A pair of synthetic oligonucleotide primers used for detection of dna of herpes simplex virus human type 6

 

(57) Abstract:

The invention relates to biotechnology, in particular genetic engineering, and can be used for DNA identification of human herpes virus type 6 (HHV-6). The selected pair of primers specific to the gene U-11 HHV-6, conservative for different serotypes of HHV-6 and has low homology with the corresponding genes of other herpesviruses. Amplificatory gene U-11 HHV-6 encodes a protein (bucephalidae family) R, which is one of the major antigens of HHV-6. Offered a unique pair of oligonucleotides (the nucleotide sequence is shown in the formula) does not give cross-reactions with related species, which allows limited to single-stage procedure for the reaction, quickly and reliably determine the presence or absence of the DNA of HHV-6 in the sample. 3 Il.

The invention relates to biotechnology, in particular genetic engineering, and can be used for diagnostic DNA identification of human herpes virus type 6 (HHV-6), and to address the research objectives for the study of herpes viruses.

In recent years, methods of diagnostics of viral infections, which are the successive DNA which is characteristic for a certain type of infectious agent. It should be noted that "genetic diagnostic methods are designed not to supplant existing immunological and other methods, but to Supplement them, allowing you to solve the problems of diagnostics of infectious diseases that were previously inaccessible to classical methods (1, 2). The most promising of the methods of gene diagnostics is a method of polymerase chain reaction (PCR), based on multiple copies with the help of the enzyme DNA polymerase specific DNA fragment, which is the marker for this type of infectious agent. PCR is a direct method of detecting DNA of the virus and has a high degree of sensitivity. This method is indispensable in some cases clinical practice (for example, in the practice of transplantation, testing in antenatal clinics).

For PCR the necessary primers, synthetic oligonucleotides that are specific for a certain type of virus. The primer must be complementary to the DNA sequences on the left and right border of the specific portion and oriented so that exponentiale increase the number of copies of a specific fragment. On the chosen primers that define the specificity of PCR depends on the severity of the diagnosis of withspecific DNA. Using appropriately selected primers can detect the DNA of entire genera or families of organisms.

There is a method-specific detection of DNA of human herpes virus type 6, providing for the amplification of DNA in a liquid mixture containing DNA polymerase, aqueous liquid sample and a combination of primers in the quality of the target genes using gene U57 encoding major capsid protein (3). The high specificity of PCR can be achieved through the use of internal primers, the so-called "nested" PCR (4), and the PCR method with the further use of specific restricts (5). The disadvantages of the described approaches DNA detection of human herpes virus type 6 is the high cost and inaccessibility of the purchase of primers, especially for "nested" PCR, we offer foreign companies, as well as the complexity of the procedure two step analysis of clinical samples.

An object of the invention is the detection of the DNA of HHV-6 with a high degree of specificity in clinical samples, limited to single-stage procedure for the segment of the nucleotide sequence of the genome of human herpes virus type 6. Finding suitable primers using the computer program PC GENE were analyzed DNA sequence is already known worldwide strains of viruses (4, 5). Identified conservative areas of the DNA of human herpes virus type 6, no homology with other herpes viruses to avoid cross-reaction similar species. Using the computer program OLIGO" were selected synthetic oligonucleotide primers of the following composition:

5' TGCTATATGGCAAGACATCACGA - 3'

3' ACCAGCGATCCCAACG - 5'

The calculated length of the PCR product for these primers is 405 mo. The selected primers specific to the gene U-11 HHV-6, conservative for different serotypes of HHV-6 and has low homology with the corresponding genes of other herpesviruses. Amplificatory gene U-11 HHV-6 encodes a protein p100 - main antigenic structural protein, which according to literature is one of the main immunogenic protein of HHV-6 (6, 7).

THE LIST OF GRAPHICAL MATERIALS

Fig. 1. The nucleotide sequence of the gene fragment U-11 HHV-6, amplificatory patentable oligonucleotide - primers. Positions of primers are indicated by underlining.

Fig.2. Rest the th gene fragment U-11 HHV-6.

Tracks 1, 8 - pUC-18/Msp-l.

Track 2-7 - amplificate obtained by PCR with DNA-matrices obtained from the genomic DNA of the following herpes viruses: herpes simplex virus type 1, herpes simplex virus type 2, human cytomegalovirus, Epstein-Barr virus, herpes zoster, human herpes virus type 6, respectively.

Tracks 9-12 restricti obtained when carrying out the restriction amplifierarava gene fragment U-11 HHV-6 the following restrictable: Vsp-1, Rsa-1, Pst-1, Cla-1, respectively.

The DNA detection of human herpes virus type 6 shown in examples 1 and 2.

Example 1. Amplification of DNA of a gene U-11. Polymerase chain reaction was performed on the amplifier brand Thermotic 16 MS, the manufacturer of "DNA-technology", Moscow.

The reaction was carried out in the following modes:

1 cycle: denaturation at 94oC for 2 min, annealing at 52oC for 0.5 min, synthesis at 72oWith over 0,6 minutes

40 cycles: denaturation at 94oC for 0.5 min, annealing at 52oC for 0.5 min, synthesis at 72oWith over 0,6 minutes

1 cycle: the synthesis of the final phase at 72oC for 3 min

The incubation mixture to the
10 mm d NTP

2 μl of primers,

5 µl of DNA template. As the DNA template used viral genomic DNA, obtained from a culture of cells MT-4 infected with HHV-6 strain Z-29 (ATCC VR-1348). Viral DNA was isolated according to the method described previously (5).

0.5 to 1 unit of DNA polymerase Taq,

water up to a volume of 50 μl.

On top of the mixture was layered 25 ál of mineral oil.

In Fig.3 (lane 7) shows the electrophoretic analysis of the PCR in 2% agarose gel. Amplificatory fragment having a size of 405 Monday, was treated restrictase Vsp-1, Rsa-1, Pst-1, Cla-1. In Fig. 3 (tracks 9-12) shows the electrophoretic analysis of the obtained restrictive, from which it follows that the sizes of the resulting fragments are expected.

The specificity of patentable pairs of primers shown in example 2.

Example 2. To determine the specificity of patentable pairs of primers were carried out PCR reactions, in which the DNA template were used viral genomic DNA following herpes viruses: human herpes virus 1 type (strain HF), human herpes virus 2-type (strain MS), human cytomegalovirus (strain AD-169), Epstein-Barr (strain Raji), varicella zoster virus and paasivaara example. In Fig. 3 (lanes 2-7) shows the electrophoretic analysis of the PCR in 2% agarose gel, from which it follows that the desired fragment size 405 p. O. obtained only when used as the DNA template DNA of HHV-6.

Thus, the task of getting a pair of highly specific primers, allowing to detect HSV DNA 6-th type for PCR from different samples, successfully solved. Selected unique oligonucleotides do not give cross-reactions with related species permit, limited to single-stage procedure for the reaction, quickly and reliably determine the presence or absence of HSV DNA 6-th type.

REFERENCES

1. PCR (Methods & Applications), 1993, v. 2, N. 4.

2. G. J. Nuovo. PCR in situ Hibridization (Protocols and Applications, Third Edition. 1997.

3. Huang L. M. et al. Detection of human herpesvirus-6 DNA in serum or plasma. J. Med. Virol. 1992; 38:7-10.

4. P. Seccheiro et al. Detection of human herpesvirus-6 in plasma of children with primary infection and immunosupressed patients by polymerase chain reaction. J. Infect. Dis. 1995; 171:273-280.

5. Kidd I. M. et al. A multiplex PCR assay for the simultaneous detection of human herpesvirus 6 and human herpesvirus 7, with typing by enzyme cleavage of PCR products. J. Virol. Methods Of 1998 Jan. 70: 1 29-36.

6. Neipel F, Ellinger K, Fleckenstein Century Gene for the major antigenic structural protein (p 100) of human herpesvirus 6. J. Virol 1992; 66:3918-3924.

7. PelletReactive An Epitope. //Virology 1993. V. 195, p. 521-531.

A pair of synthetic oligonucleotide primers used for DNA detection of human herpes virus type 6 and having the following nucleotide sequence:

5'TGCTATATGGCAAGACATCACGA - 3'

3' ACCAGTTTCGATCTTTTCCAACG -5'

 

Same patents:

The invention relates to immunobiologii and can be used in medicine

The invention relates to genetic engineering and can be used, for example, in plant breeding

The invention relates to the field of molecular biology and can be used in the diagnosis of enteroviral infections in epidemiological studies

The invention relates to genetic engineering and can be used in plant breeding

The invention relates to the field of molecular biology and can be used for the detection of human immunodeficiency virus type 1 (HIV-1)

The invention relates to the field of medicine and relates to a method of detecting or identifying patients having a risk factor for diseases associated with coronary spasm
The invention relates to molecular biology, and in particular to methods of DNA extraction, and can be used in laboratory and research practice for separation of high molecular weight DNA or their fragments (macrorestriction) from the yeast and gram-positive microorganisms suitable for further analysis using the technique of pulse electrophoresis, as well as in the formulation of polymerase chain reaction (PCR) and cloning

The invention relates to molecular biology, pharmacology, medicine and environmental protection

The invention relates to the field of molecular biology and can be used for the detection of human immunodeficiency virus type 1 (HIV-1)

The invention relates to immunobiologii and can be used in medicine

The invention relates to biotechnology and in terms of protein ATP-sensitive potassium channel, deoxyribonucleotides and expressing plasmids

The invention relates to the field of biotechnology and the new protein ATP-sensitive potassium channel and the coding of its deoxyribonucleotide

The invention relates to medicine, specifically in terms of its composition, a pharmaceutical composition having immunotropic effect, which can be used for therapy of human diseases involving a dysfunction of the immune system

The invention relates to medicine, and is concerned with the obtaining of sodium nukleospermata
The invention relates to biotechnology, in particular genetic engineering
The invention relates to biotechnology and relates to a method of purification of DNA double

The invention relates to biotechnology, in particular genetic engineering, and can be used for diagnostic purpose identification of herpes simplex virus type 1 (HSV), as well as for solving research problems in the study of this group of viruses
Up!