Variant aprotinin

 

(57) Abstract:

The invention relates to medicine, namely to the variant Aprotinin with a total charge of +3 to -3 at pH 7 and with amino acids Arg15 or Arg15-Ala17 in the binding site. Variant Aprotinin has a modified N-terminal sequence and the lengthening or shortening of the N-end or deletion of amino acids at N-end. Variant Aprotinin selected from the group des-Rho-Sr10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin, des-Rho-Sr10-Arg15-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin, des-Rho-Sr10-Arg15-Ser17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin, des-Rho-Sr10-Arg15-Alal 7-Thr26-Glu31-Asn41-Glu53-Aprotinin, des-Pro2-Ser10-Arg15-Ala17-Asp24-Thr26-Asn41-Glu53-Aprotinin, Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin, Ser10-Arg15-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin, Ser10-Arg15-Ser17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin, Ser10-Arg15-Ala17-Thr26-Glu31-Asn41-Glu53-Aprotinin and Ser 10-Arg15-Ala17-Asp24-Thr26-Asn41-Glu53-Aprotinin. The technical result - expanding Arsenal of serine proteases to correct the condition of the gastrointestinal tract. 2 S. and 3 C.p. f-crystals, 2 tab. 1 Il.

The invention relates to variants of Aprotinin, which are the best inhibitors of enzymes have improved immunological and pharmacokinetic properties.

Aprotinin, which is also referred to as inhibitor trips is berhemah serine proteases includes, for example, trypsin, chymotrypsin, plasmin and kallickrein plasma (W. Gebhard, H. Tschesche and N. Fritz, Inhibitors of proteases. Barrett: and Salvesen (ed.), Elsevier Science Publ. BV 375-387, 1986).

Aprotinin consists of 58 amino acids. Three-dimensional structure of the protein was established using x-ray crystallography and NMR spectroscopy (Wlodawer and others, J. Mol. Biol. 198(3), 469-480, 1987; Wagner and others, J. Mol. Biol. 196(1), 227-231, 1987; Berndt, etc.. Biochemistry 32 (17), 4564-4570, 1993).

Under the trade name Trasilolnatural Aprotinin has long been used to treat pancreatitis. Now Trasilolused in heart surgery, after clinical trials showed that treatment with Aprotinin significantly reduces the need for blood transfusion during such operations and leads to the reduction of secondary hemorrhage (D. Royston, J. Cardiothorac. Vasc. Anesth. 6, 76-100, 1992).

Were able to show that the substitution is responsible for the specificity of inhibition of the amino acid in position 15 leads to valuable Aprotinin variants with improved inhibitory properties (German patent DE 3339693). Depending on the entered amino acids is possible in this way to get active inhibitors, which inhibit the elastase of the pancreas or of l is the situation of the 15 choices determine and also with other amino acid residues in contact are subjected to inhibition of the target protease and molecule inhibitor. This especially applies to additional amino acid residues at positions 14, 16, 17, 18, 19, 34, 38 and 39. Options Aprotinin with improved properties resulting from the substitution of one or more of these amino acid residues in the contact area, were among other things described, for example, in the following materials: international patent application WO 89/01968, international patent application WO 89/10374, European patent application EP 0307592, European patent application EP 683229.

An interesting way could be improved pharmacokinetic properties of Aprotinin and its variants by replacing the amino acids that determine the physico-chemical properties of the substance. So, managed by reducing the overall positive charge of the molecule significantly reduce the binding of the kidneys. Such variants have been described in the international patent application WO 92/06111.

On the basis of the best technical opportunities advantageous in certain cases to take the modification of the N-Terminus of the molecule inhibitor. Such modifications can be shortened N-ends, or extend, or cause the removal of one or more amino acids. Modified by N-end Aprotinin variants have been described in European patent application EP >/P>Goal is achieved by the proposed option Aprotinin with a total charge of +3 to -3 at pH 7 and with amino acids Arg15 or Arg15-Ala17 in the binding site.

Preferably, the variant Aprotinin was used for the inhibition of serine proteases.

Preferably, the variant Aprotinin had a modified N-terminal sequence and the lengthening or shortening of the N-end or elongated amino acids at N-end.

Amino acid sequence, for example, some of the options presented in the drawing.

The objective is also achieved proposed variant Aprotinin selected from the group des-Rho-Sr10-Arg15-l17-s24-hr26-Glu3 l-Asn41-Glu53-Aprotinin, des-Rho-Sr10-Arg15-Asp24-Thr26-Glu3 l-Asn41-Glu53-Aprotinin, des-Rho-Sr10-Arg 15-Ser17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin, des-Pro2-Ser10-Argl 5-Ala17-Thr26-Glu3 l-Asn41-Glu53-Aprotinin, des-Rho-Sr10-AGD-Ala17-Asp24-Thr26-Asn41-Glu53-Aprotinin, Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin Ser10-Arg15-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin Ser10-Arg15-Ser17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin, Ser10-Arg15-Alal7-Thr26-Glu31-sn41-Glu53-Aprotinin and Ser10-Arg15-Ala17-Asp24-Thr26-Asn41-Glu53-Aprotinin.

These options Aprotinin may also be the amino acid Proline in position 2.

Options Aprotinin according to the invention, however, does not limit the receiving N-end l(-2)-Gln(-l), with the rest of the natural amino acid Proline in position 2, with the substitution of other amino acids that have a positive charge relative to neutral or negative charge of amino acid residues, or replacement of other neutral amino acids relative to the negatively charged amino acid residues. The choice of replacement amino acid residue is carried out at this on this principle, to obtain the substance possessed at physiological pH value reduced overall positive charge, preferably in the range from +2 to -2. These changes in amino acid sequence, including the lengthening, or shortening, or deletion of N-Terminus, can be used in any combination with each other. To Aprotinin variants according to the invention includes, therefore, all connections are characterized by a combination of the above characteristics and which have at physiological pH value reduced overall positive charge.

Options Aprotinin have the following characteristics:

1. The replacement of one or several amino acids in the active center of the molecule to improve the activity.

2. Replacement of amino acids to reduce the total positive charge with altnoy sequence on the basis of technical opportunities.

It has been unexpectedly discovered that the combination of two or three of the mentioned symptoms leads not only to receive, but partly even to the strengthening of distinct individual characteristics. In addition, it was possible to show new properties of substances, which, for example, relate to immunological, pharmacokinetic and surface properties of the compounds. New variants exhibit reduced reactivity towards polyclonal human and rabbit antisera, which was obtained by the use of Aprotinin. Further, it was found that new variants behave as less active immunogen compared with Aprotinin, i.e. they cause a lowered immune response. Further, it was shown that the variants according to the invention induce a slight release of histamine from the blood cells. Further, new variants clearly showed a slight accumulation in the kidney compared with Aprotinin. Kinetic constants of the enzyme (Ki values) were suddenly improved, despite the large number of changes in the molecule relative to the original versions of the molecule.

Preferred options, which have a total charge of +2 to -2, particularly preferred with s, in which, and also due to complex surgical procedures, such as, for example, surgery heart or alloautoplastic replacement joints in transplantation medicine, it is useful to activate plasma enzyme systems through prolonged or intensive contact of blood with a foreign surface.

Inhibitors reduce blood loss during operations associated with an increased risk of bleeding (for example, heart surgery, surgery of bones and joints). They are suitable for therapy in shock, multiple trauma and traumatic brain injuries, sepsis, disseminirovannaya intravascular coagulation, the involvement of many organs, inflammatory diseases with involvement of the kallikrein system, such as rheumatic joint diseases, and asthma. They prevent invasive tumor growth and metastasis by inhibiting plasmin. They are also suitable for the treatment of pain and swelling due to inhibition of the synthesis of bradykinin, as well as for the treatment of strokes.

They are also useful in the treatment of dialysis and artificial organs to prevent inflammation and coagulation and to reduce the risk of bleeding.

To obtain varioprint molecular biological methods injected into a suitable microbial expression organism genetically engineered information for the synthesis in each specific case considered variants of Aprotinin. The recombinant microorganism is subjected to fermentation; by choosing the appropriate conditions deliver heterologous genetic information for expression. Eksponirovanie options Aprotinin receive at the end of the culture broth.

Suitable organisms are the masters for the production of Aprotinin variants according to the invention can be bacteria, yeast or fungi. Expression may occur intracellularly or extracellularly using suitable secretory systems. Options Aprotinin may correct processing or connection to be exprimarea in peptides or proteins.

Suitable systems for the expression of the Aprotinin variants have been described in European patent application EP 683229, in international patent applications WO 89/02463, WO 90/10075 and in various others, the above-mentioned patent applications.

Enzymes

Used enzymes (restriction endonucleases, alkaline phosphatase from calf intestine, polynucleotides phage T4 DNA ligase of phage T4) were obtained from Boehringer Mannheim and FLEXIBLE, Brazil, and applied according to the instructions of the manufacturer.

Molecular biological techniques

Normal operation ke. coli with plasmid DNA was carried out according to Sambrook and others (Molecular cloning, cold spring Harbor, 1989). As the host body for transformations was introduced strain DH5 bacteria E. coli (FLEXIBLE, Brazil). For isolation of large quantities of plasmid DNA used Qiagen-tips (Qiagen). Extraction of DNA fragments from agarose gels was performed using inkjet sorption in accordance with the manufacturer's instructions (Genomed).

Oligonucleotides for experiments with site-specific mutagenesis and primer for polymerase chain reaction and Sequeira reaction were obtained using a DNA synthesizer 380 And" firm Aplaud Biosystems. Studies of mutagenesis was carried out according to the method of Deng and Nickoloff (Deng and other Anal. Biochem. 200. 81-88, 1992) when using a set of firm pharmacy Bietak (" Unique site elimination mutagenesis"). All vector constructs and experiments on the mutagenesis was confirmed by cycle sequencing DNA using Taq terminator with fluorescing mark on the sequencing machine (ABI 373 And" (Aplid Biosystems).

Transformation of Saccharomyces cerevisiae

Yeast cells, for example strain JC34. 4D (MATA, ura3-52, suc2) was placed in 10 ml YEPD (2% glucose; 2% peptone and 1% yeast extract Difco) and received value is jingleball), re-suspended in 0.2 ml and kept at -70oC.

To the frozen cells were added to plasmid DNA (5 µg) and DNA carrier (5 µg DNA from herring sperm). The cells were then thawed by shaking for 5 minutes at 37oC. After addition of 1.5 ml of solution B (40% polyethylene glycol 1000; 200 mm bicin, pH 8, 35) cells were incubated for 60 minutes at 30oWith off, washed with 1.5 ml of solution (0.15 M sodium chloride; 10 mm bicin, pH 8,35) and re-suspended in 100 μl of solution C. the Cultivation was carried out on selective medium with 2% agar. Transformants were obtained after incubation for 3 days at 30oC.

Nutrient medium for fermentation

1. Wednesday SD2:

Backdragging nitrogen base 6.7 g/l

Glucose* - 20 g/l

Monopotassium phosphate potassium - 6.7 g/l pH 6.0

2. Wednesday sc5 pack:

Glucose* - 20 g/l

Yeast extract Difco - 20 g/l

Monopotassium phosphate potassium - 6.7 g/l

Ammonium sulphate - 2.0 g/l

Magnesium sulfate heptahydrate - 1.0 g/l

Trace element solution SL4 - 1.0 g/l pH 6.0

Trace element solution SL4:

Titriplex III - 5 g/l

Sulphate of iron(2) heptahydrate, 2 g/l

Zinc sulfate heptahydrate, 0.1 g/l

Dujari the BR>
Chloride copper(2) dehydrate - 0.01 g/l

Chloride Nickel(2) the uranyl - 0.02 g/l

The sodium molybdate dihydrate - 0.03 g/l

* = avtoclaviruut separately

3. The medium in the fermenter:

Glucose* - 2.0 g/l

Soy peptone - 25,0 g/l

Monopotassium phosphate potassium - 1.4 g/l

Magnesium sulfate heptahydrate - 1.0 g/l

Teamengland - 5.1 mg/l

Inositol 20 mg/l

Trace element solution 3 ml/l

A solution of vitamins - 3 ml/l

Ammonium sulphate - 3.8 g/l pH 5.5

Nutrient solution:

Glucose* - 530 g/l

Ammonium sulphate - 5.0 g/l

Monopotassium phosphate potassium - 2.9 g/l

Magnesium sulfate heptahydrate - 3.8 g/l

Teamengland - 13 mg/l

Inositol - 70 mg/l

Trace element solution - 6.8 ml/l

A solution of vitamins - 6.8 ml/l

Trace element solution:

Chloride iron(3) the uranyl - 13.5 g/l

Zinc chloride tetrahydrate - 2.0 g/l

Orthoboric acid 0.5 g/l

Chloride cobalt uranyl - 2.0 g/l

Copper sulphate(2) pentahydrate - 1,9 g/l

The sodium molybdate dihydrate - 2.0 g/l

Calcium chloride dehydrate - 1.0 g/l

Concentrated hydrochloric acid 100 ml/l

* = autoclave separately

A solution of vitamins:

Riboflavin is 0.42 g/l

Pantat the BR>
Folic acid - 0.04 g/l

Obtaining a working persistent compounds

200 ml of medium SD2 were seeded to 1% in Erlenmeyer flask with a capacity of 1 L. the continuing strain. The culture was incubated for 72 hours at 28oOn the rocking chair with shaking (260 rpm). Then placed in 2 ml vessels for the remaining compositions and frozen in liquid nitrogen.

Fermentation in flasks with shaking

As a pre-culture of 200 ml of medium SD2 in the flask with a capacity of 1 l were seeded to 1% of the work remaining composition and subjected to fermentation for 72 hours at 28oOn the rocking chair with shaking (260 rpm). The pre-culture was also seeded to 1% of the main cultures (200 ml medium sc5 pack in the flask with a capacity of 1 liter) and incubated for 72-96 hours with shaking at 28oC.

Fermentation in bioreactors with a capacity of 10 l

As a pre-culture of 200 ml of medium SD2 were seeded to 1% of the work remaining composition in the flask with a capacity of 1 l and subjected to fermentation for 72 hours at 28oOn the rocking chair with shaking (260 rpm). The main culture in the fermenter was subjected to fermentation with periodic replenishment within 96 hours. As the nutrient medium used environment for Feria fermentation:

Temperature: 28oWITH

The number of revolutions of the stirrer: 500 rpm

Aeration: 10 l/min

pH: 5,5

The pressure in the empty space in the upper part: 200 mbar. After 7 hours of fermentation began feeding. The speed of the feed was controlled by means of the respiratory coefficient (DC) (the respiratory quotient = the carbon dioxide gas formed/consumed oxygen). If the DC goes up to a value > 1,15, the rate of recharge was reduced if it was falling to values <1,05, the rate of recharge was increased.

At regular intervals samples were taken from the fermenter and determined the cell growth by measuring the optical density at 700 nm. In addition, the determined concentration of the substance "Bay 19-8757" in the supernatant by measuring activity.

By the end of the fermentation the pH was lowered to 3.0 with the addition of 50% (V/o) citric acid and the fermenter was heated 10 minutes at 70oC. Then the cells were separated by centrifugation at 7500g and the supernatant was subjected to protein purification.

Materials for chemical analysis of protein

Analysis of sequences was performed using protein sequencing machine model A firm Aplaud Biosystems (Forster city, USA). Ispolzovatblizhny of phenylthiohydantoin (FGF) are described in detail in the reference manual (a Guide to using model 473 And system sequencing protein (1989). Firm Aplaud Biosystems, Forster city, California 94404, USA).

Reagents for sequencing machine and columns for high performance liquid chromatography (HPLC) for the detection of FGF received from the firm of Aplaud Biosystems.

Analyses using HPLC was performed using an HPLC system HP 1090 company Hewlett Packard (Waldbronn, Germany). For the separation column was used with reversed-phase RP-18 HPLC (250 mm 4.6 mm, material 5 microns, the pore size of 300 angstroms) company Bakerbond (Germany, gross Gerau).

Model 270-HT capillary electrophoresis was from the firm of Aplaud Biosystems (Forster city, California 94404, USA). Samples were injectively usually hydrodynamically through various time intervals. Used capillary column (50 μm 72 cm) firm Aplaud Biosystems.

Analyses of amino acids was performed using an amino acid analyzer LC 3000 firm Eppendorf Biotronic (Germany Maintal). Used easily modifiable standard program division of the company Biotronic. The program for the separation and the function of the analyzer are described in detail in the manual for the device.

Molecular weight was determined using the system MALDI I firm Kratos/ Shimadzu (Herman is oresa company pharmacy (Germany, Freiburg).

Determination of kinetic data was performed using reader with tablets for titration of microorganisms firm SLT (Germany, Crailsheim). Washing tablets titration was performed using an apparatus for washing firm Dynatec (Germany, Denkendorf).

Enzymes and substrates were from firm Calbiochem (Germany, bad Soden). All other chemicals and reagents were from the company Merck (Germany, Darmstadt) or Sigma (Germany, Deisenhofen). 96-cell tablets received from the company Greiner.

Polyclonal rabbit antibodies against Aprotinin was produced in rabbits after immunization with Aprotinin. Polyclonal human antibodies against Aprotinin were obtained from patients who were given Aprotinin.

Chemical analysis of protein

Analysis of the N-terminal sequence

On the plate sequencing machine was placed 1-3 nmole dissolved protease inhibitor pre preincubating with polybrene (hexadimethrine). Protein was subjected to sequencing using almost normal sequencing cycle. FGF-amino acids was performed using 50 pmoles FGF-standard using HPLC.

Amino acid Ana the/SUP>C. About 1 nmole samples were added in the amino acid analyzer. The number of amino acids were determined in relation to 5 nolam standard.

The electrophoresis gel using sodium dodecyl sulphate

The electrophoresis gel using sodium dodecyl sulfate was performed according to Laemmli. Analyzed 10 μg of protease inhibitor using 10-20% gel in the presence of sodium dodecyl sulfate and showed when silver staining (Merril and others).

U. K. Laemmli, Nature 227, 680-685 (1970). C. R. Merril, M. L. Dunau, D. Goldmann, Anal. Biochem. 100: No.201-207 (1981).

Capillary electrophoresis

8 ng of protease inhibitor was investigated using capillary electrophoresis in a glass column (length 72 cm, inner diameter 50 μm). Conditions: current 90 µa, column temperature 25oWith 100 nm phosphate buffer, pH 3.0, detection at 210 nm, flow under pressure for 3 seconds.

Reversed-phase chromatography

5 nmole protease inhibitor was chromatographically on the column for HPLC RP-18 company Bakerbond (material 5 MK, 4,6 nm 250 mm, a pore size of 300 angstroms). As eluent used a gradient of acetonitrile/triperoxonane acid. Conditions: flow 0.7 ml/min, column temperature 40oC, detection of nitril; gradient: 0 min 0% B, 10 min 0% B, 70 min 100% B, 80 min 0%B.

Determination of molecular weight

1 μg of the protease inhibitor were analyzed by MALDI technique. As the matrix used sinapinic acid. Standards of proteins for calibration of the mass was served insulin bovine cytochrome C and melittin.

The protein content

The protein content determined by the method using bicinchoninic acid (BCC-way). In this way present in the protein ions of divalent copper is transformed into ions of monovalent copper, which form a complex with bicinchoninic acid that absorbs at 560 nm.

Lyophilized protein is brought to a state of equilibrium moisture and prepare a solution with a concentration of 1 mg/ml in 0.9% sodium chloride solution. Prepare a series of breeding. To 50 μl of the test solution add 1000 ál of BCC for analysis (Pierce), the tube tightly closed tube and incubated for exactly 30 minutes at 60oC. After cooling the sample in a bath with ice for 5 minutes to carry out the measurement at a temperature of 25oS and a wavelength of 560 nm.

Activity: (test of inhibition of trypsin, titrimetrically)

Activity was determined according to mod roles ethyl ester of N-benzoyl-L-arginine (BAEE). Formed by reaction of the free carboxyl groups is determined by titration with alkali. The residual activity of trypsin is a measure of the inhibitory activity of biologically active substances.

Lyophilized protein is brought to a state of equilibrium moisture, prepare a solution with a concentration of 1 mg/ml in 0.9% sodium chloride solution and prepare a series of breeding. To 1 ml of the test solution add 2 ml of buffer (15 mm borate buffer, pH 8.0, 200 mm calcium chloride) and 0.8 ml of trypsin solution (2 mg/ml) and incubated for 5 minutes at 25oC. Then add 0.2 ml BAEE (6,8 mg/ml) and measured the consumption of sodium hydroxide in 5 minutes.

Definition of cross-reaction of protease inhibitors with oligosaline rabbit antibodies or human antibodies against Aprotinin

Subjected to the binding of 0.5-10 ng protease inhibitor or Aprotinin, dissolved in the buffer for the keyboard, overnight at 4oWith the tablet for titration. Cells were washed four times in 200 μl of buffer for washing and then was added 100 μl of blocking solution. The tablet was covered and incubated 1 hour at 37oC. After washing, the corresponding described above, was added polyclone the m saline solution) or polyclonal human antibodies (20 μg/ml in 1% human serum albumin in phosphate buffered saline solution). The tablets were covered and incubated 1 hour at 37oC and then washed as described above. Then there was added 100 μl of biotinylated anti-rabbit or anti-human antibody (25 ál + 10 ml of 1% bovine serum albumin or 1% serum albumin person in phosphate buffered saline) and incubated 1 hour at 37oC. the Tablet was washed as described above and then added to each well 100 μl of a complex of streptavidin-peroxidase(50 ml + 10 ml of 1% bovine serum albumin or 1% serum albumin person in phosphate buffered saline solution). The tablet was covered and incubated 1 hour at 37oC, and then washed as described above.

The substrate reaction was carried out with 3,3',5,5'- tetramethylbenzidine as substrate and peroxidase solution (1+1; 100 μl of the cell). After 10 minutes the reaction was stopped by adding to each well 100 μl of 2M phosphoric acid, and measured the absorbance at 450 nm (reference 570 nm).

Solutions:

1. Buffer for incubation: 15 nm sodium carbonate, 35 mm sodium bicarbonate, pH 9,6.

2. Buffers for sample: sample is dissolved in a suitable concentration in the buffer for incubation.

3. The solution (V/o) bovine serum albumin or serum human albumin in phosphate buffered saline solution.

Examples

Example 1

Obtaining expressing vector for yeast secretion of recombinant des-Rho-Sr10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin

As a starting substance to obtain gene DEZ-Rho-Sr10-AGD-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin gene served DEZ-Rho-Arg15-Alal 7, which under the action of restricts HindIII and Wamn was cloned into the vector pUC18. The resulting vector (pEM6.6.L) was subjected to reaction mutagenesis double chain according to the method of U. S. E. (firm pharmacy Bietak) with the primer for mutagenesis and selection primer Scal/Mlul. Primer for mutagenesis had the following sequence:

Primer AND

5'GGCTGCAGAGCTAACCGTAACAACTTCAAATCCGCGGAAGACTGCATGG AAACTTGCGGTGGTGCTTAG 3'. This primer generates mutations Asn41 and Glu53 in the gene des-Pro2-Arg15-Ala17-Aprotinin. Analysis clone was performed using restriction cleavage enzymes Scal and SphI. The desired sequence was also confirmed in determining the DNA sequence of clone pEM31.8.L. Further substitution in a region 5' of the gene (Ser10-Asp24-Thr26-Glu31) was performed with polymerase chain reaction using primers B and 'reverse 24-mer M13'-primers based on DNA plasmids pEM31.8.L. Primer B was as follows:

Primer B

5'TGCCTCGAGCCGCCGTCTACTGGGCCCT/P> Mixture for polymerase chain reaction contained 20 ng DNA plasmids REM 1.8.L, 20 pmole 'reverse 24-mer M 13'-primer, 60 pmoles primer B, 200 μm deoxynucleoside-5'-triphosphates, 1 reaction buffer II for polymerase chain reaction (Perkin Elmer), 4 mm magnesium chloride and 2.5 Units. The DNA polymerase of phage Taq (Perkin Elmer) in a total volume of 100 μl. Used the following cycle: 3 minutes at 94oC, 30 cycles of in each case 1 minute at 94oC, 1 minute at 55oC and 1 minute at 72oC and then incubated for 5 minutes at 72oC. the Mixture for polymerase chain reaction were diluted 1: 5 and ligated with the vector pCRII (Invitrogen). Using a mixture for ligation was used to transform DH5 cells of the bacteria E. coli. Identified positive clones after restriction cleavage with the enzymes XhoI Ivan and determined the sequence of a few clones. Clone pES9.10.L contained the desired sequence and was used for further studies.

Vector-dropship E. coli/yeast (for example, RA) was used to design the yeast secretory vector in which the sequence of des-Rho-Sr10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin is connected with the pre-Pro-sequence driven the Kerov for E. coli and yeast. Other important elements of the vector are Col El origin of replication 2 MK (ori). Locus REP3 is also located in this area. The fragment EcorI-HmdIII value of 1200 P. N. shifts the promoter MF1 and N-terminal pre-Pro-protein sequence-predecessor-factor in yeast (Kurjan and Herskowitz, Cell 30, 933-943, 1982). With the introduction of the modified cDNA des-Pro2-Arg15-Aprotinin in the form of a fragment HindIII-Vatn were again obtained the place of recognition for protease KEH ('Lys-Arg') within a pre-Pro-sequence factor (European patent application EP 0419878).

At the end of the 3' sequence of des-Pro2-Arg15-Aprotinin vector carries a fragment Watn-SaII yeast URA3 gene, which acts in this position as a termination signal for transcription (Yarger and others, Mol. Cell. Biol. 6, 1095-1101, 1986).

The DNA fragment size 180 P. N. cut with Xhol and Wamn from the vector pES9.10. L, purified by electrophoresis in agarose gel and clone in split also using Xhol and BamHI and dephosphorylated vector RA. By this cloning des-Rho-Arg15-Aprotinin in the vector R replace des-Rho-Sr10-Arg15-l17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin. Yeast cells (JC34.4D) were transformed using the obtained result of the cloning vector Reily inducible promoter, GAL 10, can be obtained in a similar way and lead to secretion des-Pro2-Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin. Along with this, of course, also possible to insert vectors-shuttles with other sources of replication of yeast, such as chromosome can replicate autonomously segment (ars).

Suitable breeding genes markers along with the URA3 gene are genes that carry auxotrophic mutant of yeast to prototrophic, for example, genes LEU2, HIS3 or TRP1. In addition, of course, can also be inserted genes whose products contribute to the resistance against various antibiotics, such as the aminoglycoside G418.

Other yeasts, such as the methylotrophic yeast Pichia pastoris or Hansenula polymorpha, after transformation with suitable vectors are also able to produce des-Pro2-Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-sn41-Glu53-Aprotinin.

Example 2

Obtaining expressing vector for yeast secretion of recombinant Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin with the natural N-terminal sequence 'Arg-Pro-Asp'

To get expressing vector of the yeast, allowing the secretion of Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin with U factor and the 5' end of the gene Aprotinin (up to a recognizable Xhol restriction enzyme sequence) by polymerase chain reaction and cloned. Applied primers had the following sequences:

Primer:

5'GGGATATCTATTGATAAGATTTAAAGGTATTTGACAAG 3'. Recognizable by the restriction enzyme EcorV sequence is underlined.

Primer G:

5'GGGCTCGAGGCAGAAATCTGGTCTAGCCAAAGCAGAAGAAGCAGCGAA CAAGACAGCAGTGAAAATAGATGGAATCTCATTCTTTTAATCGTTTATATT 3'. Recognizable by the restriction enzyme Xhol sequence is underlined.

Mixture for polymerase chain reaction contains 200 ng DNA plasmids RA, 0.2 μm primer, 0.2 μm of primer G, 200 μm deoxynucleoside-5'-triphosphates, 1 reaction buffer for polymerase chain reaction 11 (Stratagen, Opti-PrimeTM) and 2.5 Units. The DNA polymerase of phage Taq (Perkin Elmer) in a total volume of 50 µl. Conditions cycle: 1 minute at 94oC, 30 cycles each of 1 min at 94oC, 1 minute at 50oC and 2 min at 72oC and then incubated for 5 minutes at 72oC. the Mixture for polymerase chain reaction were diluted 1:5 and ligated with the vector RII (Invitrogen). Using a mixture for ligation was used to transform DH5 cells of the bacteria E. coli. Positive clones were identified after restriction cleavage with the enzyme EcoRI and determined the sequence of a few clones. Clone pIU20.11.L used for further operations.

Vector-E. coli Shuttle/droge is here Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin directly connected with proposedvalue factor of yeast. First, the vector pYES2 were digested with restriction enzymes SspI and Wamn, dephosphorylated and was purified on a gel. This removes located on the vector pYES2 promoter, GAL 1 and fl ori. The DNA fragment size of about 1030 P. N. cut out from the vector pIU20.11.L restrictase EcoRV and Xhol, had been cleaned during electrophoresis on agarose gel and were subjected to cloning with Xhol fragment and Wamn a value of about 180 P. N. from vector pES9.10.L split restrictase SspI and UMN vector pYES2. Cells DH5 E. coli bacteria transformed with the mixture for ligation. Identified and established a sequence of positive clones after restriction cleavage enzyme Xhol. Yeast cells (JC34.4D) was transformed with the resulting cloning vector pIU28.11.L. Expressing the vector pIU28.11. L does not contain more proposedvalue factor, so that the processing Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin is exclusively due to the signal peptidase and is not dependent on cleavage by the protease KexII.

Example 3

Fermentation Saccharomyces cerevisiae

Expression of the Saccharomyces cerevisiae strain was subjected to fermentation, as described above.

Example 4

Purification of the derivatives of approcimately cells are separated by centrifugation and the remaining supernatant liquid is filtered to remove any remaining cells.

Set pH 3 for not containing cell supernatant by adding concentrated citric acid. The solution should be diluted appropriately purified water to set the conductivity of less than 8 MSM/see Then the solution is applied on a cation exchange column, which is pre-balance of acid buffer. Unbound material is removed with copious washing of the initial buffer. Product elute with a gradient of salt. The obtained fractions were investigated on the content of the product by reverse phase high-performance liquid chromatography (RP-HPLC) and test for biological activity, which is determined by the inhibition of the protease content of its product. The fractions containing the product are pooled and applied directly to preparative column for RP-HPLC. Column pre-balance of acid buffer. Unbound protein is removed by washing the column initial buffer. Product elute with a gradient of organic solvent. Faction re-examined, as described above, the contents of the product and those fractions that contain the product are pooled. Depending on the achieved purity of the product prob is s previously described. The resulting solution was diluted with water for injection, bottled at suitable portions and subjected to drying by freezing.

Other cleaning methods derived Aprotinin without total charge at a neutral pH value, which can be combined with the above-described processes are affinity chromatography on immobilized on sepharose the trypsin and helpanimals chromatography.

2. Cleaning des-Pro2-Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin

Material fermentation volume of 10 l was purified in the following way. After the fermentation has established pH 3 the contents of the fermenter with concentrated citric acid and heated for 10 minutes at 70oC. Then the cells were removed by centrifugation (15 minutes, 7500g, centrifuge Heraeus) and the obtained supernatant was filtered (8 μm to 0.2 μm, Millipore, Germany). After this stage, the supernatant by freezing at -18oWith can be stored until further use. The solution is then diluted by adding purified water to a conductivity of less than 8 MS/cm, and was applied on a column of SP-separate FF (firm Pharmacia, Sweden). The column was pre-balanced 50 nm buffer citrate-corrosive and gradient of 1M NaCl. The obtained fractions were investigated on the content of the product by reverse phase high-performance liquid chromatography (RP-HPLC, C4) and tests for inhibitory activity against proteases. The fractions containing the desired product were combined.

Then a solution of the product was applied directly to the first column for RP-HPLC (initial program 15 by reversed-phase chromatography, Pharmacia, Sweden), which is pre-balanced to 0.1% triperoxonane acid/water. Unbound protein was removed by intensive washing with the same buffer. The product was suirable linear gradient of acetonitrile (0-70%). The fractions obtained re-examined on the contents of the product by the methods described above containing the product fractions were combined.

For the final purification of the solution containing the product was diluted with water for injection and was applied to a second column for RP-HPLC (video recorder C8, company video recorder, USA), which is pre-balanced to 0.1% triperoxonane acid/water. Unbound protein was removed by intensive washing with the same buffer. The product was suirable linear gradient of acetonitrile (0-70%). The obtained fractions were re-analyzed on the content of the product the above-described method is of capabilities, bottled at the respective portions (20, 10, 1, and 0.2 mg), liofilizirovanny and analyzed.

Example 5

Determination of Ki values in the inhibition of kallikrein human plasma des-Rho-Sr10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin

1 Ed. the kallikrein human plasma was diluted to 16 ml of buffer (0.05 M Tris/0.1 M sodium chloride, 0.05% tween-20; pH of 8.2). 200 µl of enzyme was mixed with decreasing amounts of buffer for testing(250, 240, 230, 220, 200, 180, 170, 150, 100, 50 μl) and then added increasing amounts of inhibitor in the buffer for analysis(10, 20, 30, 50, 70, 80, 100, 150, 200 and 250 μl; concentration of 0.7 µg/µl).

A solution of the enzyme/inhibitor was preincubator 4 hours at room temperature. Then 180 μl of each solution was added to the cell tablet titration and was mixed with 20 μl of the substrate solution. Measured the change in absorption at 405 nm for 10 minutes. Was determined by the enzymatic reaction rate and on the basis of this expected value of Ki described method (Biochemical Medicine 32: 387-97 (1984)).

The original substrate solution: 0.1 M in dimethyl sulfoxide

Substrate solution: 110-3M S-2302 in the buffer for analysis.

Buffer for analysis: 0.05 M Tris(hydroxymethyl)aminomethane, 0.1 M sodium chloride, 0.05% tween-rment plasmin, trypsin cattle and chymotrypsin were determined in the same way. Substrates were chromium PL for plasmin, HD-Pro-Phe-Arg-pNA for factor XI, S-2444 for trypsin and Suc-Phe-Leu-Phe-pNA for chymotrypsin.

Example 6

The results of the chemical characterization of protein des-Pro2-Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin

The protease inhibitor, des-Rho-Sr10-Arg15-l17-s24-hr26-Glu31-Asn41-Glu53-Aprotinin, received as a result of secretion using a modified genetic engineering of yeast organism. It was purified to homogeneity from yeast supernatant using various chromatographic methods. The identity of the inhibitor with the cloned sequence confirm the following analytical studies of protein.

Analysis of the N-terminal sequence

The sequence of the protease inhibitor was completely decoded in 57 steps. The following list represents a specific protein sequence identical to the cloned sequence.

Sequence analysis of the des-Pro2-Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-sn41-Glu53-Aprotinin implemented in 57 steps.

Amino acid analysis

Amino acid analysis is an important quantitative parameter for Inoculat. Amino acid analysis of des-Pro2-Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-sn41-Glu53-Aprotinin is in good accordance with theoretical values based on the primary structure (table 1).

Reversed-phase chromatography

In the case of proteins, with high-performance liquid chromatography on chemically related converted phases occurs through hydrophobic exchange interaction of the protein binding of the applied phase. Proteins in accordance with the strength of their binding to the stationary phase are displaced organic solvents (mobile phase). On this basis, this method is a good criterion for assessing the purity of the protein. Des-Pro2-Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin eluted with a phase RP-18 as a separate peak. It was shown that the selected protease inhibitor is very clean.

Capillary electrophoresis chromatography with

Capillary electrophoresis allows you to separate peptides and proteins based on their charge in an electric field. The quality of separation will depend on the buffer, pH, temperature, and additives used. As the capillaries are used columns of the so-called "quartz glass" with an inner diameter of 50-100 μm. Des-Rho-Sr10-Arg15-Ala17-Asp24-Thr26-the observed narrow peak.

Determination of molecular weight

Molecular weight des-Pro2-Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin was determined in 6223 D on the MALDI technique. Found molecular weight is in good agreement with theoretical value 6215 D within the accuracy of the measuring method. As the matrix used sinapinic acid.

The electrophoresis gel using sodium dodecyl sulphate

Des - Pro2-Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53 - Aprotinin were analyzed by electrophoresis using sodium dodecyl sulfate in reducing and nereguliruemyi conditions. Discovered the band in the area of about 6.5 KD.

Example 7

Determination of Ki values in the formation of complexes of the enzyme with des-Pro2-Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin

The inhibition constants des-Rho-Sr10-AGD-l17-sp24-hr26-Glu31-Asn41-Glu53-Aprotinin was determined for different enzymes. Table 2 shows the values of Ki.

Example 8

The interaction of protease inhibitors with polyclonal rabbit or human antibodies against Aprotinin

Cross-reactivity recombinante received protease inhibitors was investigated with polyclonal rabbit or cloven interact weakly with antisera to Aprotinin.

The Protocol sequence is given at the end of the description.

1. Variant Aprotinin with a total charge of +3 to -3 pH 7 with amino acids Arg15 or Arg15-Arg17 in the binding site.

2. Option under item 1 for the inhibition of serine proteases.

3. Variant Aprotinin under item 1 or 2 with a modified N-terminal sequence.

4. Variant Aprotinin under item 1 or 2 with the lengthening or shortening of the N-end or remote amino acids at N-end.

5. Variant Aprotinin selected from the group des-Rho-Sr10-Arg15-Ala17-Asp24-Thr26-Glu31-sn41-Glu53-Aprotinin, des-Rho-Sr10-AGD-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin, des-Rho-Sr10-AGD-Sr17-Asp24-Thr26-Glu31-Asn41-Glu53-Aprotinin, des-Rho-Sr10-AGD-l17-TRG-Glu3l-Asn41-Glu53-Aprotinin, des-Pro2-Ser10-Arg15-Ala17-Asp24-hr26-sn41-Glu53-Aprotinin, Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-sn41-Glu53-Aprotinin, Ser10-Arg15-Asp24-Thr26-Glu3l-Asn41-Glu53-Aprotinin, Ser10-Arg15-Ser17-Asp24-Thr26-Glu31-sn41-Glu53-Aprotinin, Ser10-Arg15-Ala17-Thr26-Glu31-Asn41-Glu53-Aprotinin and Ser10-Argl5-Ala17-Asp24-Thr26-Asn41-Glu53-Aprotinin.

 

Same patents:

v5-mediated angiogenesis" target="_blank">

The invention relates to medicine, in particular to a method of inhibiting angiogenesis in tissues using antagonists of vitronectinv5

The invention relates to new peptides of General formula 1 (H-a-Lys-d-Trp-Lys-c - Pro-d-Lys-Pro-Trp-e-Arg-NH2where a = -Ile or Lys; b= -Pro - or-Lys-; C, d = -Lys or Trp; e=Arg or Ala, having biocidal activity, which combine higher compared to indolizidines biocidal activity with no damaging effects on blood cells

The invention relates to compounds salts of the polypeptide represented by the formula (I), where a1AND2AND3AND4X, Y and Z have the values given in the description, and the transition metal, which have high antiviral activity against human immunodeficiency virus

The invention relates to biotechnology and can be used to create effective vaccines against AIDS

The invention relates to a new autoantigen and its derived peptides, their use in the treatment of chronic articular cartilage in autoimmune diseases, pharmaceutical compositions containing these peptides, diagnostic method detection self-reactive T cells in the analyzed sample and the analytical set used in said method

The invention relates to medicine and cardiology

The invention relates to the field of biotechnology
The invention relates to medicine and can be used in therapy, for immunocorrective
The invention relates to medicine, namely therapy, and can be used in clinical practice for immune in various diseases

The invention relates to the field of medicine

-ketoamide inhibitors of 20s proteasome" target="_blank">

The invention relates to a method for suppression of disorders of cell proliferation, infectious diseases, and immunological diseases in mammals, particularly humans, by using compounds of the following General formula:

< / BR>
where X2is a AG or AG-X3where X3includes-C=O, CH2CO - or (CH2)nwhere n=0-2, and where AG represents phenyl, substituted phenyl, indole, substituted indoles and any other heteroaryl;

R1and R2independently selected from the side chains known natural-amino acids and not natural amino acids, hydrogen, 1-10 carbon linear and branched alkyl, 1-10 carbon linear and branched substituted alkyl, aryl and substituted aryl, 1-10 carbon linear and branched substituted aryl, alkoxyaryl, 3-8 carbon cycloalkyl, heterocycle and substituted heterocycle, or heteroaryl and substituted heteroaryl

The invention relates to compounds of formula I (the values of the radicals defined in the description), their prodrugs and their pharmaceutically acceptable salts

The invention relates to new derivatives of substituted purine with immune modulating, in particular immunostimulatory activity in vivo and in vitro and does not exhibit toxicity, to pharmaceutical compositions and method of slowing tumor growth

The invention relates to biotechnology and can be used to create effective vaccines against AIDS

The invention relates to a new autoantigen and its derived peptides, their use in the treatment of chronic articular cartilage in autoimmune diseases, pharmaceutical compositions containing these peptides, diagnostic method detection self-reactive T cells in the analyzed sample and the analytical set used in said method
The invention relates to medicine and relates to tools for parenteral protein nutrition and removal of toxemia

FIELD: biotechnology, medicine, oncology, peptides.

SUBSTANCE: invention relates to a method based on phage display for preparing peptides interacting specifically with mammary Ehrlich tumor and can be used in therapy and diagnosis of malignant neoplasm. Peptides are prepared by affinity selection from phage peptide libraries comprising ten millions of different peptides of size 15 amino acid residues, the group of nine peptides wherein each peptide shows ability for accumulation in Ehrlich tumor. For practice using mimetic-peptides selected by such manner can be prepared by chemical synthesis and to use for preparing conjugates on their basis with the known cytotoxic preparations, radioactive isotopes and they can be incorporated in the composition of liposomal preparations for visualization of tumor neoplasm also.

EFFECT: valuable medicinal properties of peptides.

2 dwg, 2 ex

Up!