Recombinant vector that expresses the polypeptide with the activity of glucose oxidase, the transformed strain of saccharomyces cerevisiae, recombinant polypeptide with the activity of glucose oxidase and method thereof

 

The invention relates to biotechnology and can be used to produce glucose oxidase. Recombinant vector for expression of the polypeptide with the activity of glucose oxidase (GO) contains the nucleotide sequence encoding the polypeptide or its mutein, having a Ser at position Cys at amino acid residue 521, and operatively associated regulatory sequences. Designed vector transformed cells, in particular cells of Saccharomyces cerevisiae. Recombinant polypeptide with the activity of TH is obtained by culturing transformed cells. The invention allows to obtain a glucose oxidase from mushrooms recombinant means. 4 C. and 6 C.p. f-crystals, 17 tab., 5 table.

Methodological region

The present invention relates to the use of recombinant DNA technology to obtain proteins for industrial use. More specifically, the present invention relates to recombinant vectors containing polynucleotide originating from fungi, which encodes the glucose oxidase and the production of glucose oxidase from host cells transformed with expression vectors containing this polynucleotide.

Prerequisites

Methods gene is about, that the same methods can be applied on a large scale in the production of enzymes that are important to other industries. The benefits of obtaining a commercially useful processes through genetic engineering, is expected to include a reduction in the cost of obtaining enzyme, obtaining enzymes in safe organisms, which is good for food, and specifically genetic modification on the genomic level, luchshaya properties of the enzyme, such as stability and performance, as well as those that facilitate purification of the enzyme.

Glucose oxidase is an enzyme that catalyzes the oxidation of glucose to gluconic acid with the concomitant formation of hydrogen peroxide. The enzyme has many industrial applications, including its use in bessarione eggs in removing oxygen from beverages, wet food /flavour/ and sealed packages of food, and in the definition and evaluation of glucose in the industrial solutions and in such body fluids as blood and urine.

Glucose oxidase was first isolated from cells of Aspergillus niger Muller /Biochemische Zeitschrift /1928/, 199, 136-170 and /1931/, 232, 423-424/ and was also isolated from A. niger Franke and Defparam /Annalen der Chemie /1939/, 541, 117-150/. Products Glossa No. 2482724. The preparative method of obtaining glucose oxidase, which podocerus the glucose oxidase /TH/ line genera Aspergillus and Penicillum cultivated in an environment that has low carbohydrate content, is described in U.S. patent No. 3701715. The enzyme from Aspergillus niger /A. niger was purified to high purity and reportedly has a mol. weight. approximately 150,000, isoelectric point of 4.2 and content of flavinadeninnukleotid /FAD/ - 3 FAD in mol /Pazur and Kleppe /1964/ Biochemistry 3,578-583/. Also known amino acid composition of the enzyme from A. niger and its glycoprotein nature /Pazur and others, /1965/, Aroh. Biochem. Biophys III, 351-357/. However, unknown to any amino acid sequence, neither the nucleotide sequence encoding it.

The problem with using TH isolated from its natural source, is that the organisms that produce the enzyme may have contamination harmful to the individual applications of the desired enzyme. For example, TH is used for commercial food preparation. However, A. niger, which is the main source of commercially prepared enzyme, strongly allergenic and is not suitable for use in food. Moreover, the procedure is hard scrubbing can be relatively expensive, because TH is is istemek.

Enzymes of fungi have been expressed in recombinant vectors. Glucoamylase from Aspergillus /Innis and others, /1985/, Science 228, 21-26/ and endoglucanases from 1 brichoderma rusei (van Arsdelf etc., /1987/, Biotechnology. the ceiling of 5.60-64/ were expressed in Saccharomyces cerevisial.

The links cited in the following text

References Cited in the Following Text

Barr et al. (1986), Biotechniques 4, 428.

Boel et al. (1984), Embo J. 3, 1581.

Botstein et al. (1979), Gene 8: 17.

Broach (1981), in MOLECULAR BIOLOGY OF THE YEAST SACCHAROMYCES, vl. 1, p. 445.

Chang et al. (1977) Nature 198, 1056.

Chirgwin et al. (1979), Biochemistry 18, 5294.

Clewell et al. (1969), Proc. Natl. Acad. Sci. USA 62, 1159.

Clewell et al. (1972), J. Bacteriol. 110, 667.

Cohen (1972), Proc. Natl. Acad. Sci. USA 69, 2110.

De Voeg et al. (1983), Proc. Natl. Acad. Sci. USA 292, 128.

Edge (1981) Nature 292, 756.

Ehrhart and Hollenberg (1983), J. Bacterio1. 156, 625.

Gate, ed. (1984), OLIGONUCLEOTIDE SYNTHESIS.

Glisin (1974), Biochemistry 13, 2633.

Glover, ed. (1985), DNA CLONING vol. 1 and vol 2.

Goeddel et al. (1980), Nucleic Acids Res. 8, 4057.

Graham and Van der Eb (1978), Virology 52, 546.

Grunstein and Hogness (1975), Proc. Natl. Acad. Sci. USA 73, 6961.

Hames & Higgins, eds. (1985), NUCLEIC ACID HYBRIDIZATION.

Hammerling et al. (1981) MONOCLONAL ANTIBODIES AND T-CELL HYBRIDOMAS.

Hess et al. (1968), J. Adv. Enzym Reg. 7, 149.

Hinnen et al. (1978), Proc. Natl. Acad. Sci. USA, 75, 1929.

Hitzeman (1980), J. Biol. chem. 255, 2073.

Holland (1978), Biochemistry 17, 4900.

Holland (1981) J. Biol. chem. 256, 1385.

Huynh et al. (1985), DNA CLONING, A PRACTICAL APPROACH (D. M. Glover, ed., IRL Press, PP. 47-78).

Innis et al. (1985), Science 228, 21.

Jay et al. (1984), J. Biol. Chem. 259, 6311.

ll annd Weiland (1982), Biotech. Bioeng. 24, 1911.

Maniatis et al. (1982), MOLECULAR CLONING: A LABORATORY MANUAL.

Maxam et al. (1980), Methods in Enzymology 65, 499.

Messing et al. (1981), Nucleic Acids Res. 9, 309.

Messing (1983), Methods in Enzymology 101, 20-37.

METHODS IN ENZYMOLOGY (Academic Press, Inc.).

Miller and Calos, eds. (1987), GENE TRANSFER VECTORS FOR MAMMALIAN CELLS (J. N. Miller and M. P. Calos, eds., Cold Spring Harbor Laboratory).

Nambair et al. (1984), Science 223, 1299

Pazur and l (1964), Biochem. 3, 578.

Perbal (1984), AND PRACTICAL GUIDE TO MOLECULAR CLONING.

Poznansky et al. (1980) in DRUG DELIVERY SYSTEMS (R. L. Juliano, ed., Oxford, N. Y. 1980).

Poznansky et al. (1984), Phar. Revs. 36, 277.

Sanger et al. (1977), Proc. Natl. Acad. Sci. USA 74, 5463.

Schreier et al. (1980), HYBRIDOMA TECHNIQUES.

Scopes (1987), PROTEIN PURIFICATION, PRINCIPLES AND PRACTICE, 2nd edition (Springer-Verlag).

Shimatake et al. (1981) Nature 292, 128.

Taylor et al. (1985), Nucl. Acids Res. 13, 8749.

Travis et al. (1985), J. Biol. Chem. 260, 4384-4389.

Urdea et al. (1983), Proc. Natl. Acad. Sci. USA 80, 7461.

Warner (1984), DNA 3, 401.

Wood et al. (1985), Proc. Natl. Acad. Sci. USA 82, 1585.

Zoller (1982), Nucleic Acids Res. 10, 6487.

Disclosure of the invention

The present invention provides a cDNA sequence encoding the glucose oxidase /TH/ of the fungal source of the genus Aspergillus, more specifically from A. niger. The knowledge of this sequence makes possible the expression in recombinant systems of polypeptides that are substantially similar to, including, analogues, and fragments. Surprisingly, a relatively large amount of enzyme produced and with the us under the conditions allowing the expression of the enzyme. Secretion can be controlled either yeast secretory sequence, or preprofessionals TH encoded in A. niger.

The cDNA sequence provided here also allows the selection of sequences, coding, from other sources, which can also be used to produce recombinant TH. These other sources can be of any origin, in which nature is encoded enzyme, but should be mainly fungal sources, in which TH is the coding sequence contains at least 8 base pairs, preferably 20 base pairs, and even more preferably at least 40 base pairs that are highly homologous /i.e. have a maximum of 1 nucleotide substitution in complementary sequence/ sequence of Fig. 5V. On the other hand, isolated from a source other than A. nider, a sequence can have at least about 4 amino acids, homologous sequence ON A. niger encoded by cDNA of Fig. 5V.

Were investigated polypeptides expressed in yeast transformed with expression vectors encoding cDNA, and received a surprising lighting paint is aptidon little effect on the enzymatic activity compared to the natural, but that recombinant product has increased thermostability.

Another surprising result is that the removal of carbohydrate residues as recombinante-received, and native not inhibited, apparently, fermentativnuyu activity.

Another surprising result is that although natural is present in A. niger in relatively large quantities, encoding its mRNA are relatively rare in the cells of A. niger during the phase of logarithmic growth.

And another surprising result is that similar, i.e. mutein, has increased thermostability relative to the natural molecule of A. niger and its recombinant counterpart expressed in yeast.

Accordingly, one aspect of the invention, the vector is a recombinant containing the polynucleotide sequence encoding the polypeptide substantially similar to the glucose oxidase /TH/, substantially free from other vectors, not coding.

Another aspect of the invention is a host cell transformed with recombinant polynucleotide sequence that encodes a polypeptide that is substantially similar to TH.

And another aspect of the invention is unnatural, significantly SGAs consisting of:

a) obtaining a population of transformed cells containing the recombinant vector comprising the coding sequence for a polypeptide that is significant similar to TH, operationally associated with sequences that allow expression of the specified coding sequence in said cells;

b) growing a specified population of transformed cells under conditions when the specified polypeptide that is substantially similar to the FIRST, is expressed;

C) the allocation of the specified polypeptide that is substantially similar to TH.

Brief description of drawings

Fig. 1 shows the amino acid sequence of the natural from A. niger.

Fig. 2 shows the oligonucleotide probes derived from the amino acid sequence of the natural from A. niger for screening sequence that encodes a TH.

Fig. 3 shows a 42-membered samples long7 and long8 and their relationship with the breakdown long6.

Fig. 4B shows the cDNA sequence in clone 4, obtained from this amino acid sequence and location of restriction sites.

Fig. 5B shows the sequence of complex cDNA coding from A. niger obtained from this amino acid sequence and risposte, derived from complex cDNA shown in Fig. 5B, and the use of codons.

Fig. 7 shows the nucleotide sequence 5'-region of the gene from A. niger.

Fig. 8 shows a circuit construction of expression vectors p.AB24AGSGOGO and pAB24AGAlphaGO.

Fig. 9 - map of the significant sites of the Shuttle vector raw.

Fig. 10 shows a polyacrylamide gel in which electrophoretic separated partially purified recombinant TH when TH was treated in the presence and in the absence of endoglycosidase N.

Fig. 11 - map SGO-2, showing certain essential features, including sites of restriction.

Fig. 12 - card pSGO-1, showing some of the essential features, including sites of restriction.

Fig. 13 is a graph showing the stability in time of the polypeptide, expressed in yeast with pAB24AGS6O in comparison with the natural from A. niger.

Fig. 14 is a graph showing the stability in time mutein encoded C521S and expressed in yeast compared to the natural from A. niger.

Fig. 15 - restricta card clone.

Fig. 16 shows a partial nucleotide sequence of genome segment P. amagasakiense in clone pBRpGxA11, also shows the amino acid and plays the guitar and sings the genomic insertion P. amagasakiense in pBRpGA11 with the amino acid sequence TH A. niger encoded by the nucleotide sequence shown in Fig. 5V.

Ways of carrying out the invention

Definition

1. In the description of the present invention will use the following terminology in accordance with the definitions presented below.

As used here, the term “glucose oxidase” refers to a polypeptide that catalyzes the oxidation of glucose to gluconic acid with the concomitant formation of hydrogen peroxide. The methods for determining the activity of glucose oxidase are known and include, for example, colorimetric analysis, in which glucose oxidase is associated with the system peroxidase-o-dianisidine. This type of analysis system discussed in example IV.

The term “recombinant polynucleotide”, as used here, describes polynucleotide, useful for production, means polynucleotide source: genome, cDNA, semisynthetic, or synthetic, which through the source or manipulation: 1/ are not associated with all or part of polynucleotide with which it is associated in nature and/or 2/ is associated with a different polynucleotides than the one with which it is associated in nature, or 3/ does not exist in nature.

The term “polynucleotide”, as is ribonucleotides. This term refers only to the primary structure of the molecule. Therefore, the term includes 2 - and 1-stranded DNA, and 2 - and 1-stranded RNA. It also includes modified, for example, methylation, phosphorylation and /or kapinga and unmodified forms of polynucleotides.

“Replicon” is any genetic element, such as a plasmid, chromosome, virus that behaves as an Autonomous unit of polynucleotide replication within a cell, i.e., capable of replication under its own control.

“Vector” is a replicon, which is embedded in another polynucleotide segment to report made to the segment capacity for replication and/or expression.

“Kontroliruya sequence” refers to polynucleotide sequences which are necessary to effect the expression and/or secretion of coding sequences to which they are adjusted. The nature of such control sequences differs depending on the host organism: in prokaryotes, such control sequences in General include a promoter, the binding site of the ribosome and terminators; in eukaryotes, generally, such control sequences include promoters, ruminatory and in some of the expressed polypeptide from the host cell. The term “regulatory sequence” is intended to include, as a minimum, all components whose presence is necessary for expression, and may also include additional components whose presence is desirable, for example, a leader sequence.

“Operationally linked” refers to the neighborhood, where the components described thus, interact, allowing them to operate in an inherent manner. Controlling the sequence “operationally linked” to the coding sequence, Legerova in such a way that expression of the coding sequence is achieved under conditions of joint with regulatory sequences.

“Open reading frame” - district polynucleotide sequence that encodes the polypeptide; this area may be a part of the coding sequence or the entire coding sequence.

“Coding sequence” is a polynucleotide sequence that is transcribed into mRNA and/or translated into a polypeptide, being placed under the control of suitable regulatory sequences. The boundaries of the coding sequence are determined starting codon translateanimation polynucleotide sequence, but not limited to.

“Recombinant host cells”, “host cell”, “cell”, “cell line”, “cell culture” and other terms that define the microorganism or cell line of higher eukaryotes, cultured in unicellular form, are used interchangeably and refer to cells that can be or have been, used as recipients for recombinant vector or other portable polynucleotides and include the progeny of the original cell which has been transformed. It is clear that the offspring of a single parent cell may not necessarily be completely identical in morphology or in genomic aspect or aspect of the total DNA, the original parent, due to accidental or intentional caused by mutations. The progeny of the parent cell, which is essentially the original with a parent can be characterized by ostyvshemu property, such as the presence of the nucleotide sequence that encodes a desired peptide is included in the offspring, implied by this definition, and is covered by the above terms.

“Transformation”, as used here, refers to the introduction of exogenous polynucleotide in the host cell without regard to method, I & d can be supported as at vector, for example, a plasmid, or alternatively may be integrated into the host genome.

As used here, the term “polypeptide” refers to amino acid product having the sequence encoded in the genome, and is not related to a specific length of the product, i.e., peptides, oligopeptides and proteins are included within the definition of polypeptide. This term also does not apply to postexplosion modifications of the polypeptide, such as glycosylation, acetylation, phosphorylation, sililirovanie etc.

The term “polypeptide substantially similar to glucotoxicity or TH” refers to forms of TH non-natural origin, for example, in relation to posttranslational modifications, including glycosylation, phosphorylation, etc., but which have the same amino acid sequence that native, analogues, fragments, analogs, fragments, and fusion proteins, where, or similar, or a fragment fused with another polypeptide with which it is not usually merged in nature. “Similar TH” or “fragment of TH” -- one that has homology with native or comparable fragment more than about 70% amino acid sequence, and preferably more than about 80%. This term also vklucheniya, which is known, for example, non-natural amino acid, etc., Polypeptides that are analogs or fragments, can be or not to be “active”. “Active” polypeptide such that with appropriate cofactors and substrates is catalyzed reaction, in room natural catalyzed by the enzyme isolated from Aspergillus. “Inactive" polypeptide is one that has lost the natural activity or whose natural activity was significantly changed in terms of product education /type, or a number/, but which has at least the higher the degree of amino acid sequence homology with natural or with comparable fragment. Methods for determining the forms and analogues TH unnatural origin is known. Forms and analogues TH unnatural origin can be detected, for example, by changes in the binding of various chromatography materials and elution with them and their passage through electrophoretic gels. In addition, analogues of TH can be detected, for example, by comparison of amino acid sequences.

One type analog ST - polypeptide in which one or more are present in the normal cysteine residue replaced and famous.

As used here, the term “hyperglycosylated TH” refers to TH, which contains additional residues of carbohydrates on the number of carbohydrates associated with the natural. Methods of determining whether the polypeptide is greater than or less carbohydrates, are known and include, for example, a number of techniques, witness for the difference in molecular weight of the modified polypeptides /for example, polyacrylamide gel electrophoresis in the presence of DDS-Na, as described by laemmli's method and passing through a column containing materials - molecular sieve /for example, Sephadex, as well as methods based on affinity or loss of affinity between carbohydrate groups and materials that bind carbohydrates.

The wild-type polypeptide”, which has the amino acid sequence, identichno sequences encoded in the genome of the organism that is the source of the encoded sequence.

“Natural” and similar terms refer to TH isolated from a fungal source, in which she in norm is produced in nature, originating from the nature of the genome.

“Unnatural polypeptide” refers to a polypeptide that is produced in the host, rather than taki that will blow no more than 1 nucleotide violations pairing of two complementary sequences. Conditions for hybridization and washing of various degrees of severity is known to the experimenters and are discussed, for example, in Maniatis, etc. /1982/.

As used here, “yeast” includes ascospores yeast /Endomycetales/, basidiospores yeast, and yeast belonging to the imperfect fungi (Blastomycetes). Ascospores yeasts are divided into two families, Spermophthraceal and Saccharomycetaceae. The latter is represented by four subfamilies, Schizosaccharomycoideae /for example, genus Schizosaccharomycoideae/, Nadsonioideae, Lipomycoideae Saccharomycoideae /for example, genera Pichia. Kluyverosnyces and Saccharomyces/. Basidiospores yeasts include the genera Leucosporidium, Rhodosporidium, Sporidiobolus, Filobasidium and Filobasidiella.

Yeast belonging to the imperfect fungi are divided into two families, Sporobolomycetaceae /for example, genera Sporobolomyces, Bullera (e.g., genus Candida). Of particular interest for this invention are species of the genera Pichia, Kluyveromyces, Saccharomyces, Schizosaccharomyces and Candida, specifically interesting Saccharomyces species S. cervisiae, S. carlsbergiensis, S. diastaticus, S. dougbasii, S. Kluyveri, S. norbensis, and S. oviformis. Species of particular interest in the genus Kluyveromyces, include the K. lactis. Since the classification of yeast in the future may vary, for the purposes of this invention, yeast shall be defined as described in BIOLOGY AND ACTIVITIES OF YEAST (F. A. Skinner, S. M. Passmore, R. R. Davenport, eds. 1980) (alogia yeast and manipulation of yeast genetics. See, for example, BIOCHEMISTRY AND GENETICS OF YEAST (M. bacila on, B. L. Horecker, A. O. M. Steppany eds. 1978; THE YEAST (A. H. ROSE and J. S. Harrison, eds. 2nded., 1987) and THE MOLECUZAR BIOLOGY OF THE YEAST SACCHAROMYCES (Strathern et al. eds.).

As used here, “fungi” include classes Phycomycetes, Ascomycetes, Basidiomycetes and Deuteromycetes. Representative of the Phycomycetes group include, for example, Rhizopus, Mucor and water mold. Representative groups of Ascomycetes include, for example, Neurospora Penicillum Aspergillus (Aspergillus) and real yeast listed above. Examples of Basidiomycetes include, for example, fungi, rust and smut.

II. Description of the invention

The practical part of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology, Microbiology, recombinant DNA and Enzymology taken. These techniques are fully explained in the literature. See, for example, literature. See E. g., Maniatis, Fitsch & Sambrook, MOLECUIAR CLONING; AND LABORATORY MANUAL (1982); DNA CLONING; VOLUMES I AND II (D. N. Glover ed. 1985); OLIGONUCLEOTIDE SYNTHESIS (M. J. Gait Ed. 1984); NUCLEIC ACID HYBRIDIZATION (B. D. Hames & S. J. Higgins eds. (1984); REDUCED AND TRANSLATION (B. D. Hames & S. J. Higgins eds. 1984); ANIMAL CELL CULTURE (R. I Freshney ed. 1986); B. Perbal, AND PRACTICAL GUIDE TO MOLECULAR CLONING (1984); the treatise, METHODS IN ENZYMOLOGY (Academic Press, Inc.) and particularly vols. 154 and 155 (Wu and Grossman, and Wu, eds., respectively); GENE TRANSFER VECTORS FOR MAMMALIAN CELLS (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); IMMUNOCHEMICAL METHODOS IN CELL AND MOLECULAR BIOLOGY (Academic Press, London), and referred to here as above, so below, is incorporated herein by reference.

Nucleotidase design, coding, can be used in methods for producing recombinant enzyme methods.

DNA encoding, more private mushroom, still more specifically from Aspergillus, more specifically, was isolated from a library of cDNA generated by reverse transcription of poly /And+/ RNA isolated from A. niger in the logarithmic growth phase. However, creating samples for screening libraries for sequencing, coding, was problematic. Data as amino acid sequences and nucleotide sequences that encode fungal enzyme was absent. Moreover, it was unexpectedly found that attempts to sequence the enzyme isolated from A. niger, given only the sequence of the first 10 amino acids of the natural polypeptide, which made necessary a different approach to the design of sequences that could be used for screening ND-coding sequences.

For design samples useful for detection of cDNA sequences encoding CENTURY, in the library Oligopeptide the fragments of the natural enzyme from A. niger were purified and the amino acid posledovatelnosti. Sample 17-23 nucleotides were obtained from areas of least degeneracy.

Alternative unique longer sample was based on guessing the use of codons. The sequence of these samples are shown in Fig. 2.

Screening of the cDNA library of A. niger ingt 10 gave surprising results. First, none of the short samples was not useful for detection of clones containing cDNA. In addition, while two 42-membered samples could be used successfully for the detection of these clones, 72-membered sample, the sections of which with the exception of one nucleotide was 42-membered samples were not useful for detection. 42-membered samples, which can be used to detect clones containing cDNA shown in Fig. 3.

Using a 42-membered samples were obtained clonesgt 10, which contained the nucleotide sequence encoding the polypeptide or fragments thereof; cDNA in these clones was subcloned and sequenced. The composite cDNA prepared from 2 cDNA, shown in Fig. 5V. Amino acid sequence of CP was derived from the coding of its nucleotide sequence. From the sequence may be the residue of cysteine and 8 of consensus glycosylation site. In the amino acid sequence has preprofessionals of the 22 amino acids with a single primary site of cleavage at the beginning of the Mature sequence.

Recombinant polynucleotide shown in Fig. 5B, encodes from A. niger. We can expect, however, that from other sources, specifically from other fungal sources and more specifically from other species of Aspergillus, contains regions that are homologous to those from A. niger. Regions of homology can be determined by comparing the amino acid sequence from another source to that from A. niger; amino acid sequence derived from the cDNA sequences, shown in Fig. 5V. If the amino acid sequence of the entire polypeptide cannot be determined, the sequence Oligopeptide fragments can be compared with the sequence ON A. niger. Information codon sets the source selection can also be compared; codon sets the choice of A. niger represented in Fig. 6. Thus, samples can be obtained from the sequence in Fig. 5B and useful in the screening of cDNA libraries or genomic libraries from other detection TH-coding sequences from these sources. Options for creating samples of isvee preferably at least 20 bases, and more preferably at least 40 bases, which is identical to the sequence in the cDNA sequence in Fig. 5V. Identity can be both coding and non-coding-strand cDNA. These samples will be gibridizatsiya in harsh environments with appropriate chain of duplex DNA containing TH-coding sequence and which should be highlighted. Stringent hybridization conditions are known and are discussed, for example, in Maniatis, etc. /1982/ and in Methods in Ensymology. TH-coding sequences that have been detected break/s/, can then be cloned and selected using methods that are well known. See, for example, Maniatis (1982), B. Perbal (1984) and Glover ed. (1985).

The allocation sequence, the coding portion of the Penicillum, more specifically P. amagasakiense described in the examples. The selection was carried out using samples obtained from cDNA, contained in the recombinant vector described herein. Using fragment encoding TH Penicillum, to obtain samples it is possible to obtain the whole sequence of polynucleotide encoding this fungal enzyme from a cDNA library or genomic created from source Penicillum.

Although the method of obtaining a design DNA that encodes a TH A. niger, based on the creation of the cDNA library described here, the sequence, provided herein may be extended to other methods of obtaining polynucleotide constructs encoding. For example, the nucleotide sequence encoding, can be synthesized using automated DNA synthesis. See, for example, Edge (1981), Nambair and others (1984) and Jay and others (1984). On the other hand, can be synthesized oligonucleotides containing part of the sequence information; they can then be used as probes for screening libraries of genomic DNA and cDNA libraries. The basic strategy for obtaining oligonucleotide samples and library DNA as their screening by hybridization of nucleic acids is well known. See, for example, Glover D. P. ed. (1985), B. D. Hames and S. J. Higgins eds. (1985), M. J. Gate ed (1984), Maniatis and others (1982) and B. Perbal (1984).

After the sequence encoding TH received or allocated, it can be cloned in any convenient replicon is to create a vector, and so on. to be maintained in a condition substantially free of vectors that do not contain the gene TH /for example, other clones originating from the library. Many cloning vectors it is well known, and the selection of a suitable vector is a matter of choice. Examples of vectors suitable for cloning recombinant DNA, and the master .gif">pGV1106 gram-negative bacteria/; RME /gram-negative bacteria, not E. coli /; pHV14 /E. coli and B. subtilis/; pBD9 (Bacillus); pIJ61 (Streptomyces); YIp5 (Saccharomyces); YCp19 (Saccharomyces) and the human papilloma virus bull /mammalian cells/. See, basically, T. Maniatis and others (1982), B. Perbal (1984) and Glover, ed. (1985).

Polynucleotide sequence encoding, expressed by inserting the sequence into a suitable replicon, which creates an expression vector, transformatsii suitable host cells resulting expression vector, and growing the host cell under conditions which allow the growth and expression.

When creating the expression vector TH-coding sequence are placed in the vector so that it is operationally associated with the appropriate sequences for expression and possibly for secretion. As a minimum, the control sequences include a promoter, and transcriptional and translational stop codon. The location and orientation of the coding sequence with respect to regulatory sequences such that the coding sequence is transcribed under the “control” regulatory sequences: i.e., the promoter controls the transcription of mRNA from the coding sequence and the stop corscription.

In addition to regulatory sequences may be desirable to add regulatory sequences which allow the regulation of expression of TH relative growth hozaushka cells. This is especially true when TH is expressed in cells growing in a medium containing glucose as the hydrogen peroxide formed, can be toxic to cells. Examples of regulatory systems - those that cause or off gene expression in response to chemical or physical effects, including the presence of a regulatory compound. In prokaryotic system included system operators of the lac and trp. In yeast these may include, for example, the system ADH2. In the examples, the expression of TH in S. cerevisiae is under the control of a hybrid promoter ADH2/GAP. Another example of regulatory consecutive - ones that allow amplification of genes. In eukaryotic systems, these include gene digidrofolatreduktazy that amplificates in the presence of methotrexate, and metallothionein genes that it provided amplification in the presence of heavy metals. In these cases, the sequence encoding the CS should be placed in tandem with the regulatory element.

Other types regulatory tandem with a sequence the coding. Enhancer sequences such as the sequence of the SV40 enhancer - of this type. Enhancer sequence by their presence causes increased gene expression at a distance from them.

Modification of the sequence, coding, before or after its insertion in the replicon may be desirable or necessary depending on the choice of expression system. For example, in some cases it may be necessary to modify the sequence so that it had the right location, being joined to regulatory sequences. In some cases it may be desirable to add or change the sequence, which cause the secretion of the polypeptide from the host organism, with subsequent cleavage of the secretory signal. In the examples of the expression vector, which had been created, had either a natural preprofessionals TH A. niger, or as a secretory signal usedfactor from yeast. In addition, in some cases it may be desirable to remove the introns from sequences isolated from genomic libraries in order to make possible the expression systems, for example prokaryotes deruosi sequences containing introns. An example of the latter is discussed in Innis and other /1985/. Methods of modification of nucleotide sequences using cloning are well known. They include, for example, the use of restricted or of enzymes such as Bal31 to remove excess nucleotides, and chemically synthesized oligonucleotides for use as an adapter to replace werenich nucleotides and site directed mutagenesis. See, for example, Maniatis and others (1982), Glover, ed. (1985) and Hames and Higgins, eds. (1984).

Modification of the sequence, coding, may also be required for the synthesis of polypeptides that are substantially similar to TH. These polypeptides differ in some artificial way from the enzyme isolated from a natural source. For example, if the desired product is a fragment of the sequence encoding the enzyme is modified to remove unwanted sequences corresponding deleteroom amino acids. If the desired product is an active fragment, deleteregvalue sequence is likely to be in areas of the N - and C-Terminus.

On the other hand, polypeptides substantially similar to, can be synthesized by the natural expression of the gene in the host, which causes m is egovernance, coding TH A. niger in yeast leads to hyperglycosylated classes that retain activity. Surprisingly, however, that expressively in yeast, the polypeptide has a higher thermostability than the natural enzyme that can increase its usefulness in commercial processes.

It may also be interesting to synthesize analogues. These analogs can differ in specific activity, and/or ease of expression, and/or ease of secretion, and/or the ease of cleaning. It is known, for example, that highly glycosylated polypeptides are often difficult to clean. The data in the examples show the surprising result that the removal of carbohydrate residues, derived from A. niger, does not violate the enzymatic activity of the polypeptide. Thus, it may be desirable to vary, for example, the number of glycosylation sites. In addition, the Cys residues may be motivovany to change the folding of recombinant and/or modified polypeptide or to modify other properties with the aim of obtaining protein with high commercial value. For example, in section IV, I shows that the substitution of serine for cysteine at position 521 increases thermal stability expressed in yeast rekombinantnaya enzymatic activity.

You may also be interested in the synthesis of analogues of fragments. Such analogues, which may include inactive analogues may be useful in obtaining antibodies to TH.

May also be interested in the synthesis of analogs or fragments, which differ in hydrophobicity, making possible more or less interaction with membranes or liposomes. This can be done by substitution of hydrophobic amino acids, hydrophilic on some of the outer domains of the polypeptide, and Vice versa. Such changes of hydrophobicity are a modification of sequences coding for specific amino acids that must be substituted.

In cases when it should be used to obtain food, it may be desirable removal of immunogenic regions of the polypeptide that give allergic reactions, specifically in humans. Methods of testing for allergenicity well-known.

Polypeptides that are substantially similar to or its fragments, but which contain changes in the active site, can also be synthesized. In this case, the sequence encoding the enzyme should be modified so that the codons encoding the amino acids of the active centaur also polypeptides, which part or all poslidovnosti TH fused with a sequence encoding a different polypeptide. Fusion can occur at the N-and C-end of the polypeptide or fragment. How to create fusion proteins are well known and include, for example, ligation of the open reading frames encoding polypeptides so that they are in the frame, and so that expression of the fused polypeptide is under the control of a single promoter and terminator. The merger may also be created by chemical treatment postexplosion polypeptides. Chemical methods merge /or binding/ polypeptides are known, see, for example, Methods in Ensymology.

The above are examples of how TH can be modified by the modification sequence that encodes a TH. These examples are not exhaustive, and experienced experimenter can easily determine other modifications that will be useful. All these modifications can be performed using methods and references cited above and below, including the modification of nucleotide sequences.

Sequence encoding a polypeptide that is substantially similar to the FIRST, including TH wild type, can be Legerova with controlling posledovatel the second side, the coding sequence may be cloned directly into the expression vector which already contains a regulatory sequence and a suitable restriction site.

Regulatory sequences in the vector are selected so that they are compatible with the transformed host to allow the expression and/or secretion of molecules. These regulatory sequences can be from mixed sources. For example, in one of the examples described below, expression of TH A. niger in S. cerevisiae was fully under control of a heterologous sequences, i.e., regulated by the yeast, a yeast promoter, ADH 2/GAP, yeastfactor for secretion and yeast terminator. In another example, the controls were only partially heterologous, i.e., the secretion was regulated by preprofessionals from A. niger at that time, as the rest of the expression was controlled yeast sequences. When TH expressed in prokaryotic systems, encoding the enzyme sequence must be free of introns.

A number of replicons that can be used to construct a prokaryotic expression vectors, are well known. See, for example, a patent With the financing of yeast expression vectors, also known. See, for example, U.S. patent No. 4446235, 4443539, 4430428. The examples described here. An example that can be used to construct expression vector for host mammalian cell described in the common U. SS.N 921730, the disclosure of which is incorporated herein by reference.

Preferred expression system, recombinant TH in the yeast, preferably S. cerevisiae.

As described in the examples below, this system is expressed at relatively high levels, namely, when the sequence encoding the enzyme of A. niger wild type, is under the control of the yeast ADH2/GAP promoter, yeastfactor and yeast terminator GAP.

Depending on the choice of the expression system and host a polypeptide that is substantially similar to, including, or similar, or a fragment, is produced by growing host cells transformed by the above-described expression vector under conditions where the polypeptide is expressed. The synthesized polypeptide is then isolated from the host cells and purified. If the expression system secretes the enzyme in the growth media, the protein can be purified directly from the environment. If the recombinant polypeptide is not secreted, it is isolated from clean polypeptide depends on the system analysis, with which the polypeptide is detected. These systems of analysis is obvious to an experienced experimenter. For example, if swieciany polypeptide exhibits enzymatic activity of the polypeptide can be detected by analysis of the enzymatic activity. Analyses on the enzymatic activity of TH is described below in the examples.

It is also possible to detect swieciany polypeptide by immunoassay using antibodies to polypeptides that are substantially similar, including TH. In this case, the type used in the analysis of antibodies will reflect the expected presence or absence of known specific epitopes. Methods immunoassay known and polyclonal antibodies from A. niger commercially available.

Expressed polypeptide can be isolated and purified to the extent necessary for its application. Cleaning can be well-known methods, such as salt fractionation, chromatographia ion-exchange resins, affinity chromatography, centrifugation, etc., Cm., for example, Methods in Ensymology and Scopes (1987), where there are a number of methods of protein purification.

In General, recombinant products TH can provide a significant amount of the compounds of this fennah quantities of the polypeptide of high purity is the result of recombinant expression systems, which allow secretion in the environment recombinante produced polypeptide. Thus, with the use of modern techniques of recombinant cultures compounds ND substantial purity and quantity available.

It should be noted that the data sequence of the present invention obtain not limited to recombinant methods. It can also be synthesized by chemical methods, such as solid-phase peptide synthesis. Such methods are well-known.

Recombinant polypeptides that are substantially similar to, including, can be used to produce antibodies, both polyclonal and monoclonal. If desired polyclonal antibodies, selected mammals /for example, mouse, rabbit, goat, horse, etc./ subjected to immunization of purified or its fragment, or analog, or fragment equivalent. Serum from immunobiosensor mammal is collected and processed in accordance with known methods. If serum containing polyclonal antibodies to TH, contains antibodies to other antigens, the polyclonal antibodies TH can be cleaned immunopheno.

Monoclonal antibodies to TH can also be easily obtained by an experienced experimenter. The Hammerling, etc. (1981), Kennet and others (1980). Sets of monoclonal antibodies raised against TH, can be skanirovaniya for various properties; i.e., for isotype, epitope, affinity, etc. Monoclonal antibodies directed against specific epitopes that are useful in determining interactions. In addition, monoclonal antibodies useful in the purification of natural or recombinante-poluchennoi TH using immunoaffinity methods.

If TH polypeptides that are substantially similar to the FIRST, are used therapeutically, it may be desirable to bind the polypeptide molecule to an effective system for delivery in a suitable place, which would protect the polypeptide from proteolysis, and at the same time caused a controlled delivery of the polypeptide. Systems for the delivery of molecules are well known and are described, for example, in Poznansky, etc. /1980/. System drug delivery may include, for example, liposomes, or antibodies against specific target cells.

III. Common methods

The General methodology used to highlight polynucleotides of the cell source, the receipt and analysis of cDNA-new and/or genomic libraries, sequencing clones, constructing expression vectors, transforming cells, and the like are well known, and laborators some of the sources are currently available for such procedures and materials useful in holding them.

III.A.

The hosts and a sequence controlling the expression

For expression of a desired coding sequence can be used as a prokaryotic or eukaryotic host of ketki when using suitable regulatory sequences that are compatible with the designated host. Among prokaryotic hosts most commonly used E. coli. Sequence controlling the expression in prokaryotes include promoters, perhaps the content of the operation part, and the binding sites of the ribosome. Vector transfer, compatible with prokaryotic hosts are, in General, obtained from, for example, BR322, plasmids containing operons ampicillin - and tetracyclic resistance and various R-plasmids, which also contain sequences that carry markers of antibiotic resistance. These markers can be used to obtain successful transformants through breeding. Commonly used prokaryotic control sequences include-lactamases /pinipiling/ system lactatnogo promoter Chang and others, 1977, promotor system of tryptophan (trp) (Goeddel and others 1980), and obtained from

Eukaryotic hosts include yeast and mammalian cells in culture systems. S. cerevisiae and S. carbsbergiensis - the most commonly used yeast hosts, and common fungal hosts. Vector compatible with the yeast, are markers that allow selection of successful transformants make prototrophic in auxotrophic mutants or resistance to heavy metals in the wild type line. Vectors that are compatible with the yeast can use the origin of replication dvuhpilonnogo ring Broach, etc. the combination of CEN3 and ARS1 or other means to replicate as sequences that lead to the inclusion of a suitable fragment in the genome of the host cell. Controlling the sequence is nd and other 1978), including the promoter for 3-phosphoglycerate Hitzeman, 1980). Can also be included terminators, such as derived from the enolase gene (Holland, 1981) or glyceraldehyde-3-phosphate dehydrogenase (GAP), see examples. Specifically useful control system, containing the GAP promoter or a regulated promoter of the alcohol dehydrogenase or their hybrids /see examples/, terminators derived from the GAP, and, if desired, the secretion leader sequence offactor of yeast. In addition, the transcriptional regulatory region and the region of transcription initiation, which are operationally connected, can be such that is not associated natural in the body of the wild type. These systems are described in detail in USSN 468598, 522909. 769197, 868639, 073381, 081302 and 139682, registered on February 22, 1983, 12 August 1983, July 29, 1985, 29 may 1986, July 13, 1987, on 3 August 1987 and December 30, 1987, respectively, all of them attributed this to the representative and incorporated herein by reference.

Lines of mammalian cells, available as hosts for expression are known and include many immortal cell line available from the American collection of type cultures /ADS/, including Hela cells, cells of the Chinese hamster ovary /SNO/, kidney cells small work was the e viral promoters, from monkey virus 40 /SV40, rous sarcoma virus /RSV, adenovirus /ADV/ and human papilloma virus bull /BPV/. Mammalian cells can also require termination sequence and polyadenylation sequences; can also be included enhancer sequence that increases expression, and sequence of that gene amplification may also be desirable. These sequences are known. Vectors suitable for replication in mammalian cells may include viral replicons, or sequences that cause integration of the appropriate sequences in the host genome.

III.In the Transformation

Transformation can be by any known method for introducing polynucleotides in a host cell, including, for example, packaging polynucleotide in the virus and transduction of the host cell by the virus and the direct absorption of polynucleotide. The procedure of transformation depends on convertible owner. For example, the transformation of S. cerevisiae expression vector, encoding, discussed in the examples section, below. Bacterial transformation by direct uptake in General handles the chlorides of calcium or rubidium (Cohen (1972), Maniatis (1982)). Trance is rmacy mammals by direct absorption can be carried out by the method of calcium-phosphate precipitate (Graham and van der Eb (1978)) or with various known modifications of it.

III.With the Construction of the vector

Design vector uses techniques that are known. Sitespecifically DNA cleavage carried out by processing a convenient enzymes under conditions that are typically reported by the manufacturer of these commercially available enzymes. In General, about 1 μg of plasmid or DNA sequence was digested 1 unit of enzyme in about 20 μl of buffer solution by incubation at 37C for 1-2 hours. After incubation with the restriction enzyme protein was removed by extraction with phenol-chloroform and DNA was isolated by precipitation with ethanol. Cleaved fragments can be separated using electrophoresis in polyacrylamide or agarose gel in accordance with the General procedures, the existing Methods in Ensymology /1980/ 65:499-560.

The cleavage fragments with sticky ends may be blunt at the ends using DNA polymerase of E. coli (Klenow) in the presence of suitable deoxynucleotidase /DMTF/ present in a mixture. Can also be used for processing nuclease S1, resulting in the hydrolysis of all single-stranded DNA segments.

Ligation was carried out in standard buffer and temperature conditions with ispolzovaniem. When as part of logiraamat mixture was used fragments of the vector, they were often treated with bacterial alkaline phosphatase /VAR/ or alkaline phosphatase from calf intestine to remove the 5-phosphate and so on. prevent religiouse vector; alternative to prevent ligation can be used to splitting undesirable enzyme fragment of restrictio.

Legirovannye mixture transformed into a convenient cloning hosts, such as E. coli, and successful transformants selectively by, for example, antibiotic resistance and skanirovali on the right design.

III. The design of the desired DNA sequences

Synthetic oligonucleotides can be obtained using automated oligonucleotide synthesizer, as described Warner /91984/. If necessary, synthetic circuits can be too efficient 32Phandling polynucleotides in the presence of32R-ATC using standard reaction conditions.

DNA sequences, including isolated from cDNA libraries can be modified by known methods, including, for example, site-directed mutagenesis, as described Zller /1982/. Briefly, DNA, which have modifica aimerez using as primers synthetic oligonucleotide, the complementary part of the modified DNA and having the desired modification made to its own sequence. The resulting Dunaeva DNA is transformed into host bacteria, supporting the phage. The culture of the transformed bacteria, which contain replication each chain phage, plated on agar to obtain plaques. Theoretically, 50% of new plaques containing the phage that have mutated sequence, and the other 50% have the original sequence. Replica plaques hybridized with labeled synthetic breakdown at temperatures and conditions that allow hybridization with the correct chain, but does not allow the unmodified sequence. Sequences are identified as hybridization, isolate and clone.

III.E. Hybridization with a sample of

Library DNA can be analyzed using the procedure of Grunstein and Hogness /1975/. Briefly, in this procedure, the analyzed DNA immobilized on nitrocellulose filters, denaturised and prehybridization with buffer containing 0-50% formamide, 0.75 M NaCl, 75M Na citrate, 0.02% /in/about/ each: bullish Zavorotny albumin, polyvinylpyrrolidone, and ficoll; 50 mm Na phosphate /pH 6.5/, 0.1% DDS-Na and 100 μg/ml denatured DNA hybridization stages, depends on the required stiffness. Oligomeric samples, which are less strict conditions, in General used with a low percentage of formamide, low temperature and long times hybridization. Samples containing more than 30 or 40 nucleotides, as obtained from cDNA or genomic sequences, generally applied at a higher temperature, for example about 40-42With, and high prezentate, for example 50% formamide. After prehybridization in buffer was added 5-32P-labeled, oligonucleotide samples and filters were incubated in this mixture, under conditions of hybridization. After washing, the filters were subjected to autoradiography for visualization of the location of radioactive samples; DNA in the appropriate places on the original agar cups were used as the source of the desired DNA.

III. Design verification and sequencing.

For routine design vectors legirovannye mixture transformed into a line of E. coli HB101 or other convenient management and successful transformants selectively resistance to antibiotikum or other markers. Plasmids from transformants were then received in accordance with the method of Clewell and others (1969), usually after chloramphenicolchloramphenicol may be on dideoxy-method Sanger and other No./1977/, as described by Messing, etc. No./1981/ or method Maxima etc. /1980/. Problems with compression bands, which are sometimes observed in GC-rich regions were resolved by the use of T-deazaguanosine according to Barr et /1986/.

IV. Examples

Below are examples of the present invention, which are given for illustrative purposes only but not to limit the scope of the present invention. In light of this disclosure, a variety of embodiments within the claims obvious experienced experimenter. The set of procedures of, for example, section IV may, if desired, be repeated, but need not, because the available methods of constructing the desired nucleotide sequences on the basis of information provided by the invention. Expression is seen in the example system in Saccharomyces cerevisiae, however, available to other systems, as more fully discussed in section IIIA.

All manipulations with DNA was performed in accordance with standard procedures, unless otherwise stated. Cm. Maniatis, etc. /1982/. Enzymes, except glucoseoxidase used in accordance with manufacturer's recommendations or instructions of the supplier. Enzymes, unless otherwise stated, were obtained from New England Biolabs or from the environment /yeast nitrogen base without leucine/, the YEPD medium containing 1% /weight./about./ yeast extract, 2% /weight./about./ peptone, 2% / weight./about./ glucose and other, as described below. In the case of fill media in the Cup they contained 2% /weight./about./agar and for transformation 3% top agar with IM sorbitol.

Line E. coli, useful for transformation include Chi 1776; K12 line 294 /ATSC No. 31446/; RR1 HB101 and D1210. Line yeast, useful for transformation include AB110 and GRF180.

Line yeast AV has the genotype Mat alpha, ura 3-52, leu 2-04, or both leu 2-3 and leu 2-112, pep 4-3, his 4-580, cirabout. A sample of this line, containing various heterologous plasmid deposited with the ATCC on may 9 1984 under reception No. 20709. Cm. publ. EPON 164.556.

Line yeast GRF 180 has the genotype leu 2-3, leu 2-112, his 3-11, 3-15 his, CAN, ciro. This line can be obtained by freeing the line CRF 18 /received, as described in European patent application No. 858701070.9/ publication No. 0184575/ from its endogenous dvuhmillimetrovy plasmids using pCI/I or related plasmids, as described Erhard and Hollenberg /1983/.

Yeast strain GRF 181 easily get from GRF 180, using standard techniques of genetic manipulation of yeast. GRF 181 is essentially strain GRF 180 with deletionism genome ura 3 (GRF 181 ura 3-). It is obtained by transformation of strain GRF 180 square is e yeast cells his+select and grow. Recombination between the endogenous gene ura 3 and transforming gene lead to the desired genotype. Cells ura 3-in further selected by adding 5-torontobuy acid (5-FO), which kills cells ura 3+. Yeast strain GRF 183 has the genotype leu 2-3, leu 2-212, his 3-11, 3-15 his, ura 3-D, KEH 2-D, CAN, cirabout. This strain is identical to the strain GRF 181 except deletions KEH 2, which was integrated into KEH 2 locus. It can be easily obtained by linear transformation of the plasmid p AB 240 aforementioned strain GRF 181.

Activity TH were measured by a combination of peroxidase-o-dianisidine system reactions catalyzed by TH. The analysis, based on this combined system, described in the literature accompanying the commercial drugs, supplied by Sigma Corporation and Worthington Corporation. In General, the reaction is carried out in aqueous solution in the presence of buffer at pH 5.0-6.0,-d-glucose peroxidase in red blood cells and o-dianisidine. The oxidation dye hydrogen peroxide formed in the reaction, monitored by the increase in optical density at 450U nm or 500 mn. One unit of activity TH is defined as that amount of enzyme that liberates 1 μmol of peroxide concerned from A. niger.

In General, cDNA encoding from A. niger was obtained by skanirovaniya cDNA library constructed in agt10, oligonucleotide probes, which were obtained based on the amino acid sequence of peptide fragments of the purified TH.

IV.A. 1 obtaining a cDNA library, which contains TH-coding sequences from A. niger.

In order to determine the source of nucleic acids encoding the strains of A. niger was obtained from the American Collector types of crops were skanirovali products. One line, in particular A. niger 9029, was used as a source of mRNA, which may be prepared cDNA library as it was determined that this strain produces and secretes TH on Wednesday. In order to determine production, the strains were grown on YEPD medium and TH activity was determined in the environment of the cultivation. TH activity was determined by a combination of peroxidase-o-dianisidine system.

The presence in the environment of the cultivation confirmed by Immunoblot analysis using a preparation of rabbit antibodies against TH, which were obtained from Accurate Chemicals.

The cDNA library was obtained from poly/And+/RNA, which was isolated from Michel the ode Chirgwih and other /1979/. This method involves the destruction of cells in 4M guanidinoacetate and 0.1 M mercaptoethanol for denaturation of proteins and destruction of disulfide bonds. RNA was then separated from DNA and proteins by ultracentrifugation through a layer of 5.7 M CsCl, as charged Glisin /1974/, except that instead of the bucket-rotor used vertical rotor /VTi50, Beckman/. Poly/And+/-a fraction RNA was isolated as described in Maniatis, etc. /1982/, using two deletions. through oligo-dt-cellulose. Synthesis of cDNA from poly/And+/-RNA and the creation of a cDNA library from poly/And+/-RNA A. niger 9029gt10 conducted in accordance with the method described Huynh /1985/; synthesis of cDNA was carried out by reverse transcriptase using random primers. The complexity of the library was 1.6106.

IV.A. 2 sample Preparation and screening of libraries

To obtain samples that would be convenient for skanirovaniya librarygt10 on the phage containing cDNA encoding TH /TH-cDNA was determined amino acid sequence Oligopeptide fragments purified. This program followed, as, ironically, attempts to obtain amino acid sequence only the polyp which was further purified by polyacrylamide gel electrophoresis in dodecyl sulfate Na /DDS-Na/ conditions described Zaemmli /1970/. Protein was blueraven from the gel and fragmented bromine cyan /CNBr/ or cleavage by trypsin, which procedures standard methods in the chemistry of proteins. CNBr cleavage was performed in 70% formic acid. Cleavage by trypsin was performed after treatment TH citramonum anhydride, which specifically blocks the remains Liz, reducing the specificity of trypsin to unmodified residues Arg. Protein is usually restored and karboksimetilirovaniya using mercaptoethanol and iodixanol acid to these treatments for the destruction of all existing disulfide bonds.

The resulting peptides were separated and purified on jhud. Was used a number of ways. Used both neutral and acidic system of inverted phases using the combined acetonitrile gradients. First, the fragments were separated by size using Bio-Gel P-10 in 30% formic acid or shared and charge using ion-exchange chromatography in buffer systems with 6M urea; column HPLC Mono S and Mono-Q was used for further separation of fragments for sequence analysis. To ensure the purity of the analyzed peptide clearance at jhud usually carried out twice, i.e., the purified fragment patentov TH was determined using gas-phase sequencing machine (Applied Biosystems) according to the manufacturer's instructions. Sequence fragments obtained from this analysis, shown in Fig. 1. In the drawing, the parentheses denote the uncertainty in the sequence as read from the chromatograms, except for residues Arg, or Met, which is expected from the specificity splitting reagent /trypsin or CNBr/.

Oligonucleotide samples prepared in two ways. Sample 17-23 nucleotides were obtained from areas of least degeneracy. On the other hand, the unique longer sample was based on guessing the choice of codons. Samples were obtained for screening librariesgt10 containing sequences encoding from A. niger, shown in Fig. 2. The drawing shows the amino acid sequence of fragments and samples obtained from sequences. Also shows the size of the oligomeric samples and for shorter samples the degree of degeneracy.

Librarygt10 was skanirovali on TH-cDNA containing clones using the above-mentioned samples. The samples were obtained by chemical synthesis according to conventional procedures using phosphoramidite chemistry, as described by Urdea and others /1983/. Synthetic samples were labeled32P using polynucleotide kinase is/chr/955.gif">gt10 samples mainly as described by Huynh /1985/. Filters are hybridized over night at Troomswith 100 000 u/min x ml each of the sample 6 long, long 7 and 8 long in 4SSC, 50 mm Na phosphate, pH 6.8, 2x denhardt's solution, and 0.3 mg/ml voiced DNA salmon sperm. Then they were washed with 47With 3.0 M chloride of Tetramethylammonium according to Wood and other /1985/ and autoradiographically 6 days. None of the short samples was not useful for detection of clones containing cDNA. The library was skanirovali samples 6 long, long 7 and 8 long, in the form of a mixture; after 6 days of exposure 4 light double positive were obtained from 4x105skanirovaniya phages. After re-screening a mixture of these 4 clones remained positive on cDNA. The phages were then planted again in 3 replications and skanirovaniya three individual long samples. 4 clone was hybridisable with samples long 7 and 8 long. However, none of the clones did not hybridisable with 6 long. The result was surprising, because except for a single nucleotide replacement samples long 7 and 8 long are parts of the long 8/, see Fig. 3/.

The presence of 4 positive cDNA clones, which is associated with samples long 7 and 8 long, was confirmed by southern blot analysis of DNA, DNA isolated from case samples long 7 and 8 long. In each clone, only one band was hybridities with samples. The sizes of the cDNA bands were 0.9 T. p. N., 0.8, etc., ad, 0.7, etc., called clones 1-4, respectively.

Evidence that the cDNA clone 4 overlaps with that of the other three clones were obtained, because the cDNA insert isolated from clone 4 was hybridities with inserts from clones 1, 2 and 3 in harsh environments. cDNA clone 4 was cut EcoRI, isolated by electrophoresis in a gel and machina32P-nick-translation. The way nick-translation was as described, Manitis, etc. /1982/. The remaining 3 clones were split R1 and transferred to nitrocellulose after electrophoresis in 1% agarose gel. Nitrosopropane sample of clone 4 was denaturalising and hybridized with the southern block in the conditions described above for screening the cDNA library, except that the mixture contained 50% formamide and hybridization was carried out at 42With during the night. The filter was then washed at 60With 0.1 xSS and autoradiographically.

IV.A. 3 Nucleotide sequence of the cDNA TH

cDNA in clone 1-4 were operamini by the method of Sanger and others /1977/. In fact, the cDNA was cut out from clones RI and were isolated by fractionation by size using gel electrophoresis. l fragments seminarii circuit, Sanger et /1977/.

Nocotine sequence R1-fragment /approximately 700 p. N./ from clone 4 shown in Fig. 4. Restriction map of the fragment shown in Fig. 4B-1. The nucleotide sequence and encoded amino acid in it, as shown in Fig. 4B. The position of the restriction sites are also indicated on Fig. 4B. A fragment of the cDNA in clone 4 consists of 1 open reading frame. 2 from the peptide fragments were analyzed by analysis of amino acid sequence, encoded in the cDNA of clone 4, except that 2 of 36 amino acid residues modified. Amino acid sequences of the fragments shown in Fig. 1.

The composite cDNA can be constructed from nucleotide sequences of the cDNA in clone 1 and 2, the last of which, possibly, the full-size cDNA clone. The nucleotide sequence of the composite cDNA shown in Fig. 5. Fig. 5A shows restricto map sequence. Fig. 5B shows a composite nucleotide sequence derived from clones, and specifies the restriction enzymes cut sites. Also in Fig. 5B shows the amino acids encoded by the sequence. From the sequence can be determined that the Mature protein consists of 583 amino acids; aminokislotnoi sequence is preprofessionals of the 22 amino acids with a single primary site of cleavage /Arg-Ser/ at the beginning of the Mature sequence.

Evidence that the composite cDNA sequence encodes TH was obtained comparing the amino acid sequences of peptide fragments of the purified TH /see section IV.42/ s coded composite cDNA. This comparison is shown in Fig. 6, in which selected amino acid sequence is indicated on top of the nucleotide sequence. Amino acid sequences corresponding to the sequences peptidic fragments from purified, are underlined. Differences in the derived sequences and sequence fragments from purified TH also specified. It is evident from Fig. 6 one can see that there are very few differences between the sequences deduced from the cDNA, and those of the selected peptides.

In Fig. 6 also presents data on the molecular weight of the polypeptide comprising a signal peptide, and code selection in A. niger, based on nucleotide sequence that encodes a TH.

Of the composite DNA sequence can be predicted that Mature non-polypeptide TH has a lot 63300. The Mature peptide contains 8 sites of consensus glycosylation. Assuming 2 CD carbohydrate at each site, mol. weight glycosylated monomer TH b aminokislotnyj composition, derived from the cDNA sequence, consistent with the amino acid composition indicated in the literature. The specified amino acid composition was confirmed in separate experiments /not shown/. In addition, as shown below in section IV, the expression of cDNA active gives glucoseoxidase.

IV.In. Isolation and sequencing of genomic sequences encoding.

Oligonucleotide samples described above in section IV.A. 2, and nick-translated cDNA fragments, selected as described in section IV.A. 2, were used to extract genomic clone of A. niger from the library of A. niger on the basis of pBR322 in E. coli strain DN IV.In.1. Design library of A. niger and isolation of genomic clones encoding.

Genomic DNA was obtained from cells of A. niger method Boel, etc. /1984/. DNA /50 mcg/ processed Sau 3a under conditions which give a partial splitting /1 unit Sau 3a in a volume of 1 ml at 37C for 50 min and the reaction was stopped by adding EDTA. Cleaved DNA chased after preparative 1% agarose gel and isolated DNA size 7-10, etc., N. This DNA is ligated into pBR322, linearized BamHI, treated with alkaline phosphatase, and purified from the gel. The resulting legirovannoi NAM is separately allocated plasmid DNA, giving approximately 3500 recombinant 60,000 colonies from one portion of scattered made duplicate nitrocellulose replicas. 600-nucleotide fragments Ncol-EcoRI from clone 2 cDNA was nick-translated and used as a sample under the conditions described above. After autoradiography there were 4 potential clone, one of which is 17A, was correct, as shown later, the southern-blotting and sequencing.

IV.In.2. Analysis of the lengths of the restriction fragments of genomic DNA that encodes a TH.

The presence or absence of nitronal in genomic sequences can be determined by comparing the sizes of the fragments of the cDNA and genomic DNA obtained by restriction. The fragments were analyzed by the method of Southern, using samples, detecting sequences that encode TH.

Genomic clone 17A and the cDNA clone BRlambda 2A were both split Ncol that cuts 4 times cDNA, giving specific pattern of small fragments. After analysis in agarose and acrylamide gels picture Ncol restriction was the same for both clones. After that, the DNA clone 17a was split EcoRI, xhoI, SalI and HindIII; the splitting produced single and pairwise combinations. Pervari were subjected to electrophoresis in agarose g is g src="https://img.russianpatents.com/chr/697.gif">-half of the cDNA and 1100 p. N. EcoRI fragment from the 3-half of the genomic sequences in the clone 17A. These samples were labeled32P nick-translation. In all cases, the genomic map was congruent cDNA map.

In addition, genomic DNA from A. niger was cleaved by the same enzymes botirovna and hybridized with the same probes. The results gave the same pattern that was observed with clone 17A. These results show that the realignment and/or deletions has not occurred during the cloning process.

Analysis of the southern-blotting showed that the restriction fragments, detected samples were the same size in kancah, genomic clones and genomic DNA sequences isolated from A. niger. This gives rise to the unexpected result that the genomic DNA of A. niger, encoding, lacks intron sequences.

IV.In.3. The nucleotide sequence of the promoter region.

It was assumed that the region flanking 5-the end of the sequence encoding the CS contains the promoter sequence of a gene. This area and the adjacent area, encoding NH2the district, were allocated in the form of a polynucleotide fragment of the genomic clone, and was opis genomic clone 17a /see section IV.In.4 about how to obtain genomic clones/. Fragment was cut from the vector sequences R322 splitting EcoRI and SalI fragment size of about 609 p. N. was separated by gel-electrophoresis. The selected fragment was cloned into M13 vectors and sequenced by the method of dideoxy-termination circuit (see section IV.A. 3./. The sequence of this region is shown in Fig. 7. Restricta map sequence shown in Fig.7A; the sequence and restriction sites shown in Fig. 7V. Also in Fig. 7B shows the amino acid sequence of NH2-terminal region of TH encoded in the genomic clone.

IV.With. Construction of vectors for the expression of cDNA in the yeast.

It was constructed 2 expression vector for production in yeast. In these vectors, the expression of sequences encoding, operationally associated with the sequences for transcription and expression of the polypeptide. Both vectors contain a hybrid promoter ADH2/GAP for regulated expression. In addition, any leader sequencefactor of S. cerevisiae, or preprofessionals TH merged with a sequence that encodes a Mature, in order to cause secretion.

cDNA from clone 2 /see section, the which contains a number of flanking DNAgt10 was inserted between the Hind III and BamHI sites BR322 that gave the vector pBR-lambda-GO2. Scheme construction of expression vectors using the cDNA sequence in BR-lambda-GO2 shown in Fig. 8.

IV.With.1. Construction of expression cassettes in pAGSGOGO.

The expression cassette contained in a plasmid that can replicate in E. coli, in which the sequence encoding, operationally linked with regulatory sequences, which include a hybrid promoter of the yeast ADH/GAP, GAP terminator, the secretory signal obtained from the TH gene of A. niger, was constructed as follows.

DNA BR lambda-2a was split SalI, which cuts approximately 129 p. N. from N-end TH-coding sequence and cuts 1 time in BR322. Synthetic suplex encoding the N-end of the Mature, was received and Legerova with this perevorot. The sequence deflexa was as follows:

5AGATCTAATGGATTGAAGCTTCCCTCCTGACTGATCCCAAGGATGTCT

ATTACCGTAACTTCGAAGGGAGGACTGACTAGGGTTCCTACAGA

CCGGCCGCACACGG 3

GGCCGGCGTGCCAGCT

A BglII site was conveniently placed at the N-Terminus of the Mature TH silent mutation sequence that encodes Arg-Ser. After Ligurian what trophoresis.

The fragment containing the C-terminal fragment of the cDNA, was isolated by cutting cDNA EcoRI, treatment with a cut fragment Maple and four deoxynucleotidyltransferase and legirovaniem clinker synthetic fragment. The linker had the sequence:

5-GAGATCT-3

The resulting fragment was cleaved BglII and > PST. After this processing, the cDNA fragment by size 950 p. N. was separated by gel-electrophoresis.

Fragment 980 p. N. and fragment 950 p. N. were legirovanyh. Because ligation could be due to sticky ends, from both > PST and BglII, legirovannye fragments were treated with BglII, which gave so on. cDNA, which contained sticky ends that could form the BglII sites.

Vector AGAP1 is derived PGAP1 in which the regulated promoter of the alcohol dehydrogenase-glycerylphosphorylcholine /ADH2-GAP/ replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase /GAPDH/. Plasmid pPGAP1 described in Travis and other /1985/, EPO publication No. 164555 and also recognized in USSN 769197, zaregistrivannym July 29, 1985; these references are incorporated herein by reference. In pAGAP1 promoter ADH2-GAP associated with a terminator GAP. The promoter is 1200 p. N. BamHI-NcoI fragment isolated from pJS103. Contraviesa and which is incorporated herein by reference. Terminator GAP is 900 p. N. BglII-BamHI fragment obtained from pPGAP1. Cm. publication No. 164556. Fragment linking promoter and terminator: (BglII, former SalI site (NcoI)

5' CATGGGAATTCGTTAGGTCGAGATG 3 '

GGTACCCTTAAGCAATCCAGCTCTAGAGCTG

The restriction sites encoded in the sequence are shown in parentheses. This fragment can be replaced with the gene of interest.

For the insertion of the signal sequence TH was split NcoI and BglII, treated with phosphatase and Legerova with the following synthetic duplex coding for preprofessionals: (NcoI 5) GGACCTCCTTGTCGAGCCTTGTGGTCTCCCTCGC

GTCTGAGAGGAACAGAGCTCGGAACACCAGAGGGAGCG

TGCGGCCCTGCCACACTACATCA 3(BglIII)

ACGCCGGGACGGTGTGATGTAGTCTAG

The XhoI site was introduced using a silent mutation screening. The resulting plasmid, pAGSGOcontained a BglII site below in the course of transcription from preprofessionals, which could be insertion the cDNA sequence.

The inserted cDNA fragment in pAGSGOit was performed by splitting the plasmid BglII and treatment with phosphatase, then legirovaniem cDNA GO with the linearized plasmid. The resulting plasmid was named pAGSGOGO.

IV.With.2. Construction of expression cassettes in pAGalphaGO.

factor as secretory signal was similar to the design of pAGSGOGO /section IV.With.1./ except for the following:

A plasmid in which was Legerova fragment of the cDNA, was pCBR, which is similar to AGAP1 except that-factor leader was inserted between the promoter and the terminator with a unique BglII site at Doonbeg site processing /Lys-Arg, or in single-letter code K-P/ for CEH. Plasmid formed by inserting a cDNA fragment in pCBR, named pAGalphaGO.

IV.With.3. Construction of yeast expression vectors encoding.

Yeast expression vectors, in which the sequence TH operationally associated with sequences that control the expression and secretion of the polypeptide, were constructed by cutting BamHI cassettes expression of pAGGOGO and pAGalphaGO and wstawieniem expression cassettes into the unique BamHI site of plasmid raw.

Plasmid raw /Fig. 9/ - yeast Shuttle vector, which contains the full dvuhmetrovoy sequence /Broach /1981/ and posledovatelnostyu from the plasmid pCI/, the EPO publication No. 116201 fine. Plasmid raw was constructed by splitting Her EcoRI and regulirovanie vector to remove part dvuhstronnih sequences. The resulting plasmid, WEdeltaRi was linearized with ClaI cleavage and Legerova with full dvuhmetrovoy the plasmid that was linearized ClaI. The resulting plasmid pCBou was then split XbaI and 8605 p. N. vector fragment was isolated from gel. This dedicated XbaI fragment was Legerova with 4460 p. N. XbaI fragment containing the LEU2d gene isolated from PCT/I; the orientation of the LEU2d gene in the same direction as the URA3 gene.

To construct a yeast expression vectors the expression cassette was cut out of the pAGSGOGO and pAGalphaGO splitting BamHI and plasmid raw was linearisable the same restriction enzyme and treated with phosphatase. Cut expression cassette was isolated by gel-electrophoresis. The linearized plasmid was Legerova with either the expression cassette of pAGSGOGO that gave the vector pAB244GSGOGO, or the expression cassette of racesalphaGO that gave the vector 24GalphaGO.

IV.D. Expression in yeast with pAP24AGSGOGO and rawalphaGO-1.

The two clones of expression vectors for the production of TH were selected, i.e., 24GSGOand B24AG< ADH2GAP for regulated transcription and or leaderfactor S. cerivisiae /pAB24alphaGO/ or preprofessionals, fused with a sequence that encodes a Mature TH /24SGOGO/. However, subsequent analysis of nucleotide sequences encoding TH, revealed the presence in these clones mootanah sequences.

IV.D 1. Expression with pAB24alphaGO-10 with pAB24GOGO-1.

The yeast strains GRF 180 and AB 110 transformed specified clones of these plasmids by the method of Ainnen /1978/ and selected prototroph on Latino. Transformants were inoculable in leucine-selective medium containing 8% glucose for 48 hours. The inoculum was diluted to the initial AO=0.05 in the medium of expression WER containing 2% glucose. Cultures were grown at 30C, 300 rpm and aliquots were taken every 24 hours. Cells were separated from medium growth by centrifugation in microcentrifuge at 1400 rpm, 1 min, and was determined by the glucose oxidase present in the environment and in cell extracts, using as a standard glucose oxidase obtained from Sigma. Cell extracts were obtained by shaking the cells with glass beads. That is, precipitation cells were mixed with an equal volume of acid washed glass beads in lysis buffer containing 10 mm Tris, pH and centrifugation in microcentrifuge at 14000 rpm at 4C. Results for the active oxidase expressed after 72 hours of growth, shown in the table. 1. In the table the symbol “nd” means that the activity has not been determined.

The results in table. 1 indicate that TH encoded in the expression vectors, expressed in yeast, and that high levels of activity TH /more than 25 µg ml/ secretarials on Wednesday. Detected activity was not detected in the control transformants transformed raw. In addition to the high level of secreted activity TH only about 50% of the total activity of TH is secreted, which implies that the total synthesis of TH in these transformants is very high, i.e. in some cases more than 100 µg/ml. moreover, surprisingly, relatively yeast-factor secretory signal from A. niger appears to be an effective regulatory sequence for secretion of the polypeptide in S. cerevisiae.

Using a similar procedure was compared with the expression of TH, when the vector was transformed into GRF 180 and AB110. The results of this comparison show that the strain GRF 180 is preferable strain AV for total expression and secretion of TH.

IV. D2. Features is adelene mutations in the polypeptide, expressed in section IV. D1, was carried out by analysis of the DNA sequence of N-ends of genes in expression cassettes. The fragments that were sequenced were cut splitting vectors Sal I and Sac I, and the resulting pieces 750 p. or 940 N. p. N., obtained from 24SGOGO and pAB24alphaGO-10, respectively, were separated by gel-electrophoresis. The resulting fragments were cloned into M13mp18 and subjected to dideoxysequencing. Sequences were translated into amino acids encoded therein, and those were compared with comparable sequences encoded in the cDNA. The results of the analysis are presented in table. 2, where the amino acid sequence indicated in the standard one-letter code.

In table. 2 the first residue S is the first amino acid residue of the Mature polypeptide. Amino acid sequences that differ from those encoded in the cDNA are underlined. It is possible that these mutations is the result of impurity oligonucleotide linkers used in the construction of expression cassettes.

IV.D.2.In. Analysis of expressed polypeptides TH gel-electrophoresis in polyacrylamide gels in proudie DDS-Na: the effect of endoglycosidase secretory signal, andfactor produced TH was hyperglycosylated. This was further investigated by analysis of the impact of endoglycosidase N /Endon/ on the molecular size of the expressed polypeptides. Andon was obtained from Bochringer-Mannheim and used according to the instructions of the supplier. This enzyme catalyzes deglycosylation glycosylated polypeptides.

The expression of TH was held in transformed GRF 180 containing the expression vectors 24GSGOGO-10 and B24AGalphaGO-1, as described in section IV.D 1. After 72 hours of growth in an environment of WAR containing 2% glucose medium were collected. Aliquots of approximately 1 ml of each medium was concentrated 10 to 20 times by centrifugation using membrane Method 10. Proteins in concentrated environments besieged by pressure half-volume 50% THU containing 2% desoxycholate as a carrier /THU/DOH/. Protein precipitation was dissolved in 50 μl of water and half of each sample was treated with Anton /1-2 million IU/. Ostavshuusa part of the sample was inoculable under the same conditions but in the absence of Andon. For comparison authentic oxidase from A. niger was treated in the same way. After the second deposition THU/DOH for concentrating samples polypeptide visualized by crossing Kumasi Blue.

From gels was determined that TH expressed in yeast, hyperglycosylated, because in the absence of treatment Andon polypeptides are moving less than the standard. However, after processing Andon yeast products are moving in the form of a doublet with apparent molecular weight 68-70 kDa; the same doublet observed in the treated Andon standard.

In the absence of treatment Andon a polypeptide that is expressed and secreted from a vector containing a leaderfactor of yeast, has seemingly M. C. 90-120 kDa. The material expressed from this vector has a smaller M. C. and is less heterogeneous than the polypeptide, secreted from yeast using a secretory sequence. This is true despite the fact that in the leader sequence fromfactor, if 3 additional N-linked glycosylation site. Thus, the secretion is under control of the leaderfactor may be more effective. In addition, after processing Andon material with apparent mol. weight corresponding to that of the leader of thefactor, merged with, was discovered in small quantities or not the detected imaging is narushenie, that preprofessionals TH functions as a secretory signal in S. cerevisiae is an amazing result.

IV.E. The impact of Andon on the activity.

To determine the effect of the degree of glycosylation on the activity of the enzyme was expressed in yeast and secreted from them, and the enzyme derived from A. niger, were treated Andon. We determined the effect of removing helicoiling groups on the enzyme activity.

Secreted polypeptides, expressed in yeast, were obtained, and air-conditioned environment containing proteins were concentrated as described in section IV. After concentration of each sample was divided into 3 aliquots. One aliquot was used to determine the initial activity. The remaining 2 aliquots were incubated at 37With overnight in 50 μl of a solution containing 0.2 M Na-citrate, pH 6.0 12% VAT-Na and 1 mm phenylmethylsulfonyl /FMSF/. One aliquot was incubated with Andon, and the other was incubated without Andon. After incubation in each of the 3 samples was determined activity. In addition, part of the aliquot was besieged THU/DOH and analizirovali electrophoresis in 8% polyacrylamide gel in the presence of DDS-Na.

Results /not privides A. niger, stable at 37With over 20 hours per diluted DDS-Na2/ processing Andon not inactivate any activity, which differed from the activity of untreated samples is not more than 20%. 3/TH, secreted from yeast under the control of its own preprofessionals much more glycosylated than the one that secretionary under control sequencesfactor. Apparent m the first century in the range of 100-200 kDa at that time, as such the last within 75-150 kDa. 4/TH was not observed changes in activity samples /i.e., samples, expressed in yeast, or standard from A. niger /after processing Andon. Because the final product after processing Andon - almost the same molecule up to the carbohydrate content for different, we can conclude that hyperglycosylated product, expressed in yeast, does not affect the enzymatic activity.

The result is that the activity of TH is relatively independent of the degree of glycosylation of the polypeptide, divtitle. For other proteins was observed (for example, tissue plasminogen activator/ that hyperglycosylated polypeptide, expressed in L YEASTS, vol. 11, pp. 27-36 (CRC Press, Boca Raton, Fla).

IV.F Construction of yeast expression vectors encoding TH wild type, and the expression of the wild-type enzyme.

With the aim of constructing vectors, expression of the glucose oxidase wild-type Sal-BglII fragments of magnitude 1.9, etc., N. from mutant plasmids were isolated and legirovanyh with newly synthesized oligomers, encoding the N-terminal sequence. The sequence of the oligomers were shown above in the design of expression cassettes. The fragments were split BglII and corrected gene was inserted into the expression vectors. Analysis of the DNA sequence of the inserts showed that the resulting vectors contain the correct sequence at the N-Terminus.

Clones of each of these vectors were isolated and named pAB24GSGO and 24GiGO in the case of vectors, containing as controls secretion of preprofessionals A. niger and consistencyfactor, respectively. Vector 24GSGO also called GO2 /or pSGO)-2/; vector AB24EGO /rawalphaGO/ is also named pEGO-1 (p-alpha-GO.1). Restrictive card pSGO and pEGO shown in Fig. 11 and 12, respectively.

IV. G. Expression of TH wild-type yeast and characterization of the expressed polypeptides.

IV. G1. isia, transformed with expression vectors containing sequences encoding TH wild-type.

Strains GRF 180, GRF 181 and GRF 183 were transformed cloned expression vectors in the carriage or raw GSGO or 24GEGO. Transformation was performed by the method of Hinnen /1970/ and were selected lacinova prototroph. Inoculation culture of individual transformants were obtained by growing the transformants in 2 ml of leucine selective medium containing 8% glucose for 48 hours. Then the inoculum was diluted to a650=0.05 in non-selective medium and were grown for 96 hours at 30S at 300 rpm After growing the cells were removed from the conditioned media by centrifugation in microcentrifuge at 14000 rpm for 1 min and determined the activity of TH present in the environment.

The results of the activity of glucose oxidase expressed in yeast two sectors expression and secreted in an air-conditioned environment, are presented in table. 3. In the table, the activity of TH is expressed in μg/ml of culture.

Comparison of the results shown in the table. 3 with those of table. 1 assumes that either GO wild type, expressed in yeast, has a higher Udelnaya expressed polypeptides electrophoresis in DDS Na-polyacrylamide gels: effect of Andon.

Cultures of yeast transformants containing expression vectors 24GSGO and pAB24AGEGO raised, as described in section IV.G1. After growing the cells were removed by centrifugation and activities were determined in air-conditioned environment. Environment from transformants containing pAB24AGSGO and pA24AGSGO had activity TH 190 µg/ml and 260 µg/ml, respectively.

Before processing Andon polypeptides TH were partially purified. The medium was diluted 10 times with 0.01 M acetate, pH 4.5, and was passed through the column DEAE-cellulose Fast Flaw (Pharmacia). After application the column was washed with the same buffer, and then suirable TH 0.1 M acetate, pH 3.7.

Polypeptides, expressed from the yeast, both before and after purification, was treated with Andon overnight at 37C. the cleavage Conditions were as described in section IV.E, except that were treated with 50 MLK - aliquots of samples; control samples were incubated under conditions of splitting according to Anton.

After incubation, the samples were besieging THU, washed 3 times with acetone to remove THU and quantity, equivalent to 12.5 ál volume of each sample was applied on 8% polyacrylamide gel. The electrophoresis gel was carried out in the presence of DDS-Na in reducing condition is shown in Fig. 10; samples on different tracks, as described in table. 4, which also shows the number in the sample. In the table the symbol indicates that the specimen was processed Endon; the symbol indicates that the sample was incubated under the conditions of processing in the absence of Andon. The number in parentheses after sample is the number of fractions by elution from columns of DEAE-cellulose. As control of the A. niger was subjected to incubation under the conditions of processing in the presence and in the absence of Andon.

The results shown in the gel in Fig. 10, confirm that you have produced large quantities of protein. Because the equivalent of only 12 ál yeast medium was applied on tracks 4 and 12 and a lot more than 0.2 µg of the enzyme compared to the standard is in the gel, the results of the activity correct and more than 200 mg/l TH is secreted and expressed in yeast systems.

IV. 3. thermal stability of the polypeptide, expressed with pAB24AGSGO in comparison with native GO from A. niger.

thermostability of the purified recombinant polypeptide, expressed in yeast with 24GSGO native, purified from A. niger, were compared by research thermodenaturation.

Recombinant polypeptide, expression the Yali by centrifugation and air-conditioned environment, WER were diluted 10 times in 0.01 M Na acetate, pH 4.5. This material was applied to a column of DEAE-sepharose /20 ml/ Fast Flow (Pharmacia), equilibrated with the same buffer. This column is then washed with 3 volumes of equilibrating buffer and then suirable enzyme in 0.1 M Na acetate, pH 3.7. The fractions containing the activity, were combined and concentrated by ultrafiltration. Natural, purified from A. niger was obtained from Sigma Corp. (Type 5). Both recombinant and active TH were incubated at a concentration of 0.1 mg/ml in 0.1 M citrate-phosphate buffer, pH 5.5, using mainly the condition described in Malikkides and Weiland /1982/. The enzyme samples were incubated at 65With, taking aliquots at different times and bred them 10 times in phosphate buffer, pH 5.5. Enzymatic activity in the diluted samples was then determined using the method mainly Kelley and Reddy /1986/ with the following modifications. Analyses were performed in a volume of 1.0 ml in 0.1 M Na phosphate buffer, pH 7.0, containing 0.2 mm o-dianisidine (Sigma Corp.) 10 μg peroxidase in red blood cells of horses (Boehringer-Mannheim Corp.) and 9.5 mm D-glucose. The assays were started by adding TH /1-30 ng/, incubated at Trooms20 min and then stopped by adding 0.1 ml 4H2SO4. The resulting restored on-Dionisi the enzyme was determined in ng TH standard curve of absorbance against the amount of enzyme. The results of the study of thermal stability is shown in Fig. 13, where the percentage of remaining enzyme activity is indicated against time of incubation at elevated temperature /dark squares - TH expressed in yeast; dark triangles - native TH/.

The data in Fig. 13 show that the constant pseudobersama about 0.04 min-1received for the fall of the activity of the natural enzyme, while the enzyme expressed in yeast, was a constant 0.012 min-1. Thus, the enzyme expressed in yeast, which hyperglycosylated significantly more thermostable than the natural enzyme from A. niger.

IV. Assessment of the level of mRNA.

A. niger produces a significant quantity of TH. The studies described above showed that significantly more than 1 mg/l is expressed and secretiruetsa at relatively low cell densities. In addition, the protein was detected in crude lysates of A. niger Western blotting, suggesting that the enzyme presents more than 0.1% of total cell protein. Thus, it can be expected that relatively large amounts of mRNA of this enzyme should be present in A. niger during logarithmic and/or stationary phases of growth. For a as samples for Northern-bottom RNA, highlighted in the logarithmic base growth.

Northern-blotting RNA was carried out as described below, mainly as described by Maniatis, etc. /1982/ Poly/And+/RNA /5 ág/ isolated from A. niger in the logarithmic growth phase, were denaturiruet glyoxal and subjected to electrophoresis in 1% agarose gel. RNA was transferred to nitrocellulose filter and analyzed nick-translated 1.1, etc., N. EcoRI fragment of cDNA, using the conditions described above for southern blot. After hybridization with the sample filters were washed at 60With 1 x SSC. After one week of autoradiography was not detected bands. Control experiments showed that the RNA was intact and efficiently transferred from the gel to the filter.

The results suggest that mRNA encoding ST, very rare in the cells of A. niger in the logarithmic growth phase. This result is surprising, since synthesized such large amounts of protein. This may explain the difficulty of obtaining nucleotide sequence that encodes a CENTURY, from a cDNA library.

IV.1. Analogues of glucose oxidase, which are mottainai.

IV.1.1. Construction of vectors encoding mutiny.

The mutated sequence encoding the glucose oxidase in which the receiving site-directed mutagenesis mainly by the method of Eckstein, as described in Laylor and other /1985/.

At first it was derived 24GSGO, where 3-noncoding sequence TH was demeterova. For this purpose 3-half of the gene from clone 4 cDNA /described in Fig. 4/ was subcloned in MMR as > PST -EcoRI fragment. Two similar primers were used to introduce a total of 7 mutations in 3-end of the gene. A similar sequence of primers were as follows /with the underlined mutations, restriction sites are marked above the sequence of the primer and the amino acids encoded therein, in parentheses following sequence primer/:

XHOI Bg1II

5CGGATGCTATCCTCGAGGATTATGCTTCCATGCAGTAAGATCT 3

(D And a I L E D Y And S M Q stop).

The resulting > PST -BglII fragment, containing the 3-mountain valley cDNA, was Legerova with BglII- > PST fragment from 24GSGO, representing 5half of the gene, and they were legirovanyh in the same plasmid, treated with BglII phosphatase. The resulting plasmid is SGO3.

Mutations, in which the Cys codons were replaced by Ser codons, were made using the following primers:

GOC164S: 5ATTAACACCATGGCTCGAGGCATTGAAGTA mg src="https://img.russianpatents.com/chr/697.gif">CGGCATCATGGAACTAGTACCCACGCC 3.

5-half of the expression cassette from the plasmid 24GSGO was subcloned in MMR as AhaIII- > PST fragment. The first 2 primer (GOC164S and GOC206S) were used with this matrix; primer GOC521S was used on the matrix described above, which was used to obtain SGO3. After cloning primers were then used as samples for the selection of plaques containing the mutated sequence; insert into positive plaques were sequenced in its entirety to ensure that they have acquired only the desired mutations. The mutant genes were then reconstructed in the expression cassettes similarly pSG03 except that these vectors contain sequences of nucleotides with defined mutations. Vectors containing mutations in CIS 164, Cys 206 named pSGO 3C164S, also called C164S, pSGO3C206S (also called C206S) and pSGO3C521S (also called C521S), respectively.

IV.1.2. The expression of the expression vectors encoding mutiny, in yeast.

Expression of Malinov TH encoded in pSGO3C164S, pSGO3C206S, pSGO3C521S and wild-type gene in pSGO3 was carried out in the transformed strain of yeast GRF 180. Transformation and expression were mainly described in section IV.D except that pointed to by on serine on the expression and/or secretion and/or activity, shown in the table. 5.

As can be seen from the results, secreted activity TH from expression pSGO3164S and SG3206S was not detected. The level of secreted activity, resulting from the expression of pSGO3C521S was lowered somewhat from such expression pSGO3. From these results it is concluded that CIS 164 CIS 206 require for expression /secretion/ and/or activity of the TH.

IV.1.3. Thermostability mutein encoded and C521S.

thermal stability of the polypeptide expressed from yeast transformed pSGO3C521S, compared with that of the natural from A. niger. Study of thermal stability was performed basically as described in section IV.G.3 Results graphically expressed as % remaining activity after incubation at elevated temperature with respect to time shown in Fig. 14 /natural enzyme - squares; pSGO3C521S the encoded polypeptide - triangles/. Based on these results, the estimate of the constant of inactivation is given less than 0.01 min-1. Comparison of thermal stability of this mutein with natural from A. niger, as with the polypeptide encoded in p24GSGO indicate that mutein pSGO3C521S the most stable of the three enzymes.

IV. J Granted the way. P. amagasakiense /obtained from the American type culture Collection/ raised on the environment WAR and was isolated DNA essentially as described in Boel, etc. /1984/.

The selected DNA was digested by various restrictase, i.e., EcoRI Hind III, BamHI, SalI, PST, XhoI and transferred to nitrocellulose. The unit analyzed labeled with a random primer 1.9 T. p. N. BglII fragment of the gene from A. niger, which is present in the plasmid B24GSGO. Hybridization was performed in a mixture containing the sample in 20% formamide and 10% of dextransucrase, when 42With during the night. The filters were then washed at 50With solution 1 x SSC. 0.1% sodium dodecyl sulfate /DDS-Na/ and autoradiographically during the night. Radioautography showed only a specific band for each lane, indicating that the genome of P. amagasakiense is the only gene with homology to gene TH A. niger. In particular, it was observed BamHI fragment and Hind III fragment size of 2.4 T. p. N. and 1.9, etc., ad, respectively.

For cloning the BamHI fragment of 20 μg DNA of Penicillium were digested with restriction enzyme and the fragments separated by electrophoresis and has a size of between 2.3-2.6, etc., B.C., was isolated from the gel. DNA of this drug was Legerova in pBR322 treated with BamHI and phosphatase. The transformation of the aliquots, legirovaniem the recombinants by controlling the phenotype. Potentially recombinant colonies were transferred on duplicate nitrocellulose filters and hybridized with the above-described breakdown of pAB24AGSGO. Hybridization was carried out at 37With 10% formamide and 10% of dextransucrase. Filters were washed at 50With solution 1 x SSC 0.1% DDS-Na and autoradiographically 3 days. 6 potential positive clones were identified, selected and plasmid DNA of their selection. 5 of these clones contained a BamHI insert 2.3-2.6, etc., ad, followed by the southern blot analysis showed that 3 of them are the same. A representative plasmid, restricta map which is shown in Fig. 15, was named pBRpGOXA11.

Sequencing BamHI insert pBRpGOXA11 were carried out as follows.

The selected plasmid DNA was digested BamHI, was isolated fragments of approximately 2.5 T. p. N. and then were digested Hind III. The mixture of fragments are then ligated into M13 DNA from potentially recombinant plaques were subjected to sequencing. The resulting sequence of one such clone, RII shown in Fig. 16, where you can see that the open reading frame /LFS/ undeniable throughout 445 mon fragment.

Comparison of the amino acids encoded in 445 mon fragment derived from arise is the sequences, it is shown in Fig. 5B, shown in Fig. 17. The drawing is mapped sequence suggest that the hypothetical clone TH Penicillum begins at amino acid 64 in the sequence of A. niger. In addition, proteins, apparently, identical to 52% at the amino acid level.

Deposit of biological materials

The polynucleotide construct containing the cDNA of clone 2 was deposited by an American Collector Types of Cultures /ADS/, 12301 Parklawn Drive, Rockville, Maryland USA, and will be stored on the conditions of the Budapest Treaty. After the adoption and publication of the present application in the form of a patent of the United States limits the availability of this Deposit will be permanently marked; and access to this Deposit will be possible in the continuation of the uncertain state of the above-mentioned application for a person who, as determined by the Commissioner, shall have the right, in addition, 37 CFR 1.14 and 35 USC 1.22. The Deposit will be maintained for thirty /30/ years from the date of the Deposit, or for five /5/ years after the last provision of Deposit, or within the time of validity of a U.S. patent, if it will be longer. Receiving the number and date of Deposit given below.

This Deposit is provided in the interests of experienced Annie, equivalent embodiments unable experienced experimenters in view of this disclosure. Public availability of this Deposit is not a gift of permission to manufacture or sell the deposited material under this or any other patent. The sequence of the nucleic acid depositbingo material included in the present disclosure by reference and controlled, if contrary to any of the sequences described herein.

Although the foregoing invention has been described in some detail for the purpose of illustration, it is obvious that changes and modifications can be applied within the attached claims experienced experimenters.

Industrial validity.

Providing recombinant policitical, coding, makes it possible methods, which are based on the expression of the polypeptide in recombinant systems. These methods and recombinant systems are particularly useful because they allow the generation of large quantities of the desired product. They also make possible the obtaining of polypeptides in systems that do not which they can be easier and more economical cleaned because they can be constructed expression vectors that cause the secretion product in cf is the development and evaluation of glucose in industrial fluids in the body fluids, such as blood and urine.

In addition, methods using recombinant systems, coding, allow obtaining TH in systems that are compatible with the expressed purpose of the product. For example, TH is used beschreven eggs in removing oxygen from beverages, wet Basevich products, fragrances and sealed packages of food. Getting polypeptide in yeast, the use of which in food sanctioned, should be beneficial, because the need for harsh cleaning should be less than if the polypeptide is produced from its natural source, A. niger, which is not allowed for food products and which is highly allergic.

Moreover, the methods and recombinant systems allow obtaining analogues, and fragments, which can be found commercial use in the determination procedures. For example, fused proteins TH may act instead of the labeled antibodies or conjugates in the analysis of sandwich type. The molecule can be fused with epitope recognizable detektivami antibody. The presence of a complex of the antibody-epitope will be determined by detection of the enzymatic activity of glucoseoxidase. In conjunction with the analysis of peroxidase in red blood those who may also be advantageous in medical procedures. For example, the hydrogen peroxide is toxic to many bacteria and cells. You can target the enzyme to specific pathogens and/or merging TH with antibodies recognizing these specific targets.

Inactive polypeptides that are fragments or analogs, can be used to generate antibodies to both polyclonal and monoclonal. These antibodies are useful for cleaning TH and polypeptides substantially similar to, immunoaffinity methods.

Claims

1. Recombinant vector comprising a polynucleotide sequence encoding a polypeptide exhibiting the activity of glucose oxidase (GO), with the sequence shown in Fig.5B, or mutein containing Ser at position Cys at amino acid residue 521 sequence shown in Fig.5B, and a regulatory sequence containing glyceraldehyde-3-phosphatedehydrogenase (ADH2/GAP hybrid promoter of the yeast glyceraldehyde-3-phosphate (GAP) and terminator regulatory sequence that provides secretion, which is selected from a sequence that encodes a yeast alpha-factor and preprofessionals from A. niger.

2. Recombin is eljnosti for expression, operatively associated with the sequence that encodes a polypeptide with the activity.

3. Recombinant vector according to p. 2, where sequences that allow expression of the coding sequence, provide for expression in yeast.

4. Recombinant vector according to p. 3, which further comprises a sequence that provides secretion of the polypeptide into the environment.

5. Recombinant vector under item 1, which is selected from a group including:

(i) the vector 24GSGOGO;

(ii) the vector 24GalphaGO;

(iii) the vector 24GSGO, otherwise known SGO-2;

(iv) the vector Rav@GO, otherwise called p@GO-1;

(v) the vector pSGO3C521S.

6. The Saccharomyces cerevisiae strain GRF180 transformed SGO3C521S producing a polypeptide having glucose oxydase activity.

7. A method of obtaining a recombinant polypeptide having glucose oxydase (TH) activity, where the method includes culturing the transformed cells that produce the specified polypeptide, and the subsequent isolation and purification of the target product, characterized in that the transformation of cells is performed with the vector containing polynucleotide that encodes the polypeptide under item 9, operatively associated with a sequence specific cells or yeast cells.

9. Non-natural recombinant polypeptide exhibiting the activity, and the specified polypeptide selected from the group consisting of a polypeptide shown in Fig.5B, and his mutein, which contains a serine at the position of the cysteine at amino acid residue 521 sequence shown in Fig.6, and additionally hyperglycosylated relatively natural.

10. The polypeptide under item 9, obtained by the method according to p. 7.

Priority points and attributes:

19.06.1989 - feature “mutein containing Ser in position s at amino acid residue 521 PP.1, 7, 9, the characteristic vector SGO3C521S” PP.5 and 6;

21.06.1988 - PP.1-10, except for the sign “mutein containing Ser at position Cys at amino acid residue 521 PP.1, 7, 9 and the characteristic vector SGO3C521S” PP.5 and 6.

 

Same patents:

The invention relates to the production of endostatin mouse and man

The invention relates to genetic engineering

-glucanase encoding his dna and method thereof" target="_blank">

The invention relates to the field of production of enzyme preparations by means of genetic engineering and can be used in biotechnological processes and microbiological industry

by activity" target="_blank">

The invention relates to the production of biologically active IL-1protease using recombinant DNA technology and can be used in medicine

The invention relates to the field of biotechnology and genetic engineering and can be used in the diagnosis of diseases of pigs

The invention relates to biochemistry and biotechnology and can be used for isolation and purification of physiologically active recombinant granulocyte colony-stimulating factor human (RCG-CSF)

The invention relates to biotechnology, concerns batch fermentation of feed with a special system of vector-host E. coli for the efficient education of recombinant proteins, in particular recombinant antibody molecules, preferably fragments of antibodies, such as Manantial

The invention relates to biotechnology, in particular to antibodies against Rtln, obtained by genetic engineering methods

The invention relates to biotechnology, namely microbiological obtaining1,2-corticosteroids
The invention relates to biotechnology, may find application in biochemistry, when defining activities in biological fluids

The invention relates to biotechnology and microbiological concerns methods for producing enzyme preparations, and more particularly methods of obtaining superoxide dismutase and related enzymes

-lidiruyushey monooxygenase (options) and the method of obtaining a-amidinophenoxy form of regulatory polypeptide" target="_blank">

The invention relates to alpha-lidiruyushchim enzymes, the production of alpha-lidirujuwih enzymes and their use in the production of alpha-emitirovannykh products by influencing enzymes on elongated substrates glycine

The invention relates to Microbiology, in particular to methods for determining the activity of glucose-6-phosphate dehydrogenase in bacteria of the genus Yersinia

The invention relates to biotechnology, particularly to the obtaining of the enzyme carrying out the transformation of rifamycin - In rifamycin S through the intermediate stage of formation of rifamycin O

The invention relates to biotechnology and the receipt of the enzyme alcoholiday higher alcohols, which are used in experimental studies

The invention relates to the field of biotechnology and medicine, in particular, genetic engineering and immunology, and can be used for immunization against human immunodeficiency virus type 1 (HIV-1) subtype a
Up!