Cd19xcd3-specific polypeptides and their use

 

The invention relates to the medical industry and refers to polypeptides that are specific against CD19 and CD3, and their applications. The invention includes a single multifunctional polypeptide, specific C19 and CD3 antigens formula: VLCD19 - VHCD19 - VHCD3 - VLCDS, polynucleotide encoding this polypeptide expressing vector, strain cell culture, the method of obtaining a polypeptide, a pharmaceutical composition for treating a malignant disease In a cell, a diagnostic composition, the way to identify activators or inhibitors of T-cell activation or stimulation, the method of preparation of pharmaceutical compositions intended for the treatment of malignant diseases In cells, a method for the treatment of malignant diseases In cells or depletion of b-cells and a way to slow the development of pathological conditions. The advantage of the invention is the development of methods suitable for the treatment mediated by b-cell diseases. 11 C. and 17 C.p. f-crystals, 22 ill., table 2.

The present invention relates to a new multi-stranded polypeptides comprising at least two antigenspecific uchastki, where the above polypeptide includes at least one additional domain, preferably with a predetermined function. In addition, the present invention relates to polynucleotides coding for these polypeptides, and vectors comprising these polynucleotides, and transformed their cells-owners, and to their use for obtaining the above polypeptides. The invention also relates to compositions, preferably pharmaceutical and diagnostic compositions, comprising any of the above polypeptides, polynucleotides or vectors. Another object of the present invention is the use of the above polypeptides, polynucleotides and vectors for the preparation of pharmaceutical compositions for immunotherapy, preferably for the treatment of malignant diseases In cells, such as non-jackinsky lymphoma.

In the present description cited several documents. Each of the cited documents (including any manufacturer specifications, instructions and so on) included in the present description by reference; however, does not imply that all the cited documents are prototypes of the present invention.

Nesmotrya lymphoma, received only a small quantity is acceptable for clinical use, data, and common approaches to the treatment of such diseases remain trivial and painful and/or have a high risk of relapse. For example, although high doses of chemotherapy as the primary treatment vysokokachestvennoj not-jackinsky lymphoma can improve overall survival rates of approximately 50% of patients still die of the disease (2-4). In addition, nizkolikvidny reminiscent of not-Hodgkins lymphoma, chronic lymphatic leukemia and lymphoma cells covering layer are still incurable diseases. These reasons have stimulated the development of alternative strategies of immunotherapy. Antibodies that are produced to molecules on the cell surface, which are characterized antigens CD, give a unique valuable opportunity for the development of therapeutic reagents.

The expression of certain antigens CD largely limited to a specific line of differentiation lymphohematopoietic cells and in the last few years, the antibodies obtained to specific lymphoid tissue antigens, was used to develop treatment methods that have been effective or interest In all cell lines differentiation from Pro-b cells to Mature b cells, he disappears uniformly expressed on the surface of lymphatic cells and is absent in stem cells (8, 14). Of interest is the use of especifismo antibodies specific to the antigen CD19 and CD3 antigen on T-cells. However, a disadvantage of currently available bespecifically antibodies is their low T-cell cytotoxicity, and for the manifestation of sufficiently high biological activity required additional stimulating agents.

Thus, the technical problem underlying the present invention is the development of methods and techniques suitable for the treatment mediated by b-cell diseases, such as various forms of non-jackinsky lymphoma. The solution to this technical problem is achieved by means of embodiments, which are presented in the claims.

Thus, the present invention relates to single-chain multifunctional polypeptide, including

(a) a first domain containing antigennegative plot chain immunoglobulin or antibody that specifically recognizes the antigen CD19, and

(b) a second domain containing antigennegative plot chain immunoglobulin which the present invention refers to, one of antigenspecific plots recognizes pan-b-cell marker CD19, which is expressed uniformly on the surface of virtually all malignant b-cells, and the other antigennegative section recognizes the CD3 antigen of human T cells.

The concept of "antigennegative plot" in the context of the present invention refers to a domain that includes the three-dimensional structure having the ability to specifically bind to an epitope similar to that of the native antibody, free scFv fragments, or one of their respective chains of immunoglobulin, preferably VH-chain. Thus, this domain may include VH- and/or VL-region antibody or chain of immunoglobulin, preferably at least VH-area. On the other hand, these antigennegative parcels in the polypeptide according to the invention, can include at least one hypervariable segment (CDR) of the antibody or chain immunoglobulin that recognizes antigens CD19 and CD3, respectively. In this regard, it should be noted that the domains antigenspecific sites that are present in the polypeptide according to the invention can not only be derived from antibodies, but also from other CD19 or CD3-binding prietenii, this antigennegative the area is included in the domain.

The concept of "multifunctional peptide in the context of the present description denotes polypetide comprising at least two amino acid sequences originating from different sources, i.e., two different molecules, not necessarily originating from different species, and at least two of these sources determine the specificity antigenspecific areas. Thus, these antigennegative areas determine the specificity of the functions or at least some functions of this multifunctional peptide. Such polypeptides include, for example, bespecifically single-stranded (bsc) antibodies.

The term "single-stranded" in the context of the present description denotes that the said first and second domain polypeptide covalently linked, preferably in the form kalininoi amino acid sequence encoded by the nucleic acid molecule. CD19 refers to an antigen that is expressed In the cell line differentiation, such as Pro-b-cell and Mature b-cell, he disappears uniformly expressed on the surface of lymphatic cells and is absent in stem cells (8, 14).

CD3 denotes what about the receptor, and it consists of three different chains of CD3, CD3and CD3. The formation of clusters CD3 on T-cells, for example, by immobilization of antibodies to CD3 leads to T-cell activation, similar to the activation of T-cell receptor, but which does not depend on typical clone specificity. Characteristically, the main part of the antibodies to CD3 recognizes CD3chain.

Antibodies that recognize specific antigen CD19 or CD3, known from the existing art, as for example described in (24), (25) and (43) respectively, and can be obtained using known in the field of methods.

Previously it was found that bespecifically antibodies CD19CD3 who do not have single-stranded format, re-directed T-cell cytotoxicity on cell lymphoma independent of MTL by the way, have efficacy in vitro(5, 6, 9-11, 13, 43), in animal models (7, 28), and in some pilot clinical trials (12, 29, 30). For this purpose, antibodies designed using methods based on interspecific hybrid by covalent binding of monoclonal antibodies (31) or use bespecifically ant is low biological activity, that makes it necessary to use high doses, in addition, the use of some antibodies did not provide the desired therapeutic effect. In addition, the availability of clinically pure material was limited.

Without going into theory, it can be assumed that the results obtained using the above especifismo reminiscent of antibodies format polypeptides, such as bespecifically antibodies CD19CD3, as a rule, can destroy CD19-positive target cells by recruitment of cytotoxic T-lymphocytes, without the pre - and/or costimulate T cells. This is in direct contrast with all known bespecifically antibodies CD19CD3, which are produced according to different molecular formats and, as a rule, does not depend on the specific CD19 or CD3-specificity of the antibodies used in construction, for example, especifismo single-chain antibodies. Independence from pre - and/or costimulate T cells may largely determine extremely high cytotoxicity, mediated by the polypeptide according to the invention, as is illustrated by the use of specific bespecifically antibodies CD19CD3-specific antibodies obtained using interspecific hybrid, by chemical bonding or by renaturation of bacterial intracellular Taurus. Further advantages and unexpected properties of the polypeptide according to the invention will be discussed in the following examples, which are not intended to limit the scope of the invention, including some below, preferred embodiments of which illustrate the broad concept of the present invention.

According to the present invention, used a eukaryotic expression system, which was developed to obtain recombinantly bespecifically single-chain antibodies (1) to produce recombinante especifismo single-chain antibodies CD19CD3 by expression in Cho cells. Fully functionally active antibody can be purified from culture supernatant using its C-terminal his-tag match is reattaching the FASC (cell sorters with excitation fluorescence). The resulting molecules bscCD19CD3 (bespecifically single-chain antibody CD19CD3) discovered some unexpected properties:

- it induces high aimed to lymphoma, T-cell cytotoxicity in vitro and in vivo. Even in very low concentrations at the level of 10-100 PG/ml and a low ratio E (effector): T (target), such as 5:1 and 2.5:1, observed a significant specific lysis of cell lines lymphoma. In addition, when a sparing application of 3-10 μg molecules bscCD19CD3 according to the invention found a clear and significant improvement in health status. Compared with the known antibody CD19CD3 obtained through interspecific hybrid and methods using a double antibody (which are also different formats) that exhibit cytotoxic activity in the range of a few nanograms/ml or even μg/ml, the antibody bscCD19CD3 according to the invention is probably much more efficient (5-7, 27, 43), for example, as shown in the following examples 4, 5 and 7.

Even low concentrations of bscCD19CD3 according to the invention allagash E:T and without the need for any pre-stimulation of T cells. In contrast, conventional bespecifically antibody CD19CD3 (5-7, 27) under these conditions (i.e. without pre-stimulation of T-cells and with a low ratio of E:T) did not show any appreciable cytotoxic activity even at high concentrations, reaching 3000 ng/ml Although the induction of cytotoxic activity without prior stimulation was previously installed to a conventional antibody CD19CD3, this effect was achieved only at higher concentrations and a high ratio of E:T (100 ng/ml, 27:1) (9) compared to bscCD19CD3 according to the invention (100 PG/ml; 2,5:1). In addition, the cytotoxic effect of this is usually antibodies was observed only after 1 day after pre-stimulation by bespecifically antibody, while bscCD19CD3 according to the invention induces aimed to lymphoma cytotoxicity after 4 h According to the applicants, this rapid and specific cytotoxic activity of unstimulated T cells at such low concentrations and ratios of E:T is not described for other previously used bespecifically antibodies. Although it was recently established that F(ab)2-fragment bind src="https://img.russianpatents.com/chr/215.gif">CD3 according to the invention, for this antibody is required prior stimulation for 24 h with IL-2 (32). Thus, bscCD19CD3 antibody according to the invention has unique properties cytotoxicity, what distinguishes this molecule from other known bespecifically antibodies.

BscCD19CD3 according to the invention mediates the cytotoxic actions that are antigen-specific, as evidenced by these facts:

- this antibody has the ability to perform lysis of the cell lines plasmacytoma NCI and L363, which are cell lines of b-cell differentiation, not expressing the antigen CD19; and

- cytotoxicity against lymphoma cells may be blocked by the parent antibody to CD19 HD37 (antibody HD37 comes from hybridoma HD37 (22)).

Blockade of the pathway of biosynthesis of perforin by depletion of calcium using AGTK (etilenvinilatsetata acid) completely inhibited mediated bscCD19CD3 cytotoxicity, suggesting that specific lysis rather mediated by T-cells and is not associated with direct exposure to the antibody.

Summarizing the above, we can conclude that construire the data bespecifically antibodies CD19CD3 from the point of view of its much higher biological activity, and from the point of view of its possible quick and simple method of obtaining, providing large quantities of high quality clinically pure material.

Thus, molecules bscCD19CD3 according to the invention can be considered as acceptable candidates for evidence that therapeutically valuable bespecifically antibodies can be used for the treatment mediated by b-cell diseases, such as non-jackinsky lymphoma in clinical conditions.

In the preferred polypeptide according to the invention the specified domains connected by a polypeptide linker. This linker is located between the first and second domain, and that the polypeptide linker preferably includes numerous hydrophilic related peptide amino acids, and it connects the N end of the first domain and the second domain.

According to another preferred variant, the first and/or second domain of the above-described polypeptide mimics or corresponds to VHand VL-the field of natural antibodies. Antibody carrying antigennegative plot of the polypeptide according to the invention may Ave the bath" antibody, bespecifically antibody, synthetic antibody, antibody fragment, such as Fab, Fv or scFv fragment, and so on, or chemically modified derivative of any of them. Monoclonal antibodies can be obtained, for example, the methods originally described ohler and Milstein, Nature 256 (1975), 495, and Galfre, Meth. Enzymol. 73, 3 (1981), which include cell fusion of mouse myeloma with spleen cells derived from immunized mammals, and with the modifications adopted in this field.

In addition, antibodies to these antigens or their fragments can be obtained using the methods described, for example, Harlow and Lane "Antibodies, A Laboratory Manual", CSH Press, Cold Spring Harbor, 1988. Antibodies may be derived from several species, including humans. When derivatives of these antibodies obtained using the available methods of using phages to improve the efficiency of antibody phage that bind to the epitope of the antigen CD19 or CD3, can be applied to the surface plasma resonance (Schier, Human Antibidies Hybridomas 7, 97-105 (1996); Malmbord, J. Immunol. Methods 183, 7-13 (1995)). Obtaining chimeric antibodies are described, for example, in WO 89/09622. Methods of producing humanized antibodies is described, for example, in EP-A 10239400 and WO 90/07861. For more historichotel. General principles of obtaining xenogenic antibodies, such as human antibodies in mice, described for example in WO 91/10741, WO 94/02602, WO 96/34096 and WO 96/33735.

Antibodies, which are used according to the invention, and their corresponding(s) of immunoglobulin(s) chain(s) can be further modified using conventional methods known in this field, for example, by using amino acid(s) deletion(s), insertion(s), substitution(h), additive(s) and/or recombination(s) and/or other (s) modification(s) known in this field, separately or in combination. Methods for introducing such modifications in the DNA sequence encoding the amino acid sequence of the chain of immunoglobulin, well known to specialists in this field and are described, for example, Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory (1989), N. Y. Described in this manual modification is preferably carried out at the nucleotide level.

According to another preferred variant of the invention, at least one of the specified domains in the above-described polypeptide is a single-chain fragment variable region of the antibody.

As is well known, Fv1that is the minimum fragment antibodies, colorimetrically region of the heavy chain and the variable region of light chain (VHand VL-region), which are not covalently linked. In this configuration, which is found in natural antibodies, three hypervariable segment (CDR) of each variable regions interact to determine antigennegative area on the surface of the VH-VL-dimer. Overall, six CDR determine the binding specificity of antigen-antibody. Frame sections (FR), flanking the CDR, have a tertiary structure, which is basically conservative in nature immunoglobulins such diverse species as human and mouse. These FR serve to maintain CRD in the appropriate orientation. The constant region is not required for binding, but they may participate in the stabilization of VH-VL-interaction. Even a single variable region (or half of an Fv fragment containing only three are specific to the CDR antigen) has the ability to recognize and bind antigen, although usually with a lower affinity than the full antigennegative plot (Painter, Biochem., 11, 1327-1337 (1972)). Therefore, this domain antigennegative part of the polypeptide according to the invention can be a couple of VH-VL- VH-VHor VWith the VL-regions in the polypeptide chain is not critical to the present invention, the above order of the domains can be changed, as a rule, without any loss of function.

However, it is important that VHand VL-areas are arranged such that antigennegative the site could be properly stowed (curved).

In the preferred polypeptides according to the invention, these domains are arranged in the following order: VLCD19-VHCD19-VHCD3-VLCD3, where VLand VHdenote variable region light and heavy chain specific antibodies to CD19 and CD3.

As discussed earlier, these antigennegative sections are preferably connected by a flexible linker, preferably a polypeptide linker, which is located between these two domains, and the polypeptide linker preferably includes numerous hydrophilic related peptide amino acid sequences that have a length sufficient to overlap the distance between the end of one of the specified domains, including these antigennegative plots, and N is the end of the second domain that includes the specified antigennegative areas, when the polypeptide Elena polypeptide linker includes numerous residues of glycine, alanine and/or serine. Also preferably, this polypeptide linker included a number of consecutive copies of the amino acid sequence. Typically, the polypeptide linker comprises 1-15 amino acids, although the polypeptide linkers consisting of more than 15 amino acids, may well perform its function. According to a preferred variant of the invention, the polypeptide linker comprises 1-5 amino acid residues.

According to a particularly preferred variant of the invention, the polypeptide linker in the polypeptide according to the invention consists of 5 amino acids. As demonstrated in the following examples, it is preferable that the polypeptide linker included amino acid sequence Gly Gly Gly Gly Ser.

According to another preferred variant of the invention, the first domain of the polypeptide according to the invention includes at least one CDR VHand VL-region that has the amino acid sequence encoded by the DNA sequence shown in Fig.8 from nucleotide 82 to 414 (VLand from nucleotide 460 to 831 (VH), and/or the second domain comprises at least one CDR, more preferably two, more is the selected DNA presented on Fig.8 from nucleotide 847 to 1203 (VHand from nucleotide 1258 to 1575 (VL), optionally in combination with the frame sections, which are found together in these CDR in the parent antibody. CDR containing indicated in Fig.8 variable regions can be identified, for example, according Cabatu, Kabat, "Sequences of Proteins of Immunological Interest" (U. S. Department of Health and Human Services, 3rd ed. 1983; 4th ed. 1987; 5th ed. 1990). Specialist in this field should be obvious that antigennegative area or at least one CDR from it can be used to construct a polypeptide according to the invention. Preferably the polypeptide comprises the amino acid sequence encoded by the DNA sequence shown in Fig.8 from nucleotide 82 to 1575. Specialist in this field should be obvious that antigennegative parts of the polypeptide according to the invention can be designed using methods known in this field, for example described in EP-A and ER-A.

Domains antigenspecific sections of the polypeptide according to the invention preferably have a specificity of at least practically at the same binding specificity, for example, the antibody or chain immunos is to help support at least 105M-1preferably not higher than 107M-1against the CD3 antigen, and preferably up to 1010M-1or above with respect to antigen CD19.

In the preferred polypeptide according to the invention

(a) antigennegative plot of the first domain has an affinity of at least about 10-7M, preferably at least about 10-9M and most preferably at least about 10-11M and/or

(b) antigennegative plot of the second domain has an affinity lower than about 10-7M, preferably lower than about 10-6and most preferably about 10-5M

According to the above preferred options for implementation, it is advisable to antigennegative plot, which recognizes the antigen CD19, had a high affinity to capture target cells, which must be destroyed with high efficiency. On the other hand, the binding affinity of antigennegative area, recognizing the CD3 antigen, must have the same order as natural CD3-receptor, or to comply with the affinity, which is observed in the interaction of T-cell receptor with the ligand, representing M is estline of the invention, the above-described polypeptide is bespecifically single-chain antibody.

The present invention also relates to a polypeptide comprising at least one additional domain, these domains are linked by covalent or non-covalent bonds.

The communication can be based on genetic fusion, which is carried out according to the above-described known in the field methods, or can be obtained, for example, by chemical cross-linkage, as described, for example, in WO 94/04686. Additional domain that is present in the polypeptide according to the invention can preferably be connected by a flexible linker, preferably a polypeptide linker, to one of the domains antigennegative plot, and this polypeptide linker preferably includes numerous hydrophilic related peptide amino acid sequences that have a length sufficient to overlap the distance between the end of one of these domains and the N-end of the second domain when the polypeptide according to the invention adopts suitable for binding conformation when placed in an aqueous solution. Preferably, this polypeptide linker is a polypeptide lichti split the linker or the site of cleavage by proteases, such as enterokinase (see following examples).

In addition, this additional domain may have a predefined specificity or function. For example, in the scientific literature there is a large amount of information about the directional transfer of biologically active substances, such as drugs, toxins and enzymes to specific points in the body to destroy or localization of malignant cells or to the induction of localized action of drugs or enzyme. It was proposed to achieve this action by conjugation of biologically active substances with monoclonal antibodies (see, for example, N. Y. Oxford University Press, and Ghose, J. Natl. Cancer Inst. 61, 657-676 (1978)).

In this context, it is also understood that the polypeptides according to the invention can be further modified by conventional known in the field methods. This allows to construct chimeric proteins comprising a polypeptide according to the invention, and other functionally active amino acid sequences, such as nuclear localization signals, transactionmode domains, DNA binding domains, hormonesmassive domains, protein tags (GST, GFP, peptide h-myc, FLAG-peptide), which can be obtained from heterologic is th length of 8 amino acids (see Fig.8).

The polypeptides according to the invention can be used to treat patients suffering mediated B-cell disorders, such as b-cell lymphoma caused by b-cell chronic lymphatic leukemia (B-CLL), and/or have associated with In-cell autoimmune disease, such as myasthenia heavy psevdomatematicheskoe, graves ' disease, Hashimoto's thyroiditis or syndrome?. This therapy can be carried out, for example, by introducing a polypeptide according to the invention. For such an introduction can be used as unlabeled and labeled polypeptides.

For example, the polypeptides according to the invention can be administered in the form of polypeptides labeled with a therapeutic agent. These agents may be associated, either directly or indirectly with antibodies or antigens according to the invention. One example of indirect linking is linking with spacer elements fragments. These spacer elements fragments, in turn, can be either insoluble or soluble (Diener, Science 231, 148 (1986)), and can be chosen in such a way as to allow the medicine to be released from antigen in place of the target. Examples used for immunotherapy therapeutic agents, cotoi, lectins and toxins. Drugs that can be conjugated to polypeptides of the invention include compounds that are classic representatives of drugs, such as mitomycin C, daunorubicin, and vinblastine.

When using the polypeptides according to the invention conjugated with radioactive isotopes, for example for immunotherapy, some isotopes may be more preferable than others depending on such factors as the distribution in leukocytes, as well as the stability and radiation. Depending on the autoimmune response some emitters are more preferred than others. In General, immunotherapy are preferred radioactive isotopes that emitand-particles. Preferred are short-lived, with great energy-emitters, such as212Bi. Examples of radioactive isotopes that can be associated with the polypeptides according to the invention for therapeutic purposes are125I131I90Y67Cu212Bi212At,211Pb47Sc,109Pd and188Re.

Lectins are proteins, obychnyy also able to agglutinate cells and to stimulate lymphocytes. The ricin is a toxic lectin, which has previously been used for immunotherapy. Immunotherapy was performed by linking-peptide chain of ricin, which is responsible for toxicity, with the polypeptide capable of sitespecific orientation of toxic action.

Toxins are poisonous compounds, which are produced by plants, animals or microorganisms, and that the appropriate dose is often lethal. The diphtheria toxin is a substance produced by Corynebacterium reagent grade, which can be used for therapeutic purposes. This toxin consists ofand-subunits, which under appropriate conditions can be separated. Toxic component And may be associated with a polypeptide according to the invention and can be used for sitespecific introduction to the interacting b-cells and T-cells, which are close to each other as a result of binding with a polypeptide according to the invention.

Other therapeutic agents as described above, which may be associated with the polypeptide according to the invention, as well as the relevant protocols of experiments ex vivi and in vitro are the Anna area may be used instead of the protein material described below polynucleotide according to the invention, encoding any of the polypeptides according to the invention, or the corresponding vectors.

Thus, the person skilled in the art should be obvious that the polypeptide according to the invention can be applied to construct other polypeptides with desired specificity and biological function. It is assumed that the polypeptides according to the invention can play an important role in medicine as therapeutic and scientific point of view, for example, when creating new methods of treatment associated with In-cell diseases such as certain forms of cancer and autoimmune diseases, or as promising tools for analysis and modulation of transduction of appropriate cellular signals.

According to another variant implementation, the specified at least one additional domain contains a molecule selected from the group comprising effector molecule having a conformation suitable for the manifestation of biological activity, amino acid sequences, which have the ability to cut out ion and amino acid sequences, which have the ability to selectively contact with a solid substrate or with a pre-selected antigen.

Pretensive plot synthesized by biological antibodies the growth factor, the factor of cellular differentiation, lymphokine, a cytokine, a hormone that is found at the distance of the fragment, an antimetabolite, a radioactive atom or an antigen. This antigen may represent, for example, a tumor antigen, a viral antigen, a microbial antigen, allergen, autoantigen, a virus, a microorganism, a polypeptide, a peptide, or a variety of tumor cells.

In addition, the sequence that has the ability to cut out ion, preferably selected from the sequence calmodulin, metallothionein, their functionally active fragment or amino acid sequence rich in at least one of the amino acids selected them glutamic acid, aspartic acid, lysine and arginine.

In addition, the sequence that has the ability to selectively contact with the solid substrate can be a positively or negatively charged amino acid sequence containing the cysteine-amino acid sequence, avidin, streptavidin, a functionally active fragment of the protein A of Staphylococcus, GST, His-tag, FLAG-tag or Lex A. As described in the examples below, the polypeptide according to the invention, an example kotze, to facilitate purification and identification. Used in the example of the FLAG-tag (see Fig.8), consists of 8 amino acids, and preferably used according to the invention. However, it is also preferred are used in the examples FLAG-tags, which are shortened versions of the FLAG, such as the amino acid sequence Asp-Tyr-Lys-Asp.

The above effector molecules and amino acid sequences may be present in the form of a preliminary form (Pro-forma), which itself either is or is not active, and can be removed, for example, if you hit a certain environment of the cell.

According to a preferred variant of the invention, the receptor is a further fuelled surface molecule important for activation of T cells, or includes epitopespecific plot or garmonsway website.

According to one of the most preferred embodiments of the invention, this further fuelled the surface molecule is a CD80 (B7-1) or CD86 (B7-2).

According to another preferred variant implementation, the present invention relates to polynucleotides that when asimi expression sequences, known in this field, in order to ensure proper transcription and translation of the polypeptide.

Such polypeptides may represent, for example, DNA, cDNA, RNA or obtained by synthetic DNA or RNA or obtained by recombinant chimeric molecule of nucleic acid, which includes any of these polynucleotides individually or in combination. Preferably such polynucleotide is part of the vector. Such vectors may include additional genes such as marker genes which allow for the selection of the vector in an appropriate cell host and in suitable environments. Preferably polynucleotide according to the invention is functionally associated with controlling the expression of sequences which allow for expression in prokaryotic and eukaryotic cells. Expression of polynucleotide includes transcription of polynucleotide with getting translated RNA. Professionals in this field are well known regulatory elements ensuring expression in eukaryotic cells, preferably mammalian cells. They usually include regulatory sequences that allow initiation of transcription of the additional regulatory elements may include enhancers of transcription, as well as broadcast and/or naturally occurring or heterologous to the promoter region. Possible regulatory elements ensuring expression in prokaryotic cells-hosts include, for example, promoters PL, lac, trp or tac in E. coli, and examples for regulatory elements ensuring expression in eukaryotic cells, the owners, are the promoter AOH or GAL1 in yeast or the CMV promoter, SSV40, RSV (rous sarcoma virus), CMV enhancer, the SV40 enhancer or a globin intron in mammalian cells and other animal cells. In addition to the items responsible for the initiation of transcription, such regulatory elements may also be signals termination of transcription, such as the site of the SV40-poly-a or site tk-poly-A, located in the course of transcription relative to polynucleotide.

In addition, depending on the expression system, leader sequences, which have the ability to carry out the directed transfer of the polypeptide to a cellular compartment or to provide directional secretion into the medium, can be added to the coding sequence polynucleotide according to the invention, and they are well known in the art; see, for example, the following population, initiation and termination, and preferred leader sequence has the ability to provide directional secretion of translated protein or part thereof in periplasmatic space or the extracellular environment. Optional heterologous sequence can encode fused protein, which includes the N-terminal identification peptide imparting desired characteristics, for example, performs a stabilizing function or simplifies purification of expressed recombinant product; see above. In this context, an acceptable expression vectors are known in the field vectors, such as expression vector cDNA Okayama-Berg (Okayama-Berg) pcDV1 (firm Pharmacia), pCDM8, pRc/CMV, pcDNA1, pcDNA3 (firm In-vitrogen) or pSPORT1 (firm GIBCO BRL).

Preferably vectors that have the ability to transform transfection eukaryotic cell host, which controls the expression of the sequence must be a system of eukaryotic promoters, but can also be used and controlling the sequence of prokaryotic hosts. After the vector has integrated into the appropriate host, the host contain conditions suitable on can be carried out collection and purification of the polypeptide of the invention (see for example, the examples below).

As described above, polynucleotide according to the invention can be used individually or as part of a vector for expression of the polypeptide according to the invention in cells, for example, for gene therapy or diagnosis of diseases associated with b-cell disorders. Polynucleotide or vectors carrying sequences(and) DNA, which is(s) encode(s) of any of the above polypeptides inserted into the cells, which, in turn, produce interest polypeptide. Gene therapy, which is based on the introduction of therapeutic genes into cells using methods of ex-vivo or in-vitro, represents the most important application of gene transfer. Acceptable vectors, methods or systems, the introduction of genes for gene therapy in-vitro or in-vivo are described in the literature and known to experts in this field, see, for example, Giordano, Nature Medicine 2, 534-539 (1996); Schaper, Circ. Res. 79, 911-919 (1996); Anderson, Science, 256, 808-813 (1992); Verma, Nature, 389, 239 (1994); Inser, Lancet 348, 370-374 (1996); Muhlhauser, Circ. Res. 77, 1077-1086 (1995); Onodera, Blood, 91, 30-36 (1998); Verma, Gene Ther. 5, 692-699 (1998); Nabel, Ann. N. Y. Acad. ScL, 811, 289-292 (1997); Vewrzeletti, Hum. Gene Ther., 9, 2243-2251 (1998); Wang, Nature Medicine, 2, 714-716 (1996); WO 94/29469; WO 97/00957, US 5580859; US 5589466 or Schaper, Current Opinion in Biotechnology, 7, 635-640 (1996), and is given in these publicatione using liposomes or viral vectors (for example, adenoviral, retroviral) into cells. Preferably, these cells are embryonic cell line, embryonic cell or an egg or derivatives thereof, more preferably the cell is a stem cell. An example of embryonic stem cells, among other things, can be a stem cell, described by Nagy, Proc. Natl. Acad. Sci. USA 90, 8424-8428 (1993).

According to the above, the present invention relates to vectors, particularly plasmids, cosmides, viruses and bacteriophages, which are usually used in genetic engineering, including polynucleotide encoding the polypeptide according to the invention. Preferably the vector is an expression vector and/or vector for transfer or for targeted gene transfer. Expression vectors derived from viruses such as retroviruses, vaccinia virus, adeno-associated viruses, herpes simple virus or bovine papilloma can be used for the introduction of polynucleotides or vector of the invention into a population of target cells. To construct recombinant vectors can be used in methods known to experts in this area; see, for example, the techniques described in Sambrook, Molecular Cloning variation polynucleotide and vectors according to the invention can be recovered in liposomes for maintenance in target cells. The vectors containing polynucleotide according to the invention, can be carried in a cage-the owner of the well known methods, which vary depending on the type of host cell. For example, transfection of the potassium chloride is usually used for prokaryotic cells, and treatment with calcium phosphate or electroporation can be used for other host cells; see Sambrook, supra. After the expression of the polypeptides of the present invention can be purified according to standard techniques in this area, including the deposition of ammonium sulfate, chromatography on affinity columns, chromatography on columns, gel electrophoresis, and so on; see the Scopes, "Protein Purification", Springer-Verlag, N. Y. (1982). For pharmaceutical applications, the preferred of practically pure polypeptides, homogeneous at least 90-95%, more preferably homogeneous at 98-99%. After purification, partial or optionally to a homogeneous state, the polypeptides can be used in therapeutic purposes (including in vitro) or to develop or implement procedures for the tests.

According to another variant implementation, the present invention relates to a cell containing polynucleotide or the vector described visiteuses, if there are therapeutic polypeptide. Naturally, also especially, if the polypeptide is used for diagnostic purposes, may apply yeast cells and less preferably prokaryotic cells such as bacterial cells.

Polynucleotide or vector according to the invention, which is in the cell-the owner may either be integrated into the genome of the host cell, or may exist outside of the chromosome.

It is implied that the term "prokaryotic" include all bacteria which can be transformed or transfection molecules of DNA or RNA for expression of the polypeptide according to the invention. Prokaryotic hosts may include gram-negative and gram-positive bacteria, such as E. coli, S. typhimurium, Serratia marcescens and Bacillus subtilis. It is implied that the term "eukaryotic" includes cells of yeast, higher plants, insects, and preferably mammals. Depending on the host used for obtaining recombinant molecules, polypeptides of the present invention can be glycosylated or may not be glycosylated. The polypeptides according to the invention can also include amino acid residue site and and or transfection of a host using any of the methods, usually well-known experts in this field. Especially preferred is the use of plasmids or vaccinated coding sequence of the polypeptide according to the invention and genetically fused with her N-terminal FLAG-tag and/or C-terminal His-tag. Preferably FLAG-tag has a length of 4 to 8 amino acids, more preferably 8 amino acids. Methods of obtaining merged, functionally related genes and their expression, for example, in mammalian cells, and bacteria are well known in the art (Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y. (1989)). Described in this manual, the genetic constructs and methods can be used for expression of the polypeptide according to the invention in eukaryotic or prokaryotic hosts. In General, expression vectors containing promoter sequences which facilitate the efficient transcription of the built polynucleotide apply depending on the selected host. Expression vectors usually contain a site of initiation of replication, a promoter and terminator, as well as specific genes which allow the selection of transformed cells for phenotypic characteristic. In addition, for large-scale proizvodyaschie cells according to the invention.

Thus, according to another variant implementation, the present invention relates to a method for producing the above-described polypeptide, providing for culturing cells according to the invention under conditions suitable for expression of the polypeptide and the selection of the polypeptide from the cells or from the culture medium.

Transformed hosts can be grown in fermenters and cultured according to methods known in this field, to achieve optimal cell growth. The polypeptide according to the invention can then be isolated from the environment for growing cell lysates or fractions of cell membranes. Isolation and purification, for example, expressed in microorganisms of the polypeptides according to the invention can be implemented by any conventional means, such as, for example, preparative chromatographic separation and immunological separation, including the use of monoclinal or polyclonal antibodies, for example, to label the polypeptide according to the invention or as described below in the examples.

Thus, the invention can be obtained by recombinant polypeptides, including antigennegative sites with affinity, speco active domain. As is clear from the above, the invention relates to a large family of polypeptides comprising such antigennegative areas, which can be used for any therapeutic and diagnostic purposes. Professionals in this field should be obvious that the polypeptides according to the invention can be further merged with the other above described fragments, for example, for the directional migration of the medicinal product and to visualize. Such a merger may be effected by chemical after expression of polypeptides with a site takeover, or fused product can be created in the polypeptide according to the invention at the DNA level. DNA then Express in a suitable system of the host and the resulting expression of the proteins are collected and, if necessary, centurybut. As described above, antigennegative areas preferably derived from variable regions of antibodies. In this regard, a method using a hybrid allows you to receive cell line secreting antibody to almost any desired substance that causes an immune response. Then from the cytoplasm of hybridoma can be obtained RNA encoding heavy and light chains of immunoglobulin. According to the method according to mlekopitayushchikh can be expressed DNA encoding the polypeptides.

Depending on the choice of the host cell to achieve a proper conformation may be required renaturation methods. Optionally, the DNA can be made point replacement, help to optimize binding, using conventional mutagenesis and the use of tapes or other methodology for the design of proteins, in particular described in this description. Obtaining polypeptides according to the invention can also depend on the data on amino acid sequence (or corresponding sequence of DNA or RNA) of biologically active proteins such as enzymes, toxins, growth factors, factors of cellular differentiation, receptors, antimetabolites, hormones or various cytokines or lymphokines. Such sequences are described in the literature and available from computerized data banks. For example, can be constructed polypeptide according to the invention, which, for example, consists of a single-chain Fv fragment and the extracellular region of human additionally stimulated protein CD80 (B7-1) connected via linker (Gly4Ser1)1. Additionally stimulated protein CD80 belongs to the Ig superfamily. He is a published in Freeman, J. Immunol. 143, 2714-2722 (1989). Stable expression can be achieved, for example, in Cho cells with deficiency digidrofolatreduktazy (DHFR), as described by Kaufmann, Methods EnzymoL, 185, 537-566 (1990). The protein can then be isolated using a His-tag attached to the C-end, using Ni-NTA-column (Mack, Proc. Natl. Acad. Sci. USA, 92, 7021-7025 (1995)).

In addition, the present invention relates to compositions comprising the above polypeptide, polynucleotide or vector according to the invention.

Preferably the present invention relates to compositions, which are pharmaceutical compositions comprising these above-mentioned polypeptide(s), polynucleotide(s) or vector(s) according to the invention.

The pharmaceutical composition of the present invention may optionally include pharmaceutically acceptable carrier. Examples of pharmaceutically acceptable carriers well known in the field and include phosphate buffered saline solutions, water, emulsions such as emulsions of oil/water, various types of wetting agents, sterile solutions etc., Compositions comprising such carriers can be prepared with well-known conventional methods. These pharmaceutical compositions can be administered PAC is here intravenously, intraperitoneal, subcutaneous, intramuscular, local, or intradermal injection. The regimen of medicines can be defined by regular doctor and she depends on clinical factors. As is well known from the field of medicine for each patient doses depend on many factors, including the patient's height, surface area, age, the particular compound to be introduction, sex, time and route of administration, General health, and other drugs, which are used at the same time. In General, in the case of regular use of pharmaceutical compositions regimen medicines should include the introduction from 1 μg to 10 mg standard dose per day. If the regimen of medicines is a continuous infusion, it should also be entered in the range from 1 μg to 10 mg standard dose per 1 kg of body weight per minute, respectively. However, a more preferred dose for continuous infusion may be from 0.01 μg to 10 mg standard dose per 1 kg of body weight per hour. Particularly preferred doses are given below. Their arrival can be determined through periodic evaluation. The dose may vary, but the preferred dose of DL is obreteniyu can be applied locally or systemically. The introduction is usually parenterally, for example intravenously; DNA may also be administered directly to the site of action, for example, using booballistics introduction to internal or external or by using a catheter to a specific area in the artery. Preparations for parenteral administration include sterile aqueous or nonaqueous solutions, suspensions and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters, such as etiloleat. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered environment. Carriers for parenteral administration include solutions of sodium chloride, dextrose and ringer, dextrose and sodium chloride, aktirovannye ringer's solution or liquid fats. Carriers for intravenous administration include liquid and nutritious fillers, electrolytic fillers (for example, on the basis of dextrose ringer), etc. May be present preservatives and other additives, such as, for example, antimicrobial agents, antioxidants, chelating agents and inert gases, etc., Cromer, serum albumin or immunoglobulin, preferably derived from a human body. In addition, it is envisaged that the pharmaceutical composition according to the invention may further include biologically active agents, depending on the intended use of the pharmaceutical composition. Such agents can represent medicines acting on the gastrointestinal system, drugs acting as cytotoxic agents, drugs, warning hyperuricemia, and/or such agents as costimulatory T-cell molecules or cytokines known in this field.

According to the present invention, it is understood that various polynucleotides and vectors according to the invention is administered either individually or in any combination using standard vectors and/or systems introduction genes and optionally together with a pharmaceutically acceptable carrier or excipient. After the introduction of these polynucleotide or vectors can be stably integrated into the genome of the patient.

On the other hand, can be used viral vectors that are specific to certain cells or tissues and sohranyaetsya composition, obtained according to the invention, can be used for prevention or treatment or delay the development of different types of diseases that are associated with b-cell immunodeficiency and malignant diseases.

In addition, you can apply the pharmaceutical composition according to the invention, which includes polynucleotide or vector according to the invention for gene therapy. Acceptable system of introducing genes may include liposomes, receptor-mediated transfer system, deproteinizing DNA and viral vectors, among other things, such as the herpes virus, retrovirus, adenovirus and adeno-associated virus. The transfer of nucleic acids to a specific location in the body with the aim of gene therapy can also be carried out using booballistics delivery systems, such as described by Williams (Proc. Natl. Acad. Sci. USA, 88, 2726-2729 (1991)). Additional methods of introducing nucleic acids include indirect particles gene transfer, for example such as described in Verma, Gen. Ther. 15, 692-699 (1998). It should be obvious that introduced polynucleotide and vectors Express a gene product after introduction into the cell and preferably remain in this state throughout the lifetime letterwriting sequences can be skonstruirovana using methods well known to specialists in this field. Cell host can be transformed polynucleotide according to the invention with breeding marker located on the same or on different plasmids, and not only expression vectors that contain viral sites of replication initiation. After the introduction of foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched medium, and then transferred to the medium for selection. Breeding marker in the recombinant plasmid causes resistance to agent selection and allows you to select cells, chromosomes are stably integrated plasmid and grow them with obtaining loci, which in turn can be cloned and reproduced with obtaining cell lines. Such engineered cell line is also particularly suitable for use in screening systems to identify compounds that are involved, for example, in the interaction of b-cells/T-cells.

Can be used a large number of breeding systems, including timedancing herpes virus simple (Wigler, Cell, 11, 223 (1977), gipoksantin-guaninephosphoribosyltransferase (Szybalska, Proc. Natl. Acad. Sci. USA, 48, 2026 (1962)) and adenine which can be used resistant to antimetabolites, based on the selection of the dhfr gene, which confers resistance to methotrexate (Wigler, Proc. Natl. Acad. Sci. USA, 77, 3567 (1980); O'hare, Proc. Natl. Acad. Sci. USA, 78, 1527 (1981)), gpt gene, which confers resistance to mycophenolic acid (Mulligan, Proc. Nail. Acad. Sci. USA, 78, 2072 (1981), gene gpt, which confers resistance to the aminoglycoside G-418 (Colberre-Garapin, J. Mol. BioL, 150, 1 (1981)), gene hygro, which confers resistance to hygromycin (Santerre, Gene, 30, 147 (1984) or puromycin (pat, puromycin-N-acetyltransferase). There are also other breeding genes, for example, trpB, which allows cells to utilize indole instead of tryptophan, hisD, which allows cells to utilize gastinel instead of histidine (Hartman, Proc. Natl. Acad. Sci. USA, 85, 8047 (1982) and ODC (ornithindecarboxilase), which confers resistance to the inhibitor interdiscursivity, 2-(deformity)-DL-ornithine, DFMO (McCologue, (ed) 1987, in: Current Communications in Molecular Biology, Cold Spring Harbor Laboratory).

According to another variant implementation of the present invention relates to diagnostic compositions comprising any of the above polypeptides, polynucleotides or vectors according to the invention, and optionally an acceptable detection methods.

The polypeptides according to the invention can also be used for immunoassays in which they can ispolzut used the polypeptide according to the invention, are competitive and unbeatable the immunoassays, performed either in the direct or indirect format. Examples of such immunoassays is radioimmunoassays (RIA), sandwich assay (immunodeficiency analysis and Western blotting.

The polypeptides according to the invention can also be bound to many different carriers and used to highlight the cells that are specific related to these polypeptides. Examples of well-known carriers include glass, polystyrene, polyvinylchloride, polypropylene, polyethylene, polycarbonate, dextran, nylon, amylose, natural and modified cellulose, colloidal metals, polyacrylamide, agarose and magnetite. For the purposes of the invention, the media, by their nature, may be either soluble or insoluble.

Specialists in this area known for numerous labels and methods of introduction of the label. Examples of the types of labels that can be used according to the present invention include enzymes, radioactive isotopes, colloidal metals, fluorescent compounds, chemiluminescent compounds and bioluminescent connection, see also the above-described embodiments of.

The present invention also relates to the use of videopedia treatment of b-cell malignant diseases, mediated by b-cells in autoimmune diseases or depletion In cells.

Current clinical trials using redirected cytotoxic activity of human T cells using bespecifically antibodies gave promising results in the treatment of refractory Hodgkin's disease (33), breast cancer and ovarian (34-37) and malignant gloomy (38). Considering the fact that

bsc antibodies due to their low molecular weight facilitate penetration into the tumor (which was proven to Fab and Fv fragments) (39), and

bsc antibodies, probably reduced in a dose-dependent and limited by dose toxicity caused by the release of systemic cytokine that is associated with the Fc-fragments of normal bespecifically antibodies (40), and

even the intact monoclonal antibody (synthesized CD20) leads to regression of tumors in advanced stages of non-jackinsky lymphoma (NHL) (41, 42), it can be expected, and it was demonstrated that the polypeptides according to the invention are of interest molecules, which may contribute to the improvement of therapeutic treatment methods.

Thus, according to a preferred variant implementation of pharmaceutical conoidal, polynucleotides and vectors according to the invention are large enough to cause the desired effect in which the symptoms mediated by b-cell disease will be facilitated. The dose should not be so high as to cause significant adverse side effects, such as unwanted cross-reactions, anaphylactic reactions, etc. In General, the dose may vary depending on age, condition, sex and condition of the disease in the patient and can be determined by the person skilled in the art. The dose can be adjusted every doctor in case of any contraindications. It is envisaged that the dose range is, for example, from 0.01 μg to 10 mg of the polypeptide according to the invention. Especially preferred is a dose in the range from 0.1 μg to 1 mg, more preferably from 1 μg to 100 μg, and most preferred from 3 μg to 10 μg, for example, that illustrated in the example below 7.

In addition, the invention relates to a method for the identification of activating or additionally stimulating T-cell connections or identification of inhibitors of T-cell activation or stimulation, which involves

(a) culturing D19 positive to the according connection having the ability to provide a detectable signal in response to T-cell activation compound to be screened under conditions providing communication connections with cells, and

(b) detecting the presence or absence of a signal resulting from interaction of the compound with the cells.

This implementation is particularly important for testing the ability of compounds to be additional stimulating molecules. According to this method, CD19-positive cell/b-cell provides a primary activation signal to T cells, without using so clonotypic T-cell receptor. Then according to the invention can be installed, which of the tested compounds is also required for full activation of T cells. According to the method according to the invention, CD19-positive cell/b-cell function as stimulating cell that binds bespecifically molecules, United with CD3 complexes on the surface of the same T cells. Biological methods of cultivation, detection and optional testing obvious to a person skilled in this field.

The concept of "connection" in the method according to the invention comprises a single substance or multiple wakie samples, as cell extracts, obtained, for example, from plants, animals or microorganisms. In addition, these compounds can be known in this field, but they may not be known for the ability to inhibit T-cell activation or are not aware that they can be used for additional stimulation of T-cells, respectively. Numerous compounds may be, for example, added to the culture medium or injected into the cell by injection.

If the sample containing the compound(I), identified according to the method according to the invention, it is either possible to isolate the compound from the original sample, for which it is established that it contains interesting connection, or you can further divide the original sample, if it consists of several different compounds in order to reduce the number of different substances per sample and repeat the procedure using subgroups of the original sample. Then, using methods known in this field, such as described in the present description and are described below in the examples, it is possible to determine whether the sample or connection required properties. Depending on the complexity of the samples described above stages can be about who will only consist of a limited number of substances or of one substance. Preferably, the sample contains substances with similar chemical and/or physical properties, and most preferably, these substances are identical. The methods of the present invention can be easily implemented and reproduced by specialists in this field, for example in experiments on other cells known from the prior art, or using modifications of the methods as described in the examples below. In addition, the person skilled in the art can easily determine what additional compounds and/or cells can be used to implement the methods according to the invention, such as interleukins or if necessary enzymes, which convert a certain connection in the predecessor, which, in turn, stimulates or suppresses T-cell activation. Such adaptation of the method according to the invention are well known to specialists in this field and can be done without conducting large-scale experiments.

Compounds that can be used according to the method of the present invention include peptides, proteins, nucleic acids, antibodies, small organic compounds, ligands, peptidomimetics, PNA (agglutinin from groundnuts), etc., This is full of activators or inhibitors. Methods of obtaining chemical derivatives and analogues are well known to specialists in this field and are described, for example, Beilstein Handbook of Organic Chemistry, Springer, editor New York Inc., 175 Fifth Avenue, New York, N. Y. 10010 USA and Organic Synthesis, Wiley, New York, USA. In addition, these derivatives and analogues can be tested for their effects according to known methods described, for example, in the examples below. Can also be used peptidomimetics and/or created by computer technology appropriate activators or inhibitors of T-cell activation, for example, using the methods described below. Appropriate computer programs can be used for the identification of interactive sites of the proposed inhibitor and antigen according to the invention on the basis of computer analysis of complementary structural motifs (Fassina, Immunomethods 5, 114-120 (1994)). Additional suitable computer system, intended to create with the help of computer technology, protein and peptides, known from the existing art, as for example described in Berry, Biochem. Soc. Trans. 22, 1033-1036 (1994); Wodak, Ann. N. Y. Acad. Sci. 501, 1-13 (1987); Pabo, Biochemistry 25, 5987-5991 (1986). The results obtained using the above-described computer analysis can ispolzovatsya. Suitable peptidomimetics can also be identified by the synthesis of combinatorial libraries of peptidomimetics using sequential chemical modification and testing of the compounds obtained, for example as described in the present description method and the following examples. Methods for the creation and application of combinatorial libraries of peptidomimetics are known from the existing art, as for example described by Ostresh, Methods in Enzymology, 267, 220-234 (1996) and Dorner, Bioorg. Med. Chem. 4, 709-715 (1996). In addition, to create inhibitors or activators of T-cell activation, which can be tested according to the method according to the invention, can be used as three-dimensional and/or crystallographic structure of inhibitors or activators of b-cell/T-cell interaction (Rose, Biochemistry 35, 12933-12944 (1996); Rutenber, Bioorg. Med. Chem. 4, 1545-1558 (1996)).

In General, the present invention relates to methods of identifying compounds that possess the ability to modulate mediated B-cell/T-cell immune responses.

Connections which have found the ability to activate mediated B-cell/T-cell immune responses, can be used for the treatment of cancer and similar diseases. In addition, it also appeared the spread of the virus. Compounds identified as suppressor T-cell activation or stimulation can be applied in the transformation of bodies in order to prevent transplant rejection; see also above.

It is also assumed that the compounds identified or obtained according to the method of the present invention, can be used for diagnosis and specific therapeutic purposes. Thus, another variant embodiment of the invention relates to a method for producing a pharmaceutical composition, which includes the preparation of pharmaceutically acceptable forms of the compounds identified at stage (b) of the above-described methods according to the invention. Furthermore, it was assumed that this component can be modified using peptidomimetics. Methods of preparation and use of combinatorial libraries of peptidomimetics are known from the existing prior art and described, for example, Ostresh, Methods in Enzymology, 267, 220-234 (1996), Dorner, Bioorg. Med. Chem. 4, 709-715 (1996), Beeley, Trends Biotechnol. 12, 213-216 (1994) or al-Obeidi, Mol. Biotech. 9, 205-223 (1998).

Therapeutically acceptable compounds identified according to the method according to the invention can be administered to a patient using any way acceptable for this connection, for example, orally, intravenously, partii (for example, if the connection is in the form of a solid or semi-solid biologically compatible and capable of dissolving the matrix in place or near the place where the action required connections. Therapeutic doses can be readily determined by the person skilled in the art, see above.

In addition, the present invention relates to a method of treatment of malignant b-cell diseases, mediated by b-cells in autoimmune diseases and / or depletion of b-cells, and/or to a method of slowing down the development of the pathological condition, which is called In-cell disorders, providing for the introduction of the polypeptide, polynucleotide or vector according to the invention to a mammal suffering from these malignant diseases and/or pathological condition. Also preferably, if the mammal is a human.

These and other embodiments of presents and enabled by the description and examples in the present invention. Additional literature data concerning any of the antibodies, methods, characteristics, applications and connections, which can be used according to the present invention, can be obtained from the published libraries and databases, using, for example, at the following email address: http://www.ncbi.nIm.nih.gov./PubMed/medline.html. Other databases and addresses, such as http://www.ncbi.nlm.nih.gov./, http://www.infobiogen.fr/, http://www.fmi.ch/biology/research_tools.html, http://www.tigr.org/, well-known experts in this field or can also be obtained, for example, the url http://www.lycos.com. Overview of patent information in the field of biotechnology and relevant sources of patent information that can be used for retrospective search and retrieve current data shown in Berks, TIBTECH 12, 352-364 (1994).

The description of Fig.1-22:

Fig.1:

LTO-PAG: staining with Kumasi cleaned bscCD19xCD3-fragment with different amounts of protein. Left shows the molecular mass (kDa) of marker

Fig.2:

FACS analysis bscCD19xCD3 (200 μg/ml) of various CD19-positive lines b-cells (BJAB, SKW6.4, Blin-1, Daudi, Raji) CD19-negative line-BL60 cells and CD3-positive cell line Jurkat and primary human RVMS (peripheral blood mononuclear cells). Dashed lines indicate negative controls.

Fig.3:

Cytotoxicity bscCD19CD3 when assessing the experience of release5lCr using unstimulated human RVMS and different lines of b-cells.

The ratio of cells effectively

Fig.4:

Cytotoxicity when assessing the experience of the release of chromium using unstimulated primary human PBL (peripheral blood lymphocytes) to plasmacytoma line L363 cells and NCI and line Daudi lymphoma cells. The ratio of E:T 20:1, the incubation time of 8 hours

Fig.5:

Inhibition of cytotoxicity bscCDl9CD3 parent antibody to CD19 HD37 in the experience of the release of chromium; the incubation time of 8 h; the ratio of E:T 20:1, the concentration bscCDl9CD3 1 ng/ml

Fig.6:

Assessment of cytotoxicity using unstimulated RVMS against cell line Daudi after adding increasing amounts of EGTC; the ratio of E:T of 10:1, incubation time 4 h

Fig.7:

Cytotoxicity bscCDl9CD3 when assessing the experience of release15SG using unstimulated human RVMS and lines Blin-1 as target cells at various ratios of E:T; incubation time 4 h; the concentration of normal especifismo antibodies 3 μg/ml; the concentration of bsc17-1ACD3 100 ng/ml; the ratio of E:T, as indicated above.

Fig.8:

The DNA sequence and protein antibodies bscCDl9CD3 (version with FLAG-tagged). is under the nucleotide sequence. The coding sequence of the DNA especifismo antibodies begins with position 1 and ends at position 1593. The first 6 NT (position -10 to -5) and the last 6 NT (1596-1601) contain sites of cleavage by restrictase EcoRI and Sail accordingly. Nucleotides 1-57 specific leader sequence; nucleotides 82-414 and 460-831 encode VL-area of CD19 and VH-area CD19, respectively; the nucleotide 847-1203 and 1258-1575 encode VH-area of CD3 and VL-area CD3, respectively, and the nucleotide 1576-1593 encode His-tag.

Fig.9:

Reducing primary (malignant) D19+-B - cells by recruiting autologous primary T-lymphocytes using bscCD19CD3

A. Initial moment of time (t=0): n=3106PBL/well were seeded in 24-well plates to tissue culture in each well in 1 ml of RPMI 1640, supplemented with 10% of FCS. Determine the initial percentage of CD19+-B cells, and CD4+- and CD8+-T-cells.

B-J. the Relative content In - and CD4+- and CD8+-T-cells after incubation for 5 days (t=5 days) at 37C/5% CO2in the absence (B) or presence (D-F) bscCD19CD3 (Konzentrat the Noah antibody (17-1ACD3) with irrelevant specificity against target cells or do not include bespecifically antibody (B).

Fig.10:

The cleanup phase bscCD19CD3

Fig.11:

LTO-SDS page analysis of purity bscCD19CD3

The data obtained with the help of colored colloid, Kumasi blue LTOs using 4-12% gradient polyacrylamide gel. Lanes 1 and 6 - molecular weight markers; lane 2 is the supernatant of the cell culture; lane 3 - active fraction obtained by cation-exchange chromatography; lane 5 - active fraction obtained by gel filtration. Analyzed the same amount of protein (2 μg) from cell culture supernatant and various column fractions. The right shows the molecular weight standards in kDa. The arrow shows the position bscCD19CD3.

Fig.12:

Cation-exchange chromatography bscCD19CD3

The concentration of protein was measured by absorbance at 280 nm (mAU, left). Bold line shows the elution profile of the protein. The profile obtained using a stepwise gradient of NaCl shown a straight thick line (%, right), and the collected fractions are shown strigosum chromatography bscCD19CD3

The concentration of protein was measured by absorbance at 280 nm (mAU, left). Bold line shows the elution profile of the protein. The profile obtained with a gradient of imidazole shown a straight thick line (%, right), and the collected fractions are shown by the dashed lines, bscCD19CD3 was detected in fractions F7.

Fig.14:

Gel filtration bscCD19CD3

The concentration of protein was measured by absorbance at 280 nm (mAU, left). Bold line shows the elution profile of the protein. Dashed lines show the collected fractions, bscCD19CD3 was detected in fractions F7, corresponding to a molecular mass of approximately 60 kDa.

Fig.15:

Blood levels of gamma-glutamyl transferase (GGT) in response to processing bscCD19CD3

Levels of GGT were determined by the standard method of clinical biochemistry and were expressed as units/l On the x-axis shows time in days (d) after the first processing of the medicinal product and, since 0 hours (h) after each injection of the drug. The arrows indicate the points in time of the injection medicines.

Fig.16:

Measurement using ultrasound of the spleen of the patient And-B

A. determination of the size of the village is the increased size of the spleen (size 146 mmof 69.2 mm), which is the result of infiltration of malignant b-cells.

B. Determining the size of the spleen, dated April 16, 1999, after the introduction of 3 µg April 14 and 10 µg April 15. The drawing shows a decrease in spleen size to 132 mm58,9 mm caused by systemic treatment bscCD19CD3. Differences between the individual measurements, which can be seen from table 1, are explained by the definition ultrasound sizes in different spatial planes. Two positions marked with (+) and ().

Fig.17:

The content of leukocytes in the blood in response to the processing bscCD19CD3.

The number of cells is given in MS./L. On the x-axis shows time in days (d) after the first treatment drug, and since 0 hours (h) after each injection of the drug. The arrows indicate the points in time of the injection medicines.

Fig.18:

Blood levels of C-reactive protein (CRP) in response to the processing bscCD19CD3

Levels of CRP were determined by the standard method of clinical biochemistry and were expressed as mg/DL. On the x-axis shows time in days (d) after starting PE is DSTV. The arrows indicate the points in time of the injection medicines.

Fig.19:

Blood levels of tumor necrosis factor alpha (TNF) in response to the processing bscCD19CD3

The levels of TNF were determined using ELISA and expressed in ng/ml On the x-axis shows time in days (d) after the first processing of the medicinal product and, since 0 hours (h) after each injection of the drug. The arrows indicate the points in time of the injection medicines.

Fig.20:

Blood levels of interleukin-6 (IL-6) in response to the processing bscCD19CD3

The levels of IL-6 were determined using ELISA and expressed in PG/ml On the x-axis shows time in days (d) after the first processing of the medicinal product and, since 0 hours (h) after each injection of the drug. The arrows indicate the points in time of the injection medicines.

Fig.21:

Blood levels of interleukin-8 (IL-8) in response to the processing bscCD19CD3

The levels of IL-8 were determined using ELISA and expressed in PG/ml On the x-axis shows time in days (d) after the first processing of the medicinal product and, since 0 hours (h) after each administration of medicinal cf the VI alpha-chain of the soluble receptor of interleukin-2 (IL-2R) in response to the processing bscCD19CD3

The levels of IL-2R were determined using ELISA and expressed in PG/ml On the x-axis shows time in days (d) after the first processing of the medicinal product and, since 0 hours (h) after each injection of the drug. The arrows indicate the points in time of the injection medicines.

Below the invention is described with reference to the following biological examples, which are given only for illustration and are not intended to limit the present invention.

Example 1: Cloning of variable (V) regions of immunoglobulin

V-region light chain (VLand V-region heavy chain (VHfrom hybridoma HD37 (22) was cloned according to standard methods of PCR (23). The cDNA synthesis was performed using oligo-dt primers and Taq polymerase.

List of primers

5'L1:GAAGCACGCGTAGATATCKTGMTSACCCAAWCTCCA [SEQ ID:1] 3'K:GAAGATGGATCCAGCGGCCGCAGCATCAGC [SEQ ID:2] 5'H1:CAGCCGGCCATGGCGCAGGTSCAGCTGCAGSAG [SEQ ID:3] 3'G:ACCAGGGGCCAGTGGATAGACAAGCTTGGGTGTCGTTTT [SEQ ID:4] 5'VLB5RRV:AGGTGTACACTCCATATCCAGCTGACCCAGTCTCCA [SEQ ID:5] 3'VLGS15: GGAGCCGCCGCCGCCAGAACCACCACCTTTGATCTCGAGCTTGGTCCC [SEQ ID:6] 5'VHGS15:

GGCGGCGGCGGCTCCGGTGGTGGTGGTTCTCAGGTSNARCTGCAGSAGTCWGG [SEQ ID:7]

3'VHBspE1:AATCCGGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG [SEQ ID:8]

For amplification of the V-regions using PCR the primers used were 5'L1 and 3 C, flanking the VLregion, and 5 N and 3'G for the heavy chain, Osnova A. Traunecker (25).

Example 2: Construction of bespecifically single-stranded fragments and expression in eukaryotic organisms

To obtain scFv-fragment to CD19 corresponding to VLand VH-region cloned into various plasmid vectors were used as matrices for VLand VH-specific PCR using pairs of oligonucleotide primers 5'VLB5RRV/3'VLGS15 and 5'VHGS15/3'VHBspEI respectively. Thus, PCR products were introducible overlapping complementary sequences, which were combined to obtain the coding sequence consisting of 15 amino acids (Gly4Ser1)3-linker during subsequent PCR mergers. This stage amplification was performed using a pair of primers 5'VLB5RRV/3'VHBsEI and the resulting fused product (or usually scFv-fragment to CD19) were digested with restricted EcoRV and BspEI and then cloned into the vector bluescript KS (Stratagene), which contains either a (EcoRI/SalI-cloned) the coding sequence especifismo single-chain antibody 17-1A/CD3 with N-terminal FLAG-tag (1) or its modified version without FLAG/epitope (21), thereby replacing anti-17-1A - anti-CD-19-specificity and maintaining consisting of 5 amino the patients DNA, encoding both versions especifismo single-chain antibodies to CD19/K CD3 with the following location areas: VLCD19-VHCD19-VHCD3-VLCD3was subclinically using EcoRI/SalI in the described expression vector pEF-DHRF (1), respectively. The obtained plasmid DNA was transfectional by electroporation of Cho cells with deficiency of DHFR, selection, amplification of the gene and getting the protein was performed as described previously (1). The following examples illustrate the results obtained with FLAG-containing version bscCD19CD3.

Cleaning bscCD19CD3 of the supernatant transfection Cho cells were allowed to receive 4 mg/l of culture supernatant. Purified bsc At using its C-terminal his-tag tail using affinity chromatography on Ni-NTA-column as described previously (1). Was suirable bsc-At of Ni-NTA-column as a separate peak at a concentration of 200 nm imidazole. For analysis, purification bsc conducted At the LTO-page according to Laemmli (26) using a 12% gel, followed by staining of Kumasi brilliant blue R250. The results of the LTO-SDS page analysis (Fig.1) indicate the expected size of the bsc At (60 kDa).

Example 3: binding bscCD19

1106Cells were washed SFR, resuspendable 200 ál SFR with 10% vernimmen (firm Centeon, Marburg, Germany) and 0.1% NaN3and incubated for 30 min at 4C. stage After centrifugation (100g, 5 min), cells were incubated in 50 μl bscCD19CD3 (200 μg/ml in SFR with 10% wernimont and 0.1% NaN3) for 30 min at 4C. Cells were washed twice in SFR. To identify bsc At used conjugated with FITZ (fluoresceinisothiocyanate) the antibody Episteme, as bscCD19CD3, or one antibody to the His-tag were used as negative controls. Flow cytometry was performed using a cell sorting device with fluorescence excitation type Becton Dickinson FACScan. He detected no binding with the surface of the cell line BL60, which are not expressed either CD19 or CD3 (Fig.2).

Example 4: Cytotoxic activity bscCD19CD3 against CD19-positive cell lymphoma

In experiments on the release of51IG found that the antibody bscCD19CD3 has a high toxicity against several cell lines lymphoma (Fig.3). Human peripheral blood mononuclear cells (RVMS) as cell effectors were isolated from fresh leucocytes films random donors using centrifugation using Lymphoprep(firm Nycomed) with subsequent stages of centrifugation at 100g to remove platelets. CD19-positive b-cells eliminated by using Dynabeads®V-450 CD19 (firm Dynal). Reduced (exhausted) populations of cells were analyzed using flow cytometry (Becton Dickinson), which showed 99% depletion of the population of CD19-positive cle is used line CD19-positive b cells (Raji, Blin I, Daudi, BJAB, SKW6.4). Cytotoxicity was measured according to standard practices on the release of chromium in round-bottom 96-well plates (firm Nunc), using complete medium RPMI 1640 (company Biochrom) with 10% FCS, GIBCO).

Estimulando RWMS was added in a volume of 80 µl of medium in each well containing 20 μl of different concentrations bsc At. Then added 100 μl of labeled using51SG target cells (1104), the plates were centrifuged for 3 min at 100g, and incubated for 4 h at 37C, 5% CO2. After an additional stage centrifugation 50 μl of supernatant was removed and analyzed in relation to vswobozdauschego51SG in the count of gamma radiation (TopCount, Canberra Packard).

Spontaneous release was assessed by incubation of target cells without cell effector or antibodies, and the maximum release was determined by incubation of target cells with 10% Triton X-100. Incubation of target cells with bsc-At cells without effector did not lead to detectable lysis. The percentage of specific lysis was calculated as the non-specific release (%)=[(CPM, the release in the experiment)-(cpm spontaneous release)]/[(CPM, max is the awns. RMSE (root mean square deviation) for the three replicates in all experiments was less than 6%. To simulate in vivo conditions as cells effectors used estimulando RUMS from healthy donors. Without using any Protocol pre-stimulation of T cells was observed rapid induction of cytotoxicity after 4 hours Taken as control bsc-antibody with a different specificity against tumors (bscl7-1AxCD3), but obtained using the same system as the antibody bscCD19CD3 showed lytic activity is not significantly above the background level of the environment. In addition, no cytotoxic activity was not detected when using as target cells plasmacytoma cell lines NCI and L363, which does not Express CD19 (Fig.4). In competitive assays using increasing quantities of CD-19-specific parental monoclonal antibody HD37 cytotoxic activity bscCD19CD3 can be almost completely blocked (Fig.5). These control options showed that indirect bscCD19CD3 cytotoxic actions are antigenicities. To obtain more CD19-positive target cells was attempted to block indirect bscCD19CD3 cytotoxicity using AGTK. As can be seen from Fig.6, the cytotoxic activity bscCD19CD3 can be completely blocked when using AGTK, which suggests that specific lysis is more likely represents a mediated T-cell activity (probably through the path of metabolism perforin) rather than direct (i.e., inducing apoptosis) the action of the antibody. Using unstimulated T cells even when using concentrations of antibodies below 1 ng/ml was observed a pronounced cytotoxic activity against cell lines Blin I (Fig.7). Even with a relatively low ratio of E:T (5:1; 2,5:1) and very low concentrations of antibodies 10-100 PG/ml bscCD19CD3-antibody was able to induce specific cytotoxic activity against unstimulated T cells (Fig.7). In contrast, conventional bespecifically antibody CD19CD3 obtained using hibrido-hybridoma method (5-7, 27), these conditions did not show appreciable cytotoxic activity even at concentrations up to 3000 ng/ml (Fig.7). This is a common bespecifically antibody needed additional pre-stimulation of T-to the cytotoxicity against T cells (data not shown), which is consistent with literature data (5-7, 27).

Example 5: the Elimination of primary (malignant) cells by autologous T cells in the cytotoxic activity bscCD19CD3

In order to assess the cytotoxic activity bscCD19CD3 against primary malignant b-cells, peripheral blood mononuclear cells (RVMS) patients suffering from B-CLL (due to B-cell chronic lymphatic leukemia), were isolated by centrifugation in a density gradient using Ficoll. These cells were then cultured in the presence of bscCD19CD3 for 5 days at 37C/5% CO2in medium RPMI 1640, supplemented with 10% FCS, optional with 60 u/ml IL-2, or cultivated without bscCD19CD3. Running cytometrics analysis showed that PBL (peripheral blood lymphocytes) this particular suffering from non-Hodgkin's lymphoma (NHL) patients (which then systematically introduced bscCD19CD3; see example 7) contained 92,6% of CD19-positive b-cells (i.e., target cells) and 7.4% D3-positive T-lymphocytes (i.e., cell-effectors) in the ratio of CD4/CD8 T cells 2,6 : 4,8. The main great106PBL/ml per well in a volume environment 1 ml in 24-well plate for tissue culture. As negative controls used culture medium plus IL-2 culture medium plus IL-2 does not have the same characteristics bespecifically single-chain antibody bscl7-1AxCD3 (1) at a concentration of 0.5 μg/ml As shown in Fig.9, no depletion of CD19-positive cells were not detected under these conditions and incubation for 5 days. However, when added bscCD19CD3 at a concentration of 0.5 μg/ml or 0.05 µg/ml (in the presence of 11-2, and without it), almost all CD 19-positive b-cells were destroyed. Cultured cells at this time consisted mainly of T-lymphocytes at a ratio of CD4/CD8 T cells from about 1:2 to 1:3. This fact demonstrates the exceptional direction of the cytotoxic effect of bscCD19CD3 against CD19-positive b cells, as the total depletion of primary b-cells autologous T-cells can be induced only at a concentration of 50 ng/ml highly undesirable when the initial value of the cell effector and target cells is less than 1:10, even without IL2 or other type of additional T-cell stimulation.

Example 6: Purification bscCD is cnica Chinese hamster (Cho), stable transfection expression vector (pEF-DHFR; see example 2), encoding bscCD19CD3, and additionally hexaglycine tag and FLAG-tag. Cells were grown in serum-free medium (firm Rencyte) in the fermenter with a system of hollow fibers (firm Unisyn). 500 ml of cell culture Supernatant was collected and sterilized by filtration through filters with a pore size of 0.2 μm (type AcroCap; Pall Gelman).

Revealed bscCD19CD3 and evaluated quantitatively Western-blotting using mouse IgG to FLAG (firm Sigma) and goat antibody to mouse IgG conjugated to alkaline phosphatase (firm Sigma). Detection was performed chemiluminescent method using BCIP/NBT (firm Devitron). The concentration of protein was determined using the method of Bradford (firm Biorad) using bovine IgG (firm Biorad) as standard protein. The purity of the column fractions was determined using a reducing electrophoresis in 4-12% gradient polyacrylamide gel (SDS page) sodium dodecyl sulfate (LTOs), bis/Tris, applying the system MOPS-buffer (company Novex).

For cleaning bscCD19CD3 until a homogeneous state was required cation exchange chromatography, cobalt chelate is conventional protocols (see below). Diagram of the purification process is shown in Fig.10.

Cation-exchange chromatography: the supernatant of cell culture obtained using Cho cells, was mixed with two volumes of buffer C (30 mm morpholinepropanesulfonic acid [MES], 20 mm NaCl, 3 mm add, 0.3 mm hydrochloride of benzamidine, pH 5.5) and was passed through a 70-mm cation-exchange supersnow column type SP Sepharose Fast Flow, Pharmacia) at a flow rate of 20 ml/min the Column was balanced with buffer A (20 mm MES, 20 mm NaCl, pH to 5.8). After washing with buffer A, taken in the amount of 5 column volumes, bscCD19CD3 was suirable using stepwise gradient of 45% buffer B (20 mm MES, 1M NaCl, pH 5,8) in buffer A. the Eluate was obtained using 0,046 volume of 1M Tris/model HC1 buffer, pH 8.5, containing 47 mm imidazole, and then subjected to sterilization by filtration (0.2 μm; type AcroCap). A typical elution profile obtained using cation-exchange chromatography is shown in Fig.12. BscCD19CD3 was the same faction 6.

Purification of cobalt chelate affinity chromatography: the eluate obtained from the cation exchange column, was passed at a flow rate of 2.5 ml/min in 10 mm supersnow chelating column type Chelating Sepharose Fast Flow (Phi is Verena 0.1 M solution of cobalt chloride. After washing, the amount corresponding to the 33 volumes of column buffer OA, buffer A (50 mm Na2HPO4, 400 mm NaCl, 500 mm imidazole, pH 6.4) and a gradient from 0 to 12% buffer B (50 mm PA2NRA4, 400 mm NaCl, 500 mm imidazole, pH 6,4) in buffer A, bscCD19CD3 was suirable in one stage with 30 ml of 100% buffer C. the Eluate was subjected to sterilization by filtration, followed by approximately 10-fold concentration in the device type MacroSep (firm Pall Gelman; limit bandwidth 10 kDa). A typical elution profile for cobalt chelate affinity chromatography is shown in Fig.13. BscCD19xCD3 was detected in 7 fractions.

Gel filtration: the concentrated eluate obtained from the column for cobalt chelate affinity chromatography was loaded with a flow rate of 0.75 ml/min 124 mm column type High Load Superdex 200 (firm Pharmacia; purity "prep"), balanced phosphate buffered saline, Gibco). BscCD19CD3 was loirevalley in the fraction with molecular weight corresponding to approximately 55 kDa (Fig.14, fraction No. 7). The resulting gel filtration fraction containing bscCD19CD3, supplemented with 5% human serum albumin (firms is the number bscCD19CD3 in the supernatant of cell culture and various active column fractions according to the LTO-SDS page analysis shown in Fig 11. BscCD19CD3 was a major protein band in supernatant cell culture (lane 2). The antibody to CD19CD3 with a high degree of purification that can be used for human therapy, there were no detectable impurities (Fig.11, lane 5).

Example 7: Clinical application bscCD19CD3 for the treatment of patients with b-cell lymphoma

Out of compassion the patient (As In, a woman 1937 R.) suffering is caused by b-cell chronic lymphatic leukemia, treated bespecifically single-chain antibody bscCD19CD3 in a sparing mode.

The anamnesis of the patient:

The patient B-CLL was discovered in 1992 At the time of initial diagnosis of the disease were affected different areas of lymph nodes and spleen; there were hemolytic anemia autoimmune origin and deficiency of immunoglobulin. The patients were sites that were easily controlled compared to the normal functioning of the thyroid gland by processing carbimazole (2.5 mg/day).

Beer of the disease, the treatment was changed and were assigned to cyclophosphamide, doxorubicin, vincristine and prednisone (CHOP, 8 cycles) and for more than a year there was a stage of remission. After the new relapse was held on 6 cycles of CHOP followed by treatment with hlorambuzila and prednisone and one course of treatment for one hlorambuzila, which did not lead to any improvement. In December 1998, in order to control progressive splenomegaly in a patient, conducted the irradiation of the spleen. The patient found a marked suppression of bone marrow function with numerous infectious complications. Because of anemia and thrombocytopenia were required frequent transfusions of red blood cells, and substitution of platelets.

Because of the presence of advanced-stage disease and destruction of bone marrow function more potent chemotherapy with use of high doses has not been shown for this patient. Treatment using antibodies to CD20 rituximab was not used because to date there are no data on the effectiveness of rituximab (B-CLL.

FACS analysis showed that 95% of peripheral blood cells of the patient was a CD19-positive cells and 77% of the cells expressed the antigen CD20. Incubation of peripheral blood cells patienceto doctor has decided to expose the patient treatment new bscCD19CD3 in a sparing mode. The patient was informed in detail about the novelty of the connection and of the potential risks and possible benefits of such treatment. She completely understood the explanation and gave written consent to such treatment in a sparing mode.

Description of clinical use

Before treatment the patient was subjected to clinical examination and extensive diagnostic procedures to confirm the extent of the disease and the exclusion of any additional risk factors. The patient exhibited a distinct clinical condition with symptoms of anemia, thrombocytopenia and weight loss, but not found any cardio-vascular disorders and other complications that inhibit the use of bscCD19CD3. During the night before the first day of treatment, the patient suffered from associated with migraine headaches. For the introduction of bscCD19CD3 the patient was placed in the hospital room, where she was under constant careful supervision in order to guarantee immediate treatment of any unforeseen event that may occur. To prevent any caused by cytokines acute reactions and complications in the lysis of the tumor, the patient allopurinol and 20 mg of omeprazole (Antra®).

During treatment and during the rehabilitation period were alkalization and heparinization. In addition, the patient received all required symptomatic treatment.

Blood samples were taken before and during the treatment period of the medicinal product with the definition of biochemical, hematological and immunological parameters.

The first processing bscCD19CD3 (April 14, 1999)

The patient received the first dose containing 3 μg bscCD19CD3, a 20-minute infusion of isotonic phosphate buffer containing 5% human serum albumin (CSA). During infusion, the patient was found not to have any negative reactions. Approximately 1 h after infusion, the patient was vomiting for approximately 5 min, followed by perspiration, a moderate reduction of blood pressure by about 10 mm RT.article and a moderate increase in body temperature (+0,5C) for several hours. In addition, her headache has increased slightly. The patient received 2 mg Tavegil®and 200 mg Tagamet®250 mg of prednisolone (Solu-Decortin®) and 50 mg of pethidine (Dolantin®). All symptoms disappeared without consequences in the same day.

The second processing bscCD19C) small hyperventilation of the lungs and signs of hypotension. The patient received 2 mg Tavegil, 200 mg Tagamet and 300 mg Solu-Decortin and 15 mg Piritramide (Dipidolor®). To stabilize cardiovascular function of the patient was made infusion of dopamine and changed the volume. After such treatment, the symptoms decreased significantly. Despite this, the patient was transferred to the night in the cardiology Department, which is guaranteed to be correspondingly controlled by the parameters of the vital functions and was guaranteed immediate intervention in case of their violation. The next morning the patient was transferred to a regular room without any additional complications.

In the next three days the patient remained subfebrile temperature (approximately 37,2C) and has developed a small pleural effusion after day after treatment with a second dose (16 April 1999) and moderate edema of the lower extremities (18 April 1999). Cardiovascular function remained stable and laboratory evaluation showed the absence of any noticeable dangerous changes, except povysheniya.15).

Because the treatment bscCD19CD3 was well tolerated by the patient and the side effects could be controlled by symptomatic treatment, treatment of the patient with a new bscCD19CD3 according to the invention has been continued.

Clinical and immunological efficacy bscCD19CD3

The results of clinical experience

Ultrasound examination of the spleen and five abdominal and axillary lymph nodes was performed after 1 day and 4 days after administration of the second dose bscCD19CD3. Already after 1 day after a dose of 10 μg (16 April 1999) found a reduction in the size of lymph nodes and spleen by about 20% compared to the baseline condition. This observation was confirmed at the second ultrasound on April 19, 1999, the Weight of the spleen decreased by 350 g (1630 in the initial state up to 1280 g on April 19, 1999) (table 1; Fig.16).

The results of hematological tests:

The number of leukocytes, including mainly malignant b-cells, decreased during treatment and in the subsequent days (table 2; Fig.17). C-reactive protein (CRP) is an acute phase protein response, which reflects T of 10 µg bscCD19CD3, and then continuously decreased during 3 subsequent days of observation (table 2; Fig.18).

The results of immunological examination

The level of serum cytokines, which reflects acute immunological response to the introduction of the compounds was measured before and after different periods of time after the introduction of the new compounds according to the invention. The levels of serum cytokines and soluble receptor of IL-2 was assessed quantitatively using ELISA according to the manufacturer's instructions.

The level of tumor necrosis factor TNF-significantly increased depending on the doses in first hour after injection bscCD19CD3 (Fig.19).

Also found noticeable and dose-dependent increase in the level of interleukin 6 (IL-6) and interleukin 8 (IL-8). Their maximum levels detected within 2-4 h after injection bscCD19CD3 (Fig.20, 21). After several hours, the concentrations of all cytokines returned to the original level.

The level of soluble receptor of IL-2 has been raised already in the initial state, which can be attributed to a large number of malignant b-cells expressing the receptor for IL-2. After the introduction of the new bscCD19CD3 observed increase ur>/p>The introduction of a new bscCD19CD3 safe for patients suffering from refractory B-CLL. Portability bscCD19CD3 at doses of 3 μg and 10 μg was satisfactory and could be controlled by preventive measures and symptomatic treatment.

The application of the new bscCD19CD3 caused a decrease in the patient previously enlarged spleen and lymph nodes, which is confirmed by ultrasound examination. Since the enlargement of the spleen and lymph nodes caused by infiltration of malignant b-cells, reducing the size reflects the destruction of malignant b-cells resulting from the introduction bscCD19CD3.

In explicit contrast to any other bespecifically antibodies CD19CD3 known in this field, bespecifically antibody CD19CD3 according to the invention (bscCD19CD3) shows clinical efficacy in relation to due to In-cell non-jackinsky lymphoma, which can be seen in the reduction of lymphoid organs infiltrated malignant b-cells. It is very important that bscCD19CD3 proven clinical efficacy in unexpected is to be bscCD19CD3 confirms its extremely high cytotoxic activity determined in vitro.

Identified three dimensions of the abdominal lymph nodes, one left and one right axillary lymph nodes and spleen using sonography using devices like Toshiba SSA100.

The dimensions were evaluated in three directions in mm Weight of the spleen was calculated based on its size and ultrasonic density.

Blood levels of gamma-glutamyl transferase (GGT), lactate-dehydrogenase (LDH) and C-reactive protein (CRP) were determined by standard methods of clinical biochemistry and were expressed as units/ml (GGT), units/l (LDH) and mg/DL (CRP). The number of cells was expressed as GC./l, and the number of lymphocytes in the form of a percentage of the total number of leukocytes. In the first column presents data on baseline levels on 14 April 1999, prior to treatment. In the second column of the data on response to treatment 3 µg bscCD19CD3 (which was held on April 14, 1999), received April 15, 1999, Data on the response to the second treatment 10 mg of the compound obtained in the same day, given in the third column. Blood levels DNA columns.

Bibliography

1. Mack, Proc. Natl. Acad. Sci. USA 92 (1995), 7021-5.

2. Gianni, N Engl. J. Med. 336 (1997), 1290-7.

3. Urba, J. Natl. Cancer Inst. Monogr. (1990), 29-37.

4. Fisher, Cancer (1994).

5. Bohlen, Blood 82 (1993), 1803-121.

6. Bohlen, Cancer Res 53 (1993), 18:4310-4.

7. Bohlen, Cancer Res 57 (1997), 1704-9.

8. Haagen, Clin Exp Immunol 90 (1992), 368-75.

9. Haagen, Cancer Immunol Immunother. 39 (1994), 391-6.

10. Haagen, Blood 84 (1994), 556-63.

11. Haagen, Blood 85 (1995), 3208-12.

12. Weiner, Leuk Lymphoma 16 (1995), 199-207.

13. Csoka, Leukemia 10 (1996), 1765-72.

14. Uckun, Proc. Natl. Acad. Sci. USA 85 (1988), 8603-7.

15. Staerz, Proc. Natl. Acad. Sci. USA 83 (1986), 1453-7.

16. Lanzavecchia, EurJ Immunol 17 (1987), 105-11.

17. Mallender, J Biol Chem 269 (1994), 199-206.

18. Gruber, J Immunol 152 (1994), 5368-74.

19. Kostelny, J Immunol 148 (1992), 1547-53.

20. Mack, J Immunol 158 (1997), 3965-70.

21. Kufer, Cancer Immunol Immunother 45 (1997), 193-7.

22. Pezzutto, J Immunol 138 (1987), 2793-9.

23. Orlandi, Proc. Natl. Acad. Sci. USA 86 (1989), 3833-7.

24. Dubel, J Immunol Methods 175 (1994), 89-95.

25. Traunecker, Embo J 10 (1991), 3655-9.

26. Laemmli, Nature 227 (1970), 680-5.

27. Bohlen, J Immunol Methods 173 (1994), 55-62.

28. Demanet, Int J Cancer Suppl 7 (1992), 67-8.

29. De, J Hematother 4 (1995), 433-7.

30. Haagen, Leuk Lymphoma 19 (1995), 381-93.

31. Anderson, Blood 80 (1992), 2826-34.

32. Zhu, Int J Cancer 62 (1995), 319-24.

33. Hartmann, Blood 89(1997), 2042-7.

34. Valone, J Clin Oncol 13 (1995), 2281-92.

35. Valone, J Hematother 4 (1995), 471-5.

36. Bolhuis, Int J Cancer Suppi 7 (1992), 78-81.

37. Canevari, J Natl Cancer Inst 87 (1995), 1463-9.

38. Nitta, Lancet 335 (1990), 368-71.

39. Yokota, Cancer Res 52 (1992), 3402-8.

40. Weiner, J Immunol 152 (1994), 2385-92.

41. Maloney, Blood 84 (1ttp://img.russianpatents.com/img_data/77/772943.gif">

Claims

1. Single multifunctional polypeptide, comprising (a) a first domain comprising antigennegative plot chain immunoglobulin or antibody that specifically recognizes the antigen CD19, and (b) a second domain containing antigennegative plot chain immunoglobulin or antibody that specifically recognizes the antigen CD3 T-cells, and the domains are arranged in the following order: VLD19-VHD19-VHD3-VLCD3.

2. The polypeptide under item 1, where these two domains are related polypeptide linker.

3. The polypeptide under item 1 or 2, where the first and/or second domain mimics or corresponds to VHand VL-the field of natural antibodies.

4. The polypeptide according to any one of paragraphs.1-3, where the antibody is a monoclonal antibody, a synthetic antibody or humanitariannet" antibody.

5. The polypeptide according to any one of paragraphs.1-4, where at least one of these domains is a single-chain fragment variable region of the antibody.

6. According to the A.

7. The polypeptide according to any one of paragraphs.2-6, where the polypeptide linker comprises multiple consecutive copies of the amino acid sequence.

8. The polypeptide according to any one of paragraphs.2-7, where the polypeptide linker comprises 1-5 amino acid residues.

9. The polypeptide according to any one of paragraphs.2-8, where the polypeptide linker comprises the amino acid sequence Gly Gly Gly Gly Ser.

10. The polypeptide according to any one of paragraphs.1-9, where the first domain comprises at least one CDR (hypervariable area) VHand VL-region that has the amino acid sequence encoded by the DNA sequence shown in Fig.8, from nucleotide 82 to 414 (VLand from nucleotide 460 to 831 (VH), and/or where the second domain comprises at least one CDRHand VL-region that has the amino acid sequence encoded by the DNA sequence shown in Fig.8, from nucleotide 847 to 1203 (VHand from nucleotide 1258 to 1575 (VL).

11. The polypeptide according to any one of paragraphs.1-10, where (a) antigennegative plot of the first domain has an affinity of at least about 10-7M and/or (b) antigennegative plot of the second domain has an affinity lower than about 10-7M

12. The polypeptide is any one of paragraphs.1-12, comprising at least one additional domain.

14. The polypeptide under item 13, where additional domain linked by covalent or non-covalent bonds.

15. The polypeptide under item 13 or 14, where the at least one additional domain includes the effector molecule, which has a conformation suitable for the manifestation of biological activity, is able to cut out ion or selective contact with a solid substrate or pre-selected determinant.

16. Polynucleotide encoding single-chain multifunctional polypeptide according to any one of paragraphs.1-15.

17. Vector-expression, including polynucleotide under item 16.

18. Strain cultivated cells of the ovary hamster (CHO)/hEF-GHFR producing the polypeptide according to PP.1-15.

19. The method of producing the polypeptide according to any one of paragraphs.1-15, providing for culturing cells transformed by the vector p. 17, and the secretion of the polypeptide from the culture.

20. The pharmaceutical composition intended for the treatment of malignant diseases In cells or depletion of b cells, comprising an active substance selected from the group comprising the polypeptide according to any one of paragraphs.1-15, polynucleotide on p. 16 or vector for p. 17, in an effective amount and an optional Nate is where a malignant disease In a cell represents nahodkinskuju lymphoma.

22. The composition according to p. 20, which represents a composition for gene therapy.

23. A diagnostic composition comprising a substance selected from the group comprising the polypeptide according to any one of paragraphs.1-15, polynucleotide on p. 16 or vector for p. 17 and optionally suitable means for detection.

24. The way to identify activators or inhibitors of T-cell activation or stimulation, providing for (a) culturing T cells and D19-positive cells, preferably cells, in the presence of the polypeptide according to any one of paragraphs.1-15, and optionally in the presence of compounds with the ability to provide a detectable signal in response to T-cell activation with activator or inhibitor of T-cell activation or stimulation in conditions ensuring the activation of T-cells, and (b) detecting the presence or absence of a signal resulting from interaction of the activator or inhibitor to the cells.

25. Method of preparation of pharmaceutical compositions intended for the treatment of malignant diseases In cells or depletion of b-cells that provide for the identification of an inhibitor or activator of T-cell activation according to p. 24 and preparation on the basis of a pharmaceutically acceptable Mikov.

27. The method of treatment of malignant diseases In cells or depletion of b-cells, introducing a polypeptide according to any one of paragraphs.1-15 person suffering from these malignant or other disease.

28. A way to slow the development of the pathological condition, which is called In-cell disorders, providing for the introduction of the polypeptide according to any one of paragraphs.1-15 person suffering from this pathological condition.

 

Same patents:

The invention relates to medicine, namely to Pediatrics, and can be used to predict local infectious-inflammatory disease in full-term newborns in the first month of life
The invention relates to medicine, namely to Allergology, and can be used to identify sensitization to allergens in adults and children

The invention relates to medicine, in particular to immunology

The invention relates to the field of veterinary Virology, in particular to a method for the diagnosis of sheep pox and goat

The invention relates to the field of biotechnology and medicine, specifically to the diagnosis of opisthorchiasis

The invention relates to veterinary Virology, in particular to a method for the diagnosis of sheep pox and goat pox

The invention relates to medicine, namely to identify the expression of cytokines in cells

The invention relates to immunology and biotechnology and can be used to test rapamycin

The invention relates to immunology
The invention relates to immunology and can be used in the manufacture of diagnostic products for the detection of syphilis

The invention relates to biotechnology and can be used to create a functioning tyrosine-specific chimeras proteinkinase

The invention relates to medicine and concerns transducers cytochrome P450 retroviral vectors

The invention relates to new viral vectors

The invention relates to medicine, namely to a method for detection of N-terminal Pro-MNE, recombinant N-terminal Pro-MNE, its use as a standard in detection of N-terminal Pro-MNE, as well as antibodies that recognize the recombinant N-terminal Pro-MNEs, and their reception

The invention relates to gene therapy and for the strengthening and limitations of gene expression
Up!