A synthetic gene encoding green fluorescent protein, a method of obtaining a gene expressing vector, a method of obtaining a culture of cells

 

The invention relates to genetic engineering. A new synthetic gene that encodes green fluorescent protein. The proposed gene is characterized by the replacement non-preferred or less preferred codons preferred codons. While the preferred codons are a group of gcc, cgc, aac, gac tgc, cag ggc, cac, atc, ctg, aag, ccc, ttc, agc, acc, tac and gtg, but less preferred are ggg, att, ctc, tcc, and agg gtc, and non-preferred codons represent the remaining codons. A new synthetic gene is characterized by the ability to Express the green fluorescent protein level 110-1000% of the level of expression of a natural gene. Also proposed is a method of obtaining synthetic gene green fluorescent protein. The method involves defining a non-preferred or less preferred codons in the natural gene and replacing one or more codons preferred codons encoding the same amino acid as the replaced codon. Offered also expressing a vector containing a synthetic gene, and the method for the culture of mammalian cells carrying the synthetic gene providing for the transformation of cells expressing vector. Prienai therapy. 4 N. and 11 C.p. f-crystals, 4 tab., 21 Il.

The scope of the invention

The present invention relates to genes and highly productive ways of expression of eukaryotic and viral proteins in eukaryotic cells.

Background of the invention

The prokaryotic expression products of eukaryotic genes is sometimes restricted due to the presence of codons that are rarely used in E. coli. The expression of these genes may be aggravated by the systematic replacement of endogenous codons for codons, often presented in prokaryotic genes with high efficiency expression (Robinson et al., Nucleic Acids Res. 12:6663, 1984). Generally believed that rare codons create a pass in the ribosome, causing damage to the full formed polypeptide chain and uncoupling of transcription and translation. Believed that pass in the ribosome leads to exposure of the 3'-end of mRNA for cellular ribonuclease.

The invention

The present invention relates to a synthetic gene, codereuse protein, normally expressed in mammalian cells or other eukaryotic cells, in which at least one non-preferred or less preferred codon natural gene encoding this protein, replacing the th A1A (BCA); AGD (SDS); Asn (aac); Asp (das); Cys (tgc); Gln (garden); Gly (ggc); His (cac); Il (atc); Leu (ctg); Lys (aag); Pro (ccc); Phe (ttc); Ser (agc); Thr (ACC); Tight (tac); Val (gtg). Less preferred codons are Gly (ggg); Ile (att); Leu (ctc); Ser (tcc); Val (gtc) and Arg (agg). Codons that do not meet the description of preferred codons or less preferred codons represent the non-preferred codons. In General, the degree of preference of the individual codon indicates the prevalence of this codon in the human genes expressed with high productivity, which are listed in Table 1 under the heading “Productive”. For example, “atc” corresponds to 77% of the codon Il in a highly productive expressed human genes and represents a preferred codon Il; “att” corresponds to 18% of the codon Il in a highly productive expressed human genes and represents a less preferred codon Il. The sequence “ata” corresponds to only 5% of the codon Il in a highly productive expressed human genes as non-preferred codon Il. Replacement of the codon another codon that is prevalent in highly productive expressed human genes will, as a rule, to increase the expression of this gene in mammalian cells. According to the replacement non-preferred codon preferred or less preferred codon.

Under “protein normally expressed in the cell of a mammal” means a protein that is expressed in mammals in vivo. This term includes such genes in the mammalian genome, as genes encoding Factor VIII, Factor IX, interleukins and other proteins. This term also includes genes expressed in mammalian cells in disease States, such as oncogenes, and genes that are encoded by the virus (including retrovirus), which is expressed in post-infectious mammalian cells. Under “protein, normally expressed in eukaryotic cells”, is meant a protein that is expressed by eukaryotes in vivo. This term also includes genes expressed in mammalian cells in disease States.

In the preferred implementation of synthetic genes are able to Express the protein of mammalian or eukaryotic protein at a level that is at least, 110%, 150%, 200%, 500%, 1000%, 5000% or even 10000% of the level that is “natural” (or “native”) gene in in vitro culture system of mammalian cells under identical conditions (i.e. the same type of cells, the basic system for measuring the expression of this synthetic gene and the corresponding natural gene. Other suitable expression systems using mammalian cells, are known to experts in the art and described, for example, the following references to classic works on molecular biology. Vectors suitable for the expression of this synthetic and natural genes, described below and in the references to classical works, also described below. By “expression” refers to expression of the protein. Expression can be measured using antibodies specific to the protein of interest. Such antibodies and methods of measurement are well known to specialists in this field of technology. Under “natural genome” and “native gene” refers to a gene sequence (including natural allelic variants), which encodes this protein in nature, i.e., native or natural coding sequence.

In other preferred implementations, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the codons in the natural gene are non-preferred codons.

In other preferred implementations, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% non-preferred codons in this natural gene replaced by the preferred codons or less PR 80% or 90% non-preferred codons in this natural gene substituted for the preferred codons.

In the preferred implementation protein is a retroviral protein. In a more preferred implementation protein is lentivirusnyi protein. In a more preferred implementation protein is a protein of HIV. In other preferred implementations protein is a gag, pol, env gp 120 or gp l60. In other preferred implementations protein is a human protein. In a more preferred implementation the protein is a human Factor VIII and protein with a deletion In the field of human Factor VIII. In another preferred implementation protein is a green fluorescent protein.

In various preferred implementations, at least, 30%, 40%, 50%, 60%, 70%, 80%, 90% and 95% of the codons of the synthetic gene are preferred or less preferred codons.

The present invention also presents expression vector comprising the synthetic gene.

Another aspect of the present invention is a cell that carries this synthetic gene. In various preferred embodiments, the implementation of the present invention the cell is a prokaryotic cell, and cannulae less than 50, less than 40, less than 30, less than 20, less than 10, 5 or less does not contain “SD” sequences.

In the present invention is characterized also a method of obtaining a synthetic gene encoding a protein normally expressed by cells of mammalian or other eukaryotic cell. This method involves the identification is not preferred or less preferred codons in this natural gene encoding this protein, and replacement of one or more data non-preferred or less preferred codons preferred codon encoding the same this amino acid as the replaced codon.

In some circumstances (e.g., to give the opportunity to introduce the restriction site) it may be desirable to replace the non-preferred codon to a less preferred codon, and not on the preferred codon.

No need to replace all less preferred or non-preferred codons preferred codons. Increased expression can be achieved even in the case of partial replacement of less-preferred or non-preferred codons preferred codons. In some circumstances it may be desirable only partial replacement of non-preferred codons pre> others preferred implementation of the present invention is vectors (including expression vectors) comprising one or more synthetic genes.

By “vector” means a DNA molecule derived, for example, from a plasmid, bacteriophage or virus mammal or insect, which can be inserted or cloned DNA fragments. The vector will contain one or more unique restriction sites and can be capable of Autonomous replication in a defined host or organism medium such that can be reproduced cloned sequence. Thus, by "expression vector" refers to any Autonomous element which is able to control protein synthesis. Such expression DNA vectors include plasmids and viruses introduced into mammalian cells.

The present invention also provides fragments of the synthetic gene, which encode the desired portion of this protein. Such fragments of the synthetic gene similar to the synthetic genes of the present invention except that they encode only part of a given protein. Such gene fragments preferably encode at least 50, 100,it is possible it is desirable to avoid CpG sequences, because these sequences can cause molchanie genes. Therefore, in the preferred embodiment of the present invention encoding the data area of synthetic genes does not include the sequence “SD”.

The ambiguity of the codon present in the gene env gp120 HIV, is also present in the genes gag and pol. So replacement parts are non-preferred and less preferred codons in these genes on preferred codons should produce a gene capable of efficient expression. A large proportion of codons of the human genes encoding the Factor VIII and Factor IX, is a non-preferred codons or less preferred codons. Replacing the data portion of the codons preferred codons should produce genes capable of efficient expression in mammalian cell culture.

Synthetic genes of the present invention can be introduced into cells of a living organism. For example, the vectors (viral or non-viral) can be used to introduce synthetic gene into the cells of a living organism for gene therapy.

Conversely, you may would be desirable to replace the preferred codons in the natural gene on less prefer the Yes of recombinant DNA, include Watson et at., Molecular Biology of the Gene, Volumes I and II, the Benjamin/Cummings Publishing Company, Inc., publisher, Menio Park, CA (1987); Darnell et al., Molecular Cell Biology, Scientific American Books, Inc., Publisher, New York, N. Y. (1986); Old et al., Principles of Gene manipulation: An Introduction to Genetic Engineering, 2d edition. University of California Press, publisher, Berkeley, CA (1981); Maniatis et al., Molecular Cloning: A Laboratory Manual, 2ndEd. Cold Spring Harbor Laboratory, publisher. Cold Spring Harbor, NY (1989); and Current Protocols in Molecular Biology, Ausubel et al., Wiley Press, New York, NY (1992).

By “transformed cell” is meant a cell into which (or into an ancestor of which) has introducible methods of recombinant DNA selected DNA molecule, for example a synthetic gene.

Under “located for expression” is meant that the DNA molecule, for example a synthetic gene is located adjacent to a DNA sequence that controls transcription and translation of the sequence (i.e., contributes to the formation of the proteins encoded by synthetic genome data).

In Fig.1 (a - Fig.1D depicts the sequence of the synthetic gene Dr and synthetic gene Dr, in which codons were replaced with codons found in highly productive expressed human genes.

In Fig.2 schematically depicts a synthetic gene Dr (HIV-1 MN). The shaded part is marked as v1-v5, itano a small number of restriction sites: H (Hind3), Nh (Nhel), P (Pst1), Na (Nael), M (Mlu1), R (EcoR1), A (Age1) and No (Not1). Chemically synthesized DNA fragments, which were used as matrices for PCR, the following sequence of gp120, along with the localization of the primers used for their amplification.

Fig.3 is a photograph of the results of the analyses unstable transfection used to measure the expression of Dr. Gel electrophoresis immunoprecipitating of supernatant cells T, transfected with plasmids expressing Dr encoded by section IIIB isolated from HIV-1 (gp120IIIB), MN area, isolated from HIV-1 (gp120mn), MN area, isolated from HIV-1, which is modified by replacement of the endogenous leader peptide to the peptide of the antigen CD5 (gp120mnCD5L), or chemically synthesized gene encoding MN-variant HIV-1, CDSLeader person (syngp120im). Supernatant collected after a 12-hour period after tagging 60 hours of transfection and thus a hybrid protein CD4:IgG1 and protein-A. separate.

In Fig.4 graphically depicts the results of ELISA assays used to measure protein content in supernatant temporarily transfected cells T. Supernatant cells T, transfetsirovannyh plasmids expressing gp120 encoded by section IIIB of HIV-is Yes to the peptide of the CD5 antigen (gp120mn CD5L), or chemically synthesized gene encoding MN-variant HIV-1, human leader peptide CDS (syngp 120 mn), collected after 4 days and tested in the gp120/CD4 ELISA. Content Dr expressed in ng/ml.

Fig.5 is a photograph of a gel illustrating the results of the analysis are thus used to measure the expression of native and synthetic Dr in the presence of rev in TRANS and RRE in CIS. In this experiment, cells T temporarily transfusional by the calcium phosphate coprecipitation 10 μg of plasmids expressing: (A) synthetic g120N sequence and RRE in CIS, (B) part of the gp120 HIV-1 IIIB, (C) part of the gp120 HIV-1 IIIB and RRE in CIS, all in the presence or in the absence of expression of rev. RRE-constructs gp120IIIbRRE and syngp120mnRRE designed using RRE fragment Eag/Hpa1, cloned by PCR from a proviral clone of HIV-1 NHV. Each expression plasmid gp120 was cotranslationally using 10 μg of plasmid DNA pCMVrev or CDM7. After 60 hours after transfection collected supernatant, immunoprecipitated using hybrid protein CD4:IgG and protein-A agarose, and then dispersed in 7% pampering SDS-PAGE. Time exposure of the obtained gel was extended to give the possibility to induce a demonstration gp120IIIbrre with SIP the rum syngp120mnrre was cotranslationally with or without pCMVrev.

In Fig.5C presents a schematic diagram of constructs used in Fig.5A.

Fig.6 represents the comparison of the gene sequence ratTHY-1 wild-type (wt) and the synthetic gene ratTHY-1 (env), constructed by chemical synthesis and with prevailing codons found in the gene of the HIV-1 env.

In Fig.7 presents a schematic diagram of the synthetic gene ratTHY-1. Black rectangle indicates the signal peptide. The shaded rectangle indicates the sequence of the precursor, which controls the accession phosphatidylinositol anchors. Unique restriction sites used to build constructs THY-1, denoted as N (Hind3), M (Mlu1), S (Sacl) and No (Notl). The provisions of the synthetic oligonucleotides used for this design, shown below danaoi figures.

In Fig.8 presents a graphical depiction of the results of flow-cytometrical analysis. In this experiment, cells T temporarily transfusional the expression plasmid ratTHY-1 wild-type (bold line), the expression plasmid ratTHY-1 with codons encoding the envelope (thin line) or vector (dotted line) by the calcium phosphate coprecipitation. To the antibody against mouse IgG 3 days after transfection.

Fig.9A is a photograph of a gel showing the results of the analysis thus human cells T, transfected syngp120mn (A) or construct syngp120mn. rTHY-1env, which contains the gene rTHY-1env in the 3'untranslated region of the gene syng120mn (In). Design syngp120mn.rTHY-1env was obtained by insertion Not1 adapter in blunt ind3-site plasmids rTHY-1env. Then Not1 fragment of 0.5 T. p. N., containing the gene rTHY-lenv cloned into the Not1 site of the plasmid syngp120mn and checked for correct orientation. Supernatant cells, labeled35S, were collected 72 hours after transfection, precipitiously using hybrid protein CD4:IgG and protein-A agarose was dissolved in 7% pampering SDS-PAGE.

In Fig.9B presents a schematic diagram of constructs used in the experiment shown in Fig.9A.

Fig.10A is a photograph of COS cells, transfected with the vector, not emitting only GFP-fluorescence.

Fig.10B is a photograph of COS cells, transfected with the expression plasmid CDM7 that encodes a native GFP, designed to enable a consensus sequence for initiation of translation.

Fig.10C is a photograph of COS cells, transfected actig.10V, but containing a gene sequence with optimal codons.

Fig.10D is a photograph of COS cells, transfected with the expression plasmid, the same as in Figure 10C, but carrying the Thr residue at position 65 instead Ser.

Fig.11 depicts the sequence of a synthetic gene encoding green fluorescent protein (SEQ ID NO:40).

Fig.12 depicts the sequence of the native gene of the human Factor VIII, no Central B-domain (amino acids 760-1639 inclusive) (SEQ ID NO:41).

Fig.13 depicts the sequence of a synthetic gene for human Factor VIII, no Central B-domain (amino acids 760-1639 inclusive) (SEQ ID NO:42).

Description of the preferred implementations

EXAMPLE 1

Designing synthetic gp120 gene containing the codons found in highly productive expressed human genes.

Frequency table of codon shell predecessor LAV-subtype HIV-1 was obtained using software developed by The University of Wisconsin Genetics Computer Group. The obtained results are summarized in table mapped in the table.1 with the usage profile codons collection of highly expressed chelonioidea expressed genes differs from most preferred codon shell predecessor HIV. In addition, a simple rule describes the preferred profile - shell codons, where it is used: preferred codons maximize the number Denisovich residues in the viral RNA. In all cases it is assumed that the codon in which the third position represents And is used most often. In the specific case of serine, three codon equally provide one And the remainder of this mRNA; together, these three codon include 85% of the serine codons are actually used in shell transcripts. A particularly striking example of a displacement detected by the choice of the codon for arginine, in which the triplet AGA includes 88% of the arginine codons. In addition to this advantage And residues distinct preference among degenerate codons preferred uridine, third, the balance of which must be a pyrimidine. Finally, the incompatibility among the less frequently used options can be attributed to the observation that occurs dinucleotide CgG; therefore, the third position is unlikely to G whenever the second position is, as in the codons for alanine, Proline, serine and threonine; and the triplets CGX for arginine are hardly ever used.

The frequency I represent the percentage of cases when you use a specific codon. Frequency of use of codons envelope genes from other parts of the virus HIV-1 are comparable and show a similar shift.

With the aim of obtaining gene Dr capable of high-yield expression in mammalian cells, has constructed a synthetic gene that encodes a segment t of HIV-1 (syngp120mn), based on the sequence of the most common North American subtype, HIV-1 MN (Shaw et al., Science 226:1165, 1984; Gallo et al.,. Nature 321:119, 1986). In this synthetic gene Dr almost all native codons were systematically replaced with codons that are more frequently used in highly productive expressed human genes (Fig.1). This synthetic gene was assembled from chemically synthesized oligonucleotides 150 to 200 bases in length. If chemically synthesized oligonucleotides that exceed 120-150 reason, the percentage of full-sized product could be low, and a significant excess material consisted of shorter oligonucleotides. As these shorter fragments inhibit the processes of cloning and PCR, it may be difficult to use oligonucleotides that exceed a certain length. To use a crude synthetic material without requirements. The PCR products were isolated by purification on an agarose gel and used as matrices for the next stage of PCR. Two relatives of the fragment could be coamplification due to overlapping sequences at the end of each fragment. These fragments, which had a size of from 350 to 400 p. N., was subcloned into obtained from plasmid pCDM7 containing the leader sequence of surface molecules CD5 and subsequent polylinker Nhe1/Pst1/Mlu1/EcoR1/BamH1. Each of the enzymes in this polylinker is a website which presents either 5' - or 3'-end received in the course of PCR fragments. Therefore, consistent subclavian each of the 4 long slices were allowed to collect a gene gp120. Each fragment was subclinically from three to six different clones and before Assembly sequenced. Schematic representation of the method used to construct a synthetic gp120 shown in Fig.2. Sequence synthetic gp120 gene (synthetic gene gp160 created using the same approach) is presented in Fig.1.

The mutation rate was significant. The most frequently encountered mutations consisted of a short (1 nucleotide) and long (up to 30 nucleotides) on the e adapters or fragments from other subclones without mutations. Some deviations from the exact inheritance towards the use of optimal codons were carried out to ensure that the sites of the restriction in the resulting gene, to facilitate replacement of various segments (Fig.2). Data unique restriction sites were introduced into the gene with approximately 100 p. N. intervals. Native leader sequence of HIV was replaced by highly productive leader peptide of human CD5 antigen to facilitate secretion (Aruffo et al., Cell 61:1303 1990). The plasmid used to construct represents a derived expression vector mammalian pCDM7, transcribing integrated gene under the control of powerful human pretannage CMV promoter.

For comparison of the coding sequences of wild-type gp120 and synthetic synthetic sequence encoding a gp120, have been built into the expression vector mammal and tested in the analysis of unstable transfection. As a control used a variety of native gp120 genes to exclude differences in levels of expression between different viral sites and artifacts induced by certain leader sequences. The construct of HIV gp120 IIIb, used as control, floor the Nations, induced PCR fragment Kpn1/Ear1, containing approximately 1.2, etc., N. from this gene was replaced with the corresponding sequence of proviral clone. Constructs wild-type gp120, used as controls, were cloned by PCR from cells With 8166 infected with HIV-1 MN (AIDS Repository, Rockville, MD) and expressed gp120 or native shell or with a leader sequence of CD5. As proviral clones in this case were not available, tested two clones of each construct in order to avoid PCR artifacts. To conduct semi-quantitative analysis of secreted gp120 in supernatant cells T, temporarily transfected with calcium phosphate by coprecipitate, immunoprecipitation soluble hybrid protein CD4: immunoglobulin and protein And separate.

The results of this analysis (Fig.3) show that the product of this synthetic gene is expressed with high productivity in comparison with the levels of native controls gp120. Molecular weight synthetic gp120 gene was comparable to that of the control proteins (Fig.3), lies in the range from 100 to 110 kDa. A few more quick migration can be explained by the fact that some lines of tumor cells, for example T, Glick is Vania levels of expression of protein gp120 was carried out by quantitative analysis using gp120-ELISA with CD4 in the stationary phase. This analysis shows (Fig.4) that the ELISA data are comparable with data obtained in the process thus, with the concentration of gp120, component 125 ng/ml for synthetic gp120 gene and less than the background threshold (5 ng/ml) for all native gp120 genes. Therefore, expression of this synthetic gp120 gene, at least one order of magnitude higher than the highest value for the genes of wild-type gp120. In the experiment shown, at least 25-fold increase.

The role of rev in the expression of gp120

As rev, apparently, has an effect on several stages in the expression of viral transcripts was tested the possible role of retranslation effects in enhanced expression of the synthetic gp120 gene. First of all, controlled the levels of cytoplasmic mRNA, to eliminate the possibility in which the elements of the negative signal lead to increased degradation of mRNA or nucleic acid capture was carried out by changing the nucleotide sequence. Cytoplasmic RNA was obtained by NP40 lysis short-transfected cells T and the subsequent removal of nuclei by centrifugation. Cytoplasmic RNA was then obtained from lysates of multiple phenol extraction and precipitation, nanocylinder.

Briefly, cytoplasmic mRNA 293 cells, transfected with CDM&, DRV or syngp120, was isolated 36 hours after transfection. Cytoplasmic RNA of cells He1a infected with cowpox virus wild-type or recombinant virus expressing gp120 IIIb or synthetic gp120 gene, under the control of the promoter 7, 5, was isolated after 16 hours after infection. An equal number were applied to the nitrocellulose using a slot-blot device and hybridized with randomly labeled with 1.5 T. p. N. fragments of gp120IIIb and syngp120 or human beta-actin. The levels of expression of RNA was assessed quantitatively by scanning the hybridized membranes fosforsoderzhashchie label. In more detail the methods used are described below.

This experiment demonstrated that there is no significant difference in mRNA content in cells transfected with native or synthetic gp120 gene. In fact, in some experiments, the level of cytoplasmic mRNA synthetic gp120 gene was even lower than native gp120 gene.

These data were confirmed by measuring the expression of recombinant virus cowpox. Human 293 cells or Hela cells infected with vaccinia virus, judge the infection and thus using hybrid protein CD4:immunoglobulin and protein And separate collected supernatant. Techniques used in this experiment are described in more detail below.

This experiment showed that increased expression of this synthetic gene was still observed when the product of the endogenous gene and the product of the synthetic gene expressibility in recombinants cowpox under the control of a strong mixed early and late to 7.5 k promoter. Since the molecules of mRNA cowpox virus are transcribed and translated in the cytoplasm, increased expression of this synthetic envelope gene in this experiment cannot be attributed to its increased export from the nucleus. This experiment was repeated in two additional types of human cells, cell lines of malignant tumors 293 and HeLa cells. As in the case of transfected cells C, the mRNA levels were similar in 293 cells infected with any recombinant vaccinia virus.

The use of codons in lentivirus

Since it is clear that the use of codons has a significant effect on expression in mammalian cells, studied the frequency of occurrence of codons in the genes of coat proteins of other retroviruses. In General, this study found no clear example of a codon which was literalis separately use radonaway ambiguity is almost identical to that found for HIV-1.

Was the table of frequency of occurrence of codons for envelope glycoproteins variety of (predominantly type) retroviruses, except lentiviruses, and created a comparison table of the frequency of codon using protein sequences shell four lentiviruses, distantly related HIV-1 (the virus arthritic encephalitis goats, virus infectious anemia horses, feline immunodeficiency virus and the virus visna) (table.2).

Profile codon sets the use of lentiviruses is strikingly similar to that of HIV-1 in all cases except one, the preferred codon for HIV-1 is the same as the preferred codon for other lentiviruses. The exception is Proline, which is encoded using FTAs to 41% not related to HIV antivirusnik residues of coat proteins and using SSA for 40% of the residues, a situation which clearly reflects a significant preference for triplet ending A.

An example of using the codon for valentinorossi coat proteins does not show similar benefits residues, as well As doesn't possess the same asymmetry in favour of a third on Elam, valentinorossi retroviruses use different codons in a more equally, their profile coincides with the less productive expression of human genes.

The frequency of occurrence of the codon was calculated using the GCG program developed by The University of Wisconsin Genetics Computer Group. Numbers represent the percentage of the use of certain codon. The codon used valentinorossini retroviruses, comprised of sequences of precursor envelope protein of a virus of cattle leukosis virus, feline leukemia virus, T-cell leukemia human type I lymphotropic virus T-cell human type II; culture, forming a lesion in the cells of mink virus, murine leukemia (MuLV); culture Rausher, forming a lesion in the spleen, culture A, amphotropic culture A and myeloproliferative culture leukosis virus, and virus leukemia rat sarcoma virus simian virus leukemia T cells apes, leucosolenia retrovirus T/ leukosis virus long-armed apes. Table of frequencies of occurrence of codons for lentiviruses that are not related to HIV, SIV was from sequences of the precursor envelope protein sa visa.

In addition to the predominance of codons containing A, lentiviral transfer codons join quite representative of the pattern of CpG in HIV, so that the third position of the triplet alanine, Proline, serine and threonine is rarely a G. Retroviral triplets for coat proteins show similarities, but less pronounced represent CpG. The most obvious difference between lentiviruses and other retroviruses, in relation to the prevalence of CpG is to use option CGX arginine in triplets, which often presents additional coding sequences shell retrovirus, but almost never found among the matched antivirusnik sequences.

Differences in rev dependencies between native and synthetic gp120

To determine whether regulation using rev linked using codon HIV-1, studied the effect of rev on native and synthetic genes. As regulation using the rev needs a rev-binding site RRE in cis were generated constructs in which this binding site was cloned in the 3'noncoding region of this native and this synthetic gene. These plasmids were cotranslationally with rev or with a control plasmid in trans in cells TII, used in this experiment, described in more detail below.

As shown in Fig.5A and Fig.5B, rev positively regulates native gp120 gene, but has no effect on the expression of synthetic gp120 gene. Therefore, the effect of rev on the substrate, in which there is no sequence of the endogenous viral envelope sequences is not obvious.

Expression of a synthetic gene ratTHY-1 codons for protein shell HIV

The above experiment suggests that in fact the “sequence of shell present for rev-regulation. In order to test this hypothesis, received a synthetic version of the gene encoding a small, usually productively expressed protein is a cell surface antigen ratTHY-1. This synthetic version of the gene ratTHY-1 was intended for the use of codon similar to HIV gp120. When creating this synthetic gene sequence AUUUA, which is associated with mRNA instability were excluded. In addition, to simplify the processing of the obtained gene (Fig.6) was introducible two restriction site. This synthetic gene using codons for protein shell HIV (rTHY-lenv) was designed using three 150-170-dimensional oligo, a then cloned in pCDM7.

The levels of expression of native rTHY-1 and rTHY-1 codons for protein shell HIV was assessed quantitatively using immunofluorescence assay temporarily transfected cells T. In Fig.8 shows that the expression of the native gene THY-1 is almost two orders of magnitude higher than the background control transfected cells (pCDM7). In contrast, expression of the synthetic ratTHY-1 almost much lower than the specified native gene (shown by the shift of the peak towards the designation of the channel).

To confirm that the negative sequence elements that contribute to the degradation of mRNAs were not introduced, received a construct in which the gene rTHY-1 was cloned at the 3'-end of the synthetic gene gp120 (Fig.9B). In this experiment, cells T was transfusional genome syngp120mn or hybrid genome syngp120/ratTHY-1 env (syngp120mn. rTHY-1env). Expression was measured by the method thus using hydride CD4 protein:IgG and protein-A agarose. The methods used in this experiment are described in more detail below.

As the synthetic gp120 gene contains a stop codon UAG, this transcript rTHY-1env not broadcast. If the negative elements that enhance the degradation, are present in this sequence syngp120mn without rTHY-1env. In Fig.9A shows that the expression of both constructs are similar, indicating thereby that the low expression should be associated with the broadcast.

Rev-dependent expression of a synthetic gene ratTHY-1 codons for protein shell

To find out whether this rev is able to regulate gene expression ratTHY-1 containing codons env, created a construct with the rev-binding site on the 3'-end of the open reading frame rTHY-lenv. To measure the reactivity rev construct ratTHY-1env containing 3'-RRE, human cells T was cotranslationally ratTHY-1envrre and either CDM7 or pCMVrev. After 60 hours after transfection the cells were taken away millimetre using 1 mm EDTA in the FBI and was dyed with H anti-rTHY-1 mouse monoclonal antibodies and secondary antibodies conjugated with FITZ. The fluorescence intensity was measured using cytofluorometry EPICS XL. More detail on these methods is described below.

In repeated experiments, when rev was cotransfection genome rTHY-1env found some increased expression of rTHY-1env. To further enhance the sensitivity of the analytical system received a construct expressing the secretory variant rTHY-lenv. This construct was expected to give more reliable data, because Go period, in contrast, a protein expressed on the surface that more accurately reflects the current rate of production. A gene that can Express secreterial form, was obtained by PCR using forward and reverse primers, by annealing, respectively 3' of the endogenous leader sequence and 5' of the motif sequence required for phosphatidylinositol-lisanova anchors. The PCR product was cloned into a plasmid that already contains a leader sequence of CD5, thus creating a construct in which the membrane anchor has been deleted, and this leader sequence was replaced with heterologous (and probably more effective) leader peptide.

Reactivity rev Sekretareva form ratTHY-1env measured by immunoprecipitation of supernatant human cells T, cotransfection a plasmid expressing secreterial form ratTHY-1env and RRE sequence in cis (rTHY-1envPI-rre) and CDM7 or pCMVrev. Construct rTHY-1envPI-RRE was created by PCR using the oligonucleotide: cgcggggctagcgcaaa-gagtaataagtttaac (SEQ ID NO: 38) as a forward primer, using the oligonucleotide: cgcggatcccttgtattttgtactaata (SEQ ID NO: 39) as a reverse primer and synthetic constructs rTHY-1env as th sequence of CD5 and the RRE sequence. Supernatant cells labeled with35S, were collected 72 hours after transfection, precipitiously mouse monoclonal antibodies H against rTHY-1 and sepharose, conjugated with an antibody against mouse IgG, and were dispersed in 12% pampering SDS-PAGE.

In this experiment, the induction rTHY-1 using the rev was much more visible and clear than in the above experiment, and thoroughly confirmed that rev is able to regulate translational transcripts that supression rarely used codons.

Rev-dependent expression of a hybrid protein rTHY-1env: immunoglobulin

To check out whether or not is rarely used codons should be represented throughout the whole coding sequence or a really short area is sufficient to impart reactivity rev, was obtained hybrid protein rTHY-1env: immunoglobulin. In this construct, the gene rTHY-1env (without sequence motif responsible for phosphatidylinositol anchor) connected with a hinge, human IgG1, domains, CH2 and CH3. This design was obtained using the anchor PCR using primers with Sagami restriction Nhe1 and BamH1 and rTHY-1env as a matrix. The resulting PCR fragment coniraya CH2 and CH3 of human immunoglobulin IgG. Hind3 fragment/Eag1 containing the insert rTHY-1enveg1, then cloned in the received pCDM7-plasmid with the RRE sequence.

To measure the response of the hybrid gene rTHY-1env/immunoglobulin (rTHY-1enveg1rre) on rev, human cells T was cotranslationally using rTHY-1enveglrre and either - pCDM7 or pCMVrev. Construct rTHY-1enveg1rre created using the anchor PCR using forward and reverse primers, respectively, with a site restriction Nhe1 and BamH1. The resulting PCR fragment was cloned into a plasmid containing SV leader and a human IgG hinge, domains CH2 and CH3. Supernatant cells labeled with35S, were collected 72 hours after transfection, precipitiously using mouse monoclonal antibodies H to rTHY-1 and antimachine IgG-sepharose and dispersed in 12% pampering SDS-PAGE. Used here, the techniques are described in detail below.

As in the case of gene product rTHY-1envPI, this hybrid protein rTHY-1env/immunoglobulin is secreted in the supernatant. Therefore, this gene should answer the rev-induction. However, in contrast to the rTHY-1envPI cotransfected rev in trans does not induce or induces only a slight increase in the expression of rTHY-1enveg1.

Expression of the hybrid protein rTHY-1: an immunoglobulin with codons for protein shell is enveg1 (env-codons) or rTHY-1wteg1 (native codons). Construct rTHY-1wteg1 was obtained in a manner analogous to the method used for constructing rTHY-1enveg1, with the exception that plasmid containing the native gene rTHY-1, was used as matrix. Supernatant cells labeled with35S, were collected 72 hours after transfection, precipitiously using mouse monoclonal antibodies H against rTHY-1 and anti-mouse IgG-separate and dispersed in 12% pampering SDS-PAGE. These techniques, used in this experiment, described in more detail below.

The levels of expression of rTHY-1enveg1 were reduced compared to a similar construct rTHY-1 wild type hybrid partner, but were still significantly higher than rTHY-1env. In line with this, both parts of the hybrid protein affect the levels of expression. Adding rTHY-1env does not limit the expression to equal value, as shown for one rTHY-1env. Therefore, regulation via rev ineffective if the expression of protein supression not completely.

Codon sets the preference for membrane protein gene of HIV-1

A direct comparison of the frequency of codon usage for the envelope protein of HIV and highly expressed human genes reveals a clear distinction in all dvdcca among the nine amino acids with double radonaway degeneracy, preference is given to a third residue, which represents a or U in all nine. The possibility that all nine selected with the same probability, will be the same, approximately, of 0.004, and, therefore, by any traditional measure, the choice of the third residue cannot be considered as random. Additional evidence of asymmetry codon sets preferences found among the most degenerate codons, where you can observe a strong selection for triplets, bearing adenine. This contrasts with the pattern for highly productive expressed genes that favor the codons, bearing With or, less usually, G in the third position of codons with three or more degeneracy.

Systematic replacement of native codons for codons of highly expressed human genes dramatically increases the expression of gp120. Quantitative analysis by ELISA showed that the expression of this synthetic gene was at least 25 times higher compared to native gp120 after a transient transfection into human 293 cells. Concentration levels in this ELISA experiment were significantly lower. Since ELISA is used for the quantitative analysis, kadarnath obviously low expression. Measurement of the levels of cytoplasmic mRNA demonstrate that the difference in protein expression due to differences in translation, but not mRNA stability.

Retroviruses usually do not show such a preference in respect of a and T, as found for HIV. But if this family is divided into two subgroups, lentiviruses and valentinorossi retroviruses, a similar preference for a and, less frequently, T, is determined by the third codon sets the position for lentiviruses.

Thus, the evidence suggests that the lentiviruses retain the characteristic pattern of codons for protein shell is not due to the original advantages of reverse transcription or replication of such residues, but rather due to some reasons, the inherent physiology of this class of viruses. The main difference between lentiviruses and non-complex retroviruses is, as already mentioned, additional regulatory and minor auxiliary genes of lentiviruses. Thus, one simple explanation for the restriction of the expression of the protein shell may lie in the fact that it is based essential regulatory mechanism of one of these additional molecules. Indeed, used in viral mRNA, is used to create a class of transcripts that are susceptible to the stimulating effect of rev. This hypothesis was confirmed by using strategies similar to above, but this time used the codon changed in the opposite direction. The codon used in effectively expressing in the cell a gene was replaced by the more frequently used codons in the envelope of HIV. It is assumed that the levels of expression were significantly lower compared to the native molecule by almost two orders of magnitude, when analyzed by immunofluorescence assay surface expressed molecules. If rev was coexpression in trans, a RRE element was present in cis, for the surface molecules were found only a weak induction. However, if THY-1 expressively as Sekretareva molecules, induction of using the rev was much clearer, confirming the above hypothesis. Apparently, this can be explained by the accumulation of secreted protein in the supernatant, which significantly amplifies the effect of rev. If rev, in General, induces only a minor increase in the content of surface molecules, induction of HIV coat proteins using a rev cannot be the result of excessive increase in the surface, but rather the behavior is to check really small Subtotal elements of the gene is sufficient to limit the expression and call her, were obtained rev-dependent hybrid proteins rY1nv: immunoglobulin, in which only about one-third of all gene uses the codons for protein shell. Expression levels of this construction was at an intermediate level, showing that the negative element of the sequence rTHY-1env is not dominant within the immunoglobulin part. This hybrid protein was not or only slightly was the rev-responsive, indicating that only fully supression genes can be rev-reactive.

Another characteristic feature that was found in the tables in the frequency of occurrence of the codon is amazingly small representation of CpG triplets. In the comparative study of the use of codons in E. coli, yeast, Drosophila and primates have shown that for many of the analyzed genes of primates, at least 8 used codons contain all of the codons with the dinucleotide sequence CpG. The exception codons containing the dinucleotide motif was also detected in the sequence of other retroviruses. Apparently, veroyatnostei due to methylation of CpG cytosines. The expected number of CpG dinucleotides in HIV, in General, is almost one-fifth of expectations on the basis of a heterocyclic structure. This may indicate that the possibility of high-yield expression is restored and that this gene is, in fact, effectively expressed at some point during viral pathogenesis.

The results presented here clearly show that codon sets the preference has a strong effect on the protein and suggests that the chain growth when broadcast controls the expression of a gene of a mammal. However, other factors may play a role. First, the excess submaximal loaded molecules of mRNA in eukaryotic cells indicates that initiation is the rate limiting broadcast, at least in some cases, otherwise all the transcripts would be covered by ribosomes. In addition, if staying ribosomes and subsequent degradation of the mRNA were such a mechanism, suppression using rare codons could be probably irreversible in any regulatory mechanism similar to the mechanism presented here. A possible explanation for the effects of initiation and elongation on the translational activity of the conclusion of the about all of this RNA, so lentiviral transfer codons bow RNA to accumulate a pool of sorrow initiated RNA molecules. However, this limitation is not necessarily kinetic; for example, the choice of codons could affect the likelihood that this translational product, once initiated, duly completed fully. With this mechanism, the excess is less favorable codons would result in significant cumulative probability of failure in picking the formed polypeptide chain. Then it would be isolated RNA would increase the rate of initiation under the action of rev. Because aderinoye balances are in excess in the rev-responsive transcripts, this would mean that methylation of adenine RNA mediates the suppression of the broadcast.

Drilling techniques

In the above experiments we used the following methods.

Sequence analysis of the

The sequence analysis was carried out in accordance with the software developed by The University of Wisconsin Genetics Computer Group.

Construction of plasmids

Construction of plasmids were created using the following methods. Vectors and insertional DNA was digested at a concentration of 0.5 μg/10 μl in proper obrabatyvali with 10% (V/o) alkaline phosphatase, calf intestine (1 μg/ml) for 30 minutes prior to gel electrophoresis. The hydrolysates of the vector and insert (every 5-10 μl) were dispersed in 1.5% gel low-melting agarose with TAE-buffer. The pieces of gel containing the desired band, was transferred to a 1.5 ml reaction tube was melted at 65With and immediately made for ligating without removing the agarose. Legacy usually received in a total volume of 25 ál in 1x nitrosonium buffer with 1x ligiously additives 200-400 Eg ligase, 1 μl of vector and 4 ál of insert. If necessary, 5'-protruding ends were filled in by adding 1/10 volume of 250 μm dNTPs and 2-5 E polymerase maple for inaktivirovanie heating or extraction of hydrolyzed phenol and incubated for 20 min at room temperature. Optionally, the 3'protruding ends were filled in by adding 1/10 volume of 2.5 mm dNTP and 5-10 Eg DNA polymerase T4 to inactivate by heating or hydrolysates extracted with phenol, followed by incubation at 37C for 30 minutes In these reactions used the following buffers: 10x nizkosolevaya buffer (60 mm Tris-HC1, pH 7.5, 60 mm MgCl2, 50 mm NaCl, 4 mg/ml BSA, 70 mm (-mercaptoethanol, 0.02% of NaN3); 10x srednesetevoj buffer (60 mm Tris-Hcl, pH 7.5, 60 mm MgCl2, 50 mm NaCl, 4 mg/ml BSA, 70 mm-mercaptoethanol, 0.02% of NN3); 10x ligerie additives (1 mm ATP, 20 mm DTT, 1 mg/ml BSA, 10 mm spermidine); 50x TAE (2 M Tris-acetate, 50 mm EDTA).

Oligonucleotide synthesis and secretion clearance

Oligonucleotides were obtained using the synthesizer Milligen 8750 (Millipore). Speakers suirable with 1 ml of 30% aqueous ammonium hydroxide, and erwerbende oligonucleotides was unblocked when 55C for 6-12 hours. After the release of 150 μl of the oligonucleotide precipitiously with 10x volume of unsaturated n-butanol 1.5 ml reaction tubes, followed by centrifugation at 15,000 rpm in microcentrifuge. The precipitate was washed with 70% ethanol and resuspendable in 50 μl of H2O. the resulting concentration was determined by measuring optical density at 260 nm for cultivation of 1:333 (1 OD260=30 µg/ml).

To construct a synthetic gp120 gene used the following oligonucleotides (all sequences described in this text are in 5'-3'orientation).

Oligonucleotide 1 direct (Nhel): PIF ggg cta DSS ACE dad AMA ctg (SEQ ID NO: 1).

Oligonucleotide 1: ACC gag aag ctg tgg gtg acc gtg tac tac ggc gtg ccc gtg tgg aag ag ag gcc ACC ACC ACC ctg ttc tgc gcc agc gac gcc aag gcg tac gac acc gag gtg cac aac gtg tgg gcc ace cag gcg tgc gtg ccc acc gac ccc aac ccc cag gag gtg gag c is ucleotide 2 direct: gac cga gaa ctt caa cat gtg gaa gaa caa cat (SEQ ID NO:4).

Oligonucleotide 2: tgg aag aac aac atg gtg gag cag atg cat gag gac atc atc agc ctg tgg gac cag ag ctg aag ccc tgc gtg aag ctg acc cc ctg tgc gtg acc tg aac tgc acc gac ctg agg aac acc acc aac acc aac ac agc acc gcc aac aac aac agc aac agc gag ggc acc atc aag ggc ggc gag atg (SEQ ID NO:5).

Oligonucleotide 2 reverse (>PST): gtt gaa gct gca gtt ctt cat ctc gcc gcc ctt (SEQ ID NO:6).

Oligonucleotide 3 direct (Pstl): gaa gaa ctg cag ctt caa cat cac cac cag (SEQ ID NO:7).

Oligonucleotide 3: aac atc ACE ACE agc atc cgc gac aag atg cag aag gag tac gcc ctg ctg tac aag ctg gat atc gtg agc atc gac aac gac agc acc agc tac cgc ctg atc tcc tgc ACC ACC agc gtg atc ACC garden BCA tgc ccc aag atc agc ttc gag ccc atc ccc atc cac tac tgc BCA BCA ccc ggc ttc BCA (SEQ ID NO:8).

Oligonucleotide 3 reverse: gaa ctt ctt gtc ggc ggc gaa gcc ggc ggg (SEQ ID NO:9).

Oligonucleotide 4 direct: gcg ccc ccg ccg gct tcg cca tcc tga agt gca acg ACA hell agt tc (SEQ ID NO:10).

Oligonucleotide 4: gcc gac aag aag ttc agc ggc aag ggc agc tgc aag aac gtg agc acc gtg cag tgc acc cac ggc atc cgg ccg gtg gtg agc acc cag ctc ctg ctg aac ggc agc ctg gcc gag gag gag gtg gtg atc cgc agc gag aac ttc acc gac aac gcc aag acc atc atc gtg cac ctg aat gag agc gtg cag atc (SEQ ID NO:11)

Oligonucleotide 4 reverse (Mlu1): agt tgg gac gcg tgc agt tga tct gca cgc tct (SEQ ID NO:12).

Oligonucleotide 5 straight (Mlu1): gag agc gtg cag atc aac tgc acg cgt ccc (SEQ ID NO:13).

Oligonucleotide 5; aac tgc acg cgt ccc aac tac aac aag cgc aag cgc atc cac atc ggc ccc ggg cgc gcc ttc tac acc acc aag aac atc ggc atc acc atc ctc cag gcc cac tgc aac atc tct aga (SEQ ID NO:14).

Oligonucleotide 5 reverse: gtc gtt cca ctt ggc tct aga gat gtt gca (SEQ ID NO:15).

Oligonucleotide 6 direct: gca ACA tct cta gag cca agt gga acg ac (SEQ ID NO:16).

Oligonucleotide 6: gcc aag tgg aac gac Asiatic 6 reverse (EcoR1): gca gta gaa gaa ttc gcc gcc gca gtt gc (SEQ ID NO:18).

Oligonucleotide 7 direct (EcoR1): tca act gcg gcg gcg aat tct tct act gc (SEQ ID NO:19).

Oligonucleotide 7: ggc gaa ttc ttc tac tgc aac acc agc ccc ctg ttc aac agc acc tgg aac ggc aac aac acc tgg aac aac acc acc ggc agc aac aac aat att acc ctc cag tgc aag atc aag cag atc atc aac atg tgg cag gag gtg ggc aag gcc atg tac gcc ccc ccc atc gag ggc cag atc cgg tgc agc agc (SEQ ID NO:20)

Oligonucleotide 7 reverse: gca gac cgg tga tgt tgc tgc tgc acc gga tct ggc cct (SEQ ID NO:21).

Oligonucleotide 8 direct: cga ggg cca gat ccg gtg cag cag caa cat cac cgg tct g (SEQ ID NO:22).

Oligonucleotide 8: aac atc ACC ggt ctg ctg ctg acc cgc gac ggc ggc aag gac acc gac acc aac gac acc gac atc ttc cgc ccc ggc ggc ggc gac atg cgc gac aac tgg aga tct gag ctg tac aag tac aag gtg gtg acg atc gag ccc ctg ggc gtg gcc ccc acc aag gcc aag cgc cgc gtg gtg cag cgc gag aag cgc (SEQ ID NO:23).

Oligonucleotide 8 reverse (Not1): cgc ggg cgg ccg ctt tag cgc ttc tcg cgc tgc ACE AC (SEQ ID NO:24).

To construct a gene ratTHY-lenv used the following oligonucleotides.

oligonucleotide 1 direct (Bam.H1/Hind.3): cgc ggg gga tcc aag ctt acc atg att cca gta ata agt (SEQ ID NO:25);

oligonucleotide 1: atg aat cca gta ata agt ata ACA tta tta tta agt gta tta caa atg agt aga gga caa aga gta ata agt tta ACA gca tct tta gta aat caa aat ttg aga tta gat tgt aga cat gaa aat aat ACA aat ttg cca ata caa cat gaa ttt tca tta acg (SEQ ID NO:26);

oligonucleotide 1 reverse (EcoR1/Mlu1): cgc ggg gaa ttc acg cgt taa tga aaa ttc atg ttg (SEQ ID NO:27);

oligonucleotide 2 direct (BamH1/Mlu1): cgc gga tcc acg cgt gaa aaa aaa aaa cat (SEQ ID NO:28);

oligonucleotide 2: cgt gaa aaa aaa aaa cat gta tta agt gga ACA tta gga gta cca gaa cat ACA tat aga agt aga gta aat ttg ttt agt gat aga ttc ata aaa gta tta ACA tta gca aat ttt ACA ACA aaa gat ga is Ted 3 direct (BamH1/Sac1): cgc gga tcc gag ctc aga gta agt gga caa (SEQ ID NO:31);

oligonucleotide 3: ctc aga gta agt gga caa aat cca ACA agt agt aat aaa ACA ata aat gta ata aga gat aaa tta gta aaa tgt ga gga ata agt tta tta gta caa aat ACA agt tgg tta tta tta tta tta tta agt tta agt ttt tta caa gca ACA gat ttt ata agt tta tga (SEQ ID NO:32);

oligonucleotide 3 reverse (EcoR1/Not1): cgc gaa ttc gcg gcc gct tca taa act tat aaa ate (SEQ ID NO:33).

Polymerase chain reaction

Briefly, overlapping 15-25-dimensional oligonucleotides, annealed at both ends, used for amplification of long oligonucleotides in a polymerase chain reaction (PCR). Conventional PCR conditions were: 35 cycles, 55With the temperature of annealing, 0.2 with the time extension. The PCR products were isolated by purification in the gel, extracted with phenol and used in subsequent PCR to obtain longer fragments, consisting of two small adjacent fragments. These longer fragments cloned in CDM7-produced plasmid containing the leader sequence of SW-surface molecules with subsequent polylinker Nhe1/Pst1/Mlu1/EcoR1/BamH1.

In these reactions used the following solutions: 10x PCR buffer (500 mm KS1, 100 mm Tris-HCl, pH 7.5, 8 mm MgCl2, 2 mm each dNTP). This final buffer was supplemented with 10% DMSO for fidelity Taq polymerase.

Obtaining DNA in a small amount of

Transformirovannykh culture was poured into a 1.5 ml-new microcentrifuge tubes, played for 20 s for deposition of cells and resuspendable in 200 μl of solution I. Then add 400 ál of solution II and 300 ál of solution III. These microcentrifuge tubes were closed with caps, mixed and spun for > 30 sec. Supernatant was transferred into a clean test tube and once were extracted with phenol. DNA was besieged by filling these tubes isopropanol, mixed and Unscrew microcentrifuge for > 2 min. the precipitate was washed with 70% ethanol and resuspendable 50 ál dH20 containing 10 ál of RNase A. these operations were used the following Wednesday and solutions: LB-medium (1,0% NaCl, 0.5% of yeast extract, 1% tryptone); solution I (10 mm EDTA, pH 8.0); solution II (0.2 M NaOH, and 1.0% SDS); solution III (2.5 M KOAc, 2.5 M glacial acetic acid); phenol (pH is brought to 6.0 saturated with TE); TE (10 mm Tris-HCl, pH 7.5 mm EDTA, pH 8.0).

Obtaining DNA in a large number of

1 l of the transformed bacteria were grown within 24-36 hours (MSR transformed derivatives pCDM) or 12-16 hours (MS transformed derivatives pUC) at 37With either bacterial environment M9 (derived pCDM) or LB (pUC derivatives). Bacteria were centrifuged for 1 l bottles using centrifuges Beckman J6 at 4200 is 40 ml of solution III, and these bottles are quite vigorously shook before the formation of lumps ranging in size from 2-3 mm. This bottle was turned off at 4200 rpm for 5 min and the resulting supernatant was poured through cheesecloth into a 250 ml-new bottle.

Upstairs was added isopropanol and this bottle was centrifuged at 4200 rpm for 10 minutes

The precipitate resuspendable 4.1 ml of solution I was added caesium chloride and 4.5 g, 0.3 ml of ethidium bromide (10 mg/ml) and 0.1 ml of 1% solution of Triton X100. The tubes were centrifuged in a high speed centrifuge in a Beckman J2 at 10,000 rpm for 5 minutes the resulting supernatant was transferred into ultracentrifuge tubes Beckman Quick Seal, which then was siliconserver and centrifuged in a Beckman ultracentrifuge using NVT90-poropa with a fixed angle at 80000 rpm for > 2.5 hours. The resulting strip was removed under visible light using a 1 ml syringe and needle 20-th size. To the extracted material was added an equal volume of N2Acting DNA once were extracted using ad-butanol saturated with 1 M sodium chloride, followed by addition of an equal volume of 10 M ammonium acetate / 1 mm EDTA. The resulting material was poured in 13 ml sealable tube, which was then filled to the top absolution washed with 70% ethanol and resuspendable in 0.5-1 ml of N2O. the Concentration of DNA was determined by measuring optical density at 260 nm in a dilution of 1:200 (1 OD260=50 µg/ml).

In these operations was used following Wednesday and buffers: bacterial M9 medium (10 g M9 salts, 10 g Kazimirovich acid (hydrolysed), 10 ml of additives M9, and 7.5 μg/ml of tetracycline (500 ál of solution (15 mg/ml), 12.5 ág/ml ampicillin (125 ál of solution (10 mg/ml) ); additives M9 (10 mm CaCl2, 100 mm MgSO4, 200 μg/ml thiamine, 70% glycerol); LB-medium (1,0% NaCl, 0.5% of yeast extract, 1% tryptone); solution I (10 mm EDTA, pH 8.0); solution II (0.2 M NaOH, and 1.0% VAT); solution III (2,5 M COAs, 2.5 M SPLA).

Sequencing

Synthetic genes sequenced by dideoxynucleotide method Sanger. Briefly, 20-50 μg of double-stranded plasmid DNA was denaturiruet in 0.5 M NaOH for 5 minutes this DNA is Then besieged by using 1/10 volume sodium acetate (pH of 5.2) and 2 volumes of ethanol and centrifuged for 5 minutes the precipitate was washed with 70% ethanol and resuspendable at a concentration of 1 µg/µl. The renaturation reaction was performed using 4 μg DNA templates and 40 ng of primer in 1x renaturation buffer in a final volume of 10 µl. The reaction was heated to 65With and ment the CL mixture for tagging, of 0.75 ál dH2O, 1 μl of [35S] dATP (10 µci) and 0.25 μl of Sequenase(12 u/ml). 5 μl of this mixture was introduced into each tube origemail pry-Mer-matrix and incubated for 5 min at room temperature. For each labeling reaction was added 2.5 μl of each of the 4 termination of the mixture in tablet Terasaki and pre-heated at 37C. At the end of this incubation period in each of the 4 termination mixtures were made of 3.5 μl of the mixture for tagging. After 5 min in each reaction was added 4 μl of stop solution and this tablet Terasaki incubated at 80C for 10 min in a thermostat. The obtained reaction sequencing was electrophoretically a 5% denaturing polyacrylamide gel. Acrylamide solution was prepared by adding 200 ml of 10x TBE buffer and 975 ml dH2About 100 g of acrylamide:methylenebisacrylamide (29:1). 5% polyacrylamide gel with 46% urea and 1x TBE was prepared by mixing 38 ml acrylamide solution and 28 g of urea. Polymerization was initiated by addition of 400 ál of 10% ammonium persulfate and 60 ál TEMED. Gels formed using glass plates and combs and dispersed in 1x TBE-buffer at 60-100 W for 2-4 hours (depending on Uchenie almost 1 hour and exposed to x-ray film at room temperature. Normal exposure was 12 hours. In these operations were used the following solutions: 5x renaturation buffer (200 mm Tris-HCl, pH 7.5, 100 mm MgCl2, 250 mm NaCl); the mixture for tagging (7.5 μm each of dCTP, DSTF and dTTP); the mixture for termination (80 μm each of dNTP, 50 mm NaCl, 8 mm dNTP (each); stop solution (95% formamide, 20 mm EDTA, 0.05% of bromophenol blue, 0.05% of xylenecyanol); 5x TBE (0.9 M Tris-borate, 20 mm EDTA); Polyacrylamide solution (96,7 g of polyacrylamide, 3.3 grams of bisacrylamide, 200 ml 1x TBE, 957 ml dH2O).

Allocation RNA

Cytoplasmic RNA was isolated from cells T, transfected using the calcium-phosphate, 36 hours after transfection and from Hela cells infected with smallpox, after 16 hours after infection, almost exactly as described by Gilman. (Gilman Preparation of cytoplasmic RNA from tissue culture cells. In Current Protocols in Molecular Biology, Ausubel et al., eds., Wiley & Sons, New York, 1992). Briefly, cells were literally 400 ál lyse buffer, nuclei were centrifuged, a SDS and proteinase K were added, respectively, at a concentration of 0.2% and 0.2 mg/ml Obtained cytoplasmic extracts were incubated at 37C for 20 min, and was twice extracted with phenol/chloroform and precipitated. The obtained RNA was dissolved in 100 μl of buffer I and incubi the RA and again besieged.

In this activity you used the following solutions: Buffer for lysis (TRUSTEE, containing 50 mm Tris pH 8.0, 100 mm NaCI, 5 mm MgCl2and 0.5% NP40); Buffer I (TRUSTEE-buffer with 10 mm MgCl2, 1 mm DTT, to 0.05 U/ál Uncatego inhibitor from the placenta, 0,1 Eg/ál RNase free from Gnkazy I); Stop-buffer (50 mm EDTA 1.5 M NaOAc 1,0% VAT).

Slot-blot analysis

For slot-blot analysis was dissolving 10 μg of cytoplasmic RNA in 50 ál dH2O to which was added 150 μl of SSC/18% formaldehyde. This solubilizing RNA was then incubated at 65C for 15 min and put spots in a slot-blot apparatus. For hybridization was used radioactively labeled samples of 1.5 T. p. N. fragments of gp120IIIb and syngp120mn. Each of these two fragments accidentally marked a 50 μl reaction with 10 ál of 5x buffer for labeling oligonucleotides, 8 μl of 2.5 mg/ml BSA, 4 μl [32P] - dCTP (20 µci/µl; 6000 CI/mmol) and 5 Eg fragment maple. After 1-3 hours of incubation at 37With added 100 µl of the TRUSTEE, and unincorporated [32]-dCTP was removed using a spin-G50 column. Activity was measured in a beta counter Beckman and the same specific activity was used for hybridization. Membrane �https://img.russianpatents.com/chr/215.gif">106on ml hybridiza fluid. The resulting membrane is washed twice (5 min) wash buffer I at room temperature for one hour in wash buffer II at 65C and then exposed to x-ray film. Similar results were obtained using 1,1 T. p. N. Not1 fragment/Sfi1 of pCDM7 containing 3 untranslated region. Control hybridization was carried out simultaneously with randomly labeled the breakdown of the human beta-actin. The expression of the RNA was assessed quantitatively by scanning the hybridized nitrocellulose membranes using photoinjector Magnetic Dynamics.

In this activity you used the following solutions: 5x buffer for labeling oligonucleotides (250 mm Tris-HC1, pH 8.0, 25 mm MgCl2, 5 mm-mercaptoethanol, 2 mm dATP, 2 mm dGTP, mm dTTP, 1 M Hepes, pH 6.6, 1 mg/ml hexanucleotides [dNTP]6); the hybridization solution (0.05 M nutrifaster, 250 mm NaCl, 7% SDS, 1 mm EDTA, 5% dextran sulphate, 50% formamide, 100 μg/ml denatured DNA salmon sperm); wash buffer I (2x SSC, 0,1% SDS); wash buffer II (0.5 x SSC, 0,1% SDS); 20x SSC (3 M NaCl, 0.3 M PA3-citrate, pH is brought to 7.0).

Recombination cowpox

Used a modification regionally, infected 1-3 ál strain of cowpox wild-type WR (2x 108B. O. E./ml) for 1 hour in culture medium not containing serum of a calf. After 24 hours, these cells were transfusional calcium-phosphate with 25 µg TKG plasmid DNA per Cup. After an additional 24 to 48 hours, these cells were scraped from this Cup, besieged by centrifugation and resuspendable in a volume of 1 ml After 3 cycles of freezing/thawing was added trypsin (0.05 mg/ml and the lysates were incubated for 20 minutes For infection in small cups (6 cm) used a series of dilutions of 10, 1 and 0.1 μl of lysate CV1 cells that were pre-treated with 12.5 µg/ml mycophenolate acid, 0.25 mg/ml xanthine and 1.36 mg/ml gipoksantina within 6 hours. Infected cells were cultured for 2-3 days and then stained with monoclonal antibodies NEA9301 to gp120, and alkaline phosphatase conjugatively with the secondary antibody. Cells were incubated with 0.33 mg/ml NBT and 0.16 mg/ml BCIP in AP-buffer and, finally, fed 1% agarose in PBS. Selected positive plaques and resuspendable in 100 μl Tris pH of 9.0. The resulting plaque purified and the purification was repeated. To obtain strains with high titer infection was slowly increased. Finally, one large Cup of Nwali Daunce in the homogenizer and osvetleni from large debris by centrifugation. Recombinant strains VPE-8 cowpox virus sorted through the creation of AIDS repository, Rockville, MD and expressed HIV-1 IIIB gp120 7.5 mixed early/late promoter (Earl et al., J. Virol., 65:31, 1991). In all experiments with recombinant bovine smallpox cells were infected at a multiplicity of infection of at least 10.

In this activity you used the following solutions:

AR-buffer (100 mm Tris-HCl, pH of 9.5, 100 mm NaCl, 5 mm MgCl2).

Cell culture

Cell line CV1 and Cos7 carcinoma monkey kidney line 293 Tons of renal carcinoma human cell line Hela carcinoma of the cervix person was obtained from the American type culture Collection and maintained in IMDM with additives. They were kept in 10 cm-type cups for tissue cultures and usually stratified 1:5-1:20 every 3-4 days. For this operation you used the following medium: IMDM with additives (90% Iscove modified environment Dulbecco with the addition of 10% calf serum, iron, V / V heat inactivated for 30 min at 56C, 0.3 mg/ml L-glutamine, 25 μg/ml gentamicin, 0.5 mm-mercaptoethanol (pH was brought to 5 M NaOH, 0.5 ml).

Transfection of

Calcium-phosphate transfection of cells T was carried out by medlem during shaking. After incubation for 10-30 min at room temperature specified precipitate DNA was made in a small Cup with cells formed a monolayer on 50-70%. In cotransfection experiments with rev cells were transfusional using 10 µg gp120IIIb, gp120IIIbrre, syngp120mnrre or rTHY-lenveglrre and 10 µg pCMVrev or CDM7 plasmid DNA.

In this activity you used the following solutions:

2x HEBS buffer (280 mm NaCl, 10 mm KS1, 1.5 mm sterile filtered); 0.25 mm CaCl2(autoclaved).

Immunoprecipitate

After 48-60 hours have changed their environment and the cells were incubated for another 12 hours in Cys/Met-free medium containing 200 µci35S-transmitte. Collected supernatant and removal of debris were centrifuged within 15 min at 3000 rpm Then added protease inhibitors leupeptin, Aprotinin and PMSF in the amount of respectively 2.5 µg/ml, 50 μg/ml, 100 μg/ml, was incubated with 1 ml of the supernatant with 10 μl of protein-separate, Packed in pure form (rTHY-lenveglrre), or with protein-And separate and 3 µg of purified fused protein CD4/immunoglobulin (created from Behring) (all gp120-design) if 4With in 12 hours on a rotary shaker. Then the granules conjugated with protein A, washed 5 times for 5-15 minutes each time. After OK is (all gp120-design) or 10% (rTHY-lenveg1rre) polyacrylamide gels with SDS (TRIS-buffer, pH 8.8 for the separating gel, TRIS-buffer, pH 8,6 to concentrating gel, TRIS-glycine buffer for electrophoresis, Maniatis et al., see above, 1989). Gels were fixed in 10% acetic acid and 10% methanol, incubated for amplification for 20 min, dried and exposed for 12 hours.

In this activity you used the following buffers and solutions: wash buffer (100 mm Tris, pH 7.5, 150 mm NaCl, 5 mm CaCl2, 1% NP-40); buffer for electrophoresis (5x) (125 mm Tris, 1.25 M glycine and 0.5% SDS); buffer for sample (10% glycerol, 4% SDS, 4%-mercaptoethanol, 0.02% of bromophenol blue).

Immunofluorescence

Cells T was transfusional by calcium phosphate coprecipitation and after 3 days were analyzed for surface expression of THY-1. After exfoliation using EDTA/PBS, cells were stained with a monoclonal antibody ox-7, dilution 1:250 in 4C for 20 min, washed with PBS and then incubated with diluted 1:500 anticorodal conjugated with FITC, antibodies goat to antiimmunoglobulin mouse. Cells were again washed, resuspendable in 0.5 ml of fixing solution and analyzed in the flow cytometer EPICS XL (Coulter).

In this activity you used the following retractor (2% formaldehyde in PBS).

ELISA

The concentration of gp120 in the culture supernatant was determined using tablets ELISA coated with CD4 and goat anti-gp120-anticorodal in the soluble phase. Supernatant cells T, transfetsirovannyh calcium-phosphate was collected after 4 days, centrifuged at 3000 rpm for 10 min to remove debris and incubated for 12 hours at 4With tablets. After 6 washes with PBS for 2 hours was added 100 μl of goat anti-gp120-antisera, diluted 1:200. The tablets were again washed and incubated for 2 hours with diluted 1:1000 anticorodal conjugated with peroxidase rabbit antibodies anti-goat IgG. Then these plates were washed and incubated for 30 min with 100 µl of substrate solution containing 2 mg/ml o-phenylenediamine in natriciteres buffer. At the end of this reaction was stopped with 100 ál of 4 M sulfuric acid.

The tablets were read at 490 nm using a spectrophotometer Coulter for microplates. Purified recombinant gp120IIb was used as control. This technique was used following buffers and solutions: wash buffer (0,1% NP40 in PBS); substrate solution (2 mg/ml o-phenylenediamine in natriciteres BU is placed on gp120 suggests, the replacement of non-preferred codons less preferred codons or preferred codons (and replacing less preferred codons preferred codons) to increase expression in mammalian cells of other proteins, e.g., other eukaryotic proteins.

Green fluorescent protein (GFP) from jellyfish Aequorea victoria (Ward, Photochem. Photobiol. 4; 1, 1979; Prasher et al.. Gene 111:229, 1992; Cody et al., Biochem. 32:1212, 1993) has attracted attention recently for its possible use as a marker or reporter for transfection and study of the genus (Chalfie et al.. Science 263:802, 1994).

Analysis of codon sets table use, constructed from native coding sequence of GFP, shows that GFP-codons prefer a or U in the third position. The offset in this case is favorable And less than the offset of gp120, but is essential. Was created a synthetic gene, in which the natural GFP sequence was reconstructed biotechnology in much the same way as for gp120 (Fig.11; SEQ ID NO:40). In addition, the translation initiation of the sequence of GFP was replaced with the sequence corresponding to the translation initiation consensus. The resulting expression of the resulting protein was pretensiously consensus translation initiation (Fig.10B and Fig.10C). She has also studied (Fig.10D) the effect of the inclusion of the mutation of Ser 65Thr, which reportedly improves the efficiency of the GFP excitation at 490 nm and therefore may be preferred for fluorescence microscopy (Heim et al.. Nature 373:663, 1995). Biotechnology codon significantly increases the efficiency of expression (joint percentage of cells clearly positive for transfection), and the combination of mutations Ser 65Thr and radonaway optimization leads to the encoding of a DNA segment perfectly visible marker of mammalian protein (FIG.10D).

The above sequence encoding a synthetic green fluorescent protein, was created in a similar way as gp120, of the six fragments of approximately 120 p. N. each, using the Assembly method, which depends on the ability of enzymes BsaI and BbsI split, except for their learning sequence. Synthesized long oligonucleotides, which contain part of the coding sequence of GFP, which is inserted into the flanking sequences encoding EcoRI and BsaI at one end and BamHI and BbsI - on the other end. Thus, each oligonucleotide has a configuration EcoRI/BsaI/GFP-fragment/BbsI/BamHI. KV, which could be used to connect adjacent GFP fragments. Each of these compatible ends was designed as a unique and do not semicomplete. Exemplary synthetic DNA fragments amplified by PCR were insertional between the EcoRI and BamHI in pUC9 and sequenced. Then the intact coding sequence was collected for the six ligating fragments using interceramic fragments obtained with BsaI and BbsI. Two of the six plasmids obtained by ligating, had to insert the correct size, and one contained the desired sequence of the full length. Mutation of Ser 65Thr was performed using the mutagenesis on the basis of PCR using a primer that overlaps unique BssSI website in this synthetic GFP.

Codon sets optimization as a method for improved expression in mammalian cells

The data presented here suggest that coding biotechnology sequence, re-created, may have General applicability to enhance the expression of eukaryotic genes, mammals and non-mammals, in mammalian cells. The results obtained C the interest protein from Aequorea victoria and the human Factor VIII (see below) suggest that optimization of codon sets can be a fruitful approach to improve expression in mammalian cells of a whole range of eukaryotic genes.

EXAMPLE III

The creation of a codon-optimized gene expression of human Factor VIII, no Central B-domain

Was created a synthetic gene that encodes a Mature human Factor VIII covering (residues 779-1658, including its predecessor), no amino acid residues 760-1639. This synthetic gene was created by selecting codons corresponding to codons that contribute effectively expressed human genes. Some deviation from the exact adherence to the preferred pattern of the residue was done to allow sigam splitting a unique restriction enzyme to be introduced along the entire length of this gene to facilitate future manipulation. To obtain this synthetic gene of this sequence was then divided into 28 slices 150 base pairs and 29-th segment of 161 base pairs.

Synthetic gene expressing human Factor VIII, no Central B-domain, was designed as follows.

eat in length 105 grounds and 3'-matrix oligonucleotides had a length 104 of the base (except the last 3'-oligonucleotide, which had a length of 125 residues). Matrix oligonucleotides were created so that each trigema pair consisted of one 5'-oligonucleotide and one 3'-oligonucleotide, creating 19 pronucleotides double-stranded region.

In order to facilitate PCR and subsequent operations, the 5'ends of oligonucleotide data pairs were designed invariant within the first 18 residues, taking into account the characteristic pairs of PCR primers used for amplification, and taking into account PCR conditions used for all couples. The first 18 residues of each 5'-member of a given matrix pairs represent SDS gaa ttc gga hell CCC (SEQ ID NO:110), and the first 18 residues of each 3'-member of a given matrix pairs represent ggg gat cct cac gtc tca (SEQ ID NO:43).

Pairs of oligonucleotides were annealed, and then was extended and amplified using a PCR reaction mixture as follows: matrix, each, annealed at 200 µg/ml of PCR buffer (10 mm Tris-HCl, 1.5 mm MgCl2, 50 mm KCl, 100 μg/ml gelatin, pH 8.3). PCR reactions contained 2 ng of the annealed matrix oligonucleotides, 0.15 ug of each of the two 18-dimensional primers (described below), 200 μm each of deoxynucleoside aq polymerase (2.5 units, a 0.5 μl; Boehringer Mannheim Biochemicals) amplification was performed on the amplifier Perkin-Elmer for 25 cycles (94C for 30 s, 55C for 30 s, and 72With over 30). The final cycle was performed with subsequent 10-min elongation at 72C.

Received amplificatoare fragments were treated with EcoRI and BamHI (cleavage fragments of the 5'- and 3'-ends) and ligated with pUC9-derived, cut with EcoRI and BamHI.

Individual clones sequenced and identified a collection of plasmids, corresponds to the full desired sequence. Then the clones were joined by multi ligating, given the benefit of the restriction sites at the 3'ends of the PCR primers adjacent to the amplified sequence. 5'-PCR primer containing a BbsI site, and 3'-PCR primer containing a BsmBI site, disposed so that the splitting of the corresponding enzymes occurred before the first nucleotide amplificare part and left 4 base 5'end of the ledge, created the first 4 bases of this amplificare part. Simultaneous treatment with BbsI and BsmBI each end, which contains no primerno sequence. Typically, these projections were not semicomplete, given the multi ligerie reactions, which form the desired product with high efficiency. The unique part of the first 28 amplified oligonucleotide pairs was 154 p. N. and after processing, each, led to the emergence of 150 p. N. fragment with unique ends. The first and last fragments has not been changed in this way, however, as they had in other sites of the restriction created in them to facilitate the insertion of the assembled sequence in an appropriate expression vector mammal.

Almost the Assembly process proceeded as follows.

Assembly of synthetic gene Factor VIII

Stage 1: 29 fragments collected with the formation of 10 pieces.

29 pairs of oligonucleotides, which formed segments 1-29 by mating grounds, described below.

Plasmids bearing segments 1, 5, 9, 12, 16, 20, 24 and 27 were treated with EcoRI and BsmBI and were allocated 170 p. N. fragments; plasmids bearing segments 2, 3, 6, 7, 10, 13, 17, 18, 21, 25 and 28 were treated with BbsI and BsmBI and were allocated 170 p. N. fragments; and plasmids bearing segments 4, 8, 11, 14, 19, 22, 26 and 29 were legirovanyh education segment "B"; fragments carrying the segments 9, 10 and 11, were legirovanyh with the formation of segment "C"; pieces, bearing the segments 12, 13 and 14, were legirovanyh education segment "D"; the fragments carrying the segments 16, 17, 18 and 19, were legirovanyh education segment "F"; fragments bearing segments 20, 21 and 22, were legirovanyh education segment "G"; the fragments carrying the segments 24, 25 and 26, were legirovanyh with the formation of segment "I"; and fragments, bearing segments 27, 28 and 29, were legirovanyh education segment "J".

Stage 2: the Assembly 10 of the obtained fragments in stage 1 in three fragments

Plasmids carrying the segments "A", "D" and "G" were treated with EcoRI and BsmBI, plasmids bearing segments, 15, 23 and I, were treated with Bbsl and BsmBI, a plasmid carrying the segments C, F and J were treated with EcoRI and Bbsl. Fragments carrying the segments a, b and C, were legirovanyh education segment "K"; pieces, bearing segments D, 15, and F, were legirovanyh education segment "On"; and fragments bearing segments G, 23, I, and J, were legirovanyh education segment "R".

Step 3: Assemble the three final pieces

The plasmids bearing segment, was treated with EcoRI and BsmBI, a plasmid that carries a segment About, were processed using BbsI and BsraBI, and plasmids nessu the p>Stage 4: Inserzione obtained synthetic gene in the expression vector mammal

The plasmids carrying the segment S, was treated with NheI and NotI and was insertional between suites NheI and NotI plasmids CD51Neg1 with the formation of plasmid cd51sf8b-.

Sequencing and correction synthetic gene for Factor VIII

After Assembly, the specified synthetic gene was that it had two unwanted residue that is encoded in the sequence. One of them was an Arg residue at 749 position, which is represented in GenBank sequences, originally entered from Genen-tech, but not in the order given Genentech in the literature. The other was an Ala-residue 146 position, which was to be Pro. This mutation on unidentified stage occurred after sequencing of 29 constituent fragments. Mutation Pro749Arg adjusted by incorporating the required changes in PCR-primer (ctg ctt ctg acg cgt gct ggg gtg gcg gga gtt; SEQ ID NO:44), which includes Mlul site at position 2335 in the following sequence (sequence segment from Hindi II to NotI) and amplification between this primer and the primer (ctg ctg aaa gtc tcc agc tgc; SEQ ID NO:44) 5' to the SgrAI site at position 2225. Then the SgrAI fragment-MluI inser the coherence was checked by sequencing.

Mutation Loaa was corrected by incorporating the required changes in the sequence of the oligonucleotide (DDS add tgc tta add hell DCA BCA cta tgg cca; SEQ ID NO:46), bearing the AflII site at residue 504, and the amplification of the fragment obtained from the PCR reaction between the oligonucleotide and a primer having the sequence ctg tgt tct tca tac gcg tct ggg gct cct cgg ggc (SEQ ID NO:109), cutting the obtained PCR pragmata with AflII and AvrII to balance 989, insertional fixed fragment into expression vector and confirmation of this design by sequencing.

The design is equivalent to the native gene expressing human Factor VIII, no Central B-domain

Expression plasmid with delegated domain equivalent Factor VIII with the native radonaway sequence, designed by Introduzione NheI at the 5'end of the Mature coding sequence using primers PIF CAA ggg cta BCA BCA ACC Ada Ada tac tac ctg ggt (SEQ ID NO:47), amplification between this primer and the primer att cgt agt tgg ggt tcc tct gga xag (corresponding to residues 1067-1093 the sequence shown below), cut with NheI and AflII (the remainder of 245 in the following sequence) and insertio In-domain was performed using the method of overlapping PCR using ctg tat ttg atg aga ACE g (corresponding to residues 1813-1831, below) and CAA das tgg tgg tgg ggt ggc att aaa ttg ctt t (SEQ ID NO:48) (complementary below remains 2342-2372) on the 5'-end overlap, and aat gcc ACC CCA CCA gtc ttg aaa cgc ca (SEQ ID NO:49) (2352-2380 in the sequence below) and cat ctg gat att gca ggg ag (SEQ ID NO:50) (3145-3164). Then the products obtained from two individual PCR reactions were mixed and reamplification by using the most remote from the centre of primers, receiving the fragment cleaved by Asp718 (isolator Kpnl, 1837 in the sequence below) and PflMI (3100 in the sequence below) and insertional appropriate split expression plasmid that carries native Factor VIII.

The full sequence (SEQ ID NO:41) native gene of the human factor VIII, delegated by the Central In-region, shown in Fig.12. The full sequence (SEQ ID NO:42) synthetic gene for Factor VIII, delegated by the Central In-region, shown in Fig.13.

Retrieval and analysis of gene-expression plasmids

Two independent plasmid isolation from natural and four independent isolates of synthetic Factor VIII expression plasmids were propagated in bacteria and their DNA was obtained by centrifugation in a solution with a gradient of floating CsCl density with subsequent phenol extraction.

< / the increase of Factor VIII, approximately, four times more than the natural gene.

Then COS cells were transfusional 5 µg of each design factor VIII in 6 cm Petri dish using DEAE-dextranomer method. 72 hours after transfection in each Cup was added 4 ml of fresh medium containing 10% calf serum, 12 hours later from each Cup took the sample environment. The samples were tested using ELISA using mouse monoclonal antibody to the antibody light chain of human factor VIII and conjugated with peroxidase polyclonal goat antibodies to antibodies to human factor VIII. Dedicated purification of human plasma factor VIII was used as standard. Cells transfetsirovannyh using synthetic gene construct of Factor VIII expressed 138±20,2 ng/ml (equivalent to ng/ml nudelatinomen Factor VIII Factor VIII (n=4), and the cells targetirovannye using natural Factor VIII gene, expressed 33,5±0.7 ng/ml (equivalent ng/ml adelecaroline Factor VIII Factor VIII (n=2).

To construct a synthetic gene for Factor VIII used the following oligonucleotide matrix.

Use

Synthetic genes of the present invention are suitable for expression of the protein, usually expressed in mammalian cells in cell culture (e.g., for industrial production of human proteins, such as hGH, TPA, Factor VIII and Factor IX). Synthetic genes of the present invention is also suitable for gene therapy. For example, a synthetic gene that encodes a selected protein can be introduced into a cell which can Express the protein to create cells that can be injected into a patient in need of this protein. Such techniques of gene therapy, based on the cell, well known to experts in the art, see, e.g., Anderson et al., U. S. Patent No. 5399349; Mulligan and Wilson, U. S. Patent No. 5460959.

Formula izobreteny what inetu, presented in SEQ ID NO: 40, in which at least one non-preferred or less preferred codon may be replaced by a preferred codon encoding the same amino acid, and these preferred codons selected from the group consisting of BCA, SBC, AAC, das, tgc, garden, DDS, CAC, atc, ctg, aag, ccc, ttc, agc, ACC, tac and gtg, these are less preferred codons selected from the group consisting of ggg, att, ctc, tcc, and agg gtc, and these non-preferred codons represent all other codons other than those specified preferred and less preferred codons, and specified synthetic gene can Express this protein at a level that is at least 110% of the level of expression of a natural gene in the cultural system of mammalian cells in vitro under identical conditions.

2. Synthetic gene under item 1, where the specified synthetic gene can Express this protein at a level that is at least 150% of the expression level of the specified nature of the gene in the cell culture system in vitro under identical conditions.

3. Synthetic gene under item 1, where the specified synthetic gene can Express this protein at a level that the Soim in vitro under identical conditions.

4. Synthetic gene under item 1, where the specified synthetic gene can Express this protein at a level that is at least 500% of the expression level of the specified nature of the gene in the cell culture system in vitro under identical conditions.

5. Synthetic gene under item 1, where the specified synthetic gene can Express this protein at a level that is at least 1000% of the expression level of the specified nature of the gene in the cell culture system in vitro under identical conditions.

6. Synthetic gene under item 1, where the specified synthetic gene contains less than 5 CG sequences.

7. Synthetic gene under item 1, where at least 10% of the codons in the specified natural gene are non-preferred codons.

8. Synthetic gene under item 1, where at least 50% of the codons in the specified natural gene are non-preferred codons.

9. Synthetic gene under item 1, where at least 50% non-preferred codons and less preferred codons represented in the specified natural gene replaced by the preferred codons.

10. Synthetic gene under item 1, where at least 90% non-preferred codons and less PI>11. Synthetic gene under item 1, where 20% of the codons are preferred codons.

12. Plasmid or virus expressing a vector containing a synthetic gene under item 1.

13. Expressing the vector for p. 12, where the specified vector is expressed in mammalian cells.

14. A method of obtaining a culture of cells of the mammal-bearing synthetic gene under item 1, providing for transforming mammalian cells expressing vector under item 12 or 13 and culturing the transformed specified cell in suitable conditions for obtaining this culture.

15. The method of obtaining synthetic gene green fluorescent protein under item 1, defining a non-preferred and less-preferred codons in the natural gene of green fluorescent protein and the replacement of one or more of these non-preferred or less preferred codons preferred codon encoding the same amino acid as the replaced codon.

 

Same patents:

The invention relates to medicine and relates to humanized antibodies that recognize the verotoxin II, and producing their cell line

The invention relates to the field of medicine and relates to methods of increasing the antigenicity and immunogenicity of biomaterial

The invention relates to microencapsulating secretory cells and the method of treatment of diseases caused by impaired functioning of the secretory cells

The invention relates to the field of veterinary biotechnology, namely, to obtain cell hybrids used in Virology and biotechnology research

The invention relates to medicine and relates to a method of production of viral antigens in vitro by infection of the tissues of the animal body, rich in mitochondria, virus, including hepatitis b virus (HBV), and cultivation of the infected tissue of the human virus

The invention relates to Virology, in particular to the field of cultivation of cells and tissues for the generation and study of viruses

The invention relates to biotechnology and represents the gene of the protein mass of 120 kDa Ehrlichia canis, amplificatory by PCR using primers derived from the DNA sequences flanking the gene of the protein mass of 120 kDa Ehrlichia chaffeensis

The invention relates to the field of genetic engineering and can be used in the biomedical industry for preparation of medicinal products for gene therapy

The invention relates to the medical industry and refers to polypeptides that are specific against CD19 and CD3, and their application

The invention relates to gene therapy and for the strengthening and limitations of gene expression

The invention relates to medicine and biotechnology and the human semaphorin L (H-Sema-L) and the corresponding semaphorins in other types

The invention relates to biotechnology and medicine and can be used for inhibition of cell proliferation

The invention relates to nucleic acid constructs, self-reinforcing component expression system
Up!