Genes transferrin receptor moraxela

 

The invention relates to biotechnology and is a purified and isolated nucleic acid molecule that encodes a protein of the bacteria Moraxella catarrhalis or immunogenic fragment transferrin receptor, as well as a method of obtaining a recombinant protein transferrin receptor. The nucleic acid may be used in immunogenic compositions used in vaccination against diseases caused by the bacterium Moraxella catarrhalis, for the diagnosis of Moraxella infections, and also as a tool to obtain immunological reagents. 8 N., and 6 C.p. f-crystals, 90 ill., 3 table.

The technical field to which the invention relates

The present invention relates to the molecular cloning of genes encoding proteins of the transferrin receptor (TfR), and in particular to gene cloning of transferrin receptor Moraxella (Branhamella) catarrhalis.

This application is a partial continuation of simultaneously pending applications for U.S. patent No. 08/778570, filed January 3, 1997, which, in turn, is a partial continuation of application for U.S. patent No. 08/613009 filed March 8, 1996

The level of technology

The bacteria Moraxella (Branhamella) catarrhalis is a gram-negative d is dnia years was established, that M. catarrhalis is an important pathogen that causes inflammation of the middle ear. In addition, M. catarrhalis is associated with sinusitis, conjunctivitis, and urinary infections, as well as with a number of inflammatory diseases of the lower respiratory tract in children and adults, including pneumonia, chronic bronchitis, tracheitis, and enfisema (see 1-8). (In this application to more fully describe the state of the science, to which pertains the present invention provides various links to cited works are given in parentheses. Full bibliographic information for each cited work are given in the end of the description, immediately before the claims. The content of this work is introduced in the present description by reference). In some cases, infection with a bacterium M. catarrhalis causes septicemia, arthritis, endocarditis, and meningitis (see 9-13).

Inflammation of the middle ear is one of the most common diseases of children at an early age, and about 80% of all children under three years of age suffer from at least one infection of the middle ear (see 14). Chronic inflammation of the middle ear associated with hearing and speech in children, and in some cases, impaired ability to learn. Tuluca a tonsillectomy, adenoidectomy and tympanocentesis. According to experts, the cost of treating inflammation of the middle ear in the U.S. is from one to two billion dollars a year.

In case of inflammation of the middle ear, and M. catarrhalis are usually isolated from the fluid of the middle ear with the bacterium Streptococcus pneumoniae and Netherweave the bacterium Haemophilus influenzae, which, obviously, responsible for 50% and 30% of infections of the middle ear, respectively. I believe that the bacterium M. catarrhalis responsible for approximately 20% of infections of the middle ear (see 15). Epidemiological reports have reported that the number of cases of inflammation of the middle ear associated with M. catarrhalis, increases simultaneously with the increase in the number of antibiotic resistant isolates of M. catarrhalis. For example, prior to 1970, there were no reports of isolates of M. catarrhalis, producing-lactamases, but since the mid-seventies it was found growing number of isolates expressing-lactamases. Recent surveys suggest that 75% of clinical isolates produce-lactamases (see 16, 26).

Iron is an essential nutrient required for the growth of many bacteria. Several bacterial species, including M. catarrhal, including Neisseria meningitidis (see 17), N. gonorrhoeae (see 18), Haemophilus Influenzae (see 19) and M. catarrhalis (see 20), produce outer membrane proteins that are specifically associated with human transferrin. The expression of these proteins is regulated by the amount of iron in the environment.

Two protein receptors, transferrin M. catarrhalis, called transferrin-binding protein 1 (Tbp1) and transferrin-binding protein 2 (Tbp2), have a molecular mass of 115 kDa (Tbp1) and approximately 80-90 kDa (Tbp2). In contrast to protein receptors, transferrin other bacteria, receptors Tbp2 M. catarrhalis have preferred affinity to Galatasaray (i.e., Ferri-) transferrin (see 21).

Infection caused by M. catarrhalis, can lead to serious diseases. It would therefore be desirable to obtain a recombinant source transferrin-binding proteins, which can be used in immunogenic preparations including vaccines, as antigen carriers for other antigens, and as immunogens, as well as for the production of diagnostic reagents. Especially desirable and useful genes encoding the transferrin-binding proteins and their fragments for specific identification and diagnosis of infections Moraxella, for immunizati inventions

The present invention relates to the production of purified, isolated nucleic acid molecules encoding the transferrin receptor of the Moraxella strain, or a fragment or analog of the protein of the transferrin receptor. Obtained in accordance with the present invention the nucleic acid molecules can be used for the specific detection of strains of Moraxella and for the diagnosis of infections caused by Moraxella. Purified and isolated molecules nucleic acids of the present invention, such as DNA, can also be used for the Tbp gene expression using techniques of recombinant DNA in order to produce economic way of purified and isolated proteins of the transferrin receptor, and their subunits, fragments, or analogs. The transferrin receptor, its subunits, fragments, or analogs, and nucleic acid molecules encoding the indicated receptor, its subunits, fragments or analogs, and vectors containing such nucleic acid molecules can be used in immunogenic compositions for vaccination against diseases caused by Moraxella, and for the diagnosis of infections Moraxella, and as a tool to obtain immunological reagents. Monoclone is consistent in accordance with aspects of the present invention, can be used to diagnose infection with Moraxella; for the specific detection of Moraxella (for example, in in vitro and in vivo assays); and for treating diseases caused by Moraxella.

In accordance with one of its aspects the present invention relates to purified and separate molecules of nucleic acid (NK molecules), encoding a protein of the transferrin receptor strain of Moraxella, and more specifically, strains of M. catarrhalis, in particular, strains of M. catarrhalis 4223, Q8, or R1, or a fragment or analog of the protein of the transferrin receptor.

In one of the preferred variants of the present invention NK molecule can encode only Tbp1 protein of the Moraxella strain, or only protein b2 strains of Moraxella. In another preferred embodiment of the present invention NK molecule may encode a fragment of the protein transferrin receptor strain of Moraxella having a conservative amino acid sequence.

In another aspect the present invention relates to purified and selected NC-molecule having a DNA sequence selected from the group including: (a) the DNA sequence shown in Fig.5, 6, 10, 11, or 27 (SEQ ID No: 1, 2, 3, 4, 5, 6, 7, 8, 45 or 46), or she complementary DNA sequence; (b) DNA sequence, Qodiri she complementary DNA sequence; and (C) a DNA sequence that's hybrid in stringent conditions with any of the DNA sequences defined in (a) and (b). The DNA sequence defined in paragraph (C) preferably has a sequence that is at least about 90% identical to any one of the DNA sequences defined in (a) and (b). The DNA sequence defined in (C) may be such that it will encode equivalent protein transferrin receptor, derived from another strain of Moraxella.

In another aspect the present invention relates to a vector adapted for transformation of a host, and containing NK-molecule of the present invention, which may possess the properties of the nucleotide sequence contained in the vector LEM3-24, pLEM3, pLEM25, pLEM23, SLRD-A, DS-1698-1-1, DS-1754-1, pSLRD2, pSLRD3, pSLRD4 and pSLRD5.

This vector can be adapted for expression of the encoded transferrin receptor, its fragments or analogs, in heterologous or homologous to the host, either in the lipid or non-lipid form. In accordance with another of its aspects the present invention relates to expressing vector adapted for transformation of a host, and containing NC is providing the expression of the protein transferrin receptor, its fragment, or analog. In a particular embodiment of this aspect of the present invention NK molecule can encode mostly complete protein transferrin receptor, or only protein b1, only protein b2 strain of Moraxella, or fragments of the protein Tbp1 or Tbp2 protein. This expression element may include a promoter and a portion of a nucleic acid encoding a leader sequence for secretion of the protein transferrin receptor, or its fragment, or analog from the host cell. This expression element may also comprise a fragment of the nucleic acid encoding the signal lipidization for expression in the cell-master lepidosirenidae form of the protein transferrin receptor, or fragment, or its equivalent. The host may be selected, for example, from Escherichia. coli, Bordetella, Bacillus, Haemophilus, Moraxella, and as expressing systems can be used fungi, yeast or baculovirus and virus Semliki Forest (Semliki forest). In a specific embodiment of the present invention a plasmid adapted for expression Tbp1 is pLEM29, and for the expression of Tbp2 - L33. Other vectors are pLEM-37, SLRD35-A and SLRD35.

In another aspect the present invention relates to a transformed host containing expressyou the th fragment, or similar strain of Moraxella produced by the transformed host.

This recombinant protein transferrin receptor can be obtained mainly in pure form in accordance with another aspect of the present invention, which proposes a method of obtaining a mostly pure recombinant protein transferrin receptor, involving the cultivation of the transformed host of the present invention for expression of the protein of the transferrin receptor in the form of Taurus include; cleaning of these Taurus enable from cellular material and soluble proteins; the solubilization of the protein transferrin receptor, obtained from purified Taurus inclusion; and purification of the protein of the transferrin receptor from other solubilizing materials. Mostly pure recombinant protein transferrin receptor can contain only one Tbp1, only one b2, or their mixture. Basically, the purity of this recombinant protein is at least about 70%, and preferably at least about 90%.

So in other aspects the present invention relates to recombinante produced Tbp1 protein of the Moraxella strain that does not contain protein b2 strain of Moraxella and any other protein of the Moraxella strain, and rivers strains of Moraxella. Strain of Moraxella may be a strain of M. catarrhalis 4223, strain Q8 M. catarrhalis, or strain R1 M. catarrhalis.

In accordance with another of its aspects the present invention relates to immunogenic compositions containing at least one active component selected at least one NC-molecules of the present invention, and at least one recombinant protein of the present invention; and pharmaceutically acceptable carrier or vector. This, at least one active component causes an immune response when administered to the host.

Immunogenic compositions of the present invention can be manufactured in the form of a vaccine for in vivo introduction of the owner. For this, these compositions can be made in the form of microparticles, capsules, ISCOM, or liposomal preparation. This immunogenic composition may be introduced in combination with a molecule, delivering the composition to the specific cells of the immune system or to the surfaces of the mucous membranes. Immunogenic compositions of the present invention (including vaccines) may also contain at least one other immunogenic or immunostimulating material, and this immunostimulating material can be, at m in the present invention, are (but are not limited to, aluminum phosphate, aluminum hydroxide, QS21, Quil A, their derivatives and components, ISCOM matrix, calcium phosphate, calcium hydroxide, zinc hydroxide, glycolipids similar, octadecylamine ester amino acids, muramyldipeptide, polyphosphazene, ISCOPREP, DC-chol, DDBA, and lipoprotein. The predominant combination of adjuvants is described in simultaneously considering applications for U.S. patent No. 08/261194 (filed June 16, 1994), and No. 08/483856 (filed June 7, 1995), which were assigned their assignee, and which are introduced into the present description by reference (WO 95/34308).

In accordance with its second aspect the present invention relates to a method for producing an immune response in the host, including the stage of introduction of a susceptible host, such as human, an effective amount of immunogenic compositions of the present invention. The immune response can be humoral or cell-mediated immune response, and can provide immune protection against disease caused by Moraxella. The owners, who may be ensured immune protection against disease, are primates, including humans.

In another aspect the present invention relates to a live vector, Aetat vector may be selected from Salmonella, BCG, adenovirus, poxvirus, vaccinia virus and poliovirus.

The nucleic acid molecules of the present invention can be used for diagnostic purposes. In accordance with another of its aspects the present invention relates to a method for detecting the presence in the sample of nucleic acid that encodes a protein transferrin receptor strain of Moraxella, where the method includes the following stages:

(a) contacting the sample with NC-molecule of the present invention for producing duplex containing the NC-molecule and any NK molecule encoding a protein of the transferrin receptor of the Moraxella strain present in the sample, and specifically hybridizers with her; and

(b) determining production of duplexes.

In addition, the present invention relates to a diagnostic kit for detecting the presence in the sample of nucleic acid that encodes a protein transferrin receptor strain of Moraxella where specified set includes:

(a) NK-molecule of the present invention; and

(b) means for contacting the NK molecule with the sample to produce duplexes containing the NC-molecule and any NK molecule encoding a protein transferrin receptor strain of Moraxella, prisutstvie the complex.

In addition, the present invention relates to the use of NK molecules and proteins of the present invention as a drug. The present invention also relates to the use of NK molecules and proteins of the present invention for the manufacture of drugs against infections caused by strains of Moraxella.

The advantages of the present invention are:

- an isolated and purified nucleic acid molecule encoding a protein transferrin receptor strain of Moraxella, or a fragment or analogue;

recombinant proteins produced transferrin receptor, including Tbp1 and b2, free from each other and from other proteins of Moraxella strain; and

diagnostic kits and immunological reagents for the specific identification of Moraxella.

Brief description of drawings

For a better understanding of the present invention below is the detailed description with reference to the following drawings, where:

Fig.1 illustrates the amino acid sequence (SEQ ID No: 17 and 18) conservative region proteins Tbp1 used to synthesize degenerate primers used for PCR amplification of the fragment of the tbpA gene of a strain of M. catarrhalis 4223;

Fig.2 illustrates the restriction map to the strains of M. catarrhalis 4223;

Fig.4 illustrates a restriction map of the gene for tbpB strain of M. catarrhalis 4223;

Fig.5 illustrates the nucleotide sequence of the tbpA gene (SEQ ID No: 1 is the full sequence, and SEQ ID No: 2 is the coding sequence), and deduced amino acid sequence of the protein Tbp1 strain 4223 (SEQ ID No: 9 full - length sequence, and SEQ ID No: 10 is the sequence of the Mature protein). Leader sequence (SEQ ID No: 19) emphasized;

Fig.6 illustrates the nucleotide sequence of tbpB gene (SEQ ID No: 3 is the full sequence, and SEQ ID No: 4 is the coding sequence), and deduced amino acid sequence of Tbp2 protein of strain 4223 (SEQ ID No: 11 full-length sequence, and SEQ ID No: 12 is the sequence of the Mature protein). Leader sequence (SEQ ID No: 20) underlined;

Fig.7 illustrates the restriction map of clone SLRD-A containing genes tbpA and tbpB strain Q8 M. catarrhalis;

Fig.8 illustrates the restriction map of the tbpA gene for strain Q8 M. catarrhalis;

Fig.9 illustrates the restriction map of the tbpB gene for strain Q8 M. catarrhalis;

Fig.10 illustrates the nucleotide sequence of the tbpA gene (SEQ ID No: 5 is the full sequence, and SEQ ID No: 6 is the coding sequence), and deduced amino acid Poti Mature protein);

Fig.11 illustrates the nucleotide sequence of tbpB gene (SEQ ID No: 7 is the complete sequence, and SEQ ID No: 8 is the coding sequence), and deduced amino acid sequence of Tbp2 protein of strain Q8 (SEQ ID No: 15 with a full - length sequence, and SEQ ID No: 16 is the sequence of the Mature protein);

Fig.12 illustrates a comparison of the amino acid sequence Tbp1 strain 4223 M. catarrhalis (SEQ ID No: 9) and Q8 M. catarrhalis (SEQ ID No: 13), strain Eagan H. influenzae (SEQ ID No: 21), strains WV (SEQ ID No: 22) and M (SEQ ID No: 23) N. meningitidis, and strain FA19 N. gonorrhoeae (SEQ ID No: 24). Dots indicate identical residues, and dash were introduced to match the comparison of the primary sequences;

Fig.13 illustrates a comparison of the amino acid sequence b2 strain 4223 M. catarrhalis (SEQ ID No: 11) and Q8 M. catarrhalis (SEQ ID No: 15), strain Eagan H. influenzae (SEQ ID No: 25), strains WV (SEQ ID No: 26) and M N. meningitidis (SEQ ID No: 27), and strains of N. gonorrhoeae FA19 (SEQ ID No: 28). Dots indicate identical residues, and dash were introduced to match the comparison of the primary sequences;

Fig.14 illustrates the construction of plasmids pLEM29 for the expression of recombinant Tbp1 protein in E. coli;

Fig.15 illustrates LTO-SDS page analysis of the expression of the protein Tbp1 cells of E. coli, Tr is p1;

Fig.17 illustrium LTO-SDS page analysis of purified recombinant protein Tbp1;

Fig.18 illustrates the construction of plasmids L33 and plasmids pLEM37, which are designed for gene expression tbpA strain 4223 M. catarrhalis, E. coli, and one of which does not contain, and the other contains a leader sequence, respectively; and

Fig.19 illustrates LTO-SDS page analysis of protein expression rb2 the E. coli cells transformed with plasmid pLEM37;

Fig.20 illustrates the construction of plasmids SLRD35B designed for the expression of tbpB gene of strain Q8 M. catarrhalis, E. coli, and does not contain a leader sequence; and construction of plasmids SLRD35A designed for the expression of tbpB gene of strain Q8 M. catarrhalis, E. coli, and containing a leader sequence. Restricciones sites: B=BamHI; VD=BglII; H=HindIII; R=EcoRI;

Fig.21 illustrates LTO-SDS page analysis of protein expression rb2 the E. coli cells transformed with plasmids SLRD35A and SLRD35B;

Fig.22 illustrates a block diagram of the purification process of recombinant protein b2 from E. coli;

Fig.23 (panels a and b) illustrates the LTO-SDS page analysis of purification of recombinant protein b2 strains 4223 (panel a) and Q8 (panel C) M. catarrhalis, expressed in E. coli;

Fig.24 illustrates the binding b2 with transferrin human;

Fig. illustrates the restriction map of the tbpB gene for strain R1 M catarrhalis;

Fig.27 shows the nucleotide sequence of the tbpB gene (SEQ ID No: 45 is the full sequence and SEQ ID No: 46 is the coding sequence and deduced amino acid sequence of the protein b2 strain R1 M catarrhalis (SEQ ID No: 47); and

Fig.28 illustrates a comparison of the amino acid sequence of Tbp2 strain 4223 M. catarrhalis (SEQ ID No: 21), strain Q8 M. catarrhalis (SEQ ID No: 15), and strain R1 (SEQ ID No: 47). Dots indicate identical residues, and dash were introduced to match the comparison of the primary sequences. Asterisks indicated the stop codons.

Detailed description of the invention

To obtain purified and selected nucleic acid, which may be in the form of DNA molecules containing at least part of the nucleic acid encoding the transferrin receptor, the type of which is defined in embodiments of the present invention may be used in any strain of Moraxella. These strains are usually obtained from clinical sources and from the collections of bacterial cultures, such as the American type culture collection.

In this application, the term "transferrin receptor" (TfR) and transferrin-binding proteins" (b) are used to define a family of proteins Tbp1 and/or Tbp2, which includes the be is in, for example, strains of Moraxella. Isolated and purified DNA molecules containing at least a portion encoding the transferrin receptor of the present invention are also molecules encoding functional equivalents of the proteins transferrin receptor Tbp1 and Tbp2 Moraxella. In this application, the first protein is a "functional analogue" of the second protein, in that case, if the first protein is immunologically related to the second protein and/or has the same functions similar to the functions of the second protein. Such functional analog may be, for example, protein fragment, or mutant with substitution, insertion or deletion.

Chromosomal DNA from strain 4223 M. catarrhalis hydrolyzed by the enzyme Su3 obtaining fragments of size ranging from 15-23, etc., of O., and cloned into the BamHI site of lambda vector EMBL3. The library was skanirovali using antisera Guinea pigs against Tbp1, and a positive clone LEM3-24 containing the insert size of approximately 13,2, etc., of O., were selected for further analysis. It was found that the lysate from E. coli LE392, infected LEM3-24, contains a protein of approximately 115 kDa, which reacts on Western-blots with anticorodal against Tbp1. The second protein of approximately 80 kDa Sisulu tbpA gene 13.2 T. p. O. - insert LEM3-24 were used degenerate PCR primers to amplify a small region of the proposed tbpA gene of strain 4223 M. catarrhalis. Sequence degenerate oligonucleotide primers were selected on the basis of conservative amino acid sequences in proteins Tbp1 some species of Neisseria and Haemophilus, and shown in Fig.1 (SEQ ID No: 17 and 18). Was produced amplificatory 300 p. O. - product, and its localization is shown in Fig.5 in bold (SEQ ID No: 29). This amplificatory product was subcloned into the vector pCRII, labeled and used to probe a southern blot containing clone DNA LEM3-24, hydrolyzed restricteduse the endonuclease. This probe was hybridisable 3.8, etc. on-HindIII-HindIII-, 2,0, etc., O. AvrII-AvrII-, and 4.2, etc., O.-SlI-ShI-fragments (Fig.2).

3,8, etc., on-HindIII-HindIII fragment was subcloned into the race-177, and sequenced. Large open reading frame was identified, after which it was discovered that it contains approximately 2, etc., of a fragment of the proposed tbpA gene. The remaining 1 T. p. O. tbpA gene were obtained by sublimirovanny located directly below the adjacent HindIII-HindIII fragment into the vector pACY177. The nucleotide sequence of the gene tbpA strain 4223 M. catarrhalis (SEQ ID No: 1 and 2), and put the pots in Fig.5.

Chromosomal DNA from strain Q8 M. catarrhalis hydrolyzed by the enzyme Sau3A I, and so 15-23 p. O. fragments ligated with VMN-shoulders EMBL3. Library with high titers generated in the cells of LE 392 E. coli and skanirovali using oligonucleotide probes derived from the sequence tbpA strain 4223. Received phage DNA using restriction analysis revealed that were cloned insert size of about 13-15, etc., acting For sublimirovanny fragments for sequence analysis was used phage clone SLRD-A. To facilitate cloning of the fragments was generated vector cloning (pSKMA), and were obtained plasmids pSLRD1, pSLRD2, pSLRD3, pSLRD4 and pSLRD5 which contain all of the tbpA and most of tbpB. The nucleotide sequence (SEQ ID No: 5 and 6) and deduced amino acid sequence (SEQ ID No: 13 full - length sequence, SEQ ID No: 14 is the sequence of the Mature protein) gene tbpA strain Q8 shown in Fig.10.

It was found that the deduced amino acid sequence for the protein Tbp1 encoded genes tbpA, have some homology with the amino acid sequences encoded by the genes of several species of Neisseria and Haemophtlus (Fig.12; SEQ ID No: 21, 22, 23 and 24)

Prior to the development of the present invention bilimi conservative areas. These two genes are usually separated by a short intergenic sequence. However, tbpB gene was not detected above the tbpA gene in strain 4223 M. catarrhalis. In order to determine the localization of the tbpB gene 13.2, etc. acting on the insert of clone LEM3-24 was synthesized degenerate oligonucleotide probe based on the amino acid sequence EGGFYGP (SEQ ID No: 30), which is conservative for proteins b2 a few species of bacteria. This oligonucleotide was labeled and used to probe a southern blot containing various endonuclease-restriction fragments of clone LEM3-24. This probe was hybridisable from 5.5 T. p. O. - NheI-SlI-fragment, which was then subcloned into pBR328, and sequenced. This fragment contained a large portion of the proposed tbpB gene except for the promoter region. Clone LEM3-24 sequenced to determine the rest of the above sequence. TbpB gene was located approximately 3 T. p. O. below from the end of the tbpA gene, in contrast to the genetic organization of genes tbpA and tbpB in Haemophilus and Neisseria. The nucleotide sequence (SEQ ID No: 3 and 4) tbpB gene from a strain of M. catarrhalis 4223 and deduced amino acid sequence (SEQ ID No: 11, 12) shown in Fig.6. Was also cloned and sequenced tbpB gene of strain Q8 M. catarrhalis. asany in Fig.11. Was also cloned and sequenced tbpB gene of strain R1 M catarrhalis. The nucleotide sequence (SEQ ID No: 45 and 46) and deduced amino acid sequence (SEQ ID No: 47) shown in Fig.27. Observed region of homology between the amino acid sequences b2 strains of M. catarrhalis, as shown in Fig.28, where it is illustrated by comparison of their primary sequences (SEQ ID No: 11, 15, and 47), and between the amino acid sequences Tbp2 M. catarrhalis and sequences b2 several species of Neisseria and Haemophilus, as shown in Fig.13, where it is illustrated by comparison of their primary sequences (SEQ ID No: 25, 26, 27, 28).

Cloned genes tbpA and tbpB were expressed in E. coli to produce recombinant proteins Tbp1 and Tbp2, separated from the other proteins of Moraxella. These recombinant proteins were purified and used for immunization.

Antigenic conservatism protein Tbp2 for other strains of M. catarrhalis was demonstrated by the separation of proteins in whole cell lysates of strains of M. catarrhalis or strains of E. coli expressing recombinant Tbp2 proteins (rTbp2), by electrophoresis on SDS page with LTOs and Western blot turns using antisera against rb2 4223 or antisera against rTbp2 Q8 produced in Guinea pigs. So Simocatta with antibody against rTbp2 4223 or with antibody against rTbp2 Q8 (Fig.25).

In addition, the ability of antibodies against rTbp2 from one strain to recognize native or recombinant protein from homologous or heterologous strain in ELISA analysis, shown in table 1.

It was conducted by amino acid sequencing of the N-end and Bratianu fragments of transferrin receptors from the strain of M. catarrhalis 4223. Both N-end Tbp1 and Tbp2 were blocked. Putative signal sequence Tbp1 and Tbp2 are underlined in Fig.5 and 6 (SEQ ID Nos: 19 and 20), respectively. The deduced amino acid sequence for the N-terminal region Tbp2 suggest that they have a lipoprotein structure.

The results presented in table 1 and 2, illustrate the ability of antisera against rTbp1 and against rTbp2 produced in Guinea pigs by immunization with proteins Tbp1 or Tbp2, to lyse M. catarrhalis. These results show that the antisera produced by immunization with proteins Tbp1 and b2 isolated from M. catarrhalis, have bactericidal activity against the homologous neoglucogenesis strain RH408 M. catarrhalis [strain, which, according to the Budapest Treaty, was deposited on December 13, 1994 under the per. No. 55637 American type culture collection (in the United States adres)], derived from isolate 4223. In addition, anticavity produced by immunization with protein Tbp1 isolated from a strain of M. catarrhalis 4223, possessed bactericidal activity against neoglucogenesis strain Q8 (courtesy of Dr. M. Bergeron, Centre Hospitalier de I'universite Laval, St. Foy, Quebec). In addition, anticavity produced against the recombinant protein b2 (rb2) had bactericidal activity against the homologous strain of M. catarrhalis.

The ability of isolated and purified transferrin-binding proteins to generate bactericidal antibodies in vivo is evidence that these proteins can be used as a vaccine to produce immunity against a disease caused by Moraxella.

Thus, in accordance with another of its aspects, the present invention relates to a vaccine against infections caused by strains of Moraxella, where this vaccine contains immunogene effective amount of transferrin-binding protein originating from a strain of Moraxella, and its physiologically acceptable carrier. Vaccine preparations may contain transferrin-binding proteins, which differ in their antigenicity or by their sequences.

Transferrin-binding protein, the generation of antibodies against proteins communicating with transferrin as an antigen for vaccination against disease caused by Moraxella species, and to detect infections caused by Moraxella, and other such bacteria.

Transferrin-binding protein of the present invention can also be used as a protein carrier for haptens, polysaccharides or peptides upon receipt of a conjugate vaccine against antigenic determinants that are not related transferrin-binding proteins. Therefore, in other embodiments, implementation of the present invention, the specified transferrin-binding protein can be used as molecule-carrier to obtain chimeric molecules and vaccines conjugates (including glycoconjugates) against pathogenic bacteria, including encapsulated bacteria. For example, the glycoconjugates of the present invention can be used for generating immunity against diseases and infections caused by any bacteria with polysaccharide antigens, including lipooligosaccharide (LOS) and PRP. Such bacterial pathogens can be, for example, Haemophilus influenzae, Streptococcus pneumoniae, Escherichia coli, Neisseria meningitidis, Salmonella typhi, Streptococcus mutans, Cryptococcus neoformans, Klebsiella, Staphytococcus aureus and Pseudomonas aeruginosa. Specific antigens, cat whom I described in application for U.S. patent No. 08/433522 (filed November 23, 1993 (WO 94/12641), and assigned to its successor), which is introduced in the present description by reference.

In another embodiment of the present invention, the function of transferrin-binding protein as a carrier can be used to induce an immune response against abnormal polysaccharides tumor cells, or to produce anti-tumor antibodies, which can be conjugated with a chemotherapeutic or biologically active agents.

The present invention relates to a transferrin-binding protein from Moraxella catarrhalis, which can be used as active ingredient in a vaccine against diseases caused by Moraxella infection. The present invention also relates to a pharmaceutical vaccine composition containing transferrin-binding proteins of Moraxella catarrhalis, and optional pharmaceutically acceptable carrier and/or diluent.

In another aspect the present invention relates to the use of the transferrin-binding proteins for pharmaceutical vaccine composition intended for immunization against disease caused by Moraxella infection.

For every person it is obvious that various variants of this xella, and obtain immunological or other diagnostic reagents. Following is a discussion of non-limiting such applications.

1. The receipt and use of vaccines

Immunogenic compositions, suitable for use as vaccines, can be derived from the immunogenic proteins of the transferrin receptors, their analogues and fragments encoded by the nucleic acid molecules and nucleic acid molecules described in the present application. This vaccine produces an immune response which produces antibodies, including antibodies against the transferrin receptor, and antibodies, which are opsonizing or bactericidal. If a vaccinated individual will be infected Moraxella, antibodies will be contacted with the receptor, thereby blocking the access of bacteria to the source of iron, which is needed for their livelihood. In addition, opsonizing or bactericidal antibodies against the transferrin receptor can also provide protection through alternative mechanisms.

Immunogenic compositions, including vaccines, can be obtained in the form of an injectable liquid solutions or emulsions. Transferrin-binding proteins, their analogs and fragments, and encoding m is compatible with the transferrin-binding proteins, fragments and analogs, or nucleic acid molecules. Such carriers may be water, saline, dextrose, glycerol, ethanol, and combinations thereof. To increase the effectiveness of vaccines, these immunogenic compositions and vaccines may also contain auxiliary ingredients, such as wetting or emulsifying agents, pH-tabularasa agents, or adjuvants. Immunogenic compositions and vaccines can be introduced parenterally by subcutaneous, intradermal or intramuscular injection. Alternatively, the immunogenic compositions of the present invention can be manufactured and introduced to as a result of such introduction was producyrovtsa immune response at the mucosal surface. Thus, the immunogenic composition may be deposited on the surface of the mucous membrane, for example, by intranasal or oral route (through the stomach) introduction. The immunogenic composition may be introduced in combination with a molecule, providing targeted delivery to specific cells of the immune system or to the surface of the mucosa. Some of these delivering molecules are vitamin B12 and fragments of bacterial toxins, operative, you may prefer another way of introduction, including suppositories or oral drugs. To obtain suppositories can be used binders and carriers, for example, polyalkyleneglycol or triglycerides. Oral compositions can include commonly used fillers such as, for example, pharmaceutically pure saccharine, cellulose and magnesium carbonate. These compositions can also be made in the form of solutions, suspensions, tablets, pills, capsules, sustained-release preparations or powders, which contain from about 1 to 95% protein transferrin receptor, fragments, analogs, and/or NK-molecules.

These vaccines are given in a way compatible with this form of the medicinal product, and in such quantity that provides efficiency, protective action and immunogenicity. The amount of preparation depends on the individual being treated, including, for example, the ability of the immune system of that individual to synthesize antibodies, and if necessary, to produce a cell-mediated immune response. The exact amount of active ingredient required for the introduction, can be set by the attending physician. such micrograms of proteins transferrin receptor, its analogs, fragments, and/or NK-molecules. Appropriate schemes for the introduction of primary and booster doses will also vary, and may include the initial introduction and subsequent introduction of booster doses. Dose of the vaccine may also depend on the method of administration, and will vary depending on the body weight of the host.

The nucleic acid molecules encoding the transferrin receptor Moraxella, can be used directly for immunization by direct injection of DNA, for example by injection for genetic immunization, or by constructing "a live vector, such as Salmonella, BCG, adenovirus, poxvirus, vaccinia virus or poliovirus containing NC-molecules. Discussion of some "real" vectors that can be used to Express heterologous antigens to the immune system, is provided, for example, in the work O NADP (see 22). How direct injection of DNA studied individuals for genetic immunization are described, e.g., Ulmer et al. (see 23).

Immunogenicity can be significantly increased by co-administration of antigens with adjuvants normally used in the form of 0.05 to 1.0% solution in phosphate buffered saline solution. Adjuvants increased activate by holding antigen near the site of injection to production depot effect, facilitate prolonged slow release of the antigen towards the cells of the immune system. Adjuvants may also attract cells of the immune system to "antigenic depot and stimulate these cells to the production of an immune response.

Immunostimulatory agents or adjuvants have been used for many years to enhance the immune responses of the host, for example, in response to the introduction of the vaccine. Internal adjuvants, such as liposaccharide usually are components of inactivated or attenuating bacteria that are used as vaccines. External adjuvants are immunomodulators, which are usually ecovalence contact with antigens, and used drugs to enhance the immune response. So, for example, were identified adjuvants that enhance the immune response to the antigen, administered parenterally. However, some of these adjuvants are toxic and can have undesirable side effects, which makes them unsuitable for administration to humans and many animals. Indeed, usually, as an adjuvant for administration to humans and animals in the vaccine is used only aluminum hydroxide and aluminum phosphate (having raspredelennogo of Tokaido well known, and so in HBsAg vaccine adjuvant used alum. Although the effectiveness of alum in some cases is a well-established fact, however, their use is limited. So, for example, alum are ineffective when vaccination against influenza and produce unstable cell-mediated immune response. Antibodies that are produced in mice by antigen-stimulated alum are, in General, isotype IgG1, and may not provide optimal protection when using some vaccine agents.

External adjuvants wide range can stimulate a strong immune response against antigens. Such adjuvants are saponins, which form complexes with membrane protein antigens (immune-stimulating complexes), block copolymers of polyoxyethylene and polyoxypropylene with mineral oil, killed mycobacteria with mineral oil, complete adjuvant's adjuvant, bacterial products, such as muramyldipeptide (TIR) and lipopolysaccharide (LPS) and lipid A, and liposomes.

To efficiently induce humoral immune response (HIR) and cell-mediated immunity (CMI), immunogen often emuleret in adjuvant. Many adjuvants are), the cytolysis (saponins and block copolymers of polyoxyethylene and polyoxypropylene), fever, arthritis and anterior uveitis (LPS and TIR). Although FCA is an excellent adjuvant and is widely used in research, however, it is not licensed for administration to humans or for use in veterinary vaccines because of its toxicity.

Desirable properties of an ideal adjuvants are:

(1) lack of toxicity;

(2) the ability to stimulate long-lasting immune response;

(3) simplicity of manufacture and stability in long-term storage;

(4) the ability to produce cell-mediated (CMI) and humoral (HIR) responses against the antigen, administered in various ways, if necessary;

(5) a synergistic effect in combination with other adjuvants;

(6) the ability to selectively interacting with populations of antigen-presenting cells (APC);

(7) the ability to specific production of the corresponding Tn1 or Tn2-cell-specific immune response; and

(8) ability to selectively increase the levels of the corresponding isotype antibodies (for example, IgA) produced against antigens.

In U.S. patent 4855283 issued Lockhoff N-glycosylamine, N-glycosylation and N-glycosylceramide, each of which is substituted in the sugar residue of the amino acid, and which are used as immune modulators or adjuvants. For example, Lockhoff and others, 1991 (see 24) reported that n-glycolipid analogues with structural similarity to natural glycolipids, such as glycophospholipid and glycopyrrolate able to produce a strong immune response in the vaccine, derived from herpes simplex virus, and vaccines, based on pseudoreligious. Some glycolipids were synthesized from long chain alkylamines followed and fatty acids that are directly related to sugars via the anomeric carbon atom in order to mimic the functions of natural lipid residues.

In U.S. patent 4258029 issued by Moloney et al., and assigned to its successor, which is introduced into the present description by reference, States that the hydrochloride octadecylsilane (REL), formation of its complex with tetanus by toxoid and vaccine derived from formalin inactivated virus of poliomyelitis type I, II and III, functions as an adjuvant. In addition, Nixon-George et al., 1990, (see 25) indicate that octadecylamine esters ar is silifat immune response of the host against the virus of hepatitis C.

2. The immunoassays

Proteins of the transferrin receptor of the present invention, their analogs and/or fragments may be used as immunogens and as antigens in immunoassays including enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and other non-enzyme-linked immunosorbent assay conducted using binding antibodies, or procedures known in the art, and used for detection of antibodies against the protein transferrin receptor Moraxella. In ELISA assays protein transferrin receptor, its analogs or fragments, protein fragments corresponding to the TfR, Immobiliser on the selected surface, for example, on the surface, are able to bind with proteins or peptides, such as polystyrene wall tablet for micrometrology. With the selected surface after washing to remove not fully adsorbed transferrin receptor, its analogs or fragments may be linked to non-specific protein, such as a solution of bovine serum albumin (BSA) or casein, which is known to be antigenically neutral with respect to the subject sample. This allows you to block nonspecific adsorption sites on immobilsarda surface, and caliginous surface is subjected to contact with a sample, such as clinical or biological materials tested for ability to form immune complex (antigen/antibody). This procedure may require dilution of the sample with diluents such as BSA, bovine gamma globulin (BGG) and/or phosphate buffered saline (RW)/twin room. The sample was then incubated for approximately 2-4 hours at a temperature of from about 25 toWith up to 37C. After incubation in contact with the sample surface is washed to remove material which does not form an immune complex. The washing procedure can be performed using a solution, such as, S/twin or borate buffer.

After the formation of specific immune complexes between the test sample and the bound protein transferrin receptor, its analogs and/or fragments, and after washing, frequency, and even the level of education of the immune complexes may be determined by the way in which immunocomplex subjected to interaction with the second antibody, having specificity for the first antibody. If the test sample is from a human, then the "second" antibody is an antibody having specificity to immuno Zhirovoy activity such as, enzymatic activity, which contributes to the generation of, for example, the development of color after incubating with an appropriate chromogenic substrate. Quantitative evaluation can then be carried out by measuring the degree of color development using, for example, a spectrophotometer.

3. The use of sequences as hybridization probes

The nucleotide sequence of the present invention containing the gene sequence of the transferrin receptor, can be used to identify and clone genes transferrin receptor for all species Moraxella.

The nucleotide sequence containing the gene sequence of the transferrin receptor of the present invention, can be used to analyze their ability to selectively form duplex molecules with complementary fragments of other genes TfR. Depending on the purpose of the application can be used in different conditions of hybridization to achieve varying degrees of selectivity of probe towards other genes TfR. To achieve a high degree of selectivity used a relatively stringent conditions to form the duplexes, such as usland src="https://img.russianpatents.com/chr/176.gif">With up to 70C. In some cases, require less stringent conditions of hybridization, such as the presence of 0.15 M To 0.9 M salt, at temperatures ranging from about 20With up to 50C. hybridization Conditions can be made more rigid by adding increasing amounts of formamide to destabilize the hybrid duplex. Thus, the specific conditions of hybridization can be easily achieved by certain manipulations, and their choice mainly depends on the desired results. Usually, the suitable temperature of hybridization in the presence of 50% formamide are: 42For the probe, which is at 95-100% homologous to the fragment-target: 37For probe homologous to 90-95%, and 32For probe homologous to 85-90%.

In clinical diagnostic embodiment of the present invention for assessing hybridization, NC-sequence genes TfR of the present invention can be used in combination with the relevant components, such as a label. Experts know a wide range of indicators for tagging, including radioactive, ferment signal. In some diagnostic options instead of a radioactive label can be used enzymatic label such as alkaline phosphatase or peroxidase. In the case of enzyme tags to identify specific hybridization with samples containing the gene sequence TfR can be used kilometricka indicator substrates are known to provide the production of the signal recorded by the human eye or by using a spectrophotometric instrument.

NC-sequence genes TfR of the present invention can be used as hybridization probes in hybridization solutions and in the case of the use of solid-phase methods. In embodiments of the invention, involving the use of solid-phase methods, the test DNA (or RNA) from samples such as clinical samples, including exudates, body fluids (e.g. serum, amniotic fluid, secretions from the middle ear, sputum, bronchoalveolar lavage), or even fabric, adsorb, or in some other way attached to a selected matrix or surface. Then a fixed one-chain nucleic acid is subjected to specificity is asego of the invention or their fragments in the desired hybridization conditions. The choice of hybridization conditions depends on specific factors, and can be carried out on the basis of exactly the required criteria based, for example, from the content of G+C, type nucleic acid target, source of nucleic acid, size of hybridization probe, etc., After washing the surface for hybridization in order to remove nonspecific molecules linked probes, specific hybridization or even its quantitative level is assessed through a label. While it is preferable to choose those parts of NC sequences that are conservative for different types of Moraxella. The selected probe may have a size of at least 18 p. O., and this amount may vary from about 30 to 90 p. O.

4. Gene expression of transferrin receptor

For gene expression of transferrin receptor in expressing systems can be used plasmid vectors containing replicon and regulatory sequences derived from species compatible with the host-cell. Typically, the vector is a replication site, as well as sequence tags that are capable of providing phenotypic selection in transformed cells. So, for example, E. coli can be transpoted ensures easy identification of transformed cells. Plasmid pBR322 or other microbial plasmid or phage must also contain (or be modified so that they contain) promoters that can be used by the host-cell for the expression of their own proteins.

In addition, phage vectors containing replicon and regulatory sequences that are compatible with the host, can be used as a transformation vector for these owners. For example, the phage in lambda GEM-11 can be used to construct recombinant phage vectors that can be used to transform cells, such as E. coli LE392.

Promoters commonly used in recombinant DNA constructs are promoter system-lactamases (penitsillinazy) and lactose, as well as other bacterial promoters such as the promoter, the T7 system, described in U.S. patent 4952496. The nucleotide sequences of promoters known in detail specialists, allowing them to carry out functional ligation of these promoters from genes. The choice of promoter is usually dependent on the desired results. As hosts, suitable for expiretime E. coli, species of Bacillus, mphilus, fungi, yeast, Moraxella, Bordetella, or baculoviruses.

In accordance with the present invention is particularly preferred ways of getting protein transferrin receptor, its fragment or analogue are recombinant methods as the natural TfR protein isolated from the culture of Moraxella species, may include trace amounts of toxic materials or other impurities. This problem can be solved by using recombinante produced TfR protein in heterologous systems, which can be separated from the host to the presence of impurities in the purified material was minimal. In this connection it is especially preferred hosts for expression are gram-positive bacteria, which do not have LPS, and therefore do not contain endotoxins. Such hosts are species of Bacillus, and they can be successfully used for the production of pyrogen-free transferrin receptor, its fragments or analogs. In addition, recombinant methods of production allow to get Tbp1 or b2 or their respective analogs or fragments, which are separated from each other, which distinguishes them from normal combined proteins present in Moraxella.

Biological transferrin, derived from strains 4223 and Q8 Moraxella catarrhalis and strain RH408 M. catarrhalis, and which are described and identified in this application were before submitting this application deposited under the Budapest Treaty in the American type culture collection (ATS) in the United States at the address 1301 Parklawn Drive, Rockville, Maryland 20852, USA. Samples of the deposited vectors and bacterial strains will be available to any specialist, and restrictions on access to them, will be removed upon issuance of a U.S. patent on this application. In addition, this Deposit will be replaced if the store will not be able to produce viable samples. Scope of the present invention claimed and described in the present application is not limited to deposited biological materials, since these variants of the deposited material is presented merely to illustrate the present invention. Any equivalent or similar vectors, or strains that encode the same or equivalent antigens described in this application are included in the scope of the present invention.

A brief description of the deposited materials

Examples

Above, basically, a General description of the present invention. Konkretnymi examples. These examples are described only for purposes of illustration and should not be construed as a limitation of the scope of the invention. Provided and may be considered suitable shape change and replacement of equivalents. Although this description uses specific terms, however, these terms are merely descriptive and are not intended to limit the present invention.

A description of the methods of molecular genetics, protein biochemistry, and immunology, used but not described in detail in the above description and following examples, can be found in the scientific literature, and these methods may be implemented by any specialist.

Example 1

This example illustrates getting and immunization of Guinea pigs proteins Tbp1 and b2 originating from M. catarrhalis.

Proteins Tbp1 and b2 was prepared as follows.

The crude solid membrane preparations, not containing iron, diluted to a concentration of 4 mg protein/ml in 50 mm Tris-Hcl-1M NaCl, pH 8, in full 384 ml Membrane was solubilizers by adding 8 ml of 0.5 M EDTA and 8 ml of 30% sarkosyl, and then the samples were incubated for 2 hours at room temperature and under mild stirring. Solubilization membrane was centrifuged in those 2 hours at room temperature and under mild shaking. After this mixture was injected into the column. The column was washed with 50 ml of 50 mm Tris-Hcl-1 M NaCl and 250 mm guanidine hydrochloride to remove impurity proteins. b2 was suirable from the column by adding 100 ml of 1.5 M guanidine hydrochloride. Tbpl was suirable by adding 100 ml of 3 M guanidine hydrochloride. The first 20 ml fractions were dialyzed against 3 replacement of 50 mm Tris-HCl, pH 8.0. The samples were stored at -20With, or were dialyzed against ammonium bicarbonate, and liofilizovane.

Guinea pigs (Charles River) were immunized on day +1 by intramuscular injection of 10 μg dose of protein Tbpl or protein b2, emulsified in complete Freund's adjuvant. Animals were subjected to booster immunization at +14 and day +29 day by introducing a similar dose of protein emulsified in incomplete Freund's adjuvant. Blood samples were taken at +42 day, and serum was used for analysis on the bactericidal activity of antibodies. In addition, all antisera was assessed by immunoblot analysis for reactivity with proteins of strain 4223 M. catarrhalis.

Bactericidal activity of antisera Guinea pigs against Tbp1 and b2 4223 M. catarrhalis was determined as follows. Neoglucogenesis strain RH408 M. catarrhalis, derived from isolate 4223, inoculable in 20 ml of BHI broth, and the culture was used for inoculation of 20 ml of BHI broth, to which was added 25 mm Ethylenediamine-di-hydroxyphenylarsonic acid (EDDA; Sigma). This culture was grown to an optical density OD578=0,5. Cells were diluted in the ratio of 1:200000 in buffer containing 140 mm NaCl, 93 mm Manso3, 2 mm barbiturate sodium, 4 mm barbituric acid, 0.5 mm MgCl26N2O, 0.4 mm CaCl22H2O, pH to 7.6 (vironova buffer), and containing 0.1% bovine serum albumin (VBS), and placed on ice. Antisera Guinea pigs against Tbp1 and b2 4223 M. catarrhalis along with previously taken control antisera were heated to 56C for 30 minutes to inactivate endogenous complement. In each well of 96-well plate to micrometrology Nunclon (Nunc, Roskilde, Denmark) were added 2-fold serial dilution of each antisera in VBS. Cultivation was started at 1:8 and brought to a final volume of 25 µl in each well. Then to each well was added 25 μl of the diluted bacterial cells. The Guinea-pig complement (Biowhittaker, Walkers-ville, MD) diluted 1:10 in VBS, and 25 μl aliquots were added to each well. The plates were incubated on a rotary platform when lightly shaken at 70 rpm for 60 minutes Cockeysville, MD). The plates were incubated at 37C for 72 hours and then counted the number of colonies on the plate. Bactericidal titers were estimated as the reciprocal of the highest dilution of antisera capable of destroying more than 50% of the bacteria compared to the control containing non-immune serum. The results, shown in table 1, illustrate the ability of antisera Guinea pigs against Tbp1 and b2 to perform lysis of M. catarrhalis.

Example 2

This example illustrates obtaining chromosomal DNA from strains 4223 and Q8 M. catarrhalis

The isolate M. catarrhalis 4223 was inoculable in 100 ml of BHI broth and then incubated on a shaker for 18 hours at 37C. the Cells were collected by centrifugation at 10000g for 20 minutes. The precipitate after centrifugation was used for extraction of chromosomal DNA from a strain of M. catarrhalis 4223.

Cellular precipitate resuspendable in 20 ml of 10 mm Tris-Hcl (pH 7.5) - 1.0 mm EDTA (TE). Pronase and LTOs were added to final concentrations of 500 μg/ml and 1.0%, respectively, after which the suspension was incubated for 2 hours at 37C. After successive extraction with phenol, phenol:chloroform (1:1), and the mixture is aCl for 4 hours, and against THOSE (pH 7.5) for another 48 hours with three changes of buffer. To dialysate was added 2 volumes of ethanol, and DNA was wound on a glass rod. Then DNA was air dried and dissolved in 3.0 ml of water. The concentrations determined using UV spectrophotometry, was about 290 µg/ml.

Strain Q8 M. catarrhalis were cultured in BHI broth as described in example 1. Cells were besieged from 50 ml of culture by centrifugation at 5000 rpm for 20 minutes at 4C. Cellular precipitate resuspendable in 10 ml of TE (10 mm Tris-HCl, 1 mm EDTA, pH 7.5) and then add the proteinase K and LTOs to final concentrations of 500 μg/ml and 1%, respectively. The sample was incubated at 37C for 4 hours until, until there was obtained a transparent lysate. This lysate was twice extracted with saturated Tris mixture of phenol and chloroform (1:1) and twice with chloroform. The final aqueous phase were dialyzed for 24 hours against 21000 ml of 1 M NaCl at 4With one replacement buffer, and within 24 hours against 21000 ml when THOSE 4With one replacement buffer. The final product of dialysis besieged the two volumes of 100% ethanol. DNA was rolled onto strairway chromosome libraries of M. catarrhalis in EMBL3.

A series of Sau 3A-hydrolysis of chromosomal DNA to obtain hydrolysates in a final volume of 10 µl (each) was performed to optimize the conditions necessary to generate the maximum amounts of restriction fragments with sizes ranging from 15 to 23, etc., of O. using optimized conditions of large-scale hydrolysis hydrolysis was performed in a volume of 100 μl, containing: 50 μl of chromosomal DNA (290 μg/ml), 33 μl water, 10 μl of 10Su3-buffer (New England Biolabs), and 1.0 μl of BSA (10 mg/ml, New England Biolabs), and 6.3 μl Su3 (to 0.04 units/μl). After incubation for 15 minutes at 37With the hydrolysis reaction was stopped by adding 10 µl of a mixture of 100 mm Tris-Hcl (pH 8.0) 10 mm EDTA, and 0.1% bromophenol blue in 50% glycerol (buffer to load). Gidralizovanny DNA was subjected to electrophoresis on a 0.5% agarose gel in 40 mm Tris-acetate, 2 mm Na2EDTA-2H2O (pH 8.5) (TAE-buffer) at 50 V for 6 hours. The area containing restriction fragments with the size of the molecule in the range from 15 to 23, etc., of O., cut out from the gel and placed into a tube for dialysis containing 3.0 ml of TAE buffer. DNA was subjected electroelution from the gel slice by submitting a field strength of 1.0 V/cm for 18 hours. Electroelution DNA is astoral 5.0 ál of water.

Fractionated by size of chromosomal DNA ligated with BamHI-gidrolizovannykh shoulders EMBL3 (Promega) using DNA T4 ligase in a final volume of 9 μl. Solid legirovannoi the mixture was Packed into lambda phage using a commercially available kit packaging (Amersham) according to manufacturer's instructions.

"Packed" library DNA amplified on solid medium. 0.1 ml aliquots of strain NM539 Escherlchia coli in 10 mm MgSO4(So260=0,5) were incubated at 37°C for 15 minutes together with 15-25 μl of "Packed" library DNA. The samples were mixed with 3 ml of 0.6% agarose containing 1.0% peptone trypticase BBL and 0.5% NaCl (top agarose BBL), after which the mixture was seeded on plates with 1.5% agar containing 1.0% peptone trypticase BBL and 0.5% NaCl, and incubated for 18 hours at 37C. In each Cup was added 3 ml of 50 mm Tris-Hcl (pH 7.5) - 8 mm heptahydrate of magnesium sulfate-100 mm NaCl and 0.01% (wt./about.) gelatin (SM buffer), and these cups were left for 7 hours at 4C. the SM Buffer containing phage were collected with cups, combined, and stored in a test tube with screw cap, with 4In the presence of chloroform.

Chromosomal DNA from strain Q8 M. catarrhalis hydrolyzed in femaru 0.6% agarose gel with a low melting point. DNA fragment sizes 15-23 T. p. O. cut out, and DNA was subjected to electroelution in the dialysis tube containing TAE (40 mm Tris-acetate, pH 8.5, 2 mm EDTA) at 150 V for 25 minutes. DNA once were extracted with phenol/chloroform (1:1), besieged, and resuspendable in the water. Then DNA ligated overnight with BamHI-shoulders EMBL3 (Promega), and this legirovannoi the mixture was packaged using an in vitro set packaged in lambda phage (Stratagene), and then were seeded at cells of E. coli LE392. The library was titrated and stored at 4In the presence of 0.3% chloroform.

Example 4

This example illustrates the screening of libraries of M. catarrhalis.

10-Microlitre aliquots of phage source material from a sample EMBL3/4223, obtained as described above in example 3 were combined (each) with 100 μl of strain LE392 E. coli in 10 mm gSO4(So260=0,5) (seeded cells), and incubated at 37C for 15 minutes. The samples were mixed with 3 ml (each) top agarose BBL, and the mixture was poured on the plates with 1.5% agarose containing 1% bakterien - 0,5% backdragging extract - a 0.05% NaCl (agarose LB; Difco), and containing as an additive 200 μm EDDA. The plates were incubated for 18 hours at 37C. Plaques were transferred to bovine serum (BSA; Boehringer) in 20 mm Tris-HCl (pH 7.5) and 150 mm NaCl (TBS) for 30 minutes at room temperature or overnight at a temperature of 4C. the Filters were incubated at least for 1 hour at room temperature, or within 18 hours if 4C in TBS containing 1:1000 dilution of Guinea pig antisera against Tbp1 M. catarrhalis 4223. After four consecutive 10 minute washes in solution S-0.05% tween-20 (TBS-tween), the filters were incubated for 30 minutes at room temperature in a solution of TBS-tween containing a 1/4000 dilution of recombinant protein G, labeled with horseradish peroxidase (rProtein G-HRP; Zymed). Filters were washed as described above and immersed in the substrate solution CN/DAB (Pierce). The manifestation of staining was stopped by immersing the filters in the water. Positive plaques were removed from the tablets, and each was placed in 0.5 ml of SM buffer containing a few drops of chloroform. The screening procedure was repeated 2 more times up until 100% transferred plaques did not become positive, using Guinea-pig antisera against Tbp1 4223 M. catarrhalis.

The EMBL3 library/Q8 were seeded on LE392 cells in tablets with YT using a 0.7% top agar in YT as a covering layer. Plaques PerinoP-dCTP (set for randomized tagging praimirovanie DNA, Random Primed DNA labeling kit, Boehringer Mannheim). Pre-hybridization was carried out in sodium chloride/citrate-sodium (SSC) buffer (see 27) at 37C for 1 h, and hybridization was carried out overnight at 42C. Probes were obtained on the basis of the internal consistency of tbpA 4223:

IRDLTRYDPG

(SEQ ID No: 31)

4236-RD 5'- ATTCGAGACTTAACACGCTATGACCCTGGC -3'

(SEQ ID No: 32)

4237-RD 5'- ATTCGTGATTTAACTCGCTATGACCCTGGT -3'

(SEQ ID No: 33).

Estimated plaques re-planted and prepared for the second and third rounds of screening using similar procedures. Phage clone SLRD-A was used in order to sublimirovanny tfr genes for sequence analysis.

Example 5

This example illustrates an immunoblot analysis of phage lysates using antisera against Tbp1 and b2 4223 M-tarrhalis.

Proteins expressed fagbemi the eluates, selected as described above in example 4, was besieged in the following way. 60 ál of each phage eluate was combined with 200 μl of seeded cells LE392 E. coli, and incubated for 15 minutes at 37C. the Mixture was inoculable in 10 ml of broth, which contains the to which was added 200 mm EDDA, and were cultured at 37C for 18 hours with shaking. To 1.0 ml of culture was added to Tnkase to a final concentration of 50 μg/ml and the sample incubated at 37 ° C for 30 minutes. After this was added trichloroacetic acid to a final concentration of 12.5%, and the mixture was left on ice for 15 minutes. Proteins were besieged by centrifugation at 13,000g for 10 minutes and the precipitate after centrifugation was washed with 1.0 ml of acetone. The precipitate was dried by air and resuspendable in 50 μl of 4% of the LTO - 20 mm Tris-Hcl (pH 8.0) and 0.2 mm EDTA (buffer for lysis).

After electrophoresis 11.5% polyacrylamide gel with LTOs proteins were transferred to filters Immobilon-P (Millipore) in 25 mm Tris-HCl - 220 mm glycine, 20% methanol (buffer for transfer) for 18 hours at a constant voltage of 20 C. the Membrane was blocked in 5% BSA in TBS for 30 minutes at room temperature. The blots were exposed or anticorodal Guinea pigs against Tbp1 4223 M. catarrhalis, or anticorodal Guinea pigs against b2 M. catarrhalis 4223, diluted 1:500 in TBS-tween for 2 hours at room temperature. After conducting three consecutive 10 minute washes in TBS-tween, membranes were incubated in S-twin, containing ri temperature. Membranes were washed as described above and immersed in the substrate solution CN/DAB. The manifestation of staining was stopped by immersing the blots in the water.

Three phage EMBL3 clone expressed a 115 kDa protein that reacted with anticorodal against Tbp1, and 80 kDa protein that reacted with anticorodal against b2 on Western-blots, which confirmed the presence of these clones genes encoding proteins of the transferrin receptor Moraxella catarhallis.

Example 6

This example illustrates subclavian tbpA gene protein Tbp1 M. catarrhalis 4223.

Cropped lysates of the cultures of recombinant phage as described in example 5, was obtained by combining phage eluate seeded cells LE392 E. coli in order to produce confluent lysis on plates with LB-agar. Phage DNA was extracted from seeded lysates using a DNA purification system Wizard Lambda Preps DNA Purification System (Promega) according to manufacturer's instructions.

It was found that the clone LM3-24 EMBL3 includes a box the size of 13.2, etc., of O., flanked by two SalI sites. Was received probe for tbpA gene, which was amplified from 300 p. O. - product generated by PCR using two degenerate oligonucleotide primers corresponding to aminokislot is the shaft sequences NEVTGLG (SEQ ID No: 17) and GAINEIE (SEQ ID No: 18), which, as it was discovered, was conservative for amino acid sequences inferred from the tbpA gene sequences from several different strains of N. meningitidis and mphilus influenzae. Amplificatory product was cloned into pCRII (Invitrogen, San Diego, CA) and sequenced. Deduced amino acid sequence was homologous to other putative amino acid sequences derived from genes tbpA N. meningitidis and N. influenzae (Fig.12). Subclan was linearizable enzyme Notl (New England Biolabs) and were labeled with a set for randomized labelling digoxigenin (Boehringer Mannheim) according to manufacturer's instructions. The concentration of the probe, as it was estimated, was 2 ng/µl.

DNA from phage clone hydrolyzed by the enzymes HindIII, AvrII, SalI/SphI, or SalI/AvrII, and were subjected to electrophoresis on 0.8% agarose gel, DNA was transferred to nylon membrane (Genescreen Plus, Dupont) using a device for vacuum transfer LKB VacuGene XL (Pharmacia). After transfer, the blot was dried by air, and previously was hybridisable in a solution containing 5X SSC and 0.1% N-lauroylsarcosine - a 0.02%, sodium dodecyl sulphate and 0.1% blocking reagent (Boehringer Mannheim) in 10 mm maleic acid - 15 mm NaCl (pH 7.5) (solution for predentistry 6 ng/ml, and the blot incubated in a solution of the probe for 18 hours at 42C. the Blot was twice washed in 2X SSC - 0.1% of LTOs for 5 minutes at room temperature, and then washed twice in 0.1 X SSC - 0.1% of LTOs for 15 minutes at a temperature of 60C. After washes, the membrane was balanced in 100 mm maleic acid 150 mm NaCl (pH 7.5) buffer (buffer 1) for 1 minute and then left in buffer 1 or buffer 2) containing a 1.0% blocking reagent (Boehringer Mannheim) for 60 minutes at room temperature. Blot exhibited conjugate antibody against DIG with alkaline phosphatase (Boehringer Mannheim), diluted 1/5000 in buffer 2 for 30 minutes at room temperature. After two 15-minute washes in buffer 1, the blot was balanced in 100 mm Tris-Hcl (pH 9,5), 100 mm NaCl, 50 mm MgCl2(buffer 3) for 2 minutes. Blot moistened substrate Lumigen PPD (Boehringer Mannheim), diluted 1/100 in the buffer 3, and then wrapped in Saran wrapping paper, and exposed to x-ray film for 30 minutes. The probe was hybridisable 3.8 T. p. O. HindIII-HindIII-, 2,0, etc., O. AvrII-AvrII-, and 4.2 tonnes p. O. SalI-SphI fragment.

For sublimirovanny of 3.8 T. p. O. HindIII-HindIII fragment into pACYC177, phage DNA from the EMBL3 clone and plasmid DNA from the vector pACYC177 (New England Biolabs) gidrolizom the NT phage and 3.9, etc., of O. -HindIII-HindIII fragment of pACYC177 cut out from the gel and purified using the kit Geneclean kit (Bio 101 Inc., La Jolla, CA) according to manufacturer's instructions. The purified insert and vector are ligated together using DNA T4 ligase (New England Biolabs), and transformed into NEW E. coli (Gibco BRL). For extraction and high-quality from the point of view of sequencing DNA purification from one resistant to ampicillin/susceptible to kanamycin of transformants, which, as it was discovered, is of 3.8 T. p. O. HindIII-HindIII insert was used kit Qiagen Plasmid Midi kit (Qiagen). This subclone was marked L3. As described below in example 7, followed by sequencing revealed that L3 contains the first approximately 2.0, etc., on the sequence tbpA (Fig.2 and 5).

For sublimirovanny remaining 1 T. p. O. tbpA gene, 1,6, etc., on-HindIII-HindIII fragment was subcloned into pACYC177, as described above, and transformed by electroporation into NV E. coli (Gibco BRL). For extraction of plasmid DNA from the alleged transformant susceptible to kanamycin and carrying a plasmid with 1.6 T. p. O.-HindIII-HindIII-insert, used set containing plasmid DNA Midi kit (Qiagen). This subclone was marked pLEM25. As described below in example 7, sequencing revealed that pLEM25 contains octavias is described above, all kinds of Neisseriae and Haemophilus examined until the present invention, it was found that tbpB genes are located directly above tbpA genes that have homology with the genome of tbpA M. catarrhalis 4223. However, the sequence above M. catarrhalis 4223, does not match other sequences coding for tbpB.

To determine the localization of the tbpB gene in phage EMBL3 clone was performed southern blot analysis using degenerate probe from a highly conservative region amino acid sequence of the protein Tbp2. Was designed degenerate oligonucleotide probe corresponding to a sequence that encodes a EGGFYGP (SEQ ID No: 30), which is conservative in the protein Tbp2 in various types of Neisseriae and mphilus. The probe was labelled with digoxigenin using the kit to attach the oligonucleotides (Boehringer Mannheim) according to manufacturer's instructions. Clone DNA EMBL3, hydrolyzed by the enzyme HindIII was fractionally 0.8% agarose gel, and transferred to nylon membrane Geneclean Plus as described in example 6. After the hybridization, as described above, the double-membrane was washed in 2X SSC - 0.1% of LTOs (each time) for 5 minutes at room temperature, and then washed twice in 0.1% SSC and 0.1% LTOs (everyone who was desirable from 5.5 T. p. O. -NheI-SalI fragment.

5,5, etc., O.-NheI-SalI fragment was subcloned into pBR328 as follows. DNA LEM3-24 and pBR328 DNA hydrolyzed by the enzyme NheI-SalI, and was subjected to electrophoresis on 0.8% agarose. 5,5, etc., O.-NheI-SalI fragment and 4.9, etc., O.-NheI-SalI fragments pBR328 cut out from the gel and purified using Geneclean kit kit, as described in example 6. Fragments ligated together using DNA T4 ligase, and transformed into E. coli DH5. For extraction of DNA from resistant to ampicillin/sensitive to tetracycline clone containing 5.5 T. p. O.-NheI-SalI-box, used a set of Midi Plasmid, DNA kit (Quagen). This subclan meant pLEM23. In the sequencing revealed that pLEM23 contains 2 T. p. O. tbpB gene from 4223 M. catarrhalis (Fig.2).

Example 8

This example illustrates subclavian genes tfr Q8 M. catarrhalis.

Genes tfr Q8 M. catarrhalis was subclinically as follows. Phage DNA was obtained from tablets. To do this, the top layer of agarose three tablets with confluent culture was scraped in 9 ml of SM buffer (0.1 M NaCl, And 0.2% MgSO4, 50 mm Tris-HCl, pH 7,6, of 0.01% gelatin) was added 100 μl of chloroform. The resulting mixture was subjected to vortex mixing for 10 seconds and then incubated at room temperature for 2 hours. Cellular debris delete the Sorvall RC5C). Then the phage besieged by centrifugation at 35000 rpm on the rotor 70.1 Ti when 10C for 2 hours (Beckman model L8-80), and resuspendable in 500 μl of SM buffer. The sample was incubated overnight at 4With, and then was added to the RNase and Tenkasu to a final concentration of 40 μg/ml and 10 µg/ml, respectively, and the mixture is incubated for one hour at 37C. To the mixture was added 10 μl of 0.5 M EDTA and 5 μl of 10% LTOs, after which, the sample was incubated for 15 minutes at a temperature of 6C. the resulting mixture was extracted twice with phenol/chloroform (1:1) and twice with chloroform, and then DNA was besieged by adding 2.5 volumes of absolute ethanol.

By partial hydrolysis of the received restriction map, and the fragments were subclinically using external SalI sites from the EMBL3 and internal AvrII - or EcoRI-sites, as indicated in Fig.4. In order to facilitate sublimirovanny plasmid pSKMA designed by introducing a new multiple cloning site in the pBluescript SK (Stratagene). To introduce restriction Mst II, Sfi I and AvrII sites between the SalI and HindIII sites pBluescript SK oligonucleotides were used:

Plasmid pSLAvrII-fragments, cloned in S, respectively, and contain the complete gene tbpA. Plasmid pSLRDS contained ~2,3, etc., O.-AvrII-EcoRV1-fragment, cloned in S and plasmid SLRD5 represented 22,7, etc., O.-EcoRI-RI-fragment, cloned in S. These two clones contained full tbpB gene (Fig.7).

Example 9

This example illustrates the sequencing of genes tbp M. catarrhalis.

Both chain genes tbp, subcloned as described in examples 6-8, sequenced using DNA sequencing machine Applied Biosystems. The sequences of genes tbpA Q8 and 4223 M. catarrhalis shown in Fig.5 and 10, respectively. The obtained amino acid sequence was compared with other amino acid sequences Tbp1, including sequences Tbp1 Neisseriae meningitidis, Neisseriae gonorrhoeae, and Haemophilus influenzae (Fig.12). Sequence tbpB genes Q8 and 4223 M. catarrhalis shown in Fig.6 and 11, respectively. To obtain the anticipated start of the tbpB gene M. catarrhalis 4223, data for this sequence were obtained directly from the DNA of clone LEM3-24. This sequence was confirmed by sequencing of clone DS-1754-1. The translated sequence tbpB genes from 4223 and Q8 M. catarrhalis was derived homologous amino acid sequences b2 from Neisseria meningitidis, Neisser for producing recombinant protein Tbp1. The circuit design shown in Fig.14.

Plasmid DNA from subclone L3, obtained as described in example 6, hydrolyzed by enzymes HindIII and BglI to generate 1,84, etc., O.-glI-HindIII fragment, containing approximately two-thirds of the tbpA gene. Avoid co-emigratsii 1,89, etc., O.-glI-HindIII fragment of the vector, the hydrolysate was added BamHI. In addition, plasmid DNA from the vector RT-7 hydrolyzed by enzymes NdeI and HindIII. To construct the beginning of the tbpA gene synthesized oligonucleotide based on the first 61 grounds tbpA gene to BglI site; Ndel site included in the 5'-end. Purified insert, vector and oligonucleotide ligated together using T4 ligase (New England Biolabs), and transformed into DH5E. coli. DNA was purified from one of 4,4 T. p. O. - transformants resistant to ampicillin, and containing the appropriate restriction sites (pLEM27).

Purified DNA pLEM27 hydrolyzed by the enzyme HindIII, ligated 1.6 T. p. O. - HindIII-HindIII-fragment-insertion pLEM25, obtained as described in example 6, and transformed into DH5E. coli. DNA was purified from resistant to ampicillin of transformant containing the appropriate restriction sites (pLEM-29), and transformed by electroporation into BL21 (DE3) (Novagen; Madison, WI) with producerof is on YT, containing 100 μg/ml ampicillin, and the culture was grown on a shaker at 200 rpm overnight at 37C. 200 μl of the overnight culture was inoculable in 10 ml of YT broth containing 100 μg/ml ampicillin, and the culture was grown at 37 ° To achieve OP578=0,35. The culture was induced by adding 30 ál of 100 mm IPTG, and then cultivated at 37C for another 3 hours. One milliliter of the culture was removed at the time of induction (0 hours) and 1 hour (t=1) and 3 hours (t=3) after induction. One milliliter samples were besieged by centrifugation, and resuspendable 4% LTOs 20 mm Tris-HCl, pH 8, 200 mm EDTA (buffer for lysis). Samples were fractionally by electrophoresis 11.5% SDS page with LTOs, and transferred to filters Immunobilon (Amersham). The blots showed using antisera against Tbp1 (4223 M. catarrhalis) as "first" antibody at a dilution of 1:1000, and recombinant protein G conjugated to horseradish peroxidase (Zymed) as the second antibody. For detection was used chemiluminescent substrate (Lumiglo; Kirkegaard and Perry Laboratories, Gaithersburg, MD) Induced recombinant proteins were visible on the gel, colored Kumasi (Fig.15). Anticavity € extraction and purification of the recombinant Tbp1 protein from strain 4223 M. catarrhalis.

Recombinant Tbp1 protein, which is contained in inclusion bodies, purified from E. coli cells expressing the gene of tbpA (example 10), the method shown in Fig.16. E. coli cells from a 500 ml culture obtained as described in example 10, resuspendable in 50 ml of 50 mm Tris-HCl, pH 8.0, containing 0.1 M NaCl and 5 mm AEBSF (protease inhibitor), and was destroyed by treatment with ultrasound (310 min, duty cycle 70%). The extract was centrifuged at 20000g for 30 minutes and the resulting supernatant, which contained >85% of the soluble proteins from E. coli, were discarded.

After that, the remaining sediment (Fig.16, PPT1) were extracted in 50 ml of 50 mm Tris, pH 8.0, containing 0.5% Triton X-100 and 10 mm EDTA. After centrifugation at 20000g for 30 minutes, the supernatant containing residual soluble proteins and most of the membrane proteins was discarded.

Then the remaining sediment (Fig.16, PPT2) were extracted in 50 ml of 50 mm Tris (pH 8.0) containing 2 M urea and 5 mm dithiothreitol (DTT). After centrifugation at 20000g for 30 minutes, the precipitate (Fig.16, RRT3) received after the above extraction, contained purified calf enable.

Protein Tbp1 slyvania obtained supernatant, in addition, purified by gel filtration on a column of Superdex 200, equilibrated in 50 mm Tris (pH 8.0) containing 2 M guanidine hydrochloride and 5 mm DTT. Fractions were analyzed by electrophoresis on SDS page with LTOs, and those fractions that contained the purified protein Tbp1, together. To the combined fractions of protein Tbp1 was added Triton X-100 to a final concentration of 0.1%. Then the fractions were dialyzed overnight at 4C against 50 mm Tris, pH 8.0, and then centrifuged at 20000g for 30 minutes. Protein remaining soluble under these conditions, and purified Tbp1 protein was stored at -20C. after the treatment are shown in Fig.16, was produced protein Tbp1, which had at least 70% purity, as determined by electrophoresis on SDS page with LTOs (Fig.17).

Example 12

This example illustrates the construction of expression plasmids for rTbp2 from 4223 M. catarrhalis without leader sequence.

Scheme construction of plasmid expressing rTbp2 shown in Fig.18. To construct the first approximately 58 p. O. tbpB gene 4223 M. catarrhalis encoding the Mature protein were used oligonucleotides. In the 5'end of these oligonucleotides was included NdeI-site:

5'TATG approximately 1 T. p. O. tbpB gene from pLEM23, obtained as described in example 7, ligated with the above oligonucleotides, and was built in RT-7 cut by the enzyme NdeI-ClaI, which led to the formation of plasmid pLEM31, which contained the 5'-half of tbpB. The oligonucleotides were also used to construct the last approximately 104 p. O. tbpB gene from the AvaII site until the end of the gene. In the 3'-end of oligonucleotides was included BamHI-site:

5'GTCCAAATGCAAACGAGATGGGCGGGTCATTTACACACAACGCCGATG ACAGCAAAGCCTCTGTGGTCTTTGGCACAAAAAGACAACAAGAAGTTAAGTAGTAG (SEQ ID NO: 38) 3'

3'GTTTACGTTTGCTCTACCCGCCCAGTAAATGTGTGTTGCGGCTACTGTC GTTTCGGAGACACCAGAAACCGTGTTTTTCTGTTGTTCTTCAATTCATCATCCTAG (SEQ ID NO: 39) 5'

ClaI-AvaII fragment of pLEM23 containing approximately 0,9 etc., O. 3'-end of the tbpB gene, ligated with AvaII-BamHI-oligonucleotides, and was built in plasmid RT-7 cut by the enzyme ClaI-BamHI, which led to the formation of pLEM32. After that, 1,0, etc., O.-NdeI-ClaI-box of pLEM31 and 1.0 T. p. O.-laI-AMN-box of pLEM32, built in RT-7 cut by enzymes NdeI-BamHI, and received pLEM33, which had a full size tbpB gene under control of T7 promoter.

DNA was purified from pLEM33 and transformed by electroporation into electrocompetent cells BL21 (D3) (Novagen; Madison, WI) to generate strain pLEM33B-1. Strain pLEM33B-1 were cultured and induced using IPTG as described above in the example of the La Western blot turns. The blots showed using antisera against b2 4223, diluted 1:4000, as the "first" antibody and recombinant protein G conjugated to horseradish peroxidase (Zymed) as the second antibody. For detection was used chemiluminescent substrate (Lumiglo; Kirkegaard and Perry Laboratories, Gaithersburg, MD). Induced recombinant proteins were visible on the gels, colored Kumasi blue (Fig.19). Anticavity against b2 4223 recognize recombinant proteins on Western-blots.

Example 13

This example illustrates the construction of expression plasmids for rb2 from 4223 M. catarrhalis, having a leader sequence.

The circuit design shown in Fig.18. To construct the first approximately 115 p. O. tbpB gene to NheI site were used oligonucleotides containing natural leader sequence of the tbpB gene M. catarrhalis 4223. In the 5'end of these oligonucleotides included NdeI-site:

5'TATGAAACACATTCCTTTAACCACACTGTGTGTGGCAATCTCTGCCGTC TTATTAACCGCTTGTGGTGGCAGTGGTGGTTCAAATCCACCTGCTCCTACGCCCATTCCAAATG (SEQ ID NO: 40) 3'

3' ACTTTGTGTAAGGAAATTGGTGTGACACACACCGTTAGAGACGGCAGAA TAATTGGCGAACACCACCGTCACCACCAAGTTTAGGTGGACGAGGATGCGGGTAAGGTTTACGATC (SEQ ID NO: 41) 5'

NdeI-NheI-oligonucleotides ligated with pLEM33 cut by enzymes NdeI-NheI, which led to the generation pLEM-37, which contained a full-sized GE is imali and transformed by electroporation into electrocompetent cells BL21 (DE3) (Novagen; Madison, WI) to generate strain pLEM37-B-2. pLEM37B-2 were cultured and induced using IPTG as described above in example 10. Expressed proteins were separated by electrophoresis in SDS page with LTOs, and transferred to membranes suitable for Western blot turns. The blots showed using antisera against b2 4223, diluted 1:4000, as first antibodies, and recombinant protein G conjugated to horseradish peroxidase (Zymed) as the second antibody. For detection used chemiluminescent substrate (Lumiglo; Kirkegaard and Perry Laboratories, Gaithersburg, MD). Induced recombinant proteins were visible on the gels, colored Kumasi blue (Fig.21).

Anticavity against Tbp2 4223 recognize recombinant proteins on Western-blots.

Example 14

This example illustrates the construction of expression plasmids for rb2 from Q8 M. catarrhalis without leader sequence.

Scheme design for b2 shown in Fig.20. 5'-end of the tbpB gene Q8 M. catarrhalis was PCR-amplified from codon ys1the Mature protein to the restriction Bsm 1 site. In the 5'-end for subsequent cloning in RT-7, introduced a Ndel restriction site, and this final PCR fragment had a length of 238 p. O. PCR primers are shown below:

Example 15

This example illustrates the construction of expression plasmids for rb2 from Q8 M. catarrhalis together with its leader sequence.

Scheme design for b2 shown in Fig.20. 5'-end of the tbpB gene Q8 was PCR-amplified from the start codon ATG to restrictionsonly PCR fragment had a length of 295 p. O. PCR primers are shown below:

SLRD3-5 (example 14) hydrolyzed by enzymes BsmI and BamHI to generate 1,85 T. p. O. fragment, ligated with 295 p. O. - PCR-fragment, and then ligated into the vector RT-7, hydrolyzed by enzymes NdeI and BamHI. The obtained plasmid SLRD35A contained a full-sized tbpB gene Q8 together with its endogenous leader sequence under the control of T7 promoter. DNA from SLRD35A was purified and transformed by electroporation into electrocompetent cells BL21 (DE3), the resulting strain SLRD35AD, which is then cultured and induced using IPTG as described above in example 10. Expressed proteins were separated by electrophoresis on SDS page with LTOs, and induced protein b2 was clearly visible visually after staining Kumasi blue (Fig.19).

Example 16

This example illustrates the extraction and purification rb2 4223 and Q8 M. catarrhalis from E. coli.

Transformants pLEM37B (4223) and SLRD35AD (Q8) were cultured for producing b2 in inclusion bodies, and then b2 was purified in accordance with the scheme shown in Fig.22. E. coli cells from a 500 ml culture resuspendable in 50 ml of 50 mm solution of Tris-HCl, pH 8.0, containing 5 mm AEBSF (protease inhibitor), and was destroyed by p://img.russianpatents.com/chr/215.gif">g for 30 minutes and the resulting supernatant, containing >95% of the soluble proteins from E. coli, were discarded.

Then the remaining precipitate (PPT1) were extracted in 50 ml of 50 mm Tris, pH 8.0, containing 0.5% Triton X-100 and 10 mm EDTA. The mixture was stirred at 4C for at least 2 hours, and then centrifuged at 20000g for 30 minutes, and the supernatant containing residual soluble proteins and most of the membrane proteins was discarded.

The precipitate (PPT2) obtained by the above extraction, contained bullock inclusion. Protein b2 was solubilizers in 50 mm Tris, pH 8.0, containing 6 M guanidine and 5 mm DTT. After centrifugation of the resulting supernatant was purified using gel filtration on a column of Superdex 200, equilibrated in 50 mm Tris, pH 8.0, containing 2 M guanidine and 5 mm DTT. Fractions were analyzed by electrophoresis on SDS page with LTOs, and those fractions that contained the purified protein b2, together. This combined fractions b2 was added Triton X-100 to a final concentration of 0.1%. After this fraction were dialyzed against PBS overnight at a temperature of 4C and centrifuged at 200000C. In Fig.22 shows LTO-SDS page analysis of fractions after purification procedure rb2 from strain 4223 (Panel a) and strain Q8 (Panel B). rb2 had at least 70% purity.

Groups of five BALB/c mice three times subcutaneously (s.with.) were injected with 1-, 29 -, and 43-day cleared b2 (0.3 mg to 10 mg) of strains 4223 and Q8 M. catarrhalis in the presence or absence of lO4(1/5 mg per dose). Blood samples were taken on day 14, 28, 42 and 56 for the analysis of antibody titers against rb2 by ELISA.

Groups of two rabbits and two Guinea pigs (Charles River, Quebec) were immunized intramuscularly (i.m.) on day 1 by introducing a 5 mg dose of purified protein rb2, emulsified in complete Freund's adjuvant (CFA). Animals were subjected to booster immunization on the 14th and the 29th day through the introduction of a similar dose of protein emulsified in incomplete Freund's adjuvant (IFA). Blood samples were taken on the 42nd day for analysis of antibody titers against rTbp2 and bactericidal activity. Table 2 shows the bactericidal activity of antibodies produced against the transferrin-binding recombinant proteins rTbp1 (4223), rTbp2 (4223) and rTbp2 (Q8), obtained as described in these examples, against strains 4223 and Q8 M. catarrhalis.

Example 17

This example illustrates the binding b2 with human transferrin in vitro.

T is s some modifications. To do this, peeled rTbp2 were subjected to electrophoresis in a discontinuous double layer of 12.5% SDS page-ordinator. Protein electrophoresis were transferred to a PVDF membrane, and incubated with human transferrin, conjugated with horseradish peroxidase (HRP-transferrin human, dilution 1:50) (Jackson Measurement Research Labs Inc., Mississauga, Ontario), overnight at 4C. For chemiluminescent detection of HRP activity was using the LumiGLO substrate (Kirkegaard & Perry Laboratories, Inc., Gaithersburg, MD) according to manufacturer's instructions. In these conditions, as rTbp2 4223 and rTbp2 Q8 been associated with human transferrin, as shown in Fig.24

Example 18

This example illustrates antigenic conservatism protein b2 for strains of M. catarrhalis.

Whole cell lysates of strains of M. catarrhalis and strains of E. coli expressing recombinant proteins b2, was isolated by electrophoresis on SDS page with LTOs, and electrophoresis were transferred to a PVDF membrane. For detection b2 as the "first" antibody was used anticavity Guinea pigs against rTbp2 4223 or against rTbp2 Q8, and as a "second" antibody was used conjugated with alkaline phosphatase goat antibody against immunoglobulin of Guinea pigs. Were tested strains 3, 56, 135, 585, 4223,bp2 4223 or against rTbp2 Q8 (Fig.25).

Table 3 illustrates the ability of antibodies against rTbp2 from one strain of M. catarrhalis to recognize native or recombinant protein derived from homologous or heterologous strains of M. catarrhalis.

Example 19

This example illustrates PCR amplification tbpB gene from strain R1 M. catarrhalis and characterization of the amplified gene tbpB R1.

Chromosomal DNA from strain R1 M. catarrhalis were obtained by standard methods. Oligonucleotide sense primer designed on the basis of the area constituting approximately 274 grounds above the tbpB gene M. catarrhalis 4223, and the antisense primer was designed on the basis of the area constituting approximately 11 grounds, located below the end of the tbpB gene 4223. We used the following primers:

Sense primer (4940): 5'-GATATAAGCACGCCCTACTT-3' (SEQ ID No: 48)

Antisense primer (4967): 5'-CCCATCAGCCAAACAAACATTGTGT-3' (SEQ ID No: 49)

Each reaction tube contained 10 mm Tris-HCl (pH cent to 8.85), 25 mm KCl, 5 mm (NH4)2SO4, 2 mm MgSO4, 800 mm dNTP, 1.0 mg of each of the primers 4940 and 4967, 10 ng DNA R1, and 2.5 units of DNA polymerase Pwo (Boehringer Mannheim) in a total volume of 100 μl. Have established the following temperature cycle: the first cycle of 5 minutes at 95With subsequent 25 cycles: 30 76.gif">With, and an additional cycle of 10 minutes at 72°C. Amplificatory product was purified using the Geneclean kit (BIO 101) in accordance with the manufacturer's instructions, and then sequenced.

Restriction map of tbpB strain R1 M. catarrhalis, obtained by partial hydrolysis, as described above, is shown in Fig.26. Nucleotide and deduced amino acid sequence of PCR-amplified gene tbpB R1 shown in Fig.27. TbpB gene R1 encodes a protein of 714 amino acids, having a molecular weight of 76.8 kDa. Leader sequence of the protein Tbp2 R1 is identical to the leader sequence of proteins b2 strains 4223 and Q8. When comparing the derived primary sequence of Tbp2 R1 with the primary sequence of Tbp2 4223 it was found that they have an identity of 83% and the homology of 88% (Fig.28). As it was found in Tbp2 proteins from other strains of M. catarrhalis, and Tbp2 proteins from H. influenzae and N. meningitidis is a conservative epitope LEGGFYG (SEQ ID No: 50).

Summary of the invention

In its essence, the present invention relates to the production of purified and selected DNA molecules that contain the genes of the protein transferrin receptor Moraxella catarrhalis; the sequences of these genes, encoding a protein receptor transferleri for the diagnosis, immunization and obtain diagnostic and immunological reagents. To prevent disease caused by Moraxella can be obtained immunogenic compositions, including vaccines produced on the basis of expressed recombinant proteins Tbp1 and Tbp2, their fragments, or analogs. Possible modifications without leaving the scope of the present invention.

Antibody titers were expressed as log2dilution of antisera capable of destroying 50% of the cells. NT = not tested.

Claims

1. Purified and selected nucleic acid molecule encoding a protein transferrin receptor bacteria Moraxella catarrhalis, or immunogenic fragment transferrin receptor, having a nucleotide sequence selected from the group comprising (a) DNA sequence shown in Fig.5, 6, 10, 11, or 27 (SEQ ID No:1, 2, 3, 4, 5, 6, 7, 8, 45 or 46), or she complementary DNA sequence; (b) a DNA sequence encoding the amino acid sequence prestant sequence, encoding a protein transferrin receptor strain of Moraxella catarrhalis and hybridization in stringent conditions with the DNA sequence specified in paras.(a) and (b).

2. Plasmid vector adapted for transformation of a host comprising a DNA molecule under item 1.

3. Vector for p. 2, characterized in that it has the properties of a plasmid selected from the group comprising pLEM3, pLEM25, pLEM23, DS-1698-1-1, DS-1754-1, p3LRD2, p3LRD3, p3LRD4, pSLRD5, pLEM-29, pLEM-33, pLEM-37, SLRD35-A and SLRD35.

4. Vector under item 3, characterized in that it further comprises expression element, operatively attached to a molecule of nucleic acid under item 1 or 2, for the expression of the owner of the specified protein or immunogenic fragment.

5. Vector for p. 4, entered in a unicellular host, in which this protein is expressed.

6. A method of obtaining a recombinant protein transferrin receptor bacteria Moraxella catarrhalis or immunogenic fragment, characterized in that it includes the transformation of the unicellular host DNA under item 1, the cultivation of the transformed host, expression of the protein transferrin receptor or its immunogenic fragment in the form of Taurus on and cleanup.

7. The method according to p. 6, characterized in that the protein transferrin receptor keep the Torah transferrin has at least about 70% purity.

9. The method according to p. 6 or 7, characterized in that the protein transferrin receptor has at least about 90% purity.

10. Recombinant protein transferrin receptor bacteria Moraxella catarrhalis or immunogenic fragment with the amino acid sequence shown in Fig.5, 6, 10, 11, or 27 (SEQ ID NO 9, 10, 11, 12, 13, 14, 15, 16 47).

11. Immunogenic composition for the prevention of diseases caused by the bacteria Moraxella catarrhalis, characterized in that it contains DNA under item 1 and a pharmaceutically acceptable carrier.

12. Immunogenic composition for the prevention of diseases caused by the bacteria Moraxella catarrhalis, characterized in that it contains recombinant protein transferrin receptor bacteria Moraxella catarrhalis or immunogenic fragment under item 10 and a pharmaceutically acceptable carrier.

13. The method of detecting the presence in the sample of nucleic acid that encodes a protein transferrin receptor bacteria Moraxella, characterized in that it comprises the following stages: (a) contacting the sample with a nucleic acid molecule under item 1 for producing duplex containing the nucleic acid molecule and any specified nucleic acid molecule, coderus; (b) determining production of duplexes.

14. Diagnostic kit for detecting the presence in the sample of nucleic acid that encodes a protein transferrin receptor bacteria Moraxella, characterized in that the kit includes (a) a nucleic acid molecule under item 1; (b) means for contacting the nucleic acid molecule with the sample to produce duplexes containing the nucleic acid molecule and any specified nucleic acid molecule present in the sample and specifically hybridizers; (c) means for determining the production of duplexes.

 

Same patents:

The invention relates to the field of Oncology

The invention relates to medicine

The invention relates to genetic engineering, specifically to the technology of phage display, and can be used for selection of bacteriophages expressing peptides and proteins that bind to receptors on the cell surface and internalized

The invention relates to medicine, namely to ophthalmology, and is intended for early detection of glaucoma.

The invention relates to medicine, namely to methods of forecasting in the field of traumatology and critical care medicine

The invention relates to medicine, namely to infectious diseases, and is intended to determine the feasibility of destination emoxipin in the treatment of erysipelas

The invention relates to medicine, namely to dentistry

The invention relates to medicine, namely to pulmonology, and can be used for rapid diagnosis of the severity of chronic obstructive bronchitis

The invention relates to medicine, namely to methods for predicting in surgery

The invention relates to medicine, in particular to obstetrics

The invention relates to the field of genetic engineering and can be used in the biomedical industry

The invention relates to biotechnology and can be used to produce recombinant human insulin that is used for the preparation of drugs for the treatment of diabetes

The invention relates to the production of endostatin mouse and man

The invention relates to genetic engineering

-glucanase encoding his dna and method thereof" target="_blank">

The invention relates to the field of production of enzyme preparations by means of genetic engineering and can be used in biotechnological processes and microbiological industry
Up!