The method for determining the cytokine status of a person at a genetic level

 

(57) Abstract:

The invention relates to the field of molecular biology, immunology, Microbiology and Virology, and is intended to assess the transcriptional levels of genes activity of interferon (if), IGF-dependent and proliferative cytokines. The method includes determining the messenger RNA (mRNA) cytokines based on a combination of methods RT-PCR with blot - and mothibatsela. At the same time to detect changes in cytokine status explore the range of mRNA interferon (if)-dependent and proliferative cytokines: interferons (alpha-2, beta 1, and gamma), Interfax-regulated enzymes: 2',5'-oligoadenylates (2,5-OAS), RNA-ASE L, DS-protein kinase (dspc), factors of cell proliferation: l-2, Fas antigen (Fas-AG) and protein cytoskeletal gamma-actin, using synthetic oligonucleotides. The use of this method in clinical studies provides the necessary information about existing relationships in the network Interfax-dependent cytokine responses of cells in normal and various pathological conditions. 2 Il., table 2.

The invention relates to the field of molecular biology, immunology, Microbiology and Virology, and is intended to evaluate the activity of genes is mi activation proliferation and differentiation of cells (Kashkin K. P. cytokines of the immune system: basic properties and immunobiological activity. Clinical laboratory diagnostics, 1, 1998, S. 21-32). Interferon (if) were the first identified members of this family. Many of the cytokines known as interleukins, which determine the reactivity of the immune system, affecting the presentation of antigens, cytotoxic reactions, the level of differentiation and proliferation imcompetent cells (T - and b-lymphocytes, macrophages, and others). The most significant effects of the IFS are: antiviral, antiproliferative, and immunoregulatory hormone-like. If withspecific and are active in the cells of the homologous species. Like several well-known cytokines, Interfax cause in cells enhancing or suppressing the activity of the group of cellular genes (Ershov, F. I. the interferon System in health and disease. M , Medicine, 1996; Vilcek J. a. Sen G. C. Interferons and other cytokines. In "Fundamental Virology", p.341-345, New York, 1996). Among cellular genes activated part of the genes has a preferential relationship with the system of philosophy, and was named Interfax-dependent. These include genes and messenger RNA (mRNA) enzymes: 2'-5'-oligoadenylates (2-5-SLA), ribonuclease L (RNA-entirely and play a leading role in the development of antiviral and antiproliferative States (Sen, G. C. a. Lengyel P. , The interferonsystem. A birds eye view of its biochemistry. J. Biol. Chem. , V. 267, p.5017-5020, 1992; Lengyel P. Tumor-suppressor genes; News about the interferon connections. Proc. Natl. Acad. Sci. USA, V. 90, p. 5893-5895, 1993). Along with Interfax-dependent enzymes to proteins that regulate the processes of cell proliferation (CP) and apoptosis are protooncogen l-2, Fas antigen (Fas-AG) (E. White Life, death and the pursuit of apoptosis. Genes Dev., V. 10, p.1-15, 1996). High levels of Bcl-2 is considered an indicator of cell proliferation, and, conversely, the accumulation of Fas-antigen induces the processes leading to cell death (Schwatzman R. A., Cidlowski J. A. Apoptosis: The biochemistry and molecular biology of programmed cell death. Endocrine Rev., V. 14, p.133-151, 1993). Indicators of activity of genes of proteins involved in mitosis and in the construction of the cellular cytoskeleton, such as gamma-actin important for the characterization of the processes of cell proliferation (Erba N. R., Eddy, R., Shows, T. et. al. Structure. Chromosome localization and expression of the human gamma-actin gene. Mol. Cell. Biol., V. 8, p.1775-1789, 1988).

The term "cytokine status" us United indices of the activity of cytokines systems interferon (if) and cell proliferation (CP), which define the normal physiological reactions of an organism in response to external stimuli of different nature, including drug therapy, viral and bacterial infections. System if and KP closely svyazanyi of interrelated stages: induction, synthesis and actions. In the induction of genes IFS is the transcription of mRNA IFS and protein synthesis d'if, which are secreted from cells. Follow-up action if carried out, by interacting with receptors on adjacent cells and inducyruya in a number of cellular genes and transcription with them mRNA, of which the most studied of the above enzymes and proteins of cell proliferation.

If subdivided into 2 main types and 3 types: type I Interfax include leukocyte (alpha) and fibroblastic (beta); type II is represented by one species - immune (gamma-Interfax). If (alpha, beta and gamma) are encoded by different genes, and numerous subspecies alpha-if (20) is sufficiently conservative for the primary structure (60-70% homology). On the contrary, between genes alpha and beta if homology is low. Moreover, the genes beta-1 if and beta-2 if (interleukin 6) have little similarity. Currently decoded primary structure of mRNA 3 kinds of human Interfax and several IGF-dependent and proliferative proteins, we studied (table 1).

Actively developed by reverse transcription - polymerase chain reaction (RT-PCR) is a method of determining the mRNA of different types of interleukins and inflammatory factors, which apply the feron and Cytokine Res., V. 15, p. 1005-1009, 1995; C. Platzer, Blankenstein T. Polymerase chain reaction to quantitate cytokine mRNA. In: Cytokines. A practical approch. Ed. F. R. Barkwill. IRL Press, Ox-ford, N-Y, Tokyo, 1995).

Known invention, describes several variants of RT-PCR for comparative determination of mRNA in different cell types and tissues (Klotman, P. E. et. al. , U.S. patent 5543509, 6 Aug. 1996; Pardee et. al., U.S. patent 5665547, 9 Sept. 1997; Banker et. al., U.S. patent 5643730, July 1, 1997; Sutcliffe et. al., U.S. patent 5807680, 15 Sept. 1998). In contrast, the proposed method for the determination relates to a special group studied mRNA of cytokines coding synthesis IFS, IFS-regulated enzymes and proteins KP (table 1). Currently, the commercial RT-PCR kits for the determination of IGF-dependent and proliferative mRNA is absent. Private firms offer only enzyme immunoassay system for the determination of proteins of the immune system (inflammatory factors) (see catalog "Genzym diagnostics", 1995). Therefore, in the newly developed method with the original set of specific oligonucleotides for determination in biological environments (systems) mRNA cytokines systems of philosophy, and KP will fill a gap in the necessary PCR-based assays. The essential features of the invention that distinguish it from previously published, include:

1. Semiquantitative predeliveries human blood. This is achieved by transforming different types polyadenylated RNA /poly(A) RNA/ complementary DNA (cDNA) in response to the subsequent amplification of specific DNA segments by PCR with a pair of oligonucleotide primers and hybridization of DNA dilutions products labeled with radioactive probes. (see definitions).

2. Using the original set of oligonucleotide primers and probes to areas mRNA of cytokines person coding the synthesis of: 3 types of IP (alpha-2, beta 1, and gamma), 5 if-regulated and proliferative proteins (2,5-OAS, RNA-ASE L, DS-PC l-2, Fas-AG) and protein cytoskeletal gamma-actin.

The essence of the patented method definition is that a comparative analysis of the levels of transcription of the spectrum of mRNA of IGF, IGF-dependent and proliferative cytokines in biological environments, including in microprobe the blood of man, by combining variant of the method of semi-quantitative RT-PCR methods blot and detribalization. For 9 species of mRNA of cytokines person we designed and synthesized a specific oligonucleotides (PCR-primers and hybridization probes) size 21-24 nucleotide. Description primary structure oligosol the manner shown in table 1. Conducted computer analysis of the specificity of the oligonucleotides, which allowed to exclude their interaction with heterologous matrices PCR conditions. When comparing nucleotide sequences of mRNA IFS for calculation of primers were selected plots that differ in mRNA for alpha-2, beta 1, and gamma-IFS. Primers and probes for human mRNA l-2 and mRNA gamma-actin interact with the mRNA of similar cytokines murine origin and therefore may have greater species use.

Patented method involves complex formerly known molecular methods for the determination of mRNA and DNA with high specificity, sensitivity, and clarity. The method allows to determine the content of mRNA of IGF-regulated human genes with high, medium and low levels of expression. Incorporate it into clinical trials will provide important information about the existing relationships in the network Interfax-dependent cytokine responses of cells in normal and various pathological conditions. The proposed method will make technology a comprehensive comparative study of the influence of any drugs, especially drugs of philosophy, and its inducers on the expression of genes of the systems of philosophy, and To the gene expression systems of philosophy, and KP in cancer patients, and also in individuals with chronic viral and bacterial infections.

THE PROCEDURE DEFINITION

For definitions used semiquantitative option combined method of reverse transcription and polymerase chain reaction (RT-PCR), high sensitivity (Dallman P. J., Porte, A. S. In: PCR. A Practical Approch, Lond. , 1991, p. 215-224). Samples of fresh blood volume of 0.2 ml (immediately after the capture of Vienna) was mixed with an equal volume of 2 × lysis buffer (14 M guanidinylation, 25 mm Na citrate (SSC), pH 7.0, 0.5% of sarkosyl, 100 mm mercaptoethanol). The samples were stored at -20oC. Allocation of mRNA was performed according to the literature method (Chomzynsky P. and Sacchi, N., Anal. Biochem. V. 162, p.152 to 159, 1987). RNA was consistently perioadele 70% ethanol, 3 M ammonium acetate and again 70% ethanol.

Total RNA extracted from 0.2 ml of blood is added to the reverse transcription reaction for the synthesis of complementary DNA (cDNA). As a universal primer is used oligodeoxythymidine acid /oligo(dt)16/, which interacts with all poly(A)RNA in the total RNA preparation. Next, the synthesized cDNA mixture is diluted in 10 and more times for PCR with specific oligonucleotides (pairs of primers), the calculated is about 3.4" (table 1). RT-PCR was carried out in 2 stages:

1) FROM the reaction with the universal primer oligo(dt) on the total poly(A)RNA to obtain cDNA. The composition of the reaction mixture by volume of 40 μl: cellular RNA 1-10 μg, primer oligo(dt)16 5 µg mixture: dATP, DSTF, dCTP and dTTP - each at 1 mm, the enzyme reverse transcriptase M-MULV (Moloney Murine Leukemia Virus "MBI Fermentas") 40 units, an inhibitor of RNA-ASE (RNAsin "MBI Fermentas") 30 IU; 5x buffer 8 ál (single composition: 50 mm Tris-Hcl, pH 8.0, 10 mm MgCl2, 14 mm KCl, 10 mm dithiothreitol). The mixture was incubated 1 h at 40oC in a water bath. The reaction was stopped by heating at 94oC for 3 minutes.

2) PCR amplification of 10-fold dilutions of cDNA obtained in response, thermostable enzyme Taq polymerase ("MBI Fermetas") with specific pairs (forward and reverse) oligonucleotide primers on the device DNA-amplifier according to the program: T melting 94oSec, 1 min, T annealing (set for each pair of primers), Vol amplification - 72oWith 2 minutes Number of PCR cycles was varied from 30 to 50 (depending on the accumulation of specific DNA product). Time PCR was 3-5 hours To prevent evaporation of the reaction sample from above was added to liquid paraffin. The composition of the mixture incubation PCR volume is - each 1 mm, 10x buffer 2 ál (single composition: 67 mm Tris-HCl, pH 8.8; of 16.6 mm ammonium sulfate, and 2 mm MgCl2; 0.1% tween-20, the enzyme Decolorata Thermus aqaticus (Taq polymerase) of 2.5-5%

The resulting DNA products size 200-600 nucleotides is determined by electrophoresis in 1.4% agarose gel (80V, 1 h) coloring bromide by ethidium visually (Fig. A I, II, III B. I, II, III). The specificity of the DNA products evaluated according to:

- according to the mobility in the gel DNA amplification size in the studied plots mRNA of cytokines;

- blotthybridization on membranes amplification DNA radioactively labeled32P probes to the inner areas of mRNA of cytokines.

Quantification of the accumulation of specific products is carried out in detribalization autoradiographically registration of the interaction of 10-fold dilutions of amplification DNA labeled with32R-probes.

Blot and detribalization performed in 50% formamide on the membranes (Hybond-N, Amersham) according to the methods recommended by Promega. PCR products were transferred to membranes, denaturiruet 0.5 M NaOH, neutralized in 0.5 M Tris-HCl, pH 7.0, was heated at 80oC for 2 h, the Membrane was first incubated in prehybridization buffer for 2 hours, and then in hybridization 32P-probe (100 million u./g) for 19 h in a thermostat at the optimum for each probe temperature interaction (T designed using the program Oligo 3.4"). The membrane was sequentially washed from unbound radioactivity in 1X and 0.1 X SSC 2-3 times. The dry membrane was autoradiographically with x-ray film 18 PM

Example 1. Semiquantitative evaluation of constitutive levels of mRNA of cytokines systems of philosophy, and KP in microsamples of human blood.

Blood was taken from the ulnar vein 2 healthy donors. An aliquot of blood (0.2 ml) was mixed with an equal volume of 2-fold lyse buffer and kept at -20oC. Using the method of RNA extraction (Chomczynski P. a. Sacchi N. Single-step method of RNA isolation by acid guanidinium thi-ocyante-phenol-chloroform extraction. Anal. Biochem. 162, 156-159, 1987). On 2 selected samples of total RNA in independent reactions FROM universal primer oligo(dt)16 were synthesized cDNA preparations. Aliquots of cDNA (undiluted and diluted 1/10-1/1000) was added in 9 independent reactions da (each with a pair of specific oligonucleotide primers). The PCR program was different T With annealing of the primers on the matrices cDNA (indicated for each used a pair of primers in table 1) and the number of cycles of amplification, not the th ethidium). In 2 patients in the studied blood samples obtained matching results constitutive levels of mRNA, which are summarized in table 2. According to the data obtained constitutive levels of mRNA of different types of cytokines in blood samples of patients vary considerably. Comparison of quantities of DNA products obtained with dilutions of cDNA permits separation of mRNA of cytokines in the group with very high (alpha-2-Interfax), high (RNA-Aza L, gamma-actin, BcL-2), average (beta-1-if) and low (undetectable) levels of transcription (gamma-Interfax, 2,5-OAS, dspc, Fas-AG). More than 1000-fold excess of the level of the endogenous alpha-Interfax on mRNA of beta - and gamma-IFS suggests that blood leukocytes genes alpha-d'if can be activated in a high degree. The high content of mRNA RNase L, gamma-actin and l-2 also indicates increased gene activity of these cytokines in the blood cells. The proposed method for the determination of cytokine status can be used to assess the clinical efficacy of drugs in humans by individual comparative analysis of changes in the levels of accumulation of mRNA of IGF-regulated and proliferative cytokines in the blood cells.

Samples of venous blood (0.2 ml) was taken in 2 patients for 1 h and after 24 and 48 h after drug injection. The production of semi-quantitative RT-PCR was similar to that described above when determining constitutive levels of mRNA of cytokines. Additionally, the specificity of the DNA-amplification was established methods blot and detribalization with radioactive32R-probes designed to the internal sequences of 9 species of mRNA of cytokines (table 1). For blotthybridization agarose gels with the identified DNA products were transferred to membrane Hybond-N for 18 h under pressure. For detribalization DNA amplificate of a mixture of PCR was first besieged by 75% ethanol, then dissolved in 10 and more times and put on 1 μl of the membrane Hybond-N. the Procedure of hybridization with labeled probes described above. Quantification of the accumulation of specific DNA products made by their dilutions detected by autoradiography on x-ray films. Results to identify changes in the levels of synthesis of mRNA of cytokines in 2 patients receiving the drug T-immunomodulator (patient 1) or the product t-inducer if (patient 2) presented in Fig.A and b Detected a slight individual variations (within 10-fold) in ishodnymi mRNA for beta-1-if-and gamma-IFS. Patient 1 (according to blotthybridization) the content of the endogenous beta-1-d'if was almost 100 times higher than that of patient 2 (probably it is connected with the peculiarities revealed he has an infectious disease). The feature of the gene expression of beta-1-if is an intermediate mRNA transcripts, which, according to the literature, are the stages of maturation of the final form mRNA in human cells. Data electrophoresis of DNA products in agarose gel, blot and detribalization show changes in the levels of transcription of mRNA after administration of drugs. Drug T causes a strong suppression of gene expression of beta-1-if, because of specific DNA product /393 nucleotide pairs (N. p.)/ was not determined after 24 and 48 hours, on the Contrary, the drug C stimulated the transcriptional activity of the gene beta-1-if more than 100 times (quantitative evaluation according to detribalization). The effect of induction of the gene beta-1-if product C had disappeared by 48 h, which can be explained by the rapid removal of the drug from the body. The product T (patient 1) inhibited the transcription of the endogenous alpha-2-if a product C (patient 2) stimulated her about 10 times to 24 hours the Severity of the effects of drugs T and C on the activity of the gene alpha-2-Interfax was significantly lower than the activity of a gene which induces highly informative patentable method to detect changes in cytokine status of a person at a genetic level.

Thus, the experimental verification of patentable method showed its applicability for the determination of constitutive and changing under the influence of drugs) levels of gene expression of a number of IGF-dependent and proliferative cytokines human microprobe blood by a combination of semiquantitative method RT-PCR, blot and detribalization using specific oligonucleotide primers and hybridization probes.

Semi-quantitative way of assessing the levels of transcriptional activity of genes in biological systems by defining the messenger RNA (mRNA) cytokines based on a combination of methods RT-PCR with blot - and mothibatsela, characterized in that the determination is carried out in microprobe (0.2 ml) human blood and to detect changes in cytokine status explore the range of mRNA interferon (if)-dependent and proliferative cytokines: interferons (alpha-2, beta 1, and gamma), Interfax-regulated enzymes: 2', 5'-oligoadenylates (2,5-OAS), RNA-ASE L, DS-protein kinase (dspc), factors of cell proliferation: l-2, Fas antigen (Fas-AG) and protein cytoskeletal gamma-actin, using synthetic oligonucleotides:

primers of 21 link with nucleotide posledovatelnostyu

GAGCCTTCTGGAACTGGTTGC,

interacting with the endogenous alpha-2 d'if; primers of 21 link to the nucleotide sequence of

TGCAGCAGTTCCAGAAGGAGG and TCCAGTCCCAGAGGCACAGGC

and hybridization probe of 24 links with nucleotide sequence

CCTGGAAGAAAAACTGGAGAAAGA,

interact with the mRNA of beta-1 d'if; primers of 21 link to the nucleotide sequence of

GGTTCTCTTGGCTGTTACTGC and GCAGGCAGGACAACCATTACT

and hybridization probe of 24 links with nucleotide sequence

GACCAGAGCATCCAAAAGAGTGTG,

interacting with mRNA gamma IFS; primers of 21 link to the nucleotide sequence of

TCGGGGAGGGGGTGGAGTTCG and GCTCACTGGGGACCCATCCCA

and hybridization probe of 24 links with nucleotide sequence

GCCCAGGGATTTCGGACGGTCTTG,

interacting with mRNA 2,5-OAS; primers of 21 link to the nucleotide sequence of

TGCATCGGGGGTGCATGGGCC and CTTCACGCTCCGCCTTCTCGT

and hybridization probe of 24 links with nucleotide sequence

CCTGTCCTCTGGTTCTTTTGCTAC,

interacting with mRNA DS-PC; primers of 21 link to the nucleotide sequence of

AGAGGAAGGGGGCTGGACACC and GCGTTTACATCTGCCCCCATC

and hybridization probe of 21 link to the nucleotide sequence of

TCACGCTCCCCGCAATCGCTG,

interacting with mRNA Hybridization probe of 23 links with nucleotide sequence

TTCTGCCATAAGCCCTGTCCTCC,

interacting with mRNA Fas-AG; primers of 21 link to the nucleotide sequence of

TGCACCTGACGCCCTTCACCG and CCAGGTGTGCAGGTGCCGGTT

and hybridization probe of 24 links with nucleotide sequence

CCTCCCCCAGTTCACCCCGTCCCT,

interacting with mRNA l-2; primers of 21 link to the nucleotide sequence of

GGGCGACCACTGGCATTGTC and GCGGTGGACGATGGAGGGGCC

and hybridization probe of 21 link to the nucleotide sequence of

ACCGGAACCGCTCATTGCCAA,

interacting with the endogenous gamma-actin.

 

Same patents:

The invention relates to the field of molecular biology and can be used in medicine in the diagnosis of some diseases

The invention relates to medicine and can be used for the diagnosis of hepatitis C virus in biological environments

The invention relates to purified and dedicated not naturally occurring RNA ligands to vascular endothelial growth factor (VEGF) (indicated oligonucleotide sequence)
The invention relates to biotechnology and relates to a method of purification of DNA double
The invention relates to medical Microbiology

The invention relates to biotechnology, in particular genetic engineering, and can be used for diagnostic purpose identification of herpes simplex virus type 1 (HSV), as well as for solving research problems in the study of this group of viruses

The invention relates to sanitary Microbiology

The invention relates to sanitary Microbiology

The invention relates to medical and veterinary Microbiology, namely, Mycology, laboratory diagnosis of dermatomycosis

The invention relates to the field of molecular biology and can be used in medicine in the diagnosis of some diseases

The invention relates to medical and veterinary Microbiology

The invention relates to medicine and can be used for the diagnosis of hepatitis C virus in biological environments

The invention relates to clinical Microbiology

The invention relates to environmental and genetic toxicology

The invention relates to environmental and genetic toxicology

The invention relates to medicine, namely the derived protein S obesity with long half-life
Up!