Gene grb 3-3, its variants and their application

 

(57) Abstract:

The invention relates to biotechnology and can be used to regulate cell proliferation. Gene Grb 3-3 allocate using oligonucleotide probe derived from the gene sequence Grb 2. Gene Grb 3-3 represents the isoforms of the gene Grb 2, has a deletion in the region of SH2 and can cause apoptosis of cells. The antisense sequence to gene Grb 3-3 has the ability to inhibit the called Grb 3-3 cellular effect. The invention allows to create a pharmaceutical composition for the treatment of AIDS. 3 S. p. f-crystals, 5 Il.

The present invention relates to a new gene, designated Grb 3-3, its variants and their applications, for example, in cancer gene therapy.

A variety of genes, called oncogenes and suppressor genes involved in the control of cell division. Among them, the ras genes and their products, usually referred to as p21 proteins, play a key role in cell proliferation in all eukaryotic organisms, where they were examined. It was shown that some specific modifications of these proteins are deprived of their normal control and become carcinogenic. So, a large number of human opout to disrupt cell proliferation. Therefore, understanding the precise role of these proteins p21 in cells, their functions and their characteristics is the main goal for understanding and approach to therapy carcinogenesis.

Various factors involved in pathways ras-dependent signaling were identified. Among them appears the gene Grb-2, which encodes a protein 23-25 kDa, with the structure of the SH3-SH2-SH3 /Lowensteinetal, Cell 70 /1992/ 431; Matuoka et al., PNAS 89 /1992/ 9015/. Possible gene product Grb 2 interacts with proteins phosphorylated on tyrosine in its SH2 region and factor exchange of GDP class SOS in its SH3 region /Egah et al., Nature 363/ 1993/ 45/. Thus, it is one of the components of the transforming activity of the product of the ras gene. The present invention stems from the discovery, cloning and characterization of the isoforms of the gene Grb 2, designated Grb 3-3 with a deletion in the region of SH2. This gene is identified in adult tissues: the corresponding mRNA is under a single band of 1.5 kb and translates into a protein of 19 kDa. Because of the presence of deletions in the region SH2 gene product Grb 3-3 cannot interact with phosphorylated at tyrosine protein /phosphorylated EGF receptor/, but it retains the ability to interact with regions rich in Proline, protein S gene product Grb 2. Transfer of this gene in vivo or its variants, including antisense sequences, allows, therefore, to inhibit the proliferation, differentiation and/or cell death.

So, the first object of the invention relates to nucleotide sequences comprising all or part of the gene Grb 3-3,the sequence SEQ ID No. 1 (sequence 1-9 listed at the end of the description).

Another object of the invention relates to nucleotide sequences derived from SEQ ID No. 1 and is able to inhibit at least partially the expression of protein Grb 2 or Grb 3-3. In particular, the invention relates to antimuslim sequences, the expression of which in the target cell allows you to control the transcription of cellular mRNAs. Such sequences can be, for example, transcribed in the target cell in RNA, complementary cellular mRNA Grb 2 or Grb 3-3, and it can block their translation into protein, according to the method described in European patent EP 140 308. Such sequences may be composed wholly or partially of the nucleotide sequence of SEQ ID No. 1, transcribed in the opposite orientation.

As mentioned above, Grb 2 is crownie on tyrosine, and in two areas SH3 factors of currency SOS family. Grb 3-3, lost its ability to associate with proteins phosphorylated on tyrosine may, therefore, form the complex with the protein SOS. Therefore, Grb 3-3 may hinder the formation of the complex Grb 2-SOS on the receptors autophosphorylating growth factors or associated proteins are also phosphorylated on tyrosine, such as SHC or IRSI. able to block this complexation. He is able to block the mitogenic pathway and induce cell death. The applicant has indeed shown that the protein Grb 3-3 exerts its effect during certain physiological processes, such as maturation of the thymus in rats. The applicant also showed that Grb 3-3 able to cause cell death apoptosis in various cell types. These are very valuable properties can be proved /i/ by injection of recombinant protein in fibroblasts and ZTZ /ii/ by transferring sequence that encodes a Grb 3-3, cells ZTZ /example 4/. Therefore, Grb 3-3 able to induce cell death of living cells, such as immortalized /immortal/, cancer or germ cells. As shown in the examples, Grb 2 is able to counteract the action of OK with the HIV virus, allowed to show that the massive production of virus observed 7 days after infection, correlates with overexpression of mRNA Grb 3-3 infected cells /example 5/. This experiment shows that removing or counteracting cellular effects Grb 3-3 can also allow you to save the life of infected cells, namely infected with VIH, and also allow the T4 lymphocytes continue to perform the role of immune protection. In this regard, the invention also relates to the use of compounds able to eliminate or inhibit at least partially the cellular effects Grb 3-3, for the preparation of pharmaceutical compositions intended for the treatment of AIDS. More specifically compounds used can be:

genetic antisense sequence such as defined above,

- specific oligonucleotide Grb 3-3, modified or not for better stability or bioavailability /phosphorothioate, inserts, etc./. Preferably we are talking about the oligonucleotides containing the localized coding sequence between the N-terminal SH3 region and residual SH2 region.

- any sequence, the transfer of which in the host cell causes the ISU is as such, for example, after injection into a person or an animal to induce protection or to treat cancer. In particular, they can be injected in the form of naked DNA by the method described in the application WO 90/11092/. They can also be introduced in the form of complexes, for example, DEAE-dextran /Pagano et al., J. Virol.I /1967/ 891/ nuclear proteins /Kaheda et al., Science 243 /1989/ 375/, lipids /Felgner et al., PNAS 84 /1987/ 7413/, in the form of liposomes /Fraley et al., J. Biol.Chem.255 /1980/ 10431/ etc.

Preferably the nucleotide sequence according to the invention are part of the vector. The use of such a vector allows in fact to improve the introduction of nucleic acid in the treated cell, and to increase its stability in these cells, which allows to obtain a prolonged therapeutic effect. In addition, you can enter multiple nucleic acid sequences in the same vector, which also increases the effectiveness of the treatment.

Used the vector can be of different origin, if only he was capable of transforming animal cells, preferably human tumor cells. In a preferred embodiment of the invention using a viral vector, which can be selected cf is and ospowiki etc. Vectors derived from adenoviruses, retroviruses, or AAV, comprising heterologous nucleic acid sequences, have been described in the literature [Akli et al., Nature Genetics 3 /1993/ 224; Stratford-Perricandet et al., Huwan Gene Therapy I /1990/ 241; EP 185573, Levrero et.al., Gene 101 /1991/ 195; Le Gal la Salla et al., Science 259 /1993/ 988; Roemer et Friedmann, Eur.J.Biochem.208 /1992/ 211; Dobson et al., Neuron 5 /1990/ 353; Chiocca et al., NewBiol. 2 /1990/ 739; Miyanohara et al., New Biol. 4 /1992/ 238; WO 91 /18088].

Therefore, the present invention also relates to any recombinant virus containing inserted into its genome a nucleotide sequence such as described above.

It is advisable that the recombinant virus according to the invention was defective virus. The term "defective virus" means a virus is unable to replicate in the target cell. Usually, therefore, the genome of the defective viruses used in the present invention, deprived of at least sequences necessary for replication of the indicated virus in the infected cell. These areas or can be removed /completely or partly/ or made non-functional, or substituted by other sequences and, for example, a nucleic acid of the invention. Preferably, the defective virus nevertheless retained pogodno to use nucleic acid sequences of the invention in the form of inclusion in the adenovirus, in AAV or defective recombinant retrovirus.

As adenoviruses, there are different serotypes, structure and properties of which vary little, but which are not pathogenic for humans, and it is not suppressing the immune system. In addition, these viruses are not integrated in the genome of the cells that they infect, and can include large fragments of exogenous DNA. Among the various serotypes are preferably used in the present invention, the adenovirus type 2 or 5 /Ad2 or Ad5/. In the case of adenovirus Ad5 sequences necessary for replication, are the field of EIA or EIB.

Recombinant defective viruses of the invention can be obtained by homologous recombination between defective virus and a plasmid carrying, along with other nucleotide sequence such as defined above /Levrero et al. , Gene 101 /1991/ 195; Graham, EMBO J. 3/12/ /1984/ 2917/. Homologous recombination occurs after ko-transfection of the indicated virus and plasmid into an appropriate cell line. Used cell line should be preferably /i/ transforming these elements and (ii) to keep the sequence being complementary to a portion of the genome detectnow the and line, used to obtain recombinant defective adenovirus, you can draw a line of human embryonic kidney 293/ Crahamet al., J. Gel.Virol. 36/1977/ 59/, which contains, for example, integrated into its genome, the left part of the genome of adenovirus Ad5 /12%/. As an example, the lines used for production of recombinant defective retroviruses that can result in a line CRIP /Danos et Mulligan, PNAS85 /1988/ 6460/.

Then multiply the viruses are harvested and purified according to the classical methods of molecular biology.

The object of the present invention is also a pharmaceutical composition comprising at least one recombinant virus or a nucleotide sequence such as defined above.

The pharmaceutical compositions of the invention can be formulated according to the route of administration for local introduction of oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, etc.

Preferably the pharmaceutical composition containing pharmaceutically acceptable carriers for formulations for injection, not necessarily directly in treating the tumor. In particular, can result in electrolyte solutions /mononitrite, dinati dry composition, for example, lyophilized, which when added depending on the situation of sterilized water or physiological serum allow to obtain solutions for injection.

The doses of nucleic acids /sequences or vectors/ used to introduce, can be adapted depending on various parameters, for example, depending on the method of administration, the specific pathology, acting nucleic acid, or even from the desired duration of treatment. Usually, as for the recombinant viruses according to the invention, formulated and administered in the form of a dose containing between 104and 1014pfu/ml, preferably 106- 1010pfu/ml of the Term pfu /"plaque-forming unit/ matches infecting power solution virus and is determined by infecting appropriate cell culture and usually measured after 48 hours by the number of plaques of infected cells. Methods for determination of titer pfu of virus solution is well documented in the literature.

Such pharmaceutical compositions can be used for humans for the treatment and/or prevention of cancer. In particular, the products of the invention can modulate activity of ras proteins, they are on maruosa activity through functional p21-GAP interaction. Indeed, many cancers are associated with the presence of oncogenic ras proteins. Among cancers, most often containing mutated ras genes can lead, for example, adenocarcinoma of the pancreas, 90% of which have mutated Ki-ras oncogene in the twelfth codon /Almoguera et coll., Cell 53/ 1988/ 549/ adenocarcinoma of the colon and cancers of the thyroid gland /50%/ or lung carcinoma and myeloid leukemia /30%/, Bos, J. L. Cancer Res. 49 /1989/ 4682/. More typically, the compositions according to the invention can be used to treat any type of pathologies in which there is abnormal cell proliferation by induction of apoptosis, as well as any pathologies characterized by cell death apoptosis /AIDS, Huntington's chorea, Parkinson/, with compounds that block the effects of Grb 3-3 /for example, antisense/.

The present invention will be more fully described with the following examples which should be construed as illustrating, but not limiting.

Captions for figures:

Fig. 1 : Schematic illustration of the structural areas-Grb 2 and Grb 3-3.

Fig. 2: examination of the relationship Grb 3-3 and receptor EFG /Fig.2,a/ and peptides rich in Proline /Fig.2/.

Fig. 3: Effect of Grb 3 and cells, caused Grb 3-3 on fibroblasts ZTZ.

Fig. 5: Detection of the expression of Grb 3-3 in cells infected with the HIV virus.

Conventional molecular biology techniques.

Techniques commonly used in molecular biology, such as preparative extraction of plasmid DNA, centrifugation of plasmid DNA in the gradient of cesium chloride, electrophoresis in agarose and acrylamide gels, purification of DNA fragments electrically isolated, extraction of proteins with phenol or phenol-chloroform, precipitation of DNA in saline medium with ethanol or isopropanol, transformation Esaherichia coli, etc. well known to specialists in this field and are described in detail in the literature /T. Maniatis et al., "Molecular Cloning, Laboratory Manual", Cold Spring Harbor Laboratory Cold Spring Harbor, N. Y. , 1982; Ausubel F. M. et al. /eds/, "Current Protocols in Molecular Biology", John Wiley and Sons, New York, 1987/.

Plasmids type pBR322, pLC and phages series M13 have a commercial origin /Bethesda Research Laboratories/.

For ligating the DNA fragments can be separated according to their size by electrophoresis on agarose or acrylamide gels, extracted with phenol or with a mixture of phenol/chloroform, precipitated with ethanol, and then incubated in the presence of DNA ligase of phage T4 /Biolabs/ in accordance with the recommendations li /Biolabs/ description manufacturer. The destruction of the protruding 3'- ends is carried out in the presence of the DNA polymerase of phage T4 /Biolabs/ used in accordance with manufacturer's recommendations. Destruction /destruction/ protruding 5'- ends of the conducting careful treatment with nuclease I.

Directed in vitro mutagenesis with synthetic oligonucleotides can be carried out in accordance with the method developed by Taylor et al. /Nucleic Acids Res. 13 /1985/ 8749-8764/ using a kit manufactured by Amersham.

Enzymatic amplification of DNA fragments by a technique called PCR /Polymerase chain reaction, Saiki R. K. et al., Science 230 /1985/ 1350-1354; Mullis K. B. et Faloona F. A. Meth.Ensym 155 /1987/ 335-350/, can be carried out using a DNA thermal cycler" /Perkin Elmer Cetus/ described by the manufacturer.

Inspection of the nucleotide sequences can be carried out according to the method developed by Sanger et al. /Proc. Natl.Acad. Sci.USA, 74/1977/ 5463-5467/ using set manufactured by Amersham.

Examples

1. The selection gene Crb 3-3

Gene emit screening strips of human DNA using a probe derived from the gene sequence Grb 2.

500000 recombinant phage Lambda gt11 carrying DNA fragments isolated from a Bank human placenta /Clontech/ were skanirovaniya protein Grb 2 and has the following sequence:

ATGGAAGCCATCGCCAAATATGAC (SEQ ID N 2)

Thus was identified 10 positive clones. Box of 10 clones was isolated as EcoRI fragments cloned in the plasmid M13 p18 and sequenced. Among these 10 clones 9 is inserted, the identical sequence of Grb 2. One has an insert size of less than Grb gene 2, due to deletions in the region SH2 /Fig.1/. Analysis of the rest of the sequence showed complete identity with the corresponding regions of Grb 2, including non-coding region 5' and 3'. The phase of the open reading this clone encodes a protein of 177 amino acids /SEQ ID No. 1/ containing 2 region SH3 on the edges unfinished SH2 region /Fig.1/. Amino acids that are missing in the region SH2 /the remains of 60-100 protein Grb 2/ correspond to the residues involved in the binding of Grb 2 with peptides containing the phosphorylated tyrosines.

2. The activity of the binding protein Grb 3-3

As mentioned above, protein Grb 2 is a mediator of the interaction between the phosphorylated receptors of growth factors and factors SOS. This example shows that the protein Grb 3-3 cannot interact with phosphorylated by the EGF receptor, but it retains its ability to interact with the peptide enriched in Proline, the origin Taiwan is using fusion proteins to Glutathione-S-Transferase /GST/, biotinylated. This type of merge allows you to quickly and effectively clean recombinant products. For this sequence of the invention have been shown in E. coli strain TGI in the form of fusion proteins with GST according to the method described by Smith et Johnson /Gene 67 /1988/ 31/. In short, genes Grb 2 and Grb 3-snachala been modified by introduction from both sides of the start and stop codons of the BamHI site. For this phase of the open reading these genes were amplified by PCR using the following oligonucleotides:

Oligonucleotide I /5'/ /SEQ ID No. 3/:

GAATTCGGATCCATGGAAGCCATCGCCAAATATGACTTC

Oligonucleotide II /3'/ /SEQ ID # 4/:

GAATTCGGATCCTTAGACGTTCCGGTTCACGGGGGTGAC

The underlined part corresponds to the created BamHI site following or preceding the start and stop codons.

Amplificatoare thus genes then clone in the form of a BamHI fragments into the vector pGEX 2T /Pharmacia/, lineatopennis the same enzyme, 3' and the phase of cDNA that encodes a GST. The resulting vectors are then used to transform E. coli strain TCI. Transformed thus the cells were pre-cultured overnight at 37oC, diluted 1/10 in LB medium, add IPTG to induce the expression /2 hours 25oC/, then cultured for 21 hours at about 25oC. After 3 washes with Tris-HCl pH 7.4 proteins elute in the presence of buffer Tris-HCl pH 7,7 containing an excess of GST. The supernatant is collected and centrifuged.

The same Protocol is used for mutant Grb 2, in which the glycine 203 is replaced by arginine /Grb 2G203R/ and mutant Grb3-3, in which the glycine 162 is replaced by arginine /Grb 3-3G162R/. Mutant Grb 2G203R was described as having no activity in the test for the re-initiation of DNA synthesis /Lowenstein et al., above/. Mutant Grb 3-3G162R carries the same mutation in the same position and, therefore, must also be inactive.

These mutants were obtained by mutagenesis using PCR genes Grb 2 and Grb 3-3 using a 5' oligonucleotide 1, described above, and a 3' oligonucleotide III below, in which the mutated codon is underlined:

Oligonucleotide III /3'/ /SEQ ID No. 5/:

GACGTTCCGGTTCACGGGGGTGACATAATTGCGGGGAAACATGCGGGTC

Amplificatoare thus the fragments are then elute, reamplification PCR with oligonucleotides I and II, then clone into the vector pGEX 2T. Then get the mutants, as described above.

Then proteins fused with GST /GST-Grb2, GST-Grb3-3, GST-Grb3-3,GI62R and GST/, biotinylated by classical methods known in the art (See. General molecular biology techniques, as well as Mayer et al., PNAS 88/ 1991/ 627/, and use in cachestoreprivate of hSOSI /2.2/.

2.1. The binding of phosphorylated by the EGF receptor

Protocol: used EGF receptor is purified from A431 cells by immobilization on WGA-sepharose according to the method described Duchesne et al. /Science 259 /1993/ 525/. First 2 µg stimulate this receptor 1 μm EGF for 10 minutes at 22oC, then incubated with or without cold APR /10 μm/ in the presence of 2.5 mm MnCl2in the buffer HNTC /20 mm Hepes, 150 mm NaCl, 0.1% Triton, 10% glycerol, pH 7.5/ 4oC for 2 minutes. Then stop the phosphorylation of the receptor by the addition of a buffer decomposition. Then the sample is placed on the gel SDS-PAGE 4-20%, then transferred to membranes from polyvinylidenedifluoride /PVDF/. Spots are then incubated in the presence of various merged biotinylated GST /2 ág/ml/, then show using streptavidin connected with the alkaline phosphatase /Promega/. The EGF receptor is also subjected to Western blot turns in the presence of antibodies anti-phosphotyrosine /anti-RU/ to confirm that the receptor is already phosphorylated.

Results: the results obtained are shown in Fig.2,a. They show, as expected, that the protein Grb 2 interacts with the EGF receptor only in the phosphorylated form. Then they show that the protein Grb 3-3 is not associated with the EGF receptor, as is Qty: synthesize two peptide enriched with Proline:

Peptide hSOSI: GTPEVPVPPPVPPRRRPESA: This peptide corresponds to residues 1143-1162 protein hSOSI/Li et.al., Nature 363 /1993/ 83/ responsible for the interaction between Grb 2 and hSOSI /SEQ ID No. 6/.

Peptide 3BPI: PPPLPPLV: This peptide is derived from protein 3BPI, which is known to effectively bind the field SH3 Abl and Src /Cicchelli et al. , Science 257 /1992/ 803/ /SEQ ID No. 7/.

Each of these peptides /1 Μl, 10 mg/ml/ immobilised on the membrane of nitrocellulose. Then the membrane is incubated in blocking buffer /20 mm Tris pH of 7.6, 150 mm NaCl, 0.1% tween, 3% serum albumin/. Then the membrane is incubated overnight at 4oC in the presence of various merged biotinylated GST /4 μg/ml/, then show using streptavidin linked with alkaline phosphatase /Promeoa/.

Results: the results obtained are shown in Fig.2,century, They show that Grb 3-3, and Grb 2, capable of binding the peptide hSOSI. They also show that this interaction is specific, because there is no any binding peptide 3BPI. In addition, the results also show that the mutant Grb 3-3C162R not able to bind the peptide hSOSI, which confirms the importance of this residue and the functional role of this interaction.

3. The act is otherwise functional effect.

The activity of the protein Grb 3-3 was investigated by determining its ability to cooperate with ras for TRANS-activation of the promoter with the response to ras (RRE), and the controlling expression of a gene-reporter.

The used Protocol is described, for example, Schweighofter et al. Science 256 /1992/ 825. In short, the used promoter is a synthetic promoter consisting of the promoter of the gene thymidine kanazi mouse and 4 elements PEAL, recurring, deriving from amplifier polimi /Wasylyk et al, EMBO J. 7 /1988/ 2475/: promoter Py-TK. This promoter controls the expression of a gene-reporter, in the case of bacterial gene chloramphenicol acetyl transferase /CAT/: the vector Py-TK-CAT. Vectors for the expression of the tested genes were constructed by inserting these genes in the form of a BamHI fragments into the BglII site of plasmid pSV2. This website allows you to place genes under the control of the early promoter of SV40.

Cells EP22 with 40% confluence were infected with 0.5 μg of the vector Py-TK-CAT, one /Py/ or in the presence of the expression vector carrying under the control of the early promoter of SV40 gene: Grb 2, 2 µg, Grb 3-3, 2 μg, Grb 2/C203P/ 2 mg, Grb 3-3/C162P/ 2 μg, or Grb 3-32 mcg + Grb 2, 2 µg. In each case, establish the total amount of DNA with 5 µg of the expression vector without insert. Spend infection in prisutstvovati calf. Then determine the activity of the CAT /the transactivation PPE/, as described Wasylyk et al., /PNAS85 /1988/ 7952/.

The results obtained are shown in Fig. 3. They clearly show that the expression of the protein Grb 3-3 prevents the effects of activation of the growth factor receptor. They also show that excess Grb 2 counteracts the effects of Grb 3-3 on the response of the growth factor.

4. Grb 3-3 causes apoptosis of cells.

This example shows the direct participation of Grb 3-3 in cell apoptosis. This property makes it particularly suitable for use for the treatment of pathologies caused by cell proliferation /cancers, restenosis and so on/.

The occurrence of apoptosis using Grb 3-3 shows /i/ by injection of recombinant protein in fibroblast ZTZ and (ii) by transfer sequence that encodes a Grb 3-3, cells ZTZ.

/i/ Injection of recombinant protein

Recombinant protein Grb 3-3 was obtained in the form of a fused protein with GST according to the Protocol described in example 2. Fused protein is then treated with thrombin /a 0.25%, Sigma/ to separate part of the GST, then purified by ion exchange chromatography on a column of Q. Then the fractions containing the recombinant protein concentrate using microconcentrators /1-3 mg/ml in cultured cells ZTZ with automatic microinjector Eppendorf. The cells are then incubated at 34oC and photographed at regular intervals to track morphological transformations. The results show that after 5 hours after injection Grb 3-3 the main part of the cells die, whereas injection under the same conditions Grb 2 or mutant Grb 3-3/C162R/ has no effect on cell survival.

/ii/ Transfer sequence that encodes a recombinant protein.

Construct a plasmid containing the sequence SEQ ID No. 1 encoding the protein Grb 3-3 under the control of the early promoter of SV40 virus.

The fibroblast ZTZ with 40% confluence were infected in the presence of lipocerin /Transfectam/ / IBF-Sepracor/ 0.5 or 2 mg of this plasmid expression. 48 hours after infection, 50% of these cells suspended in the medium, and the remaining cells adhering to the walls, have a very strong morphological changes /Fig.4/. Analysis by electrophoresis on agarose gel showed, moreover, that the cells have design fragmentation oligonucleosomal DNA, characteristic of dead cells /Fig.4/. In contrast, cells infected under the same conditions the plasmid expression Grb 2, Grb 3-3/C162R/ or Grb 2 /C203R/ retain normal morphology, are always alive and not ASS="ptx2">

These results clearly show, therefore, that the Grb 3-3 represent gene-killer that can cause apoptosis of cells. As mentioned above, this feature makes the application particularly advantageous for the treatment of pathologies resulting from cell proliferation, such as cancers, restenosis, etc.

5. Confirmation of expression of Grb 3-3 in lymphocytes infected with the HIV virus.

This example shows that during the cycle of infection of T lymphocytes by HIV virus, the relative amount of mRNA Grb 2 and Grb 3-3 modified and that the RNA Grb 3-3 sverhpredelna at the moment an abundant production of virus and cell death.

Peripheral blood lymphocytes infected by a virus HIV-1 in two dilutions /1/10 and 1 / 100th of/ for 1, 4 or 7 days. Then analyze mRNA cells by inverse PCR using oligonucleotides specific for Grb 2 and Grb 3-3 to determine the relative proportion of information Grb mRNA 2 and Grb 3-3. Used oligonucleotides specific for Grb3-3, are as follows:

Oligonucleotide IV /3'/:

ATGTTCCAAACGGATGTGGTTT (SEQ ID NO. 8)

Oligonucleotide V /5'/:

ATAGAAATGAAACCACATCCGTTT (SEQ ID NO. 9)

The results obtained are shown in Fig. 5. They clearly show that after 7 days of th the basics of the virus, day 7 also corresponds to the period for which there is abundant production of the virus.

1. The nucleotide sequence of Grb 3-3 encoding a protein that can inhibit the cellular effects of the gene product Grb 2, and containing the nucleotide sequence of SEQ ID No. 1.

2. Nucleotide sequence which is antisense to the sequence SEQ ID No. 1 and capable of at least partially inhibiting the expression of protein Grb 2 or the expression of a protein Grb 3-3.

3. Pharmaceutical agent for the treatment of AIDS, characterized in that it comprises the nucleotide sequence defined in paragraph 2.

 

Same patents:

The invention relates to biotechnology and related analogue of erythropoietin

The invention relates to the field of medicine and biotechnology, namely to new proteins, which factors in the growth and development of megakaryocytes (MGDFs; mostly labeled Mp1-ligands), the biological activity of which is to stimulate the growth of megakaryocytes and their differentiation or maturation, which ultimately leads to the formation of platelets

family" target="_blank">

The invention relates to the field of molecular biology and concerns a new factor in the growth/differentiation of ТGЕ-collection and coding of its DNA sequences

Therapeutic protein // 2155810
The invention relates to a new protein - human stem cell factor (FGC, SCP), DNA sequences coding for this protein, its use in therapy, in particular for in vitro fertilization, as well as to pharmaceutical compositions containing such protein

The invention relates to the field of medicine

The invention relates to biotechnology, genetic engineering

The invention relates to biotechnology and can be used for selective destruction of cells infected with hepatitis C virus (HCV) or infectious RNA

The invention relates to medicine and can be used for selective destruction of cells infected with RNA of hepatitis C virus(HCV)

The invention relates to medicine, namely to the use of inhibitors of proliferation of stem cells

The invention relates to medicine, namely to immunology and immunology, and concerns the problem of vaccination against tumor cells and vaccine therapy of cancer

The invention relates to medicine, in particular to the use of suppressor genes in malignant tumors, in combination with a DNA damaging agent or factor, with the aim of killing cells, in particular cells of malignant tumors

The invention relates to a vaccine for combating infections caused by In

FIELD: biotechnology, veterinary science.

SUBSTANCE: invention relates to therapeutic vector used in therapy of infectious diseases in cats that comprises at least one foreign nucleic acid each of that (a) encodes protein taken among the group consisting of feline protein CD28 represented in SEQ ID NO:8 or its immunogenic moiety; feline protein CD80 represented in SEQ ID NO:2 or 3, or its immunogenic moiety; feline protein CD86 represented in SEQ ID NO:6 or its immunogenic moiety, or feline protein CTLA-4 represented in SEQ ID NO:10 or its immunogenic moiety; and (b) nucleic acid that is able to be expressed in insertion of vector in the corresponding host. Indicated therapeutic vector is used in effective dose as component of vaccine against infectious diseases in cats for their immunization and in methods for enhancement or inhibition of immune response in cats and reducing or eradication of tumor in cats. Invention provides stimulating the activation and proliferation of T cells and to enhance effectiveness of control of infectious diseases in cats.

EFFECT: valuable biological properties of recombinant virus.

41 cl, 13 dwg

FIELD: molecular biology.

SUBSTANCE: the suggested innovation deals with the fact that nucleic acids should be isolated directly out of the sample without pipetting stage but with the help of interconnected reservoirs being prepared beforehand. The above-mentioned vessels should be applied either separately or being interconnected according to standard microtitrating format. The sample should be mixed with a lyzing buffer and nucleic acids are bound with matrix in closed system including, at least, two interconnected reservoirs. Forced movement of sample's mixture and buffer back and forth from one reservoir into another one for several times through narrow passage provides their thorough intermixing. The method provides quick and safe isolation of nucleic acids.

EFFECT: higher efficiency.

44 cl, 4 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: method involves applying a composition comprising liposomes having gene structures encoding growth factors. The composition is administered for making injections into wound and impregnating materials for covering or closing wounds with the materials. Advanced bandage has coverage material and liposomes. Introducing liposome gene structures directly into wounds contributes to better healing results.

EFFECT: wide range of functional applications; enhanced treatment effectiveness and safety.

31 cl, 13 dwg, 4 tbl

Up!