Recombinant plasmid dna pss5 encoding the synthesis of recombinant human alpha-2b interferon, a strain of escherichia coli ss5 - producer of recombinant human alpha-2b interferon and method for producing interferon alfa-2b

 

(57) Abstract:

The invention relates to biotechnology and can be used to produce recombinant leukocyte interferon alpha 2b human medical purposes (INT). Recombinant multicopying plasmid DNA pSS5 that encodes the synthesis of leukocyte alpha-2b interferon man, the expression of which is under the control of the Lac, T7 phage and tryptophan promoter and terminator of transcription of the rrn BT1T2, containing the gene for resistance to kanamycin and containing the DNA fragment from the plasmid pUC19 responsible for replication of recombinant plasmids, transformed cells of the recipient strain E. coli BL 21(DE3). Get a strain of E. coli SS5 with a productivity of at least 800 mg of alpha-2b interferon with a total activity of 1-2x1011ME for 1 l culture medium or 15-20 g wet cell biomass of the strain. The method involves culturing in a nutrient medium, freezing the culture fluid at a temperature not higher than -70°C, defrosting with increasing temperature up to 4°C, the introduction into the culture fluid lysozyme, destruction of DNA and RNA processing lysate DNA Azoy, the concentration of the obtained product by washing the protein restodruid followed by denaturaciei interferon and purification using ion-exchange chromatography ion-exchange resins of the type Whatman CM-52 cellulose. The invention improves the productivity of obtaining online. 3 S. and 4 C.p. f-crystals, 1 Il.

The invention relates to biotechnology, and in particular to methods of production of recombinant leukocyte interferon Alfa-2b human medical devices (hereinafter INT), and recombinant strains of Escherichia coli (E. Coli) and plasmids to obtain it.

Known methods for producing leukocyte interferon man from leukocytes of donor human blood, induced by viruses, double-stranded RNA, and other inductors (ed. St. and U.S. Pat. USSR N 297296, 1970; N 1366064, 1983, N 1713591, 1986 - class. C 12 N 15/00; U.S. Pat. Russian NN 1364343, 1984; 1709615, 1990; 2066188, 1993 - class. C 12 N 15/00).

The disadvantages of these methods are, as a rule, low product yield, the inability to scale this process, the probability of contamination of the final product by human viruses, such as hepatitis b and C, human immunodeficiency virus, etc. So now more recognized as promising way to obtain online microbiological synthesis, which provides the ability to obtain the target product with a significantly higher yield from a relatively inexpensive starting material. Used chemical approaches can create on arousih his expression.

Currently, as the source of microorganisms mainly use various artificially constructed strains of P. pastoris Ps. putida and E. coli.

The lack of strain P. Pastoris (J. N. Garcia, J. A. Aguiar et. al.//High level expression of human IFN-2b in Pichia pastoris.//Biotecnologia Aplicada. , 12(3)., 152-155., 1995), is the low yield of the target product per gram of biomass, and strain Ps. putida (U.S. Pat. USSR N 1640996, 1989, CL C 12 N 15/00) - the complexity of the allocation of the final product and, consequently, the complexity and high cost of the process.

We know a significant number of plasmids and created on the basis of strains of E. coli: the strains E. coli ATCC 31633 and 31644 with plasmids Z - pBR322 (Pst1) HclF-11-206 or Z-pBR 322 (Pstl)/HclN SN 35-AHL6 (U.S. Pat. UR N13380, 1997, C 12 N 15/21) strain of E. coli HB 101 with plasmid pER 103 (U.S. Pat. The USSR N1417800, 1985, CL C 12 N 15/00); E. coli strain SG 20050 with plasmid p280/21FN (Kravchenko Century. Century. and other Bioorganic chemistry, 1987, T. 13, No. 9, S. 1186-1193) and others.

The lack of technology based on these strains is their instability, and lack of expression of interferon.

The prototype of the proposed strain and plasmids strain is E. coli sg 20050/ pIF16 deposited under N PMBC V and recombinant plasmid pIF16 containing a tandem of two synthetic genes alpha-INTL. C 12 N 15/21).

Expression of alpha-interferon by E. coli strain SG 20050 (plF16) containing this plasmid, is controlled by a tandem of two constitutive mutant tryptophan promoter and the transcription terminator of phage 1. The plasmid contains a selective marker gene for resistance to ampicillin and the replicon vector pBR322. The level of expression of INT - 200-300 mg / l of cell suspension.

The disadvantages of this plasmid and strain on its basis are the use of plasmid strong-regulated promoters, which leads to rapid dissociation of the plasmid; and the use of gene beta-lactamase as a selective marker, because it is secreted from the bacterial cells and destroys the antibiotic, resulting in the fermentation process is a continuous decrease of selectivity conditions for plasmid-containing cells of strain accumulation besplatnih cells and result in reduction of the yield of interferon.

Along with specific strains of the efficiency of the process depends largely on the technology used in the isolation and purification of interferon.

A method of obtaining online, involving the cultivation of cells Ps. putida, the destruction of biomass processing polyetheramine lysate, his concentration and diafiltration, ion-exchange chromatography on cellulose DE-52, elution in a gradient of pH, ion-exchange chromatography eluent obtained on cellulose CM-52, concentration passing through the cartridge filters and gel - filtration on Sephadex G-100 (Ed. St. USSR N 1640996, 1995, CL C 07 K 14/56).

The disadvantage of this method is its low productivity using the cell-based Ps. Putida, as well as a multi-stage and large loss of the final product.

A method of obtaining online, involving the cultivation of a strain of E. coli SG 20050/pIF16, in LB-broth in flasks on a shaker, centrifuged biomass, the washing buffer solution and treated with ultrasound for cell disruption. The resulting lysate centrifuged, washed with 6M solution of urea in PBS buffer containing sodium chloride, potassium phosphate and Na2EDTA, is dissolved in a solution of guanidinate in PBS buffer and centrifuged ((U.S. Pat. RF N 2054041, 1996, class. C 12 N 15/21).

The disadvantages of the method are its relatively low performance, volatility producer in the fermentation process and, as a consequence, the volatility of output interferon.

The prototype of the proposed method of obtaining Inromania E. coli strain 294 ATCC 31446, transformed by the introduction of plasmids, the freezing of the received cells, their destruction by mechanical methods, suspendirovanie in the buffer solution and gomogenizirovannom. For the removal of DNA and RNA to homogenizate add polyethylenimine, then removed by filtration or centrifugation solids. The upper layer is concentrated by ultrafiltration, and then subjected to a first affinity chromatography, regulation of pH, and then subjected to ion exchange chromatography on cellulose SM or its equivalent using buffer solutions. (U.S. Pat. USSR N 1414319, 1981, class. C 12 N 15/00).

The disadvantage of this method is its multi-stage and low adaptability.

Task for the authors was to create a more productive plasmid DNA, producer strain and technologies for online.

This problem was solved by creating a recombinant plasmid DNA pSS5 and Escherichia coli SS5.

Plasmid pSS5 has 3604 base pairs (p. O.), and is characterized by the presence of the following fragments:

DraI-HindIII DNA fragment of plasmid pUC19 size 1103 p. O., containing a sequence that is responsible for replication of the plasmid, and the sequence of the Lac promoter (Plac);<T7) and tryptophan promoter (Ptrp) and the sequence Shine Dalgarno responsible for initiating broadcast;

XbaI-BamHI DNA fragment size of 512 p. O., containing the sequence of the synthetic gene alpha-interferon obtained by the method of DNA amplification (PCR);

BamHI-SspI fragment of DNA plasmid pKK233-3 size 529 p. O., in which the HindIII site AAGCTT replaced by the sequence AAGCTAGCTT containing a sequence rrnBT1T2responsible for the termination of transcription,

> PST - > PST fragment of DNA size 1227 p. O. plasmid pUC4K, in which the HindIII site AAGCTT replaced by the sequence AAACTT method of site-directed mutagenesis using PCR method, encoding resistance to kanamycin (kan).

On the drawing is the nucleotide sequence of plasmid pSS5.

The strain Escherichia coli SS5 obtained by transformation of Escherichia coli cells BL21 (DE 3) plasmid pSS5 using traditional genetic engineering technologies.

The strain of E. coli SS5 is characterized by the following features:

Cultural and morphological characteristics.

Cells small, straight, thickened rod-shaped, gram-negative, risperadone.

Cells grow well on simple nutrient is growth in liquid medium (minimal medium with glucose or LB-broth) intensive form a smooth suspension.

Physical-biological signs

Aerobe. Temperature range for growth 4-42oC at the optimum pH of 6.5-7.5.

As the source of nitrogen used as a mineral salt in ammonium and nitrate forms, and organic compounds in the form of amino acids, peptone, tryptone, yeast extract, etc.

As the carbon source used amino acids, glycerol, carbohydrates.

Resistance to antibiotics. Cells are resistant to kanamycin (100 μg/ml).

The strain Escherichia coli SS5 producing interferon-alpha

The method, conditions and medium composition for the storage of strain:

L-agar with the addition of 20 μg/ml kanamycin under oil, L-broth with 15% glycerol and antibiotics at -20oC in vials, lyophilized state in the vials at -70oC.

The strain Escherichia coli SS5 identified by the Identifier of Berga (1974) as the type strain of Escherichia coli.

Feature of the proposed method is to develop technologies that allow the separation of interferon in the form of insoluble forms (in the form of Taurus include (TV)), which allows to significantly simplify the technological scheme of the process and increase the yield of the target product.

The method consists in cultiv C, defrosting BM when the temperature is raised to 4oC, the destruction of the cells of the microorganism treatment of them by lysozyme, the destruction of DNA and RNA introduction to the lysate dnaase and cleaning, TV-washing detergents, by centrifugation, by dissolving TV in a solution of guanidine hydrochloride and subsequent denaturaciei online, renaturation carried out by cultivation INT buffer solution containing non-ionic detergents. Obtained online was subjected to purification using ion-exchange chromatography on cellulose CM-52 cellulose.

The optimal conditions of the individual stages receiving interferon are the following:

the destruction of cells is realized by the introduction of lysozyme in solution in a concentration of 0.1-0.2 wt.%;

destruction of DNA and RNA is carried out by incubating suspensions of interferon with an excess of DNA-ases at room temperature for at least 1 hour;

cleared sediment INT dissolved in 6M buffer solution of guanidine hydrochloride;

renaturation is carried out by dilution of the solution, INT buffer solution containing non-ionic detergents.

Outlet online as a result of application of the method in the optimal mode is not less than 700 mg ocosingo online with 1 l of culture medium, the level expt of the prototype are more productive new strain, that allows you to change the technological process and to make more appropriate enzymatic destruction instead of mechanical and obtaining insoluble forms of interferon, used for removal of DNA and RNA processing, DNA-zoé, translation online in soluble form and renaturation, replacing the three-stage cleaning online on one.

The nature and advantages of the claimed group of inventions is illustrated by the following examples.

Example 1. The preparation of recombinant plasmids.

The technology of obtaining plasmids pSS5 includes the following steps:

getting a semisynthetic gene alpha-interferon,

construction of vector plasmids pSSI,

construction of recombinant plasmids pSS5.

Getting a semisynthetic gene alpha-interferon.

For cloning of the gene alpha-interferon was used the method of direct polymerase chain reaction (PCR) to amplify a DNA fragment from total human genomic DNA encoding alpha-interferon (S. L. Emanuel, S. Pestka. //Human interferon-aA-a2, and a2 (Arg) genes in genomic DNA/The J. of Biol. Chem., V. 268., No 17., 12565- 12569, 1993).

For amplification, we used two primer: 1 and 2, the nucleotide sequence of which was sostav the AA-3' and S2-5'-CGCGGATCCTCATTCCTTACTTCTTAAACC-3'.

This and subsequent PCR reaction was performed under the following conditions: 10 mM Tis-HCl, pH 8.3, 50 mM KCI, 3 mM MgCl2, 0.2 mM of each dNTP, 1.25 units of Taq polymerase, 100 ng of DNA.

The process of amplification consisted of the following stages: heating at 94oC 3 min, 35 cycles of PCR (30 s 94oC, 30 s 56oC, 30 s 72oC) and incubation for 2 min 72oC. the resulting DNA fragment size 539 p. O. handled restrictase XbaI, BamHI, cloned into the vector pUC19 at the same restriction sites, the structure of the cloning of the fragment was confirmed by determining the nucleotide sequence. The result was obtained plasmid pUCAl size 3225 p. O. , in which the DNA of the gene alpha-interferon flanked by the restriction sites XbaI and BamHI.

Mutagenesis of the gene alpha-interferon was to replace the rare triplets in E. coli, encoding the corresponding amino acids in common triplets in E. coli, encoding the same amino acids. Mutagenesis of the DNA of the gene alpha-interferon is performed by PCR. For DNA amplification the primers used were:

S3-5'-CTAGTCTAGATGTGTGATCTGCCGCAGACCCACTCCCTGGGTA GCCGTCGTACCCTGATGCTCCTGGCACAGATGCGTCGTATCTCTCTGTTCTCC-3' and

S4-5' -CGCGGATCCTCATTCCTTGGAACGCAGGGATTCCTGCAGGTT GGTGGACAGAGAAAAAGAACGCATGACTGCACGAACAACCTC-3'

In the PCR reactions DNA plasmids pUCAl used as the same restriction sites, the structure of the cloned fragment was confirmed by determining the nucleotide sequence. The result was obtained plasmid pUCA2 size 3225 p. O., in which the DNA synthetic gene alpha-interferon flanked by the restriction sites XbaI and BamHI.

Construction of vector plasmids pSS1.

Vector plasmid pSS1 is a vector pUC19 in which a gene amp is replaced by a gene kan, remote HindIII site, and the restriction sites BamHI - SspI cloned DNA fragment containing the transcription terminator from plasmid RCC-3, which was also removed HindIII site.

Construction of vector plasmids pSS1 is carried out in four stages:

- remove the HindIII site in the plasmid RCC-3,

- obtaining plasmids pUC19T,

mutagenesis of the gene kan (removal of the HindIII site in the gene kan),

- receive vector plasmids pSS1

DNA plasmids RCC-3 treated sequentially with restriction enzyme HindIII, enzyme fragment maple and then the enzyme ligase of phage T4.

Legirovannoi DNA to transform cells of E. coli strain DH5 and plated on LB medium containing 100 μg/ml ampicillin. After incubation for 12 h at 37oC clones Tsevaot, isolated plasmid DNA and spend restriction is To BamHI-Ssp1 size 520 p. O., coding a transcription terminator rrn BT1T2from the plasmid RCC-3H in plasmid pUC19 on these sites is carried out by processing these plasmids by restriction enzymes BamHI and Ssp1, and then legirovaniem the ligase of phage T4. Legirovannoi DNA was transformed into cells of E. coli strain DH5, were sown on LB medium containing 100 μg/ml ampicillin, and incubated 12 h at 37oC. Clones were Adewale, was isolated plasmid DNA was carried out by restriction analysis. The result was obtained plasmid pUC19T size 2600 p. O. At the third stage was performed removing HindIII site of the gene kan, and the substitution of a gene on a gene amp kan remote HindIII site in the plasmid pUC19T. For this purpose, conducted three rounds of DNA amplification by PCR.

During the first round, using DNA plasmid pUC4K as a matrix, perform the amplification of DNA fragment size 757 p. O. encoding the N-end of the kan gene, using the primers:

S5-5'-AGAATGGCAAAAGATGCA-3'

24-mer rev Sequencing primer - 5'-AGCGGATAACAACACACAGGA-3'

During the second round, using DNA plasmid pUC4K as a matrix, perform the amplification of DNA fragment size 642 p. O. encoding C-end of the kan gene, using the primers:

S6-5'-AAATGCATAAACTGCCATTCT-3'

24-mer Sequencing primer - 5'-CGCCAGGGTCCCAGTCACGA-3'

During the third rumelihisari DNA fragment size 1376 p. O., encoding full gene kan remote HindIII site using the primers:

24-mer rev Sequencing primer - 5'-AGCGGATAACAACACACAGG A-3'

24-mer Sequencing primer - 5'-CGCCAGGGTCCCAGTCACGA-3'.

Next, get vector plasmid pSS1. This DNA fragment size 1376 p. O. obtained in the 3 round of amplification, is treated sequentially by enzyme restriction > PST and enzyme fragment maple, and DNA obtained plasmids pUC19T the enzymes SspI and DraI. Next, the thus treated DNA fragment encoding the gene kan and DNA plasmids pUC19T are ligated enzyme ligase of phage T4. Legirovannoi DNA to transform cells of E. coli strain DH5 and plated on LB medium containing 20 μg/ml kanamycin. After culturing for 12 hours at 37oC clones Tsevaot, isolated plasmid DNA, perform restriction analysis. The result is a vector plasmid pSS1 size 2920 p. O.

Construction of recombinant plasmids pSS5

Construction of recombinant plasmids pSS5 carried out in two stages:

construction of a DNA fragment flanking the restriction sites HindIII - XbaI encoding at the same time the promoter of phage T7, the promoter of tryptophan operon and the SD sequence (Shine-Dalgarno);

construction of recombinant OSU reaction PCR which are used as matrix E. coli DNA and the following primers:

S7 (which includes the sequence of the restriction site for the enzyme Hindlll, the sequence encoding the T7 promoter and the sequence encoding

the 5'-end tryptophanase promoter):

5'-CCCAAGCTtaatacgactcactatagggagaccctatggctgtgcaggtcgta and

S8 (which includes the sequence of the restriction site for the enzyme XbaI, SD sequence and the sequence encoding the 3'-end of the tryptophan promoter):

5'-TGCTCTAGATTATCTCCTTGAATTCCTTACGTGAACTTGCGTA-3'.

In the second stage amplificatory DNA fragment with primers S7-S8 were treated with restriction enzymes HindIII-XbaI DNA plasmids pUCA was treated with restriction enzymes XbaI-BamHI, and a DNA plasmid pSSI was treated with restriction enzymes HindIII - BamHI and the resulting DNA fragments are ligated.

Legirovannoi DNA was transformed into cells of E. coli strain DH5, were sown on LB medium containing 20 μg/ml kanamycin, and incubated 12 h at 37oC. Clones were Adewale, was isolated plasmid DNA, restriction analysis was performed and determined the nucleotide sequence.

The result was obtained recombinant plasmid pSS5 size 3604 p. O.

Example 2. The receipt States the function of cells of the strain E. coli BL21 recombinant plasmid pSS5 with subsequent selection of recombinant clones in the medium with kanamycin at 37oC and determination of the activity of alpha-interferon and measuring the amount of alpha-interferon in extracts of cells grown to an optical density 15.0-16.0 O. E. in the M9 medium containing 1% acid hydrolyzed casein (Difco), 1% glucose, 20 μg/ml kanamycin, at a temperature of 38-39oC.

The activity of alpha-interferon was determined by the method of inhibiting the cytopathic effect of vesicular stomatitis virus in diploid human fibroblasts and by ELISA.

Alpha interferon in 15-20 g cell biomass obtained from 1 l culture was depending on series 700 - 800 mg of alpha-interferon with a total activity of 1-2 x 10 ME.

Example 3. Getting online from strain E. Li SS5.

Receiving alpha-interferon was performed in 4 stages:

stage 1. Cultivation of a strain of E. coli SS5

stage 2. Isolation and purification of insoluble forms of alpha interferon

stage 3. Dissolution and resaturate interferon-alpha

stage 4. Chromatographic purification of interferon-alpha

Cultivation of strain K. coli SS5.

Grown seed mater is Ter, containing 8.0 liters of a sterile medium containing 1 x M9, 1% acid hydrolysate of casein, 1% glucose, 1 mm MgCl2, 0.1 mM CaCl220 mg/ml kanamycin. Growing in the fermentor was carried out at a temperature of 38-39oC, maintaining the pH 70,15 by automatically Podarok 40% sodium hydroxide solution. The concentration of dissolved oxygen in the range (4010)% of saturation was maintained by varying the speed of revolutions of the stirrer from 100 to 400 rpm and air flow from 0.2 to 1.5 volume of air/min

The accumulation of alpha-interferon in the form of insoluble forms - Taurus inclusions" controlled by using phase-contrast microscopy. Fermentation was completed after reaching the maximum optical density (15-16) O. E. and the emergence of Mature Taurus inclusions". After the cultivation, the biomass was separated from the medium by centrifugation at a speed of 5000-10000 rpm Biomass was packaged in polyethylene bags and frozen at minus 70oC.

Isolation and purification of insoluble forms of alpha interferon.

20 g of frozen biomass of the strain E. coli SS5 suspended in 200 ml of buffer 1 (10 mm Tris-HCl, pH 8.0, 10 mm EDTA, 0.1% Triton X100) was added 30 mg of lysozyme and incubated with stirring for 3 hours, and then raised to room temperature. To the suspension was added 5 mg Gnkazy and 5 mm MgCl2, were incubated for 1 hour at room temperature, and then added an equal volume of buffer 2 (10 mm Tris - HCl pH 8.0, 1 mm EDTA, 0.1% Triton X100), intensively mixed and centrifuged 20 min in a centrifuge, Bachman J2-21 at a speed of 9000 rpm on the rotor JA-10. The precipitate was washed successively once with buffer 2, buffer 3 (10 mm Tris-HCl pH 8.0, 1 mm EDTA, non-ionic detergent). The time of incubation in the buffer was at least 12 h at 4oC. Further leaching were buffer 2 with 3 M urea, buffer 2 without detergent Triton X100, a solution of 40% isopropanol and finally with water.

Dissolution and resaturate interferon-alpha

Obtained in the previous step, the precipitate was dissolved in 5-10 ml of 6 M guanidine hydrochloride containing 100 mm DTT, 20 mm Tris-HCl and kept at pH 8.0 and room temperature for 2 hours, Nerastvorim material was removed by centrifugation at 18 000 rpm in a centrifuge, Bachman J2-21, rotor JA-10.

Renaturation alpha-interferon was performed by slowly diluting the obtained solution in 250-500 ml of buffer 4 (20 mm Tris-HCl pH 8.0, 70 mm NaCl, a mixture of non-ionic detergents) when temporany material was removed by centrifugation at 9 000 rpm rotor JA-10 in the centrifuge, Bachman J2-21.

Chromatographic purification of alpha-interferon.

The chromatographic purification of alpha-interferon held on the cation exchange resin CM-52 (Watm). To a solution of denaturirovannogo alpha-interferon was added 1M solution of NH4(CH3COO) at pH 4.5 to a concentration of 25 mm and was applied to the resin CM-52, pre-equilibrated with buffer 5 (25 mm NH4(CH3COO), pH 4.5). Next, the resin was washed with buffer 6 (50 mm NH4(CH3COO) at pH 4.5) buffer 7 (50 mm NH4(CH3COO) at pH 5.0).

Online was suirable buffer 7, containing 0.15 mm NaCl. The output of interferon Alfa-2b was not less than 800 mg of 20 g of biomass obtained from 1 l of culture medium with specific activity of not less than 2108IU/mg.

As follows from the above examples, the claimed group of inventions allows you to receive interferon Alfa-2b with high yield in a relatively simple and reliable technology.

1. Recombinant plasmid DNA pSS5 encoding the synthesis of recombinant alpha 2b interferon person, the size 3604 p. O., comprising: Dral-Hind DNA fragment from plasmid pUC19 size 1103 p. O., Hind-Xbal DNA fragment size 226 p. O., including the sequence of the two promoters - promoter of phage T7 and tryptophan promoter and the sequence Shay is-2b interferon person, obtained by the method of DNA amplification; BamHl-Sshl the DNA fragment of the plasmid PKK 233-3 size 529 p. O. , containing the sequence AAGCTAGCTT, and the sequence rrnBT1T2; Pstl-Pstl DNA fragment size 1227 p. of plasmid pUC4K containing a sequence AAACTT, and having the nucleotide sequence shown in Fig.1.

2. The bacterial strain Escherichia coli SS5 - transformed with recombinant plasmid in p. 1 - the producer of recombinant leukocyte alpha-2b interferon person.

3. The method of producing interferon Alfa-2b human using transformed by the methods of genetic engineering of Escherichia coli, including its cultivation in a nutrient medium, freezing the biomass of strain at a temperature not above 70oC, defrost when the temperature is raised to 4oC, the destruction of the cells of the microorganism, the destruction of DNA and RNA, the concentration of the obtained product and its purification using ion-exchange chromatography on cellulose CM 52, characterized in that the cultivated strain of Escherichia coli SS5 under item 2, the destruction of the cells is carried out using lysozyme, destruction of DNA and RNA carry out the processing of DNA Asai, purification of insoluble forms of interferon occasioned precipitate in a solution of guanidine hydrochloride followed by denaturaciei interferon, after which it is subjected directly to ion-exchange chromatography.

4. The method according to p. 3, characterized in that the destruction of the cells is realized by the introduction of lysozyme in solution in a concentration of 0.1-0.2 wt.%.

5. The method according to p. 3, characterized in that the removal of DNA and RNA is carried out by incubating suspensions of interferon with an excess of DNA-ases at room temperature for at least 1 h

6. The method according to p. 3, characterized in that when the concentration of the precipitate is dissolved in 6M buffer solution of guanidine hydrochloride.

7. The method according to p. 3, characterized in that renaturation carried out by dissolving the precipitate in a buffer solution containing non-ionic detergents.

 

Same patents:

The invention relates to biotechnology and can be used for thermolabile of enterotoxin (t-enterotoxin) and toxoid Enterobacter cloacae in the production of vaccines

The invention relates to the field of biotechnology, to the processes of extraction and concentration of enzymes from the culture fluid
The invention relates to biotechnology and can be used for thermolabile of enterotoxin (LT-enterotoxin) and toxoid in the vaccine production, and can also be used as a reference strain of Citrobacter diversus
The invention relates to the field of veterinary Microbiology, in particular the production of inactivated vaccines against salmonellosis piglets

The invention relates to biotechnology and can be used for thermolabile of enterotoxin (LT enterotoxin) and toxoid Enterobacter agglomerans, in the production of vaccines

The invention relates to a biotechnological methods of sewage treatment
The invention relates to a method of processing waste palm oil production

The invention relates to biotechnology and can be used in the production of recombinant human interferon in industrial scale

The invention relates to biotechnology, particularly to the production of recombinant interferon-alpha 2 people on an industrial scale

2man, escherichia coli producing mature leukocyte interferon2man" target="_blank">

The invention relates to biotechnology, in particular genetic engineering, and represents the construction in vitro of recombinant plasmid DNA containing synthetic genes leukocyte interferon2 person tandem mutant promoters (Ptгрx2) tryptophan operon of E. coli and synthetic sites of translation initiation, contributing to the efficient biosynthesis of the polypeptide with the biological activity of interferon2 human and Escherichia coli producer of this polypeptide

The invention relates to biotechnology, in particular genetic and protein engineering

The invention relates to the production of antimicrobial proteins that are used to control fungi

The invention relates to biotechnology and Microbiology and is a method of obtaining biomass of recombinant strains of E. coli containing plasmid DNA encoding the biosynthesis of cytokines with the properties of factors, tumor necrosisand(TNF-alpha and TNF-beta), granulocyte colony-stimulating factor (G-CSF) and granulocyte-macrophage colony-stimulating factor (GM-CSF) human and bearing as a selective marker gene bla (resistance to ampicillin)
Up!