressive systemic sclerosis, anorexia, increased nervous excitability and myotonica dystrophy.

Postoperative bowel obstruction means clogging or kinetic lack of intestinal peristalsis due to disorders of muscle tone after surgery.

Pseudoprobability bowel is a condition characterized by constipation, colic and vomiting in the absence of a physical obstruction.

Compounds of the present invention can be used to correct the actual cause of the disease or reduce its symptoms.

In addition, some compounds, which are stimulants kinetic activity of the large intestine, can be used to normalize or improve the passage of contents through the intestine in subjects with symptoms of motility disorders, such as decreased peristalsis only small and large intestine or in combination with slow emptying of the stomach.

Taking into account the ability of the compounds of the present invention to increase the kinetic activity of the large intestine object of this invention is a method of treating warm-blooded animals, including humans, suffering from disorders presecnica, the irritable bowel syndrome (IBS) and is caused by drugs slow the passage of contents through the intestine.

Compounds that are antagonists, as established in the analysis of the present invention, can also be used for treatment and prevention of diseases of the gastrointestinal tract, resulting from increased peristalsis of the gut such as diarrhoea (including secretory diarrhea, bacterial diarrhea, galernuju diarrhea, traveler's diarrhea and psychogenic diarrhea), Crohn's disease, mucous colitis, irritable bowel syndrome (IBS), diarrhea caused by irritable bowel syndrome, hypersensitivity gastrointestinal tract.

Given the usefulness of the compounds according to this invention, it can be concluded that the present invention also relates to the treatment of warm-blooded animals, including humans, suffering from diseases of the gastrointestinal tract, such as irritable bowel syndrome (IBS), in particular diarrhea caused by IBS. In addition, this invention relates to a method for alleviating symptoms in need of subjects suffering from diseases such as syndrome of irritated that the ka, and pain caused by increased sensitivity of the gastrointestinal tract.

Compounds of the present invention can also be used to treat other disorders of the gastrointestinal tract, for example, due to the motility of the upper intestine, as well as antiemetics, cytotoxic agents and antiemetics during irradiation.

To inflammatory bowel diseases include, for example, ulcerative colitis, Crohn's disease and the like.

Another object of this invention is a method of treating disorders caused by the expression of ENOVIA of the present invention, by introducing needy subject antisense molecule or its antagonist in a sufficient amount to eliminate or alleviate symptoms such violations.

Disorders caused by inactivation or suppression of the expression ENOVIA, can also be treated successfully by the introduction of needy subject compounds, which are agonist ENOVIA, in sufficient quantities to mitigate or eliminate the symptoms of this disorder.

Another object of this invention is a method of obtaining a pharmaceutical preparation for the treatment of diseases, oemlogo connection which is an agonist or antagonist ENOVIA according to this invention, obtaining the specified connection in required quantities and the introduction of this compound in a pharmaceutically acceptable carrier.

As will be described in more detail in the following examples, inulin allows you to successfully recover the lack of sensory neurons, formed under the influence of Taxol. So enovin helps eliminate painful symptoms in the case of neurogenic disorders of the peripheral and Central nervous system, rheumatic diseases, as well as conduction disturbances, and can modulate processes in sensory neurons, resulting in percutaneous, local and Central application (such as an epidural, vnutriobolochechnoe, ICV, inside plexus, into nerve cells), provide oral, rectal and system introduction. Therefore, similar to other disorders, due to Envenom, these diseases can be treated and even prevented by the introduction of antisense molecules, nucleic acids, protein ENOVIA, pharmaceutical composition or compound which is an agonist or antagonist, depending on the needs, according to this invention is sufficient if the position of the present invention can be entered in any appropriate way, known in this field, including, for example, intravenous, subcutaneous, intramuscular, percutaneous, vnutriobolochechnoe or intracerebral introduction or introduction into cells by the method of ex vivo. The introduction can be fast in the form of injections or for a sufficiently long time in the form of slow infusion or drug prolonged action. For the treatment of tissue in the Central nervous system connection according to this invention can be administered by injection or infusion into the cerebrospinal fluid (CSF).

Inulin may also be connected or anywhereman with the tools with the required pharmaceutical or pharmacodynamic properties. For example, it is possible to connect with any substance that is known to stimulate the penetration or migration across the blood-brain barrier such as an antibody to the transferrin receptor, and administered by intravenous injection.

Enovin, antisense molecules or compounds that are agonists or antagonists ENOVIA according to this invention, can be used in the form of pharmaceutical compositions, which can be obtained by methods well known in this area. Preferred compositions contain a pharmaceutically acceptable the to other pharmaceutically acceptable carriers, including non-toxic salt, sterile water or the like. The composition may also include an acceptable buffer, allowing lyophilisate this composition and stored in a sterile environment prior to recovery by adding sterile water for subsequent injection. Inulin can be introduced in solid or semi-solid biologically compatible matrix which is then implanted in the tissue to be treated.

The carrier may also contain other pharmaceutically acceptable excipients that modify parameters such as pH, osmotic pressure, viscosity, sterility, lipophilicity, solubility or the like. The composition may also contain pharmaceutically acceptable excipients which allow prolonged or delayed release of the drug.

Protein ENOVIA, nucleic acid molecules or compounds of this invention can be administered orally. In accordance with this embodiment of the invention medicinal substances can be encapsulated and mixed with appropriate carriers in solid dosage forms, which are well known to specialists in this field.

As is well known to specialists in this field, the regimen l is a way of introduction. The number of input composition, however, must identify the attending physician depending on factors such as severity of symptoms, the shape of the input composition, age, weight and response needs of the subject, and the selected method of administration.

The present invention is described hereinafter with reference to the following examples, having only illustrative, and the accompanying drawings.

In Fig.1 shows a partial sequence of cDNA-derived neurotrophic factor in this invention, called Envenom. Consistent sequences produced by different amplification of cDNA and genomic DNA using PCR with the use of nucleating PNHsp3 and PNHap1, then make cloning, sequence analysis and comparison of the obtained sequences. The putative amino acid sequence indicated by single letter codes shown above the DNA sequence. The number of nucleotide residues shown to the right of the DNA sequence, and the number of amino acid residues are indicated to the right of the translated protein sequence. The proposed site RXXR cleavage for predomina printed in bold and underlined. Estimated start of the Mature protein is indicated by arrows. Seven kirim font. Potential site of N-glycosylation underlined with two lines.

In Fig.2 shows a comparative analysis of the primary structure of the assumed sequence of a Mature protein GDNF, NTN, PSP and EVN person. These sequences analyzed in accordance with the program of comparative analysis ClustalW. Amino acid residues, which is conservative in all three proteins, are located in areas of black. The remains, which is conservative in two or three sequences are colored in gray. Seven conservative cysteine residues common to all members of the family of TGF-marked by asterisks above the sequence. The number of amino acid residues is indicated on the right. Postername lines indicate gaps introduced into the sequence to optimize the comparative analysis.

In Fig.3 shows a partial cDNA sequence ENOVIA. Consistent sequences produced by different amplification of cDNA using PCR (primary PCR was performed using seed PNHsp1 and PNHap1 and nested PCR was performed using seed PNHsp2 and PNHap2), then produce cloning, sequence analysis and comparison of the obtained sequences. Translirovat the Ohm, shown above the sequence, and the number of residues is indicated on the right (A1-A85). This reading frame contains the expected codon of translation initiation ATG. The translated amino acid sequence of nucleotides 334-810 (reading frame) indicated by single letter codes shown above the sequence, and the number of residues is indicated on the right (B1-V). This reading frame contains a region of homology with GDNF, NTN and PSP. The number of nucleotide residues shown to the right of the DNA sequence. The proposed site RXXR cleavage for predomina printed in bold and underlined. Estimated start of the Mature protein is indicated by arrows. Seven conservative cysteine residues common to all members of the family of TGF-printed in bold. Probable site of N-glycosylation underlined with two lines.

In Fig.4 shows localization to chromosome ENOVIA person. (A) diagram of the results of mapping ENOVIA by the FISH method. Each point represents two FISH signal detected in the chromosome 1, region P31.3-R. (C) an Example of mapping ENOVIA by the FISH method. On the left picture shows the FISH signals on chromosome 1. On the right picture shows the same mitotic, izobrazheniya ENOVIA in different human tissues. (A), (B), (C) Northern blot expression ENOVIA in the tissues. The expression of mRNA ENOVIA in different human tissues determined using a probe corresponding to part of the coding region ENOVIA (including the region encoding the Mature protein ENOVIA), analyzing the blots of poly(A)-rich RNA person. (A) Northern blot of several tissues (MTN); (C) MTN blot II) blot MTN II of the fetus. In the photo (D) shows the results of autoradiography primary RNA blot person, probed the same cDNA fragment ENOVIA. On the picture (E) shows the position of the samples of mRNA from human tissues on the main band is RNA, pictured here (D).

In Fig.6 graphically illustrates the overall survival of cells SH-SY5Y after 72-hour treatment 10-6M Taxol and the effect of increasing doses ENOVIA on the survival of cells, normalized to the status of the solution. Cells SH-SY5Y differentiated for 5 days 25 nm staurosporine before applying Taxol. The data obtained from the execution of two independent experiments using six identical samples. In Fig.6 shows the average values and standard deviations.

In Fig.7 provides a graphic depiction of the effect of increasing concentrations ENOVIA within 48 hours on axonal growth differential of stauros Europeana prior to the 48-hour experiment. As a positive control result is a differentiating effect achieved 25 nm staurosporine. The length of the axons is calculated using at least 5000 cells. Data obtained by performing experiments using two identical samples. This drawing shows the average values and standard deviations.

In Fig.8-18 provides a graphic depiction of the effect ENOVIA on the proliferation of different cell types.

In Fig.19 provides a graphic depiction of the effects ENOVIA on caused by Taxol shortage of sensory neurons, obtained by the method of acupuncture. This figure shows the average (1 standard error of the mean) aggregate estimates obtained throughout the experiment, rats, which after the introduction of Taxol is injected or 2 different doses ENOVIA (23 or 130 μg/ml; n=10 rats/group), or a filler/saline (n=20 rats). Enovin or saline/filler administered as an injection in a volume of 75 μl in the bottom of the right rear paw.

In Fig.20 provides a graphic depiction of the effects ENOVIA on caused by Taxol shortage of sensory neurons, obtained by the method of acupuncture. In this drawing Genii the whole experiment, for rats, which before the introduction of Taxol is injected or 2 different doses ENOVIA (23 or 130 μg/ml; n=10 rats/group), or a filler/saline (n=20 rats). Enovin or saline/filler administered as an injection in a volume of 75 μl in the bottom of the right rear paw.

In Fig.21 shows the DNA sequence ENOVIA. Consistent sequences obtained by amplification of cDNA frontal lobe of the cerebral cortex of man and human genomic DNA using PCR with the use of nucleating PNHsp5 and PNHap1, then make cloning, sequence analysis and comparison of the obtained sequences. The putative amino acid sequence is shown above the DNA sequence only for splanirovano option, after giving the translation of a functional protein ENOVIA. The number of nucleotide residues shown to the left of the DNA sequence, and the number of amino acid residues are indicated to the right of the translated protein sequence. 5'- and 3'-terminal splicing sites discovered through comparison of the fragments sequenced cDNA with the genomic sequence indicated by the vertical lines, respectively curved to the left or right, and then pronom who believe the beginning of the Mature protein is indicated by arrows. Seven conservative cysteine residues common to all members of the family of TGF-printed in bold. Estimated N-linked glycosylation site is underlined with two lines. 5'- and 3'-terminal splicing sites are numbered and circled.

In Fig.22 illustrates the expression of different playerowner options ENOVIA in human tissues. (A) Schematic representation of playerowner options ENOVIA, identified by RT-PCR using invisiline nucleating on RNA isolated from different human tissues, with subsequent cloning and sequence analysis of the PCR products. The top line shows the sequence length (in base pairs). The second line depicts the genomic sequence ENOVIA. This line shows the position of the initiating and terminating transmission of the codon beginning of the coding sequence of the Mature enovin and 5'- and 3'-terminal splicing sites (see Fig.21). On the right side of the figure shows the PCR products obtained by performing RT-PCR in relation to RNA of the ovary and the frontal lobe of the cerebral cortex together with a DNA ladder with a length of 100 base pairs. The position of the different variants of mRNA shows the ons. The rectangle outlines the area represented in the cDNA. Dashed lines mark splanirovannaya genomic DNA. The shaded area indicates the coding sequence of the Mature enovin. Dotted line marks the beginning of the coding sequence of the Mature enovin. Two transcript can give a functional protein ENOVIA marked with an asterisk on the left side. (B) Distribution of the major tissues playerowner options. The photograph shows the PCR fragments obtained by performing RT-PCR using invisiline anticipated in relation to different human cDNA. Four main playerowner options (A-D) is shown by arrows on the left side. The length indicated on the right side, at the same time as the reference length in the gel is adopted, the length of the DNA ladder of 100 p. O.

In Fig.23 shows the putative protein sequence of long splanirovano option ENOVIA received by splanirovanie two introns of DNA sequences is shown in Fig.21. Splicing sites 5'-1 and 3'-1 is used for the removal of the first intron and splicing sites 5'-2 and 3'-3 used to remove the second intron. This allows us to obtain the cDNA sequence, it is a of Fig.24 shows the putative protein sequence of alternative (short) splanirovano option ENOVIA, received splanirovanie two introns of DNA sequences is shown in Fig.21. Splicing sites 5'-1 and 3'-2 used for removal of the first intron and splicing sites 5'-2 and 3'-3 used to remove the second intron. This allows us to obtain the cDNA sequence with an open reading frame encoding the above protein consisting of 220 amino acid residues. This protein sequence no 8 amino acid residues compared with the sequence depicted in Fig.23.

In Fig.25 given the graphical representation of the results obtained during the experiments compared the levels of expression of ENOVIA in healthy and diseased tissue. Expression ENOVIA and GAPDH are shown in brain tissue affected multiple sclerosis and Alzheimer's disease.

In Fig.26 given the graphical representation of results showing the levels of expression of ENOVIA and GAPDH in tissues affected by Parkinson's disease and cancer.

Deposit

Plasmid EVNmat/pRSETB comprising a DNA sequence encoding enovin, deposited on may 6, 1999 under the number of access LMBP3931 in the database of the Belgian coordinated collections of microbiological cultures (WSSM) Laboratorp>Materials and methods

Materials

Native Taq polymerase, ampicillin, IPTG (isopropyl--D-thiogalactoside), X-gal (5-bromo-4-chloro-3-indolyl--D-galactopyranoside) and all restriction enzymes provided by the company Boegringer Mannheim (Mannheim, Germany). A mixture of 10 mm dNTP purchased from the firm Life Technologies (Gaithersburg, MD, USA). Set to clone TORO-purchased from the company Invitrogen BV (Leek, Netherlands). The cleaning kit plasmid mini or midinc Qiagen, kit Qiaprep Spin Miniprep and extraction Qiaquick gel purchased from the company Qiagen GmbH (Dusseldorf, Germany). CDNA library, ready cDNA Marathonpanels I and II cDNA multiple human tissues (MTS), Northern blots of multiple tissues and PCR using cDNA Advantage-GC obtained from a company Clontech Laboratories (Palo Alto, CA, USA). All polymerase reaction synthesis chain (PCR) performed in the fuser 9600 system GeneAmp PCR (Perkin Elmer, Foster City, CA, USA). Medium LB (Luria-Bertani) contains 10 g/l of tryptone, 5 g/l yeast extract and 10 g/l NaCl. Planxty with double volume YT/ampicillin containing 16 g/l of tryptone, 10 g/l yeast extract, 5 g/l NaCl, 15 g/l agar and 100 mg/l ampicillin.

The search for homologous sequences in the database and comparing the activity of the person (EST) library EMBL/GenBank and genome databases, using reprezentirovanii neurotrophic factor selected from the glial cell line person (GDNF; no access Q99748), neurturin (NTN; no access R), persephin (PSP; no access AF040962) isolated from the cDNA of the protein sequence as the reference sequence and the device to perform a comparative analysis of the primary structures of the BLAST (Basic Local Alignment Search Tool; Altschul et al., 1990).

Additional studies using BLAST performed using genomic sequence with no access AS and several EST, available in the GenBank database and search for sequences homologous to this genomic sequence.

The percentage of identity and similarity between the members of the GDNF family is calculated by pairwise comparison of sequences using the program BESTFIT (software for sequence analysis Genetics Computer Group, version 8.0, University of Wisconsin, Madison, PCs Wisconsin, USA). Comparative analysis of DNA or protein sequences performed using the comparative analysis ClustalW (EMBL, Heidelberg, Germany).

The synthesis of oligonucleotides for PCR and DNA sequencing

All oligonucleotide priming purchased from the company Eurogentec (Seraing, Belgium). Specificity the shares of the synthesis chain, manually created. DNA get on anion-exchange columns (Qiagen-tip 20 or -100 or centrifugal Qiaquick columns (Qiagen GmbH, Dusseldorf, Germany) and isolated from the column in 30 µl of TE buffer (10 mm Tris-HCl, 1 mm EDTA (sodium salt), pH 8.0).

The sequencing reaction performed on both circuits, using the kit for sequencing (ABI prism BigDye Terminator Cycle, the sequencing machine Applied Biosystems 377XL (Perkin Elmer, ABI Division, Foster City, CA, USA). The Assembly sequence and manual editing (GeneCodes, Ann-Arbor, MI, USA) performed using the software Sequencher.

Cloning of a new homologue of GDNF

Nucleotides 67411-68343, covering a region of the DNA from the database EMBL no access AS, in which the translated protein sequence homologous Mature NTN and PSP, used to generate oligonucleotide seed for amplification using PCR. Different used seed are shown in table 1.

Seed PNHsp3 and PNHap1 used for amplification of fragment length 502 p. O. on cDNA, isolated from different human tissues (cDNA brain of the fruit, the whole fruit, prostate or lung Marathon-Ready(Clontech Laboratories), cDNA of the frontal lobe of the cerebral cortex, hippocampus and cerebellum), and genoino, what amplificatory fragment must contain a G+C in the amount of 76%. Therefore, amplification is produced by means of a set for PCR cDNA Advantage-GC (Clontech Laboratories, Palo Alto, CA, USA), which is optimized for amplification of DNA sequences with a high content of GC. Polymerase reactions of synthesis circuit perform in the environment total volume of 50 µl, containing a single volume of the reaction buffer for PCR with GC cDNA, 0.2 mm dNTP, 1 M GC-MELT, 200 nm seed PNHsp3 and PNHap1, 1 μl polymerase mix Advantage KlenTaq and 1-5 μl of cDNA or 0.5 μg of genomic DNA. The samples are heated to 95C for 5 minutes and subjected to heat treatment performed for 45 seconds at 95C, 1 minute at 58C and 40 seconds at 72C for 35 cycles with a final stage with a duration of 7 minutes at 72C. Finally, the samples treated with 2.5 units of native Taq-DNA polymerase to add the extension segment A. the PCR Products analyzed in 1% (weight to volume) agarose gel in a single volume TAE buffer (40 mm Tris-acetate, 1 mm EDTA (sodium salt), pH 8.3). The PCR fragments expected length (495 p. O.) cut out from the gel and purified using the kit for the extraction of the Qiaquick gel. Fragment set to clone TORO THAT in accordance with the manufacturer's instructions. Approximately 20 ng of purified fragment is mixed with 1 μl of vector pCR2.1-TOPO in a total volume of 5 ál. The reaction mixture incubated at room temperature (20(C) within 5 minutes. The reaction mixture (2 μl) transform competent cells of the TOP 1 OF' (Invitrogen BV) under the action of temperature shock and cultured on tablets, containing twice the amount YT/ampicillin with 10 mm IPTG and 2% (weight to volume) X-gal, for a screening of blue-white colonies. White colonies after growing overnight take tablets, grown in 5 ml LB medium containing 100 mg/l ampicillin, and plasmid DNA obtained using the kit Qiaprep Spin Miniprep. The presence of insertion of the expected length confirm restriction by EcoRI digestion. Plasmid insert multiple positive clones is sequenced and the obtained sequences are compared using comparative analysis ClustalW.

To obtain additional coding sequence for a new homologue of GDNF, a fragment of the expected length, containing 931 p. O., calculated on the basis of sequence from the database EMBL/GenBank (no access AS), amplified using PCR, using seed PNHsp1 and PNHap1. Polymerase reactions for the synthesis C is mm dNTP, 1 M GC-MELT, 200 nm seed PNHsp1 and PNHap1, 1 μl polymerase mix Advantage KlenTaq and 1-5 μl of cDNA from the cerebellum, the frontal lobe of the cerebral cortex or the hippocampus or 0.5 μg of genomic DNA. The samples are heated to 95C for 5 minutes and subjected to heat treatment performed for 45 seconds at 95C, 1 minute at 58With 1 minute 30 seconds at 12C for 35 cycles with a final stage with a duration of 7 minutes at 72C. the PCR Products analyzed in 1% (weight to volume) agarose gel in a single volume TAE buffer (40 mm Tris-acetate, 1 mm EDTA (sodium salt), pH 8.3). The second amplification is performed by using nested seed (PNHsp2 and PNHap2). The product of the first amplification (1 μl) used in the environment total volume of 50 µl, containing a single volume of the reaction buffer for PCR with GC cDNA, 0.2 mm dNTP, 1 M GC-MELT, 200 nm seed PNHsp2 and PNHap2, 1 μl polymerase mix Advantage KlenTaq. The samples are heated to 95C for 5 minutes and subjected to heat treatment performed for 45 seconds at 95C, 1 minute at 58With 1 minute 30 seconds at chr/176.gif">C. the Samples analyzed in 1% (weight to volume) agarose gel in a single volume TAE buffer. The PCR fragments expected length (870 p. O.) cut out from the gel and purified using a kit for the extraction of the Qiaquick gel. The PCR fragments is sequenced to confirm their identity, process, and 2.5 units of Taq polymerase and clone in plasmid vector pCR2.1-TOPO using a kit for cloning TORO THAT in accordance with the manufacturer's instructions. Approximately 20 ng of purified fragment is mixed with 1 μl of vector pCR2.1-TOPO in a total volume of 5 ál. The reaction mixture incubated at room temperature (20(C) within 5 minutes. The reaction mixture (2 μl) transform competent cells TOP1OF' under the action of temperature shock and cultured on tablets, containing twice the amount YT/ampicillin with 10 mm IPTG and 2% (weight to volume) X-gal, for a screening of blue-white colonies. White colonies after growing overnight take tablets, grown in 5 ml LB medium containing 100 mg/l ampicillin, and plasmid DNA obtained using the kit Qiaprep Spin Miniprep. The presence of insertion of the expected length confirm restriction by EcoRI digestion. Plasmid insert multiple put the aleesa ClustalW.

Analysis of gene expression ENOVIA using RT-PCR

Oligonucleotide priming PNHsp3 and PNHap1 (see table 1) used for the specific amplification using PCR fragment length 502 p. O. isolated from ENOVIA. Amplification using PCR is carried out using cDNA panels several human tissues (MTS), normalized to levels of mRNA expression of six different binding genes. Polymerase reactions of synthesis circuit using invisiline nucleating perform in the environment total volume of 50 μl, containing 5 μl cDNA, a single volume of the reaction buffer for PCR with GC cDNA, 0.2 mm dNTP, 1 M GC-MELT™, 400 nm nucleating PNHsp3 and PNHap1 and 1 μl polymerase mix Advantage KlenTaq. The samples are heated to 95C for 30 seconds and subjected to heat treatment performed for 30 seconds at 95C and 30 seconds at 68C for 35 cycles. The samples analyzed in 1.2% (weight to volume) agarose gel in a single volume TAE buffer (40 mm Tris-acetate, 1 mm EDTA (sodium salt), pH 8.3) and get images of gels, stained with ethidium bromide, using video Eagle Eye II (Stratagene, La Jolla, CA, USA).

In the search of similarity daily obnovlyaemom sequence of genomic DNA, coding the new estimated protein, such neurotrophic factors GDNF, NTN and PSP, which was called "inulin" (EVN). Search for more homologous sequences in the database using the sequence of genomic DNA surrounding the region encoding enovin, gives several clones of labels expressed sequences (EST) isolated from different human tissues (epithelium of the prostate [#access A (ID 1322952)], lung carcinoma [#access AA] and tumor of the parathyroid gland [#access AA]). These clones contain DNA sequence outside the region of homology with GDNF, PSP or NTN, but confirm that mRNA ENOVIA expressed in healthy and tumor tissues.

Initial amplicate using PCR with the use of nucleating (PNHsp3 and PNHap1) based on the genomic sequence allows to obtain fragment length 500 p. O. from cDNA fruit of the fetal brain, the prostate, the frontal lobe of the cerebral cortex, hippocampus, cerebellum and from genomic DNA, and this selection cannot be obtained from cDNA lung. Cloning and sequence analysis of these fragments gives the DNA sequence of length 474 p. O. that is transmitted through pryh cysteine residues, characteristic for all members of a family of proteins transforming growth factor(TGF-) (Kingsley, 1994) (Fig.1). This sequence also contains the RXXR motif for cleavage of predomina (RAAR, the position of the amino acids 23-26) (Barr, 1991). A similar site splitting features in protein sequences GDNF, NTN and PSP in a similar position sequence predomina. If we assume that the splitting predomina ENOVIA occurs at this site in vivo, the sequence of the Mature protein EVN contains 113 amino acid residues (residues 27-139 in Fig.1), has a calculated molecular mass equal 11965 Yes, and isoelectric point, corresponding to 11.8. In the Mature sequence (NST in the position of the amino acids 121-123) has one of the alleged site of N-glycosylation. In addition, inulin also has several areas that are conserved in the Mature forms known neurotrophic factors GDNF, NTN and PSP (Fig.2). Table 2 shows the results of the comparison of the Mature protein sequences of members of the GDNF family using the program BESTFIT. This table shows the percentages of identity and similarity. Mature sequence of GDNF, NTN, PSP and EVN used in this comparison, the beginning of the Sabbath.

These comparisons show that the Mature protein ENOVIA is more closely related to persefona and neurturin than GDNF.

As a result of amplification, cloning and sequence analysis of a larger fragment of DNA sequences ENOVIA isolated from cDNA of the frontal lobe of the cerebral cortex using seed-based genomic sequence from the database EMBL/GenBank (no access AS) receive sequence consisting of 819 p. O. (Fig.3). This sequence contains the estimated initiating codon ATG at positions of nucleotides 30-32 and gives open-reading frames (frame readout And Fig.3), which reaches up to the termination codon at the positions of the nucleotides 285-287. The translated protein sequence of this region has no similarity with any known protein in these databases. Translation of the cDNA sequence in the second reading frame (frame readout In Fig.3) gives the expected protein sequence, consisting of 159 amino acid residues. This sequence contains a cleavage site RXXR (position V-B46; the position of the nucleotides 460-471) and the sequence corresponding to the sequence of Mature enovin (the state is the selected Mature enovin, comes from the position of the nucleotide 334 (preceded by in frame termination codon) to the termination codon at position 811-813, but does not contain an ATG codon for the initiating methionine residue. By analogy with persefona (Milbrandt et al., 1998), the authors of this invention has advanced the hypothesis that in most mRNA transcripts of the gene EVN has resplice-integration of the intron. GDNF and NTN also have introns in the corresponding coding regions of predomina (Matsushita et al., 1997, Heuckeroth et al., 1997).

To establish the presence of different mRNA transcripts for ENOVIA perform experiments based on RT-PCR, using the seed, located at the 5'-end coding sequence ENOVIA, 5'-end of the proposed top of the initiating codon ATG (seed PNHsp5 [5' - GCA AGC TGC CTC AAC AGG AGG G - 3']) and nested priming PNHsp6 [5' - GGT GGG GGA ACA GCT CAA CAA TGG -3'] and the 3'-end (seed PNHap1 and nested priming PNHap2 [see table 1]). Experiments performed on panels cDNA multiple human tissues (panels I and II, Clontech MTS) using a cDNA library isolated from fetal heart (Clontech), and cDNA isolated from cerebellum, hippocampus or frontal lobe of the cerebral cortex of man (Masure et al., 1998). Initial polymerase reaction synthesis circuit perform, img.russianpatents.com/chr/176.gif">C - 30 seconds, 60C - 30 seconds, 72With 1 minute) in accordance with the description. Nested polymerase reaction synthesis circuit performed using 1 µl of the primary PCR product, using nucleating PNHsp6 and PNHap2 in the same conditions for 30 cycles. The resulting PCR products analyzed in 1.5% agarose gel and distribute in length from350 p. O. to800 p. O. Several bands purified from the gel and the PCR fragments are subjected to direct sequencing. Some purified PCR products also clone in the vector pCR2.1-TOPO (set to clone TORO-TA, Invitrogen) and then is sequenced. The sequence analysis confirmed the presence of other mRNA molecules containing a sequence ENOVIA. The sequence of the obtained fragments are compared with the genomic sequence ENOVIA. This allows to identify several possible 5'- and 3'-terminal splicing sites in the genomic sequence (Fig.21). All of these splicing sites correspond to coherent sequences for donor and acceptor splicing sites (Senapathy, P., Shapiro, M. B. & Harris, N. L. (1990)), the boundaries of the splicing sites of the acceptor points splicing, exons (Sequence Statistics, Identification, the e in different human tissues is shown in Fig.22. Only two out of 5 sequenced transcripts give a functional protein ENOVIA broadcast from the initiating codon ATG. These two transcripts encode proteins or 220 228 amino acids having, respectively, the estimated signal peptides, consisting of 47 and 39 amino acid residues. Putative protein sequences of these two variants is shown in Fig.23 (long version) and in Fig.24 (short version). Long option could be derived from the DNA sequence shown in Fig.21, splicer first intron in positions 5'-1 and 3'-1 and the second intron in positions 5'-2 and 3'-3. Following the broadcast of the open reading frame receive the expected protein sequence shown in Fig.23. A shorter version could be derived from the DNA sequence shown in Fig.21, splicer first intron in positions 5'-1 and 3'-2 and the second intron in positions 5'-2 and 3'-3. Following the broadcast of the open reading frame receive the expected protein sequence shown in Fig.24.

The longest transcript, apparently, is most often found in most tissues, as judged by the intensity of the bands in Fig.22V. Shorter transcripts cause shifts the reading frame, which gives the tra is GDNF, NTN and PSP. At least two transcripts is not even part of the Mature coding sequence, including two of the seven highly conserved cysteine residues. In Fig.22B shows the distribution of the main playerowner variants in different human tissues. Functional mRNA ENOVIA expressed in almost all tested tissues, including the brain, heart, kidney, liver, lung, pancreas, skeletal muscle, colon, small intestine, peripheral blood leukocytes system, spleen, thymus, prostate, testis, ovary, placenta, and fetal heart. In some human tissues (e.g., cerebellum, hippocampus) using PCR can amplify only non-functional transcripts. To the authors ' knowledge this invention, the presence of non-functional mRNA transcripts in such numbers so far not been described. It is necessary to study the biological significance of this discovery. Although the expression of NTN and PSP in different tissues is not fully investigated, the levels of their ex-pressie, apparently, are much lower, and the expression is more restricted to specific tissues (Kotzbauer et al., 1996, Milbrandt et al., 1998).

Expression of recombinant ENOVIA in expressing anew is me human DNA using nucleating PNHsp4 and PNHap2 (table 1) and clone in the vector pCR2.1-TOPO method TA-cloning (Invitrogen). The structure of the sequence of the insert confirmed by sequence analysis. One clone containing the insert with the agreed sequence ENOVIA (clone 36), is used for subsequent creation of expressing plasmids. Get two seed containing the appropriate restriction sites at the 5'-ends. Top seed PNHexp-sp1 (5' - GCGCT GGG GGC CCG GGC A - 3') contains the restriction site BamHI (underlined), and the lower seed PNHexp-apl (5' - GCCAG CCC AGG CAG CCG CAG G - 3') contains the restriction site XhoI (also underlined). Using these seed from clone 36 amplified fragment encoding Mature enovin (position 81-422 in Fig.1). Polymerase reaction synthesis circuit perform in the environment total volume of 50 µl, containing a single volume of reaction buffer with GC cDNA, 0.2 mm dNTP, 1 M GC-MELT, 200 nm seed PNHexp-sp1 and PNHexp-ap1, 1 μl polymerase mix Advantage KlenTaq and 10 ng of plasmid DNA from clone 36. Samples heated to 94C for 5 minutes and subjected to heat treatment performed 45 seconds at 94C, 1 minute at 58C and 30 seconds at 72With over 25 cycles with end-stage ol the La purification of PCR products Qiaquick (Qiagen) and DNA elyuirovaniya in 30 µl. This purified product (25 μl) hydrolyzing a 30 μl reaction mixture with 10 units of BamHI and 10 units of XhoI in a single volume of buffer B (Boehringer Mannheim) for 1 hour at 37C. After performing electrophoresis in 1% (weight to volume) agarose gel in a single volume TAE buffer (40 mm Tris-acetate, 1 mm EDTA (sodium salt), pH 8.3) the desired strip length 353 p. O. cut out from the gel and purified using a kit for the extraction of Qiaquick gel. The resulting fragment are ligated with the vector pRSET B (Invitrogen) and linearized using BamHI and XhoI. The structure of the insert of the resulting construction based plasmid vector (hEVNmat/pRSETB) confirm by performing the analysis of the whole sequence. The resulting construct encodes a protein consisting of 146 amino acids, with an estimated molecular mass 15704 Yes, including NH2-terminal His-tag of the 6 elements fused in frame with the coding sequence of the Mature enovin. NH2-terminal amino acid sequence of the obtained protein has the structure

MRGSGMASMTGGQQMGRDLYDDDDKDP(the Mature sequence ENOVIA bold, and His-tag consists of 6 items highlighted).

Expression ENOVIA in to the ina by Trigonom and other (Creedon et al., 1997), which make modifications. To obtain recombinant protein ENOVIA, plasmid hEVNmat/pRSETB transformed into strain BL21 (DE3) E. coli (Novagen) and grown in medium with twice the volume YT/ampicillin (16 g/l of tryptone, 10 g/l yeast extract, 5 g/l NaCl and 100 mg/l ampicillin) at 30(225 rpm) or 37(300 rpm) until an optical density OD600 equal to approximately 0.5, then add IPTG to a final concentration of 0.2 mm to induce expression. Cellular debris collected by centrifugation after a three-hour induction, washed with saline phosphate buffer, centrifuged and stored frozen. For cleaning and re-packing of cellular debris again suspended in the buffer to ultrasonic treatment (20 mm Tris-HCl, pH 8.0, 300 mm NaCl, 1 mm 2-mercaptoethanol, protease inhibitors (mixed tablet of protease inhibitor Complete(Boehringer Mannheim, 1 tablet per 50 ml buffer) and 1 mg of lysozyme per 500 mg of cellular debris)). Cells destroy ultrasound and intracellular bullock collected by centrifugation. Intracellular bullock dissolved and incubated in buffer A (8 M urea, 20 mm Tris-HCl, pH to 7.6, 200 mm NaCl, 1 mm 2-Mer is I acid, Qiagen). The mixture was shaken for 40 minutes at 37C, the samples are washed once with buffer a and injected into the column with 5 ml Ni-NTA. The column is sequentially washed with 10 volumes of buffer A, 10 volumes of buffer And at pH 7.2 and 10 volumes of buffer And at pH of 7.2 + 10 mm imidazole. Enovin elute from the column in 4 volumes of buffer And at pH of 7.2 + 200 mm imidazole.

Re-laying ENOVIA performed using stepwise dialysis overnight at 4With buffer for renaturation (0.1 M phosphate, 0.15 M NaCl, 3 μm cysteine, 0.02% of Tween-20, 10% glycerol, 0.01 M Tris-HCl, pH 8.3) containing urea, the amount of which decreases at each stage (from 6 M to 4 M, 3 M, 2 M, 1 M, 0.5 M and 0 M urea). Take an aliquot of purified protein, store it at -20With and then used to perform functional tests.

Localization of the gene ENOVIA in the chromosomes

A fragment of the gene ENOVIA 3,3 T. p. O. amplified from cDNA of the cerebellum, using seed EVN(7)-spl (5' - TTC GCG TGT HUNDRED CAA ACT CAA CTC CC - 3') and PNHapl (5' - GCA GGA AGA GCC ACC GGT AAG G - 3') derived from the EMBL sequence with no access AS. Polymerase reaction synthesis circuit perform in the environment total volume of 50 µl, containing a single volume of the reaction buffer E is support for 2 minutes at 94To add to 0.75 µl polymerase Expand Long Template (Boehringer Mannheim) and subjected to heat treatment performed for 10 seconds at 94C, 30 seconds at 58C and 3 minutes at 68With over 10 cycles. Then do another 20 additional cycles of heat treatment, increasing the processing time in each cycle at 68With 20 seconds. Heat treatment to complete the cycle of 7 minutes at 68C. the resulting fragment of 3,3 T. p. O. purified after electrophoresis in 0.8% of agarose/TAE gel and clone in the vector pCR2.1-MAINTENANCE method of the TA-cloning (Invitrogen). Analysis of the entire sequence of the insert of 3,3 T. p. O. one clone confirms that the obtained cDNA sequence corresponds to the genomic sequence in the database ENBL (no access AS). As a result of splicing cDNA obtained from cDNA of the cerebellum, were not selected introns.

Chromosomal mapping carried out by the method of fluorescent in situ hybridization (FISH) (Heng et al., 1992, Heng & Tsui, 1993). Human lymphocytes were cultured at 37For 68-72 hours and treated with 0.18 mg/ml 5-bromo-2'-deoxyuridine (BrdU) to synchronize chr/176.gif">C for 6 hours. Cells collect and receive microscopic preparations by standard methods, such as hypotonic treatment, fixation or natural drying. Probe 3,3, etc., acting for ENOVIA treated with Biotin and used for detection by the FISH method. Microscopic specimens calcined at 55C for 1 hour, treated with RNase, denatured in 70% formamide and twice the amount of a mixture of NaCl/Cit (a 20-fold volume of a mixture of NaCl/Cit contains 3 M NaCl, 0.3 M diatrizoate, pH 7.0) for 2 minutes at 70And dehydration ethanol. The probe was denatured and applied to denatured chromosomal microscopic preparations. Microscopic preparations hybridized overnight, washed, and on the photographic film separately register the FISH signals and picture strips, painted 4',6-diamidino-2-phenylindole, the data mapping method combine FISH with painted stripes chromosomes by superimposing FISH signals on chromosomes stained with 4',6-diamino-2-phenylindole (Heng & Tsui, 1993). In the applicable conditions, the efficiency of hybridization is approximately 72% for this probe (out of 100 tested mitotic figures signals in one pair of chromosomes were then specific chromosome, it had been correspondence between the probe signal and the short arm of chromosome 1. The exact position is further determined on the basis of summation of the data obtained at 10 photographs (Fig.4A). As used in the conditions of the FISH method not found additional locus, we can conclude that inulin is located in chromosome 1 person, region P31.3-R. An example of the results of the mapping shown in Fig.4V.

On the basis of genetic map data, presented in the National center for biotechnology information (NCBI, http://www.ncbi.nlm.nih.gov/genemap), we can conclude that the genomic clone containing the sequence ENOVIA (EMBL no access AS), is located on chromosome 1 between markers D1S2843 and D1S417. This position corresponds to chromosome 1, region P31.1-R.3, confirming the data obtained by the FISH method.

Distribution ENOVIA in the tissues as determined by Northern blot and dot blot

Northern blots containing 2 μg of poly(A)-rich RNA isolated from different human tissues (Clontech Laboratories, Palo Alto, CA, USA; blot MTN, blot II MTNand blot II MTNfrom fruit), hybridized in accordance with the manufacturer's instructions with a fragment ENOVIA length 897 p. O. labeled put amplification of cDNA frontal lobe of the cerebral cortex using PCR with the use of nucleating PNHsp1 and PNHap1 and subsequent cloning in the vector pCR2.1-TORO. This fragment contains 897 p. O. sequence ENOVIA to the termination codon and includes reprezentirovannoe the coding sequence for the Mature protein ENOVIA.

mRNA ENOVIA found in the main transcript length about 4.5, etc., R.H. (Fig.5A-C). mRNA ENOVIA expressed in several tissues, it is most often found in heart, skeletal muscle, pancreas and prostate. Some transcripts of smaller length are present, for example, in the placenta (4 etc., of O., 2,4, etc., of O., and 1.6 T. p. O.) and prostate (4, etc., of O., and 1.6, etc., O.). In the tissues of the fruit of the expressed transcript length of 2.4 T. p. O. detected in the liver and to a lesser extent in the lung. Other transcripts are also detected in kidney, liver, lung and brain of the fetus.

In addition to the primary RNA blot (Clontech Laboratories) containing poly(A)-rich RNA from different human tissues, with the probe ENOVIA length 897 p. O. also hybridized tissue under development. Samples of poly(A)-rich RNA used to generate this blot, normalized to levels of mRNA expression of eight different binding genes provided by the manufacturer. mRNA ENOVIA expressed in all samples, but the highest levels of mRNA detected in peyrovani vectors merge GFR-IgG-Fc

Region cDNA of the receptor GFR-1, GFR2 and GFR-3 (coding for amino acids, respectively 27-427, 20-431 and 28-371) with the exception of the sequences encoding the signal peptide and the COOH-terminal hydrophobic region that is involved in the binding of GPI clone in frame read in expressing the vector Signal pIg plus (R&D Systems Europe Ltd.). The obtained proteins expressed from these constructs contain NH2-terminal signal peptide of CD33, consisting of 17 amino acid region of the protein GFRand the COOH-terminal domain of the fusion IgG1-Fc human, consisting of 243 amino acids. The cells of the Chinese hamster ovary transferout merged designs GFRand choose steadily transfetsirovannyh cells using 500 μg G418. Permanent select clones using antibodies against the Fc. For cleaning the slit proteins GFRcells grown in medium without serum, which is collected every 3 days. Wednesday, centrifuged and injected into a column of protein A (protein a "sepharose", Pharmacia Biotech). Associated protein elute with 0.1 M Na-citrate, pH 3.0, and collected in 1 M Tris buffer, pH of 8.4. The protein concentration determined by optical https://img.russianpatents.com/chr/945.gif">-1 - GFR-3 is used in subsequent studies of the binding.

Analysis of resonance of the surface plasmon

Experiments on the study of surface plasmon resonance (SPR) are performed with 25With the apparatus BIAcore 3000. Analyses performed using ENOVIA and NGF as immobilized ligands. Carboxypropanoyl matrix of sensor chip F1 first activate a mixture of 400 mm N-ethyl-N-(dimethylaminopropyl)carbodiimide and 100 mm N-hydroxysuccinimide with a ratio of 1:1 for 10 minutes. Then recombinant enovin and NGF applied to the activated surface in 10 mm acetate buffer, pH 4.5, with a flow rate of 5 μl/min Unoccupied reactive group inactivate 1 M ethanolamine hydrochloride. To perform experiments on the binding of soluble proteins GFR1-3 Fc are sverhslojnoe at concentrations of 10-100 nm in buffered physiological solution containing HEPES (150 mm NaCl, 3.5 mm EDTA, 0.05% P-20, 10 mm HEPES, pH 7,4), a flow rate of 10 μl/min. Association control for 3 minutes and dissociation - in for 1 minute, followed by regeneration, using a 5 mm NaOH. Dissociation initiate evergleam using sub>d) and the equilibrium constants of dissociation (KD, is calculated as kd/ka) calculate using BIAcore, version 3.0.

Results

The surface plasmon resonance (SPR) is used to measure binding of soluble proteins GFR-1-3 with immobilized Envenom. Specific binding Envenom can only be detected when using soluble protein GFR3. GFR1 and GFR2 is not bound to the immobilized Envenom. The observed binding GFR3 is specific, since no binding to NGF. In a separate control experiment revealed specific binding of TrkA-Fc (NGF receptor) with immobilized NGF in the absence of binding to immobilized Envenom.

On the basis of the binding curves obtained using three different concentration GFR, derived the following constants are given in table 3. These results show that GFR3 specifically binds with Envenom.

As GDNF, NTN and PSP contribute to the preservation and survival of different types of neurons, we assume the RC. From the above it follows that the protein ENOVIA may be useful for treatment of diseases of the nervous system, including Parkinson's disease, Alzheimer's disease, peripheral neuropathy, amyotrophic lateral sclerosis (ALS), Huntington's disease, acute brain damage, tumors of the nervous system, multiple sclerosis, injury or damage to the peripheral nervous system and the defeat of neurotoxins.

Inulin can also be useful for neurotoxity in different situations. Because of its influence on the survival of different populations of neurons and elongation of axons in the model of SHSY5Y cells, it can be assumed that this compound exerts a neuroprotective and neurodegenerative effects.

This conclusion is based on the following observations. Taxol induces apoptosis of neurons in NGF-differentiated cells of rat pheochromocytoma PC 12 (Nuydens et al., scientific paper presented). Therefore, the cytotoxicity induced by Taxol, characterized by apoptosis of neurons, as evidenced by DNA fragmentation, labeling with annexin V and protection of bcl-2. On this basis we can conclude that Taxol induces apoptosis in differentiated SHSY5Y cells. It is established that enovin able to reduce cell death and in rodegenerative diseases, are experiencing apoptosis of cells; such diseases include stroke (Hakim, 1998), Parkinson's disease (Marsden et al., 1998), Alzheimer's disease (Nagy et al., 1998), Huntington's disease (Wellington et al., 1997), injury of the nervous system (Smirnova et al., 1998), peripheral neuropathy (Srinivisan et al., 1998).

As an example, recent clinical evidence the authors of this invention have found that this neurotrophic factor actually protects differentiated cells, SHSY5Y human neuroblastoma from toxic damage of cells caused by Taxol.

Methods of measuring the viability

Cell viability determined by adding to each well 100 μl of a solution (1 mg/ml) of 2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazole-5-carboxanilide (XTT, Sigma) in DMEM (37(C) containing 0.02 mm of methosulfate phenazine (PMS, Sigma). Tablets incubated at 37C for 2.5 hours. Optical density was measured (molecular devices) at 450 nm, using as a reference optical density at 650 nm. This analysis using the XTT based on conversion of the salt of tetrazole HTT in the product formazan red. This reaction is performed using mitochondrial enzymes.

The differential method is days using 25 nm staurosporine. Influence ENOVIA measured 72 hours after the start of the experiment (see Jalava et al., "Protein Kinase inhibitor staurosporine dosage a nature neuronal phenotype in SHSY5Y human neuroblastoma cells through an a,b,z PKC-independent pathway" Journ. cell Physiol. 155, 301-312 (1993)).

2. The dimension of elongation of axons

Morphological changes of neurons automatically defined in quantitative terms as follows. Briefly, this method can be described as follows: at the appropriate time periods in the environment add glutaraldehyde and leave for 30 minutes at room temperature. This ensures that the morphology of the cells in a given time reflects the actual state. Cells are examined in the mode of the transmitted light under the microscope Axiovert (Zeiss, Oberkochen, Germany) equipped with a scanning device Marzhauser, driven Indy workstation (Silicon Graphics, Mountain View, USA). Image photographed by the camera MH (HCS). Was studied 3000 cells / 64 combined images, forming a square matrix of 8x8 images. The precise combination of images ensures the opportunity to observe axons in successive images. Automatic detection of movements of axons labeled polyclonal tau-antibody perform using necesaary detector of curvilinear structures (l and the total length of axon.

To study the effect ENOVIA on other types of cells was performed two analyses, in particular the analysis of DNA synthesis and the analysis of chemotaxis.

Analysis of DNA synthesis

Cells, including fibroblasts of human skin (39SK), endothelial cells of the umbilical vein of a person (HUVEC) cells, smooth muscle (HSMC), human chondrocytes and osteoblasts rats, incubated in DMEM containing 10% FBS (39-SK, HSMC, osteoblasts rats), or in the environment of a particular composition (chondrocytes and HUVEC) at 37C in an atmosphere with 5% CO2and 95% air. For analysis of DNA synthesis cells were seeded in 96-well plate for tissue culture with a density of 5000 cells/well in DMEM containing 10% FBS, and incubated for 24 hours. Then this culture medium is replaced by DMEM containing different concentrations ENOVIA and 0.1% BSA (39-SK, osteoblasts, HSMC, chondrocytes), or DMEM containing different concentrations ENOVIA and 0.5% FBS (HUVEC), and incubated the cells for 24 hours. Then this culture medium replaced with 100 μl of DMEM medium containing 5% FBS and 0.1 MX [3H]-thymidine. After 2 h pulse labeling of cells fixed with methanol/acetic acid (3:1, volume ratio) for 1 hour at room temperature. Fixed kletki% SDS (100 µl/well) for 30 minutes. Aliquots of cell lysates (180 μl) is mixed with 2 ml of scintillation cocktail for account and measure the radioactivity in the cell lysates using a scintillation counter (Wallac 1409).

Analysis of chemotaxis

Cells incubated as described in the section "Analysis of DNA synthesis". Chemotactic activity ENOVIA analyze, using a 12-hole camera of Boyden (McQuillan, D. J., Handley, C. J., Campbell, M. A., Bolis, S., Milway, V. E., Herington, A. C., (1986), "Stimulation of Proteoglycan biosynthesis by serum and insulin-like growth factor-I in cultured bovine articular cartilage", Biochem. J. 240:423-430). Cells treated with 0.05% trypsin and 0.5 mm EDTA and re-suspended in DMEM. In the lower wells of the chamber Boyden add aliquots of 150 μl of medium containing different concentrations ENOVIA. Polycarbonate membrane (8 μm) coated with 0.1 mg/ml collagen type I, is injected from the top to the bottom of the hole and produce top holes. At the top of the wells add 100 ál aliquots of cells (70,000 cells/ml). Cells incubated for 6 hours, after which the apparatus is dismantled. Cells remaining on the upper side of the membrane, is removed. The membrane is fixed with 10% formaldehyde for 15 minutes and stained with hematoxiline intensity according to Gill. Cells are considered under the microscope (250-fold increase) and use the average value calculation tile is s in the form of numbers, fold the control sample (DMEM containing 0.1% BSA).

As shown in Fig.8-18, enovin no effect on the proliferation of all types of cells and migration of HUVEC cells (Fig.14), as described above. This enovin effect on SHSY5Y neuroblastoma cells. This testifies to the electoral impact ENOVIA on neurons.

Found that GDNF and NTN transmit a signal through a signaling complex containing landscapelaumu subunit GFR-1 or GFR-2 and a signaling subunit, such as tyrosinekinase protein cRET. It is assumed that enovin exerts biological effects via similar signaling complex, including GFRbinding partner (GFR-1, GFR-2, recently investigated the receptor GFR-3 or others not yet investigated members of the family GFRin combination with cRET or other signaling partner. Indeed, data binding, obtained by the authors of this invention, show that inulin can specifically bind with GFR-3.

In humans, mutations of the line of pathogenic microorganisms in GDNF or cRET can lead to Vozniknovenie of Hirshsprung (HSCR) (Romeo et al., 1994, Edery et al., 1994, Angrist et al., 1996). Both diseases are caused by poor intestinal motility, and disease Hirshsprung is the most common cause of congenital stenosis of the intestine in children of younger age. Interestingly, in mice which were administered GDNF and cRET show similar pathology, accompanied by renal insufficiency and ganglionated intestine (Sanchez et al., 1996; Moore et al., 1996; Pichel et al., 1996). Enovin may be relevant to the same diseases of the bowel or kidneys, and because enovin expressed in different tissues, it may be important for the development of other peripheral organs in the body.

The interaction of ligands with their receptors are usually the result of establishing specific links between specific residues in both proteins. The protein fragments can serve as agonists, activating the receptor, causing it stimulates growth and cell survival. So part ENOVIA or synthetic peptides based on the protein sequence ENOVIA can be useful agonists or antagonists, regulating the activity of the receptor GFR3. Using peptide synthesis or recombinant institutions factor or growth factor with parts ENOVIA, which allow you to obtain a new synthetic growth factor with new properties.

Were performed two preliminary tests to study the ability ENOVIA change caused by Taxol shortage of sensory neurons in rats after injection into the sole of the feet. In the first experiment investigated whether a single injection ENOVIA to resolve due to Taxol shortage of sensory neurons, and in the second experiment investigated whether enovin to prevent the development caused by Taxol shortage.

Recovery caused by Taxol dysfunction of sensory neurons

Methodology

In this experiment, we used male rats Sprague-Dawley weighing 300-340 grams. Animals were placed in separate cells, where they were given an unlimited amount of food and water. Before the experiment, animals were placed in standard cages for observation and after adaptation period of 15 minutes, was determined reflex acupuncture. The sole of the right paw of the animal irritated needle and evaluated the reactivity on acupuncture as follows: the presence of reactivity (score=1) or no reactivity (score=0). In the experiment, this procedure was repeated three times with intervals of 1 mirmirani reactivity in response to an injection needle. In the experiment used only those rats which had been the normal reaction of 3 acupuncture.

In the morning for three consecutive days, animals daily were injected with in the bottom of the right hind paw with 50 μl of Taxol (3 mg/ml of paclitaxel dissolved in cremophor and digidratirovannogo alcohol with water). The next morning produced a re-examination of reflex acupuncture and selected animals that have no reactivity to 3 irritation. These animals were randomly divided into subgroups (n=10/group), each of which animals were injected with in the bottom of the right hind paws 75 μl of filler, saline or 23 or 130 μg/ml ENOVIA. Since it was not observed any differences between the results with the introduction of animals filler and saline solution, both groups were combined into one (the control group). 1, 4, 5 and 7-th day after the last injection test acupuncture was performed in the morning (between 8:00 and 9:00 a.m.) and evening (between 15:30 and 16:30 hours). On the 8th day in the morning had the last trial on acupuncture. For each animal was determined by the total score obtained depending on the reaction to acupuncture throughout the experiment. Tavani) after the last injection of the medicinal product, the maximum score that can be obtained at the time of the experiment, was equal to 27.

Results

Re-injecting Taxol in the sole for 3 consecutive days causes an acute inflammatory reaction and no reaction to stimulation by acupuncture in most animals. Injecting into the sole of saline or filler does not affect caused by Taxol shortage of neurons. During the first measurement only in 4 out of 20 control animals were observed at least 1 response to three acupuncture, and the average score (the standard error of the mean) in the control animals during the first measurement was 0.25 (0,12); this figure differs from the estimate obtained at the beginning of the experiment, when the average score was equal to 3.0 (0,0), since all animals respond to acupuncture. After performing the measurements within 8 days reactivity control animals was impaired to such an extent that only 11 out of 20 rats at least once reacted to the needle, while the average score of acupuncture was equal to 0.75 (0,18). In this control group, all rats ovocny at the time of the experiment is shown in Fig.19. Because animals tested 9 times for 8 days, then the maximum score that could be obtained during the execution of 3 acupuncture sessions in each trial, was equal to 27. As shown in the graph, injecting saline or filler in the bottom did not cause recovery caused by Taxol shortage of neurons throughout the entire time of the experiment. The average total score of the control animals at the end of the experiment was equal to 5.10 (0,87); that is to 18.9% of the maximum assessment that could be obtained.

In the single injection in the bottom 75 μl of a solution containing 23 mg/ml ENOVIA, after the first measurement, it was found that 4 in 10 rats observed at least one reaction, while the average score of acupuncture was 0.70 (0,33). On the 8th day, all 10 animals at least once responded to acupuncture, and normal reactivity was observed in 5 of 10 rats. Average rating of acupuncture in this group on day 8 was equal 2,20 (0,29). Compared with the control animals, the average total score at the end of the eight-day period of measurement is significantly uvelicila,50 (1,96) (Fig.19). This is 53.7% of the maximum assessment.

When injecting into the sole 130 μg/ml ENOVIA were also obtained better results compared to the control animals. During the first measurement after the introduction of 130 μg/ml ENOVIA in 6 of 10 rats were observed at least one reaction, and the average score of acupuncture was equal 1,10 (0,35). On the 8th day, all 10 animals reacted on at least one side of the needle, while the average score was equal 2,60 (0,22). Normal reactivity of 3 acupuncture was observed in 8 out of 10 rats. The average total score of acupuncture in the end of the experiment in this group was $ 17,20 (1,94). This accounts for 63.7 percent of the total possible evaluation and represents a significant improvement compared with the control group (p<0,01).Methodology

In this experiment, we used male rats Sprague-Dawley weighing 300-340 grams. Animals were placed in separate cells, where they were given an unlimited amount of food and water. Before the experiment, animals were placed in standard cages for observation and after period is about irritated needle and evaluated the reactivity on acupuncture as follows: the presence of reactivity (score=1) or no reactivity (score=0). In the experiment, this procedure was repeated three times with intervals of 1 minute between two successive stimuli; this test on acupuncture consisted of 3 measurements of reactivity in response to the angle of the needle. In the experiment used only those rats, which saw a normal reaction for 3 of the injection needle (acupuncture=3). After the execution of this test measurement, the animals were randomly divided into subgroups (n=10/group), each of which animals were injected with in the bottom of the right hind paws 75 μl of filler, saline or 23 or 130 μg/ml ENOVIA. Since it was not observed any differences between the results with the introduction of animals filler and saline solution, both groups were combined into one (the control group). Within three days, the animals daily were injected with in the bottom of the right hind paw with 50 μl of Taxol (3 mg/ml of paclitaxel dissolved in cremophor and digidratirovannogo alcohol with water). 1, 4, 5 and 7-th day after injection of Taxol test acupuncture was performed in the morning (between 8:00 and 9:00 a.m.) and evening (between 15:30 and 16:30 hours). On the 8th day in the morning had the last trial on acupuncture. For each animal predella. As in total was made 9 trials on acupuncture (each of which consisted of 3 acupuncture) after administration of Taxol, the maximum score that can be obtained at the time of the experiment, was equal to 27.

Results

Injecting into the sole of saline or filler does not affect caused by Taxol shortage of neurons when tested in acupuncture. During the first test after the introduction of Taxol 8 of 20 rats at least once responded to acupuncture, with the average score of acupuncture was ravnaas 0,60 (0,18). On the 8th day still was caused by Taxol shortage of neurons, and the reaction was observed only in 8 out of 20 animals, and the average score was 0.8 (0,25). Two animals had a normal reflex to acupuncture. At the end of experiment comprehensive assessment of acupuncture decreased, and the average score was equal 6,55 (1,08), which is 24.3% of the maximum assessment (Fig.20).

Preliminary injecting 23 μg/ml ENOVIA decreases caused by Taxol shortage of neurons when tested in acupuncture. 1 day 8 of 10 animals reacted on the day the reaction was observed in all animals, and the average score was 2,50 (0,27). In 7 animals was discovered normal reactivity to all irritation acupuncture. With respect to the aggregate response throughout the experiment (Fig.20), the average total score improved significantly (p<0.01) compared with the control group and was equal to is 18.40 (1,73); this accounts for 68.1% of the maximum value.

Comparable results were obtained after pre-injection of 130 μg/ml ENOVIA. In this case, 6 out of 10 animals were observed response during the first test, the average score of acupuncture was equal to 1.70 (+0,31). On day 8, all animals at least once responded to stimulation by acupuncture, the average score was equal to 2.40 (+0,22), and all three reactions were normal in half of the animals. As for the cumulative assessment, the average score obtained on day 8, was $ 17,70 (1,92), which accounts for 65.5 per cent of the total assessment.

This series of experiments shows that even one injection ENOVIA in the sole can reduce caused by Taxol shortage of sensory neurons, as evidenced by the results of trials on acupuncture. Invites the Xia acceptable drug for the treatment of pain syndromes, mainly due to neurogenic disorders of the peripheral and Central nervous system, rheumatic/inflammatory diseases, as well as conduction disturbances and can modulate processes in sensory neurons, in the case of percutaneous, local, Central (such as an epidural, vnutriobolochechnoe and the like) and systemic use.

In addition, inulin can be used as a diagnostic tool for the study physiopathological changes in this area.

Comparison of mRNA expression ENOVIA in healthy and diseased tissues

The expression of mRNA ENOVIA analyze in quantitative terms, using a detection system sequences ABI Prism 7700 (TaqMan; Perkin Elmer) in accordance with the patented method, developed, and implemented by the company Pharmagene Laboratories Ltd., Royston, United Kingdom Of Great Britain. In this system used fluorogenic probe, generating specific for the sequence of fluorescent signals during PCR. This probe is an oligonucleotide with a fluorescent reporter, which caused quenching the fluorescence of the dyes, and is located between the upper and lower blades on the only probe becomes part of the replicating complex, fluorescent reporter is cleaved from the quencher 5'- and 3'-terminal exonuclease present in the Taq-polymerase. Amplification of the fluorescent signal of the reporter in the reaction mixture is direct evidence of the accumulation of PCR product. The initial number of copies of a target sequence of mRNA (Cn) establish, determining the number of cycles of fractionation PCR (Ct) when you first detect the PCR product, i.e. the point at which the fluorescence signal exceeds the threshold value. Quantitative determination of mRNA target in each sample is produced by comparing the experimental values of Ct standard curve.

Obtaining RNA and quality control

Reprezentirovannoe RNA isolated from the whole and isecheno tissue using Tri reagent-Zol (Life Technologies, Gaithersburg, MD, USA) in accordance with the instructions of the supplier. Quality control for all RNA samples includes evaluating the integrity of intact 18S and 28S ribosomal RNA) and the detection of transcripts with high content (actin) and low content (transferrin receptor).

Design of seed/probe

Two seed and TaqMan probe design with the possibility of amplification of specific sequences from ENOVIA.

Seed 1: 5' ACGGTTCTCCAGGTGCTGT 3'

Straut intron and amplified part of the gene GAPDH person.

Seed 2: 5' CAGAGTTAAAAGCAGCCCTGGT 3'

Seed 4: 5' GAAGGTGAAGGTCGGAGTCAAC 3'

Probe 6: 5' TTTGGTCCGTATTGGGCGCCT 3'

Probe 5 mark fluorescent FAM, and the probe mark 6 fluorescent VIC.

Processing Dnazol reprezentirovannoe RNA

For each of the tested tissue of 2.2 µg reprezentirovannoe RNA split 2 units Gnkazy, not containing RNase (Gibco BRL) for 15 minutes at room temperature in 20 μl of a single volume of buffer Dnazol (Gibco BRL). The reaction is stopped by adding 2 μl of a solution of 25 mm EDTA. Samples incubated at 65C for 10 minutes to inactivate the enzyme.

Synthesis of single-stranded cDNA

For each test fabric 100 ng reprezentirovannoe RNA is used as template to synthesize single-stranded cDNA. RNA in a volume of 4 ml, 50 nm of the blades 1 and 2, a single volume of buffer II for PCR (Perkin Elmer) and 5 mm MgCl2heated to 72C for 5 minutes and slowly cooled to 55C. Add all other reagents and 6 ml of the reaction mixture is incubated during 48C for 30 minutes, after which inactivate the enzyme at 90C for 5 minutes. The final reaction conditions are: a single volume of buffer II for PCR, 5 mm MdCl2, 1 mm dATP, dTTP, dGTP>The DNA extracted from 100 ng reprezentirovannoe RNA for each sample, amplified performing a polymerase reaction in the synthesis chain, to identify transcription and GAPDH transcript. Seed/probe used in the following final concentrations for transcript-target: 300 nm seed 1, 300 nm seed 3 and 200 nm of probe 5, and for GAPDH transcript: 20 nm seed 2, 20 nm seed 4 and 100 nm probe 6. Other reagents in the reaction mixture used in the following final concentration: 4.5% glycerol, single volume of buffer And TaqMan (Perkin Elmer), 6.25 mm MgCl2, 430 M dATP, dUTP, dGTP, dCTP, 2.5 units AmpliTaq Gold. Amplification using PCR is performed in the detection system sequences ABI 7700, at this initial stage of activation of the enzyme is carried out at 94C for 12 minutes followed by 45 cycles at 94C for 15 seconds, at 60C for 1 minute (minimum ramp time).

Disease and subjects fabric

The expression of mRNA ENOVIA compared to tissues obtained from patients subjects and healthy control subjects (Fig.25 and 26). The table below shows the diseases investigated and the corresponding tissue. The img.russianpatents.com/img_data/84/840582.gif">

Statistical analysis

For each group of three tissues calculate the average value and the standard deviation on the basis of the Ct values (which are normally distributed), then convert them into values of Cn by the formula Cn=10((Ct-40,007)/-3,623. In addition, perform analysis of variance (ANOVA) of Ct values to compare mean levels of expression of mRNA ENOVIA in healthy and diseased tissues.

In Fig.25 and 26 indicates the average number of copies of mRNA ENOVIA. (standard deviation; n=3) in diseased and control tissues. The results of the statistical analysis show a significant increase in the level of expression of ENOVIA in the periventricular white matter of subjects suffering from multiple sclerosis (p=0.013). In the control sample internal GAPDH not found significant differences (p=0,79). The level of expression of ENOVIA in the periventricular white matter is quite low in healthy tissue (average of 270 copies per 100 ng reprezentirovannoe RNA compared to the 200,000 copies of GAPDH), and this level is three times higher (825) in subjects suffering from multiple sclerosis.

Found only one difference diseased tissue from healthy control tissue: adenocarcinoma m the value of GAPDH also significantly increased (165000 compared with 44000; p=0.03), which perhaps indicates a General increase in levels of mRNA.

Thus, the authors of this invention have found that the mRNA levels ENOVIA raised in the periventricular white matter in subjects suffering from multiple sclerosis.

The use of cellular ELISA-based phosphospecific antibodies for screening mimetic forms ENOVIA in the receptor complex GFR3/cRET

This method can also be used to identify agonists or antagonists of other receptors of neurotrophin, such as GFR1, GFR2, GFR4, TrkA, TrkB and TrkC.

Analysis

Using this analysis, you can identify agonistic or antagonistic compounds of neurotrophic growth factors, which measure the activation of key signaling kinases that are activated in neurotrophic path, or activating kinase receptor cRET. Activation measure, detektywa the number of phosphorylated kinases or kinase receptor using phosphospecific antibodies. With this purpose you can use cells NIH T, temporarily or permanently expressing TrkA, TrkB, TrkC, GFRa1/cRET, GFRa2/cRET, GFRa3/cRET or GFRa4/cRET.

Activation of map-kinase R42 cable line/R, RKV-kinesio, cRET can be deactivated using phosphospecific antibody to cRET.

This analysis is performed in accordance with the following procedure:

Cells NIH T cultured on 96-well tablet in 10% calf serum, and these cells should be 80% confluent prior to stimulation.

On the next day, your environment is replaced by a medium containing no serum, and grown cells on minimal medium for 18-24 hours.

After growing on minimal medium cells stimulate connections and neurotrophic factors, used as a positive control sample (10 ng/ml for neurotrophic factors).

Cells fixed with 4% formaldehyde in PBS at 4C for 20 minutes.

Cells washed three times with 200 ál S/0,1% Triton for 5 minutes.

- Growth of cells stop 100 µl of 0.6% H2O2in PBS/0,1% Triton for 20 minutes.

Cells washed three times with 200 ál S/0,1% Triton for 5 minutes.

- Cell block 100 μl of 10% fetal calf serum in PBS/0,1% Triton within 60 minutes.

Cells incubated with phosphospecific antibody in 50 μl of 5% BSA//PBS/0,1% Triton overnight at 4C. the Degree of dilution of the antibodies necessary to determine the 5 minutes.

Cells incubated with secondary antibody linked to horseradish peroxidase (HRP), with the degree of dilution of 1:100 in 50 μl of 5% BSA/PBS/0,1% Triton for 1 hour at room temperature.

Cells washed three times with 200 ál S/0,1% Triton for 5 minutes.

- One OPD tablet (Sigma) dissolved in 25 ml buffer (3,65 g of citric acid - N2Oh and 5.9 g of Na2HPO4-2H2O 0,51 H2O, pH 5,6) and added to 12.5 μl of N2About2. To each well add 50 ál and incubated for 15 minutes on a shaker (200 rpm/min), covered with aluminum foil.

Reaction stop 25 µl of N2SO4.

- The optical density OD490-650measured in apparatus for reading tablets ELISA.

The culture of dopaminergic neurons in the midbrain

Culture of neurons

Cultures of neurons derived from the middle ventricle of the brain of fetal rats enzymatic and mechanical dispersion. Tissue is collected, washed with cooled in ice physiological solution with phosphate buffer without CA2+and Mg2+containing 0.6% glucose (PBSG), and incubated for 30 minutes with PBSG containing 0.1% trypsin at 37C. the Cell suspension is cultivated with a density of 2.5105cells/cm296-hole is definitely the chemical composition (CDM), containing 10% fetal calf serum. The culture is placed in a medium of a certain chemical composition (CDM), consisting of a mixture (1:1) modified by way of Dulbecco eagle medium and nutrients F12 containing glucose (0,6%), glutamine (2 mm), sodium bicarbonate (3 mm), HEPES (5 mm), insulin (25 μg/ml), transferrin person (100 μg/ml), putrescine (60 μg/ml), sodium Selenite (30 nm), streptomycin (100 μg/ml) and penicillin (100 m u/ml).

Treatment of neurotrophic factors

Neurotrophins are dissolved in 0.5% bovine serum albumin used as the initial solution. Neurotrophins add 3 hours after the beginning of cultivation and after 5 days of being in the culture. The same amount of 0.5% bovine serum albumin added to control wells.

The high-affinity uptake of dopamine

The uptake of dopamine measured after 10 days. To do this, cells are washed twice with preheated PBS containing glucose (5 mm), ascorbic acid (100 mm) and pargyline (100 mm), and pre-incubated for 10 minutes with the same solution. Solution for pre-incubation replace the same solution containing 50 nm [3N] DA, and continue to incubate for 15 minutes at 37

Cells grown for 10 days in the presence ENOVIA or without him. The results obtained for the untreated control samples, taken for 100%. These results obtained during the execution of 1-5 independent experiments.

Links

Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. (1990) Basic local alignment search tool, J. Mol. Biol. 215, 403-410.

Angrist, M., Bolk, S., Halushka, M., Lapchak, P. A. & Chakravarti, A. (1996) Germline mutations in glial cell line-derived neurotrophic factor (GDNF) and RET in a Hirschsprung disease patient. Nature Genetics 14, 341-344.

Baloh, R. H., Tansey, M. G., Golden, J. P., Creedon, D. J., Heuckeroth, R. O., Keck, C. L., Zimonjic, D. B., Popescu, N. C., Johnson, E. M. & Milbrandt, J. (1997) TrnR2, a novel receptor that mediates neurturin and GDNF signaling through Ret. Neuron 18, 793-802.

Baloh, R. H., Gorodinsky, A., Golden, J. P., Tansey, M. G., Keck, C. L., Popescu, N. C., Johnson, E. M. & Milbrandt, J. (1998) GFR3 is an orphan member of the GDNF/neurturin/persephin receptor family. Proc. Natl. Acad. Sci. USA 95, 5801-5806.

Barr, P. J. (1991) Mammalian subtilisins: the long-sought dibasic processing endoproteases. Cell. 66, 1-3.

Beck, K. D., Valverde, J., Alexi, So, now, K., Moffat, B., Vandlen, R. A., Rosenthal, A. & Hefti, F. (1995) Mesencephalic dopaminergic neurons protected by GDNF from axotomy-induced degeneration in the adult brain. Nature 373, 339-341.

Bilang-Bleuel, A., Revah, F., Colin, P. Locquet, I., Robert J. J., Mallet, J. & Horellou, P. (1997) isease. Proc. Natl. Acad. Sci. USA 94, 8818-8823.

Buj-Bello, A., Buchman, V. L., Horton, A., Rosenthal, A. & Davies, A. M. (1995) GDNF is an age-specific survival factor for sensory and autonomic neurons. Neuron 15, 821-828.

Buj-Bello, A., Adu, J., Pinon, L. G. P., Horton, A., Thompson, J., Rosenthal, A., Chinchetru, M., Buchman, V. L. & Davies, A. M. (1997) Neurturin responsiveness requires a GPI-linked receptor and the Ret receptor tyrosine kinase. Nature 387, 721-724.

Choi-Lundberg, D. L., Lin, Q., Chang, Y. N., Chiang, Y. L., Hay, C. M., Mohajeri, H., Davidson, B. L. & Bonn, M. C. (1997) Dopaminergic neurons protected from degeneration by GDNF gene therapy. Science. 275, 838-841.

Creedon, D. J., Tansey, M. G., Baloh, R. H., Osborne, P. A., Lampe, P. A., Fahrner, T. J., Heuckeroth, R. O., Milbrandt, J. & Johnson, E. M. (1997) Neurturin shares receptors and signal transduction pathways with glial cell line-derived neurotrophic factor in sympathetic neurons. Proc. Natl. Acad. Sci. USA 94, 7018-7023.

Durbec, P., Marcos-Gutierrez, C. V., Kilkenny, C., Grigoriou, M., Wartiowaara, K., Suvanto, P., Smith, D., Ponder, B., Costantini, F., Saarma, M., Sariola, H. & Pachnis, V. (1996) GDNF signalling through the RET receptor tyrosine kinase. Nature 381, 789-793.

Edery, P., Lyonnet, S., Mulligan, L. M., Pelet, A., Dow, E., Abel L., Holder, S., Nihoul-Fekete, C., Ponder, B. A. & Munnich, A. (1994) Mutations of the RET proto-oncogene in Hirschsprung''s disease. Nature 367, 378-380.

Gash, D. M., Zhang, Z., Ovadia, A., Cass, W. A., Yi, A., Simmerman, L., Russell, D., Martin, D., Lapchak, P. A., Collins, F., Hoffer, B. J. & Gerhardt, G. A. (1996) Functional recovery in parkinsonian monkeys treated with GDNF. Nature 380, 252-255.

GFRNomenclature Committee (1997) Nomenclature of GPI-linked receptors for the GDNF ligand family. Neuron 19, 485.

Hakim A. "Ischemic penumbra: therapeutic window." Neurology. 1998 Sep; 51 (3 Suppi 3): S44-6.

Henderson, C. E., Phillips, H. S., Pollock, R. A., Davies, A. M., Lemeulle, C., Armanini, M., Simmons, L., Moffett, B., Vandlen, R. A., Koliatsos, V. E. & Rosenthal, A. (1994) GDNF: a potent survival factor for m chromatin. Proc. Natl. Acad. Sci. USA 89, 9509-9513.

Heng, H. H. Q. & Tsui, L.-C. (1993) Modes of DAPI banding and simultaneous in situ hybridization. Chromosoma 102, 325-332.

Heuckeroth, R. O., Kotzbauer, P., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Zimonjic, D. B., Popescu, N. C., Johnson, E. M. & Milbrandt, J. (1997) Neurturin, a novel neurotrophic factor, is localized to mouse chromosome 17 and human chromosome 19pl3.3. Genomics 44, 137-140.

Jing, S., Wen, D., Yu, Y., Holst, P. L., Luo, Y., Fang, M., Tamir, R., Antonio, L., Hu, Z., Cupples, R., Louis, J.-C., Hu, S., Altrock, B. W. & Fox, G. M. (1996) GDNF-induced activation of the ret protein tyrosine kinase is mediated by GDNFR-a, a novel receptor for GDNF. Cell 85, 1113-1124.

Jing, S., Yu, Y., Fang, M., Hu, Z., Holst, P. L., Boone, T., Delaney, J., Schultz, H., Zhou, R. & Fox, G. M. (1997) GFR-2 and GFR-3 are two new receptors for ligands of the GDNF family. J. Biol. Chem. 272, 33111-33117.

Kingsley, D. M. (1994) The TGF-beta superfamily: new members, new receptors, and new genetic tests of function in different organisms. Genes & Development 8, 133-146.

Klein, R. D., Sherman, D., Ho, W.-H., Stone, D., Bennett, G. L., Moffat, B., Vandlen, R., Simmons, L., Gu, Q., Hongo, J.-A., Devaux, C., Now, K., Armanini, M., Nozaki, C., Asai, N., Goddard, A., Phillips, H., Henderson, C. E., Takahashi, M. & Rosenthal, A. (1997) A GPI-linked protein that interacts with Ret to form a candidate neurturin receptor. Nature 387, 717-721.

Kotzbauer, P. T., Lampe, P. A., Heuckeroth, P. O., Golden, J. P., Creedon, D. J., Johnson, E. M. & Milbrandt, J. (1996) Neurturin, a relative of glial-cell-line-derived neurotrophic factor. Nature 384, 467-470.

Lin, L.-F. H., Doherty, D. H., Lile, J. D., Bektesh, S. & Collins, F. (1993) GDNF: a glial cell line-derived neurotrophic factor for midbrain dopaminergic neurons. Science 260, 1130-1132.

Mandel, R. J., Spratt, S. K., Snyder, R. O. & Leff, S. E. (1997) the Midbrain injection of recombinant adeno-associated virus encoding rat glial cell line-derived neurotrophic factor protects nigral neurons in a progresnd rational neuroprotective therapy is close to reality." Ann Neurol. 1998 Sep; 44 (3 Suppi 1): S189-96.

Masure, S., Cik, M., Pangalos, M. N., Bonaventure, P., Verhasselt, P., Lesage, A. S., Leysen, J. E. & Gordon, R. D. (1998) Molecular cloning, expression and tissue distribution of glial-cell-line-derived neurotrophic factor family receptor-3 (GFR-3). Eur. J. Blochem. 251, 622-630.

Matsushita, N., Fujita, Y., Tanaka, M., Nagatsu, T. & kiuchi's, K. (1997) Cloning and structural organization of the gene encoding the mouse glial cell line-derived neurotrophic factor, GDNF. Gene 203, 149-157.

Milbrandt, J., de Sauvage, F. J., Fahrner, T. J., Baloh, R. H., Leitner, M. L., Tansey, M. G., Lampe, P. A., Heuckeroth, R. O., Kotzbauer, P. T., Simburger, K. S., Golden, J. P., Davies, J. A., Vejsada, R., Kato, A. C., Hynes, M., Sherman, D., Nishimura, M., Wang, L. C., Vandlen, R., Moffat, C., Klein, R. D., Now, K., Gray, C., Garces, A., Henderson, C. E., Phillips, H. S. & Johnson, E. M. Jr. (1998) Persephin, a novel neurotrophic factor related to GDNF and neurturin. Neuron 20, 245-253.

Moore, M. W., Klein, R. D., Farinas, I., Sauer, H., Armanini, M., Phillips, H., Reichardt, L. F., Ryan, A. M., Carver-Moore, K. & Rosenthal, A. (1996) Renal and neuronal abnormalities in mice lacking GDNF. Nature 382, 76-79.

Mount, H. T., Dean, D. O., Alberch, J., Dreyfus, C. F. & Black, I. E. (1995) Glial cell line-derived neurotrophic factor promotes the survival and morphologic differentiation of Purkinje cells. Proc. Natl. Acad. Scl. USA 92, 9092-9096.

Nagy Z. et al. "The cell division cycle and the pathophysiology of Alzheimer's disease." Neuroscience. 1998 Dec; 87(4): 731-9.

Naveilhan, P., Baudet, C., Mikaels, A., Shen, L., Westphal, H. & Ernfors, P. (1998) Expression and regulation of GFR3, a glial cell line-derived neurotrophic factor family receptor. Proc. Natl. Acad. Scl. USA 35, 1295-1300.

R. Nuydens, Dispersyn g, Van den Kieboom G., De Jong M., Connors R., Ramaekers f, Borgers M., Geerts H. Bcl-2 protects neuronal cells against taxol-induced apoptosis by inducing mutli-nucleation", submitted.

Oppenheim, R. W., Houe73, 344-346.

Pichel, J. G., Shen, L., Sheng, H. Z., Granholm, A. C., Drago, J., Grinberg, A., Lee, E. J., Huang, S. P., Saarma, M., Hoffer, B. J., Sariola, H. & Westphal, H. (1996) Defects in enteric innervation and kidney development in mice lacking GDNF. Nature 382, 73-76.

Romeo, G., Ronchetto, P., Luo, Y., Barone, V., Seri, M., Ceccherini, I., Pasini, B., Bocciardi, R., Lerone, M., Kaariainen, H. et al. (1994) Point mutations affecting the tyrosine kinase domain of the RET proto-oncogene in Hirsch-sprung''s disease. Nature 367, 377-378.

Sanchez, M. P., Silos-Santiago, I., Frisen, J., He, C., Lira, S. A. & Barbacid, M. (1996) Renal agenesis and the absence of enteric neurons in mice lacking GDNF. Nature 582, 70-73.

Sanicola, M., Hession, C., Worley, D., Carmillo, P., Ehrenfels, C., Walus, L., Robinson, S., Jaworski, G., Wei, H., Tizard, R., Whitty, A., Pepinsky, R. B. & Cate, R. L. (1997) Gliai cell line-derived neurotrophic factor-dependent RET activation can be mediated by two different cell-surface accessory proteins. Proc. Natl. Acad. Scl. USA 94, 6238-6243.

Smirnova et al. "Thrombin is an increasing interest among signal that activates intracellular death protease pathways inducing apoptosis in model motor neurons". J Neurobiol. 1998 Jul; 36(l): 64-80.

Srinivisan et al. "Serum from patients with type 2 diabetes with neuropathy dosage complement-independent, calcium-dependent apoptosis in cultured neuronal cells." J. Clin. Invest. 1998 Oct 1; 102 (7): 1454-62.

Steger C., "An unbiased detector of curvilinear structures," IEEE Transactions on pattern analysis and machine intelligence, 20, 1, 113-125 (1998).

Suvanto, P., Wartiovaara, K., Lindahl, M., Arumae, U., Moshnyakov, M., Horelli-Kuitunen, N., Airaksinen, M. S., Palotie, A., Sariola, H. & Saarma, M. (1997) Cloning, mRNA distribution and chromosomal localisation of the gene for glial cell line-derived neurotrophic factor receptor, a homologue to GDNFRa. Human Mol. Genet. 6, 1267-1273.

Tomac, A., Lindqvist, E., Lin, L. F., Ogren, S. O., Young, D., Hoffer, B. J. & Olson, L. (1995) Protection and repair of the nigrostriatal dopaminergic system by GDNF in vivo. Naturuj-Bello, A., Davies, A. M., Asai, N., Takahashi, M., Vandlen, R., Henderson, C. E. & Rosenthal, A. (1996) Characterization of a multicomponent receptor for GDNF. Nature 382, 80-83.

Trupp, M., Arenas e, Fainzilber, M., Nilsson, A. S., Sieber, B. A., Grigoriou, M., Kilkenny, C., SalazarGrueso, E., Pachnis, V.,U., Sariola, H., Saarma, M. & Ibanez, C. F. (1996) Functional receptor for GDNF encoded by the c-ret proto-oncogene. Nature 381, 785-788.

Wellington et al. "Toward understanding the molecular pathology of Huntington''s disease." Brain Pathol. 1997 Jul; 7 (3): 979-1002.

Widenfalk, J., Nosrat, S., Tomac, A., Westphal, H., Hoffer, B. & Olson, L. (1997) Neurturin and glial cell line-derived neurotrophic factor receptor-(GDNFR-), novel proteins related to GDNF and GDNFR-with specific cellular patterns of expression suggesting roles in the developing and adult nervous system and in peripheral organs. J. Neurosci. 27, 8506-8519.

Widenfalk, J., Tomac, A., Lindqvist, E., Hoffer, B. & Olson, L. (1998) GFR-3, a protein related to GFR-1, is expressed in developing peripheral neurons and ensheathing cells. Eur. J. Neurosci. 10, 1508-1517.

Worby, C. A., Vega, Q. C., Zhao, Y., Chao, H. H.-J., Seasholtz, A. F. & Dixon, J. E. (1996) Glial cell line derived neurotrophic factor signals through the RET receptor and activates nitogen-activated protein kinase. J. Blol. Chem. 272, 23619-23622.

Worby, C. A., Vega, Q. C., Chao, H. H. J., Seasholtz, A. F., Thompson, R. C. & Dixon, J. E. (1998) Identification and characterization of GFR-3, a novel co-receptor belonging to the glial cell line-derived neurotrophic receptor family. J. Blol. Chem. 273, 3502-3508.

Yan, Q., Matheson, C. & Lopez, A. T. (1995) In vivo neurotrophic effects of GDNF on neonatal and adult facial motor neurons. Nature 373, 341-344.

List of abbreviations

BLAST device's structures

p. O. - base pair

cDNA - complementary DNA

CNS - Central nervous system

EST - tag expressed sequence

EVN - enovin

GDNF - dedicated line glial cells

GFR- receptor and family GDNF

GPI - glycosylphosphatidylinositol

MTS - cDNA from multiple tissues

NTN - neurturin

PCR - polymerase reaction synthesis circuit

PNS - peripheral nervous system

PSP - persephin

RT-PCR - polymerase reaction synthesis circuit with reverse transcription

TGF-- transforming growth factor

FISH - fluorescent in situ hybridization

MTN - Northern-blotting multiple tissues

NGF - nerve growth factor

SPR - surface plasmon resonance

Claims

1. The selected nucleic acid molecule encoding a neurotrophic factor human growth (inulin) and having a nucleotide sequence corresponding to the amino acid sequence shown in Fig. 1, or the coding sequence having at least 70%, preferably 80%, 90% or 95% homology with the amino acid sequence shown in Fig. 1.

2. The nucleic acid molecule under item 1, which is Cleanaway acid according to any one of paragraphs.1-3, having the sequence of nucleic acid from the provisions 81-419 the sequence shown in Fig. 1.

5. The selected nucleic acid molecule according to any one of paragraphs.1-4, having a nucleic acid sequence corresponding to the sequence of any playerowner variations in position from the 5'-1 to 3'-1 or 3'-2 and 5'1 or 5'-2" to 3'-2 or 3'-3 of the sequence shown in Fig. 21.

6. The nucleic acid molecule according to any one of paragraphs.1-5, having the nucleic acid sequence shown in Fig. 21.

7. Selected neurotrophic factor human growth encoded by the nucleic acid molecule according to any one of paragraphs.1-6.

8. The growth factor under item 7, contains the amino acid sequence of the provisions 27-139 amino acid sequence shown in Fig. 1, or having at least 70%, preferably 80%, 90% or 95% homology with the amino acid sequence shown in Fig. 1.

9. The growth factor under item 7 or 8, containing the amino acid sequence shown in Fig. 1.

10. The growth factor under item 7, contains the amino acid sequence shown in Fig. 23 or 24.

11. Expressing the vector for the expression of neurotrophic factor containing the nucleic acid molecule to the 11, containing additional nucleic acid sequence encoding a reporter molecule.

13. The growth factor under item 7, expressed by the cell that contains expressing vector for p. 11 or 12.

14. Pharmaceutical composition for treatment or prevention of disorders of the nervous system that contains expressing vector under item 11 or 12, together with a pharmaceutically acceptable carrier, diluent or excipient.

15. Pharmaceutical composition for treatment or prevention of disorders of the nervous system containing a growth factor according to any one of paragraphs.7-10, together with a pharmaceutically acceptable carrier, diluent or excipient.

16. The antibody obtained using the growth factor under item 7.

17. The way to detect the presence of growth factor in the sample, including interaction with the specified sample antibodies are able to bind growth factor under item 7, and detecting binding of the indicated antibodies with the specified growth factor.

18. The method according to p. 17, in which the indicated antibody conjugated with a reporter molecule.

19. The kit or device to detect the presence of neurotrophic growth factor in the sample containing the antibody, the ability to communicate with growth factor under item 7, and a device for the OS the antagonist derived neurotrophic factor human growth under item 7, providing for the interaction of a cell, tissue or organism expressing the receptor of the specified growth factor, with the test compound in the presence of the indicated growth factor and comparing the activation levels of the protein predecessor protooncogene receptor ret tyrosinemia protein kinase (RET) in a given cell, tissue or organism with a control sample which was subjected to interaction with the specified test connection.

21. A method of identifying agonists or antagonists derived neurotrophic factor human growth under item 7, involving the interaction of a cell, tissue or organism expressing the appropriate receptor specified growth factor and protein-precursor protooncogene receptor ret tyrosinemia protein kinase (cRET), with the test compound in the presence of the indicated growth factor, measuring the level of activation of signaling kinases in the signal transduction cascade, part of which is specified receptor, after addition of antibodies specific to the indicated signal kinase and conjugated with a reporter molecule, compared with the cell, tissue or organism, which are not subjected to the interaction with the specified connection.

22. The method according to p. 20 or 21, to the health of the cell, tissue or organism is a cell NIH T.

24. The method according to any of paragraphs.21-23, wherein said receptor is a GFRl, GFR2, GFR3 or GFR4.

25. The method according to any of paragraphs.21-24, in which the indicated antibody is specific to any of the MAR-kinase R42 cable line/R, RKV-kinase, c-jun, CREB, JNK/SAPIC-kinase.

26. Plasmid EVNmat/pRSETB, deposited in the collection LMBP under access number LMBP 3931 encoding a neurotrophic factor human growth under item 7.

 

Same patents:
The invention relates to medicine, namely to Phthisiology (the science of tuberculosis), and is intended for determining the activity of tuberculosis

The invention relates to biotechnology and may find application in Allergy and medicine

The invention relates to medicine, namely to obstetrics and Perinatology, and can be used to predict infectious disease in full-term newborns

The invention relates to the field of medicine

The invention relates to the field of biotechnology, particularly to a method of selection of bacterial lipopolysaccharides, and can be used for production of chemical vaccines, immunomodulators and design of diagnostic test systems

The invention relates to medicine, namely to gynecology, and can be used to predict the growth of uterine fibroids

The invention relates to medicine, namely to traumatology and orthopedics

The invention relates to medicine, namely cardiology and rheumatology, and can be used in particular for the early prediction of occurrence, clinical course and outcome of exudative pericarditis in systemic diseases
The invention relates to medicine, namely to gynecology, pathology and immunology, and can be used for the diagnosis of chronic endometritis and determine the nature of the inflammatory changes in the endometrium

The invention relates to the field of biotechnology and can be used in medicine

The invention relates to biotechnology and may find application in Allergy and medicine

The invention relates to the field of genetic engineering, in particular, can be used to produce transgenic tobacco plants

The invention relates to biotechnology, in particular genetic engineering

The invention relates to biotechnology and can be used to analyze in vitro transcription of viral and cellular genes

The invention relates to medicine and biotechnology and concerns of soluble mutant CTLA4 molecules that bind to the antigen CD86 with higher avidity than wild type CTLA4

The invention relates to the field of biotechnology and medicine, namely, to new sequences of DNA nucleotides and amino acids sequences of monoclonal antibodies (MABS) generated against lymphoblastoid cells, and peptides that bind MAT

The invention relates to the field of biotechnology and can be used in medicine
Up!