Recombinant plasmid dna ptls, containing the gene for single-chain antibodies against tick-borne encephalitis virus, and bacterial strain escherichia coli producing single-chain antibodies against tick-borne encephalitis virus

 

(57) Abstract:

The invention relates to biotechnology, genetic and protein engineering. Obtaining single-chain antibodies against tick-borne encephalitis virus is carried out by insertion in the plasmid vector GEM1 DNA fragment encoding the leader peptide of pectinase In (lB) Erwinia carotovora, and genes of variable domains µa EV against tick-borne encephalitis virus within a single DNA sequence. The constructed recombinant plasmid DNA TLS provides the expression of single-chain antibodies against tick-borne encephalitis virus in the cells of the bacteria E. coli. The obtained chimeric antibodies retain the conformation of the variable domain of the original ICA and able to interact with the E2 domain of the surface glycoprotein of tick-borne encephalitis virus. Proposed recombinant bacterial strain E. coli B-716 producing single-chain antibodies against tick-borne encephalitis virus, which can be used to create a new generation medications against tick-borne encephalitis virus. 2 c.p. f-crystals, 3 ill.

The invention relates to biotechnology, genetic and protein engineering, specifically to obtain single-chain antibodies against the virus closelog agendum infectious agent, causing serious injury to the nervous system. The incidence of tick-borne encephalitis is growing, and the only specific and fairly reliable remedy is donor encephalitis gamma-globulin. An acute shortage of this drug, its high price and possible biological risk associated with its use necessitates the search for alternative therapeutic agents. The use of monoclonal antibodies for prophylaxis and therapy of tick-borne encephalitis remains extremely problematic. So it is especially important to create an artificial antibodies for use as pharmaceuticals.

In recent years published a number of works devoted to the creation of artificial antibodies, which is believed to be cheaper, safer and more effective than immunoglobulins isolated from the blood of immunized animals and people. Of great interest are single-chain antibodies, which consist of variable domains of heavy and light chains of immunoglobulins, United by a flexible peptide linker. The small size of single-chain antibodies facilitate their penetration in tissues and excretion of [1, 2]. In addition, no is ivati on their use in medical practice, in particular, to combat viral diseases.

The obtaining of single-chain antibodies to various antigens, including receptors of cancer cells [3, 4], ferritin [5] , rhinovirus [6]. The obtained single-stranded antibodies to the virus Scottish encephalomyelitis of sheep (LIV), which belongs to the family Flaviviridae, which have neutralizing activity [7].

In the merger of mouse myeloma P3/X63 Ag8.653 with mouse splenocytes immunized with purified E protein of TBE virus derived murine monoclonal antibodies hybridoma cell line E6B (µa E6B) that recognize group-specific epitope of the virus complex EC, block hemagglutinin activity of TBE virus and possess neutralizing activity [8] . Described antibodies interact with the domain of the E2 glycoprotein E, which plays a major role in the formation of neutralizing and protective antibodies. These antibodies obtained antiidiotypic antibodies that recognize the idiotype E6B. It was also shown that ICA E6B recognize the area glycoprotein E that interacts with the cellular receptor [9]. However, there is no analogues of recombinant single-chain antibodies by DNA containing the genes for the variable domains of the ICA E6B against tick-borne encephalitis virus, and bacterial strain of the bacteria Escherichia coli - producer single-chain antibodies against tick-borne encephalitis virus.

This goal is achieved by constructing plasmids pTLS by insertion in the plasmid vector pGEM1 DNA fragment encoding the leader peptide pectolyase B (pelB) Erwinia carotovora, and genes of variable domains µa E6B against tick-borne encephalitis virus within a single DNA sequence. The resulting plasmid pTLS consists of:

genes variable domains µa E6B, United oligonucleotide connector, size 742 p. O.,

- DNA fragment, encoding 22.to. leader peptide Erwinia carotovora pelB and regulatory elements of the gene pelB, 220 p. O.,

- plasmid vector pGEM1, provide efficient transcription of the gene obtained single-stranded antibodies and expression.

The genes of the variable domains µa E6B were derived from mRNA isolated from cells hybridoma E6B [8], in the system of reverse transcription - polymerase chain reaction method [10] using as primers for Vh 5'TGAGGAGACGGTGACCGTGGTCCCTTGGCCCC and Vk for 5'GTTAGATCTCCAGCTTGGTCCC, complementary to the 3'-end of mRNA, the code is G and Vk back 5'GACATTGAGCTCACCCAGTCTCCA, complementary to the 5'-end of mRNA encoding the variable domains of the heavy and light chains of mouse IgG, respectively. Connector, encoding the linker peptide (Gly4Ser)3, was obtained by annealing the oligonucleotides: 5'GTCACCGTCTCCTCAGGTGGCGGTGGCTCGGGCGGTGGT, 5'GGGTCGGGTGGCGGCGGATCTGACATTGAGCT, 5'GAGCCACCGCCACCTGAGGAGACG, 5'CAATGTCAGATCCGCCGCCACCCGACCCACCACCGCC according to [10] and sewed together using ligase of phage T4 with 3'-end of the gene variable domain of the heavy chain on the BstEII restriction site and the 5'-end of the gene variable domain of the light chain by SacI site. The DNA fragment encoding the leader peptide Erwinia carotovora pelB was obtained by polymerase chain reaction using as a template the plasmid pET(rF11) [5] and oligonucleotide primers: 5'- CCGCTCGAGCAGCTGCACCTGGGC, 5'-GGAATTCGACCACACTCCCCTTG providing amplication fragment restriction sites EcoRI and XhoI.

As a plasmid vector, providing the insert fragment encoding the leader peptide and the gene single-stranded antibodies and its expression under the control of the late promoter and a T7 DNA polymerase, used plasmid pGEM1 (Promega) treated restrictase EcoRI and HindIII.

To obtain strain-producer of single-chain antibodies competent cells of Escherichia coli BL21(DE3) (F-, ompT, hsd Sb(rb

Morphological features. Cells small thickened rod-shaped, gram-negative, risperadone.

Cultural characteristics. Cells grow well on simple nutrient media. During growth on agar "Difko" - colonies are round, smooth, adpressed, muddy, shiny grey, smooth edge. With the growth in liquid medium (minimal medium with glucose or LB broth) intensive form a smooth suspension. Cells grow at a temperature of 37oC at the optimum pH from 6.8 to 7.0.

Resistance to antibiotics. Cells are resistant to ampicillin (100 μg/ml), due to the presence of plasmids.

The E. coli strain BL21(DE3)/pTLS provides induced IPTG synthesis of single-chain antibodies with the level of expression of about 10% of the total cellular protein.

The resulting strain deposited at the Institute of culture Collections of microorganisms SRC VB "Vector" number In-716.

The invention consists in the fact that gene expression of single-chain antibodies embed it with a fragment encoding a leader peptide pelB, EcoRI and HindIII sites in plasmid pGEM1. The result is the target plasmid pTLS, containing the gene for single-chain antibodies against tick-borne encephalitis virus.

Thus, for the first time obtained plasmid DNA and producing strains, providing the expression of single-chain antibodies against tick-borne encephalitis virus in E. coli bacterial cells.

The invention is illustrated by the following figures:

Fig. 1. The General scheme of the structural organization of the plasmid pTLS.

Vh and Vl genes of the heavy and light chains of immunoglobulin, L - connector, pelB - DNA fragment, encoding a leader peptide, T7 - promoter of phage T7, Apr- gene resistance to ampicillin; are some restriction enzymes cut sites.

Fig. 2. Electrophoregram lysates of E. coli cells.

A. The Coomassie blue staining of R-250. 1 - induced culture of E. coli cells BL21(DE3)/pTLS, 2 - induced culture of E. coli cells BL21(DE3)/pGEM1.

B. The Western blot turns with antiadiotipiceskih antibodies to MCA Fig. 3. Immunological analysis of single-chain antibodies.

A. Interaction polyclonal antiidiotypic antibodies to MCA E6B and cell lysates in enzyme-linked immunosorbent assay. Solid phase barbirolli cell lysates BL21(DE3)/pTLS (1, 3) and BL21(DE3)/pGEM1 (2, 4) in dilutions. A 1/100 dilution corresponds to 10 μl of cell culture. Lines 1, 2 - interaction with antiadiotipiceskih antibodies, lines 3, 4 - interaction with normal rabbit serum was used for dilution of serum 1/200 and the depletion of their lysate of strain BL21(DE3) in dilution 1/200).

B. Interaction of single-chain antibodies from cell lysates with recombinant protein E. solid phase was applied for sorption 200 ng E protein, lysates of cells BL21(DE3)/pTLS (1, 3) and BL21(DE3)/pGEM1 (2, 4) was applied in dilutions and showed antiadiotipiceskih antibodies (1, 2) and normal rabbit serum (3, 4). Dilution of sera and their depletion as in 3A.

C. Competitive binding of single-chain antibodies from cell lysates and MCA E6B with recombinant protein E. solid phase was applied for sorption 200 ng protein E. Lysates of cells BL21(DE3)/pTLS (1) and BL21(DE3)/pGEM1(2) was applied in dilutions competing µa E6B used in breeding 1/500000.

For best Poneman is struisbaai plasmids pTLS.

1.1. The Assembly of the gene single-stranded antibodies in a single DNA sequence.

As a source of genes for the heavy and light chains µa E6B against tick-borne encephalitis virus using plasmid pMG-EH and pMG-EK [11], containing the gene fragment heavy and the gene fragment light chains µa E6B. 50 μg of plasmid pMG-EH and pMG-EK split restrictase XhoI, BstEII and SacI, HindIII, respectively, in the reaction mixture containing 50 mM HCl, pH 7.5; 10 mM MgCl2; 50 mM NaCl and 50 units of activity of the respective enzymes. The reaction are 1 hour at 37oC. the DNA fragments by length 339 p. O. of XhoI, BstEII digests the plasmid pMG-EH, containing the gene variable domain of the heavy chain and a length of 332 p. O. of the SacI-HindIII digests of plasmid pMG-EK, containing the gene variable domain of the light chain, isolated by the method of polyacrylamide gel electrophoresis with subsequent Electrosila.

Separately carry out the annealing of the two pairs of oligonucleotides encoding a flexible peptide linker (Gly4Ser)3after which them are ligated under standard conditions. The selected gene fragments of the heavy and light chains of immunoglobulin combined into a single reaction mixture with a 10-fold excess of oligonucleotide connector and are ligated.

Mersey chain reaction with Taq-DNA-polymerase, carried out in standard buffer under the following conditions: cycle I - 94oC, 1 min, cycle II - 45oC, 1 min, cycle III - 72oC, 1 min using primers and plasmid pET(rF11) [5] as a matrix. The DNA fragment size 220 p. O. allocate the method of polyacrylamide gel electrophoresis with subsequent Electrosila. Then process its restrictase EcoRI and XhoI in standard buffer at 37oC for 1 hour. Enzymes inactivate by heating at 65oC 20 minutes

PGEM1 plasmid DNA treated with restrictase EcoRI and HindIII, inactivate the enzymes by heating at 65oC 20 min, add the DNA fragment encoding the pelB leader, and the DNA fragment containing the gene single-chain antibodies. In standard buffer spend ligation. Received ligase mixture transform cells of E. coli JM 109. Using restriction analysis of selected clones containing inserts of the correct size. Thus obtained target plasmid is designated as pTLS. Scheme of plasmid DNA pTLS shown in Fig. 1.

Example 2. Characterization of the recombinant protein of single-chain antibodies against tick-borne encephalitis virus product plasmids pTLS.

Cells of E. coli BL21(DE3) carrying the gene for RNA polymerase of phage T7 by the plasmid pTLS, grow overnight at 37oC. the overnight culture (1/50) seeded in fresh medium YTx2 with ampicillin (50 μg/ml). The synthesis of RNA polymerase induce the addition IPTG to a concentration of 0.5 mm at the time when the culture reaches srednetehnicheskoy phase of growth. Induced cells grow overnight at 37oC, and then harvested by centrifugation at 5000 g and analyzed by electrophoresis according to laemmli's method in 12% SDS-polyacrylamide gel (SDS page) and Western blot turns with polyclonal antiadiotipiceskih antibodies to MCA E6B. The results of this analysis, shown in Fig. 2A shows the presence of induced culture cells BL21(DE3)/pTLS additional protein with a molecular weight of about 26 kDa, which corresponds to the calculated molecular weight single-chain antibodies (lane 1), which is absent in the control lysate of E. coli cells BL21(DE3)/pGEM1 (track 2). This protein is colored in with polyclonal Western blot turns antiadiotipiceskih antibodies (Philadelphia Chapter) (Fig. 2B).

For analysis, cells resuspended in THE buffer (50 mM Tris-HCl, pH 8.0, 10 mM EDTA) and destroy ultrasound.

Maintaining the correct conformation antigennegative domain single-chain antibodies examined in experiments on their sweateronto assay (ELISA) demonstrate the ability of polyclonal Philadelphia Chapter to E6B to interact with recombinant single-chain antibodies, contained in lysates of E. coli cells carrying plasmid pTLS (Fig.3A).

The ability of single-chain antibodies to interact with the viral antigen was demonstrated in ELISA using recombinant E protein of TBE virus. This protein contains the domains of E1 and E2 and effectively communicates the original MCA E6B. The results of the experiments showed the ability of the obtained single-stranded antibodies to interact with the protein E (Fig. 3b).

To confirm the identity of the epitope recognized µa E6B and recombinant antibodies was conducted competitive analysis between MCA E6B and the resulting single-chain antibodies. The results confirmed the binding specificity of recombinant antibodies with protein E and showed the presence of competition for a common binding site (Fig. 3b).

Thus, for the first time obtained plasmid DNA and bacterial strain producing, providing the expression of single-chain antibodies against tick-borne encephalitis virus, preserving the conformation of the variable domain of the original ICA and able to interact with the E2 domain of the surface glycoprotein of tick-borne encephalitis virus. The involvement of this domain in the interaction of viral particles with cellular rozpoczecie antibodies can block viral infection. These results are the first stage in creating a new generation medications against tick-borne encephalitis virus.

LITERATURE

1. Hauschield J. , Faro H. P. Pack, P., Pluckthun A. Pharmacokinetic properties of left-hand drive vehicles miniantibodies and comparison to other immunoglobulin forms. // Antibody Immunoconjugates and Radiopharmaceuticals. -1995. -Vol. 8. -P. 111-129.

2. Yokota T., D. E. Milenic, Whitlow M., Schlom J. Rapid tumor penetration of a single-chain Fv and comparison with other immunoglobulin forms. // Cancer Res. - 1991.- Vol. 51. -P. 6363-6365.

3. Schier R., Bye J., Apell, G., et al. Isolation of high-affinity monomeric human anti-c-erbB-2 single chain Fv using affinity-driven selection. // J. Mol.Biol. - 1996. - Vol. 255. - P. 28-43.

4. Hu, S., Shively L; Raubitschek, A.; et.al. Minibody: A novel engineered anticarcinoembryonic antigen antibody fragment (single-chain Fv-CH3) which exhibits rapid, high-level targeting of xenografts. // Cancer Res. - 1996. - Vol.56. - P. 3055-3061.

5. Bespalov, I. A., Shiyanov P. A., Lukashevich L. C., and others Receiving single-chain antibodies to the human ferritin in the cells of Escherichia coli. // Mol. Biol. - 1995. - So 27. - S. 451-460.

6. J. H. Condra, Sardana, V. V., Tomassini, J. E., et al. Bacterial expression of antibody fragment that block human rhinovirus infection of cultured cells. // J. Biol. Chem. 1990. - Vol.265. - P. 2292-2295.

7. Jiang W., Bonnert, T. P., Venugopal K., Gould, E. A. A single chain antibody fragment expressed in bacteria neutralizes tick-borne flaviviruses. // Virology. - 1994. - Vol.200. - P. 21-28.

8. Protopopov E. C., Khusainov, A. D., Konovalov S. N., Loktev Century B. Obtaining and study of the properties of antiidiotypic an. 1996. - N 2. - S. 50-53.

9. Protopopov E. C., Konovalov S. N., Loktev Century B. the Allocation of the cellular receptor for the virus of tick-borne encephalitis using antiidiotypic antibodies. // The. virusol. - 1997. - N-6. - S. 264-268.

10. Maniatis T., Fritsch E., Sambrook D. Molecular cloning. M.: Mir, 1984. (Maniatis T., Fritsch E. E., Sambrook J. Molecular cloning. Cold Spring Harbor Laboratory. N. Y.: Cold Spring Harbor 1982.)

11. Nikolenko, N., Bighead S. I., Il'ichev, A. A., N. Tikunova.In. Cloning and sequencing of the gene encoding single-chain immunoglobulin on the surface glycoprotein E of tick-borne encephalitis virus. // Journal of infectious diseases - 1996. - So 3. - S. 47-52.

1. Recombinant plasmid DNA pTLS, containing the gene for single-chain antibodies against tick-borne encephalitis virus molecular weight of 2.5 Md and size 3782 p. O., comprising: plasmid vector pGEM1, revealed by EcoRI and Hind. III - sites and contains the site of initiation of replication of plasmid PUC18, the promoter of phage T7 and unique restriction sites EcoRI (969), Hind III (7), Pvu I (2483), Pvu II (1015), SphI (3350), BglI (2195), Aat II (3006); Xho I - BstE II fragment 339 p. O., representing gene variable domain of the heavy chain of the monoclonal antibody E6B against tick-borne encephalitis virus; Sac I - Hind III fragment 332 PP, Principality; synthetic BstE II - Sac I connector size 71 p. O. encoding the linker peptide (Gly4Ser)3; EcoR I - Xho I - amplication fragment 220 p. O., containing regulatory elements 22 and the first triplet gene pectolyase B Erwinia carotovora ; genetic markers: bla gene, the ampicillin resistance gene-lactamase), which defines the resistance to ampicillin in transformation of Escherichia coli.

2. The bacterial strain Escherichia coli B-716 producing single-chain antibodies against tick-borne encephalitis virus.

 

Same patents:

The invention relates to biotechnology and Microbiology and is a method of obtaining biomass of recombinant strains of E. coli containing plasmid DNA encoding the biosynthesis of cytokines with the properties of factors, tumor necrosisand(TNF-alpha and TNF-beta), granulocyte colony-stimulating factor (G-CSF) and granulocyte-macrophage colony-stimulating factor (GM-CSF) human and bearing as a selective marker gene bla (resistance to ampicillin)

The invention relates to biotechnology, cleaning the environment from pollution by oil and oil products

The invention relates to biotechnology, cleaning the environment from pollution by oil and oil products

The invention relates to biotechnology, cleaning the environment from pollution by oil and oil products

The invention relates to biotechnology, cleaning the environment from pollution by oil and oil products

The invention relates to biotechnology, cleaning the environment from pollution by oil and oil products

The invention relates to biotechnology, cleaning the environment from pollution by oil and oil products

The invention relates to medicine, namely to clinical Microbiology, and can be used bacteriological examination of various clinical materials and objects in the external environment

The invention relates to genetic engineering

The invention relates to the field of medicine

The invention relates to biotechnology, in particular genetic engineering and medicine, specifically for medical Virology and immunology, and can be used as an immunodiagnostic hemorrhagic fever Marburg, and also to produce specific antibodies to Marburg virus and genetically engineered vaccines against Marburg virus
The invention relates to biotechnology and genetic engineering and can be used in microbiological industry and medicine to develop a highly effective preventive and diagnostic tools in the fight against tick-borne encephalitis virus (VIK)

The invention relates to the field of genetic engineering and biotechnology, in particular, to obtain the recombinant plasmid DNA RS-NS3 integrating the complex of genes C, prM, E, NSI, NS2A, NS2B, NS3 virus tick-borne encephalitis (tick-borne encephalitis) into the genome of vaccinia virus (WWII), and the corresponding strain of the great Patriotic war
The invention relates to biotechnology, in particular genetic engineering

The invention relates to biotechnology and concerns gumanitarnogo immunoglobulin specific for the protein L-selectin person

The invention relates to humanized antibodies and their binding proteins which are capable of contacting the T cell with certain variable beta chain

The invention relates to biotechnology and can be used to create a fused protein fragments of antibodies with bi - or multifunctional binding sites
Up!