The promoter of the gene of human endoglin and its application

 

The invention relates to the field of genetic engineering and can be used in the biomedical industry for preparation of medicinal products for gene therapy. Obtained and characterized the promoter sequence of the gene endoglin person with high specificity against endothelial defined sequence fragments that retain the ability to function as full-length promoter. The proposed nucleotide structures in which under control of a new promoter or active fragment is the gene(s), the transcription of which(s) in endothelial cells, it is desirable to activate. By embedding the proposed structures in suitable vectors can be obtained medicines for the treatment of a wide range of human diseases. 3 S. and 9 C.p. f-crystals, 4 Il., 1 PL.

The present invention relates to the gene promoter of human endoglin or its functional parts and to its use for obtaining medicines.

One of the important problems of gene therapy is the regulation of transcription and translation of the effector gene, which is embedded in clickmotive or enhancer sequence - the coding sequence of the effector gene.

Under "promoter sequence" means a sequence that represents the segment of the gene, which may contact the regulatory proteins called transcription factors, which activate the transcription of the effector gene in the forward direction. These areas, which lie in the direction of transcription, called the "lower" sequences, while sequences that are in the opposite direction, called the "upper" sequences. Under the "effector gene" is usually understood as a gene, a structural gene, gene product which has, for example, the desired effect in terms of steps in gene therapy.

Such promoter or enhancer sequences can be necklace-specific, cell-specific, virus-specific, metabolically-specific or specific for the cell cycle. Examples of such promoter sequences and their application, for example, for gene therapy in various diseases are described in the patent applications WO 96/06940, WO 96/06938, WO 96/06941 and WO 96/06939. In addition, in these patent applications are methods and examples sodiciting cycle control effector gene.

Depending on the choice and combination of the promoters of the latter are the cause of greater or lesser restriction and/or more or less strong transcriptio effector gene, which depends on these promoters.

The endothelial cell is the best example of target cells for gene therapy, on the one hand, because endothelial cells are openly available for gene constructs, which is injected in the cardiovascular system, and, on the other hand, because they are directly involved in the development and progression of several diseases such as tumor diseases, inflammation, Allergy, autoimmune diseases, rejection reactions of organs and circulatory disorders and coagulation, as well as in the processes of wound healing and/or immediately adjacent to the location of these violations.

Typically, the target cell-specific promoters are the promoters of the genes for those proteins, which are formed especially aggressively or in a very large degree in the relevant the target cell. In the case of endothelial cells example of one of these proteins is endoglin.

Endoglin is not transmitting the signal receptor TGF(Gougos et al., J. Biol. Chem., 265, 8361 (1990), Chei, the n in the increased extent is expressed in proliferating endothelium (Westphal et al., J. Invest. Derm., 100, 27 (1993), Burrows et al., Pharmac. Ther., 65, 155 (1994)). Available information regarding the promoting strength and cell specificity is absent. Despite the fact that endogenous gene known for about 4 years (Bellon et al., (1993)), still failed to allocate endogenous promoter.

Bellon and other (Eur. J. Immunol., 23, 2340 (1993) described a cDNA sequence of human endoglin, while mouse endoglin described Ge and others (Gene, 138, 201 (1994)). Although there is information about the sequence for a portion of the 5’-noncoding region endokrinologa gene, nothing is known about the function of this region or promoter region.

Other endothelial cell-specific protein is a VEGF receptor. In this case, there are two receptor (Plate et al. Int. J. Cancer, 59, 520 (1994)): on the one hand, VEGF receptor 1 (flt-1) (de Vries et al., Science, 255, 989 (1992)), which contains the fms-like tyrosinekinase in cytoplasmic part, and VEGF receptor 2 (flk-1, KDR) (Terman et al., BBRC, 187, 1579 (1992)), which contains tyrosinekinase in the cytoplasmic part. Both receptors are found almost exclusively on endothelial cells (Senger et al., Cancer Metast. Rev., 12, 303 (1993)).

Other endothelial cleto the Development, 119, 957 (1993), Dumont et al., Oncogene, 7, 1471 (1992)) and receptor V (Eck receptor) (Bartley et al. Nature, 368, 558 (1994), Pandey et al.. Science, 258, 567 (1995), van der Geer et al., Ann. Rev. Cell. Biol., 10, 251 (1994)).

Other endothelial cell-specific proteins are: molecule B, which is the ligand for receptor V (Hoizman et al. J. Am. Soc. Nephrol., 4, 466 (1993), Bartley et al., Nature, 368, 558 (1994)), endothelin, in particular endothelin B (O'reilly et al., J. Cardiovasc. Pharm., 22, 18 (1993), Benatti et al., J. Clin. Invest., 91, 1149 (1993), O'reilly et al., BBRC, 193, 834 (1993)), the promoter sequence described in the work Benatti et al., J. Clin. Invest., 91, 1149 (1993), endothelin 1 (Yanasigawa et al., Nature, 332, 411 (1988)), the promoter sequence described in the work of Wilson et al., Mol. Cell. Biol., 10, 4654 (1990), endothelioma receptors, in particular the endothelin receptor B (Webb et al. Mol. Pharmacol., 47, 730 (1995), Haendler et al. J. Cardiovasc. Pharm., 20, 1 (1992)), mannose-6-phosphate receptors (Perales et al., Eur. J. Biochem., 226, 225 (1994)), whose promoter sequences described in the works of Ludwig and others (Gene, 142, 311 (1994)), Oshima and others (J. Biol. Chem., 263, 2553 (1988)) and Pohlmann and others (PNAS USA, 84, 5575 (1987)), and the factor a background of Villebranda (vWF), a promoter sequence which is described in the works Jahroudi and Lynch (Mol. Cell. Biol., 14, 999 (1994)), Ferria and others (Biochem. J., 293, 641 (1993)) and Aird and others (PNAS USA, 92, 4567 (1995)).

Other endothelial cell-specific proteins are IL-1 in the form of endotelialnami cells (Warner et al. J. Immunol., 139, 1911 (1987)) and a promoter sequence which is described in the works Hangen et al. Mol. Carcinog., 2, 68 (1986), Turner et al. J. Immunol., 143, 3556 (1989), Fenton et al. J. Immunol., 138, 3972 (1987), Bensi et al. Cell Growth Diff., 1, 491 (1990), Hiscott et al., Mol. Cell. Biol., 13, 6231 (1993) and Mori et al., Blood, 84, 1688 (1994), the receptor for IL-1, promoter sequence which is described in the work of Ye et al., PNAS USA, 90, 2295 (1993), and the factor vascular cell adhesion (VCAM-1), and the expression of VCAM-1 in endothelial cells activated by lipopolysaccharide, TNF-(Neish et al., Mol. Cell. Biol., 15, 2558 (1995)), IL-4 (Iademarco et al., J. Clin. Invest., 95, 264 (1995)) and IL-5 (Marni et al., J. Clin. Invest., 92, 1866 (1993)). The promotor sequence of VCAM-1 was described in Neish et al., Mol. Cell. Biol., 15, 2558 (1995), Ahmad et al., J. Biol. Chem., 270, 8976 (1995), Neish et al., J. Exp. Med., 176, 1583 (1992), Iademarco et al., J. Biol. Chem., 267, 16323 (1992) and Cybulsky et al., PNAS USA, 88, 7859 (1991).

Other endothelial cell-specific promoters are synthetic activator sequences, while synthetic activator sequences which are comprised of oligomerization binding sites for transcription factors, which are mainly or selectively active in endothelial cells, such as transcription factor GATA-2 binding site in which the gene of endothelin-1 is 5’-TTATT-3 is alternatively natural endothelialisation the promoters and specific brain endothelial glucose-1-vector, while endothelial brain cells characteristically, quite forcefully Express this vector to implement transendothelial transfer of D-glucose in the brain (Gerhart et al., J. Neurosci. Res., 22, 464 (1989)). The promoter sequence described by Murakami and others (J. Biol. Chem., 267, 9300 (1992)).

Being quite specific for endothelial cells, some of these promoters such as the promoter for the gene of the factor a background of Villebranda or the gene for VEGF-receptor 1 (flk-1), have, however, only relatively low activity. Although the activity of these "weak" promoters can be increased by connecting them with the main promoter (e.g., SV40), or enhancers, usually such a procedure leads to an accompanying drop in specificity.

The aim of the present invention is therefore, the search of the promoter, which is both strong and endothelialization.

Surprisingly, it was discovered that these properties, among others, has the promoter endokrinologa gene.

The present invention relates, therefore, to the promoter of the gene of human endoglin or its functional parts and options. Found that this promoter has a length of maximum 2415 base pairs (see t is the sequence.

To characterize the promoter of the present invention, the promoter sequence endokrinologa gene or portion thereof associated with a reporter gene (e.g. a gene coding for the enzyme luciferase) plasmid pGL3 (Promega) and endothelial cells (cell line ECV-304) and to compare cell cervical carcinoma (cell line HeLa) transfecting this design. Found, surprisingly, that endogenous promoter is 80 times stronger than the vWF promoter. This is surprising because vWF, as mentioned earlier, is expressed endothelialization and, therefore, one would expect that the activity endokrinologa promoter will be the same as y vWF-promoter. Also found that endogenous promoter is approximately 30 times more active in endothelial cells than in the cells of cervical carcinoma. This is surprising because vWF-promoter, who is also endothelialization, has a similar activity in the cells of cervical carcinoma and endothelial cells. Therefore, endogenous the promoter of the present invention is clearly superior to the vWF promoter-gene both in relation to the strength and specificity for endothelial function.

Also discovered that part of the promoter posledovatel the th.

So, get the following values of relative (with respect to the activity of the SV40 promoter as standard) activity in endothelial cells to cut from the 5’-end design promoter endokrinologa gene.

The term "functional part of promoter" is understood as denoting all incomplete sequence of the promoter according to the invention, which have promoter activity, in particular incomplete sequence approx. from 1 to approx. 2378, approx. from 36 up to approx. 2378, approx. from 470 up to approx. 2378 and approx. from 948 to approx. 2378, as well as partial sequences of approx. from 36 up to approx. 2415, approx. from 470 up to approx. 2415 and approx. from 948 to approx. 2415, preferably an incomplete sequence approx. from 470 up to approx. 2415 and approx. from 470 up to approx. 2378. Incomplete sequence with promoter activity, also extend, for example, approx. from 1310 to approx. 2415, approx. from 1310 to approx. 2378, approx. from 1847 up to approx. 2415 and approx. from 1847 up to approx. 2378.

However, the present invention is not limited to the promoter depicted in the placenta. No. 1, and its functional parts, but also includes options that obladania one or more grounds preferably approx. from 1 to approx. 50 bases, in particular approx. from 1 to approx. 25 bases, especially approx. from 1 to approx. 5 grounds. Promoter activity can be easily measured, for example, using the described luciferase analysis.

The present invention also relates to the nucleotide structure, which contains,

a) at least one nucleotide sequence of the promoter according to the invention (component a)) and in the appropriate case,

b) at least one effector gene (component b)), and transcription of the effector gene is activated component (a).

Component a) preferably is located against the course of transcription component b).

The present invention also relates to nucleic acid constructs in which the promoter sequence endokrinologa gene according to the invention is connected to another target cell-specific, virus-specific, specific metabolism or specific for the cell cycle promoter sequence and at least one effector gene, in which the combination of promoter sequences regulates the activation of transcription of at least one of effecta design" is understood as denoting man-made structures, which are composed of nucleic acid and which can be transcribing in target cells. They are preferably inserted into a vector, such as non-viral vectors, such as plasmids or viral vectors. The specialist in this field of technology is familiar with obtaining non-viral vectors and viral vectors.

The present invention also relates to cells that Harbor nucleotide structure according to the present invention.

In General, the choice of effector gene depends on the disease that is treated with gene construct.

Examples of such effector genes for the treatment of neoplastic diseases, leukemias, autoimmune diseases, allergies, arthritis, inflammatory diseases, rejection of organs, reactions "graft vs. host diseases of the blood coagulation system cardiovascular diseases, anemia, infections or lesions of the Central nervous system are described in detail in the patent applications WO 96/06940, WO 96/06938, WO 96/06941 and WO 96/06939.

For example, effector genes corresponding to the present invention, encode a cytokine, chemokine, growth factor, receptor for a cytokine, a receptor for the chemokine or receptor for a growth factor and a cytokine antagonist, a protein that induces citistat, zitotoksicescoe blood, fibrinolytic protein, an enzyme that cleaves precursor drugs, forming by this drug, a protein that affects the circulation, or an antigen of an infectious pathogen that causes an immune response.

A nucleotide construct according to the invention can also contain two or more identical or different effector genes, which are connected to each other through a promoter sequence or an internal ribosomal aminoaniline sites (IRES). Their examples are provided in the above-mentioned patent applications.

Nucleotide structure according to the present invention can be used, for example, for gene expression only cell-specific for endothelial cells in a manner or cell-specific for endothelial cells and is specific for the metabolism method, cell-specific for endothelial cells and specific cell cycle and/or cell-specific for endothelial cells and virus-specific, and the gene is preferably a gene which encodes a pharmacologically active compound, or an enzyme that cleaves the inactive pre

Preference is given to using the nucleotide constructs of the present invention to obtain drugs for the treatment of the above diseases, and the specified receiving pharmaceuticals usually involves cloning the nucleotide construct in a suitable vector, which is then, for example, is administered to the patient. The specialist in this field of technology is familiar with other applications of the promoter of the present invention or nucleotide constructs of the present invention.

The example below together with the table and drawings is intended for a more detailed description of the invention without limitation.

The table description and drawings

Table 1. The sequence of the promoter of the human endoglin. Base pair 1 corresponds to the region of sequence that is located furthest from 5’. Highly conserved sequence A1u is located in the area of base pairs 1360-1666, while homology with documented cDNA M. musculus begins at the 3’-region from base pair 2300 and documented part of the cDNA N. sapiens (5’-noncoding region) begins at base pair 2379.

Fig.1. Cloning of promoter h is the website of the TA cloning vector pCR 2.1 (Invitrogen). In: the fragment containing the promoter of the human endoglin, exclude from design pCR 2.1 Endo enzymes M1uI and Xhol and clone into the luciferase reporter vector pGl3 (Promega).

Fig.2. Luciferase activity of different endothelial cell-specific promoters. All promoters clone in pGl3 and all values standardize with respect to the main promoter of SV40. SV40: the main promoter of SV40 without enhancer. PGL3Endo: endogenous promoter (see Fig.1B). Enhancer vWF+SV40: the promoter of the factor a background of Villebranda, reinforced by the SV40 enhancer in the opposite direction, flk-1 promoter for VEGF receptor flk-1 (-224/starting from ATG). vWF: promoter factor von Willebrand's disease (-487 to+247) without additional enhancers.

Fig.3. Luciferase activity of the promoter of the human endoglin in endothelial and endothelially cells. The designs are the same as in Fig.2. Standardized relative to the main SV40 promoter activity endokrinologa promoter in endothelial cell line ECV304 compared with its activity in the cell lines HeLa cervical cancer. In this analysis, the activity in the cells ECV304 approx 29 times higher than in HeLa cells.

Fig.4. Putative binding sites for transcription factors on endogenous the promoter. Pakasai.

Example

For cloning of the promoter used set for walks DNA PromoterFinder(Clontech). Using this set fragment of approx. 2.4 thousand base pairs documented sequence of 5’-noncoding region of cDNA of human endoglin amplified in two stages PCR using two especifically nucleating

E1: GCTGGGCTGGAGTTGCTGTCCGAAGGATC (serial no.2) and

E2: AATGGATGGCAGTCACAGCAGCAGTCCTG (afterbirth. No. 3).

The PCR conditions in this case are as follows.

1. PCR: the Seed E1 - 25 s at 94C, 25 s at 94C, 20 s at 63C, 4 min at 68C, 39 cycles of 4 min at 68C.

2. (Nested) PCR: the Seed E2 - 25 s at 94C, 25 s at 94C, 20 s at 61C, 4 min at 68C, 26 cycles of 4 min at 68C.

Polymerase: a System for long PCR matrix Expand(Boehringer Mannheim).

The PCR fragment purified on spin columns (QIAquick(Qiagen) and inserted into the cloning vector of THE set of Original TA Cloning(Invitrogen)). This design pCR 2.1 Endo (see Fig.1A) Selina (sequence, see tab.1).

The cloned region of this vector clone in luciferase reporter vector, i.e., pGL3 (Promega), and try it on promoter activity, as the design pGL3Endo (see Fig.1B), in HeLa cells and ECV304.

Cells transfection or using the method of DEAE/dextran (based on the method of Sompayrac et al., PNAS, 78, 7575 (1981)), or using LipofectAMINE(Gibco BRL). As standard transfection the main promoter of SV40 as well as design pGL3Endo; also transfection promoter flk-1-(VEGF) (-225/starting with ATG), and the promoter factor von Willebrand's disease (vWF) (-487 to+247) with or without the SV40 enhancer. This last vWF-promoter construct that contains the SV40 enhancer, characterized in that its activity is considerably higher than the activity of promoter wild type, while its selectivity, albeit reduced, but not destroyed. All designs clone in pGL3 and analyze with luciferase as described Herber and others (Oncogene, 9, 1295 (1994)) and Lucibello and others (EMBO J., 14, 132 (1995)).

Luciferase activity of different promoters in ECV304 cells (Fig.2) shows that the cloned fragment of the 5’-region endokrinologa gene has promoter activity. This activity is very high when compared with the activity of other typical endotel eight times higher than the activity of the vWF promoter. Activity design pGL3Endo is higher even when the vWF promoter reinforce enhancer sequence of SV40. These data confirm that the cloned region is the promoter of the gene of human endoglin.

In Fig.3 shows a comparison of activity endokrinologa promoter in cells ECV304 with its activity in cell lines of cervical cancer HeLa. By standardizing on the main SV40 promoter activity in cells ECV304 about 29 times higher than in HeLa cells. This indicates that the cloned promoter not only active in endothelial cells, but is also selective for these cells.

In Fig.4 shows the putative binding sites for transcription factors on endogenous the promoter. Some highly homologous potential binding sites, which may be responsible for the selectivity and activity of the promoter and which include several conservative binding sites of NF-KB, are located in the area between conservative Alu sequence and documented cDNA.

Claims

1. The promoter of the gene of human endoglin having the sequence SEQ ID No. 1, or functionality from 36 to 2415, from 470 to 2415, from 948 to 2415, from 1310 to 2415, or from 1847 until 2415 nucleotide SEQ ID No. 1.

3. Nucleotide structure, designed for the regulation of transcription of the effector gene in endothelial cells, containing the promoter under item 1 or 2 and at least one effector gene, and the promoter sequence associated with the sequence of the effector gene to activate transcription of the latter.

4. Nucleotide structure on p. 3, characterized in that the promoter sequence of the human endoglin is located above the effector gene.

5. Nucleotide structure under item 3 or 4, characterized in that it further includes at least one activating sequence, and specified additional activating sequence selected from the group consisting of virusspecific specific to metabolism, cleocinonline and specific to cell cycle sequences.

6. Nucleotide structure according to one of paragraphs.3-5, characterized in that the nucleotide sequences are DNA.

7. Nucleotide structure according to one of paragraphs.3-6, designed for embedding in vector.

8. Nucleotide structure on p. 7, characterized in PP.3-8, wherein said effector gene is a gene that encodes an active compound which is selected from the group consisting of cytokines, chemokines, growth factors, receptors for cytokines, receptors for chemokines, receptors for growth factors and cytokine antagonists, proteins with antiproliferative or cytostatic or apoptotic action of antibodies, fragments of antibodies, inhibitors of the development of blood vessels, clotting factors, inhibitors of blood coagulation, fibrinolytic proteins, the enzyme that cleaves precursor drugs, with education, and through this, drug, protein, has effect on blood circulation, or antigen of an infectious pathogen that causes an immune response.

10. Nucleotide structure according to one of paragraphs.3-9, characterized in that it contains several effector genes that are associated with each other through a promoter sequence or internal binding sites of the ribosome (IRES).

11. Nucleotide structure according to one of paragraphs.3-10, characterized in that is used for preparing medicines for treating sableman the th, skin manifestations in articular diseases, inflammation, rejection of organs, reactions “graft versus host”, blood coagulation disorder, cardiovascular disease, anemia, infections, and Central nervous system.

12. Line of endothelial ECV304 cells transformed by the vector pGL3 Endo containing a nucleotide construct according to any one of paragraphs.3-10 used for deposition of the named nucleotide structure.

 

Same patents:

The invention relates to the medical industry and refers to polypeptides that are specific against CD19 and CD3, and their application

The invention relates to biotechnology and can be used to create a functioning tyrosine-specific chimeras proteinkinase

The invention relates to medicine and concerns transducers cytochrome P450 retroviral vectors

The invention relates to new viral vectors

The invention relates to medicine, namely to a method for detection of N-terminal Pro-MNE, recombinant N-terminal Pro-MNE, its use as a standard in detection of N-terminal Pro-MNE, as well as antibodies that recognize the recombinant N-terminal Pro-MNEs, and their reception

The invention relates to the medical industry and refers to polypeptides that are specific against CD19 and CD3, and their application

The invention relates to gene therapy and for the strengthening and limitations of gene expression

The invention relates to medicine and biotechnology and the human semaphorin L (H-Sema-L) and the corresponding semaphorins in other types

The invention relates to biotechnology and medicine and can be used for inhibition of cell proliferation

The invention relates to nucleic acid constructs, self-reinforcing component expression system

The invention relates to the field of molecular biology and genetic engineering and can be used in medicine
Up!