Mutant gp 50 for preparation of vector vaccines, vector vaccine and its preparation

 

(57) Abstract:

The invention provides for obtaining vaccines for the prevention and control of animal diseases, including virus pseudoleskeella. The vaccine is suitable for use against Aujeszky's disease (pseudoleskeella) or against other animal diseases, if the mutation is an insertion (insert) containing a heterologous gene that encodes the antigen corresponding to the disease of the animal. Virus pseudoleskeella can optionally have at least one mutation in one of its other genes, such as gp63 gene or gene gl. This virus cannot be spread from vaccinated to unvaccinated animals. Attenuated virus can enter a route that provides the best protection of the animal. 3 S. and 1 C.p. f-crystals, 3 ill., 3 table.

Background of the invention

This invention relates to conditionally flying mutant virus pseudoleskeella (PRV), also known as a virus of Aujeszky's disease (ADV). PRV is vysokonaporny the herpes virus that causes Aujeszky's disease in domestic and wild animals (see reviews ettenleiter, Comp. Immun. Environ. Infect. Dis, 14, 151 - 163 (1991); Wittmann and Rzina. in (G. Wittmann ed.) Herpesvirus Diseases of Cattle, Horses and Pigs, Kluwer, Bosten, 230 - 325 (1989); Raw PRV and why they are considered the natural host of this virus. Natural gate infection is the nasopharyngeal area. The virus is able to multiply in the cells of the nasal and faringealni mucosa and after infection of the peripheral nerves, it is transferred in the Central nervous system where it causes severe encephalitis, which is often fatal in young pigs. Older pigs usually carry the infection, but they may develop fever and pneumonia. Infection of sensory ganglia, as a rule, leads to latency.

To limit economic losses caused by mortality and stunting of infected animals are vaccinated against Aujeszky's disease. For this purpose, suitable vaccines based on attenuated (weakened) virus and inactivated virus. Preferred vaccines based on attenuated live virus, as they are more easy to prepare and, consequently, they are less expensive than inactivated vaccines. In addition, the attenuated virus can enter a route that provides better protection than parenteral or weakened live vaccine, or inactivated virus.

Previous vaccines based on attenuated live virus strains, p. the us were not homogeneous and were included in the mixture of viral variants of unknown virulence and immunogenicity. In addition, these vaccines was fraught with the danger of reverting to virulence. More recently, the development of knowledge at the molecular level about the structure and replication of viruses and the availability of thin molecular biological methods have allowed scientists to construct attenuated vaccine, without relying on luck. Viral genetics and analysis of DNA sequences has made it possible to identify regions in the viral genome, changes in which can reduce viral pathogenicity. Recombinant DNA technology makes possible changes in or deletion of such areas, resulting in an attenuated virus with defined and stable changes. This approach was successfully applied for the first time Kit and coworkers (Am. J. Vet. Res. 46, 1359 - 1367 (1985)) to loosen the PRV. Inactivation of the gene timedancing (TK) PRV resulted in significantly reduced virulence for pigs (EP-A-141458). In addition to damage in the TK gene deletions were introduced into the genes of glycoproteins such as gI, gIII and gX (Kit et al., Am. J. Vet. Res. 48, 780 - 793 (1987); Marchioli et al., Am. J. Vet. Res. 48, 1577 - 1583 (1987); Quint et al., J. Gen. Virol. 68, 523 - 534 (1987); Moormann et al., J. Gen. Virol. 71, 1591 - 1595 (1990); WO-A-9102795), which led to a further reduction in virulence of the virus and serological resposne - 1182 (1986); Van Oirschot et. al., J. Virol. Meth. 22, 191 - 206 (1988); Eloit et. al., Vet. Rec. 128, 91 - 94 (1989)).

A new approach to vaccine development is the expression of the genes of alien pathogens with the use of live attenuated viral vaccine strains as media (viral vaccine vectors). The expression of the antigens a live virus vector mimics the expression after natural infection and can stimulate both humoral and cellular immune response. Vaccine vectors can be used for immunization against diseases for which there is currently no available adequate vaccines, or, if such vaccines can not be safely and easily obtained.

Receiving vaccine vectors has focused mainly on the vaccinia virus (Moss and Flexner, Ann. Rev. Immunol. 5, 305 - 324 (1987); Piccini and Paoletti, Adv. Virus Res. 34, 43 - 64 (1988)). Vaccinia virus has been intensively used for the eradication of smallpox and was highly effective and relatively safe. A wide range of hosts and the ability to accommodate large amounts of foreign DNA allowed to choose the vaccinia virus to test it as a vaccine vector (Hruby, Clin. Environ. Rev. 3, 153 - 170 (1990); Tartaglia et al., Crit. Rev. Immunol. 10, 13 (1990)). Alternatively, the virus is used as vaccine vectors (Tayor et al., Vaccine 6, 504 - 508 (1988); Lodmell et al., J. Virol. 65, 3400 - 3405 (1991); Letellier et al., Arch. Virol. 118, 43 - 56 (1991)).

Other viruses that can be used as vaccine vectors are adenovirus (Berkner, BioTechniques 6, 6003 - 6020 (1988)) and herpesvirus (Shih et al., Proc, Natl. Acad. Sci, U. S. A. 81, 5867 - 5870 (1984); Thomsen et al., Gene 57, 261 - 265 (1987); Lowe et al., Proc. Natl. Acad. Sci. U. S. A. 84, 3896 - 3900 (1987); Cole et al., J. Virol. 64, 4930 - 4938 (1990); van Zijl et al., J. Virol, 65, 2761 - 2765 (1991); Kit et al. , Vaccine 9, 564 - 572 (1991)). The suitability of a reliable and efficient live herpes virus vaccine in combination with their ability to accommodate large amounts of foreign DNA makes these viruses are very attractive candidates for the development of vaccine vectors. The use of PRV as a vaccine vector is very promising. PRV has been well characterized and have developed a reliable and effective live vaccines using targeted deletions (see above). This virus has a wide range of hosts, but harmless to humans. The use of PRV as an effective vaccine carrier was recently demonstrated by van Zijl et al., (J. Virol. 65, 2761 - 2765 (1991), WO-A-9100352), which showed that the PRV recombinants expressing the glycoprotein E1 of the virus envelope cholera swine protected pigs against pseudoleskeella and against cholera pig is as accurate molecular changes, which lead to the altered phenotype weakened conventional ways of live vaccines generally unknown, there is always a small chance that they may again become virulent. This problem can be eliminated by the use of recombinant vaccines that are certain and stable deletions. However, the design of stable, attenuated vaccines is sometimes very difficult if not possible. In this case, you can count on a killed vaccine or the use of a reliable vaccine vectors. Well prepared and experienced, live attenuated deletion vaccines and vaccine vectors, usually reliable in the immunocompetent host. However, in hosts with defective immune system protection can be serious complications. Since live attenuated vaccines and vaccine vectors are able to multiply, they can be released to the environment in which they can create a threat for the hosts with weakened immune systems. In addition, the vaccine, which is safe for use in species targets for vaccine can still be virulent for other types.

Genes that are candidates for inclusion in vaccine vectors often encode structural proteins of the virion, which can oblad the neuraminidase (Hruby, Clin. Environ. Rev. 3, 153 - 170 (1990)). Such proteins are often involved in interactions, virus - cell, which determine the tropism of the virus in the direction of the owner and(or) cells. Therefore, expression of these genes by virus-carrier can theoretically alter its biological properties such as pathogenicity, demetrovics and specificity with respect to the host. In addition, the modified biological properties can be transferred via homologous recombination from an attenuated vector of the virus to a virulent wild-type virus.

The above considerations are an argument in favor of the development of live vaccines and vaccine vectors, which are self-limited, i.e., that do not apply vaccinated organisms. Ideally, the vaccine should produce infectious progeny and should be able to generate infectious virus after recombination with the corresponding wild-type virus. Here we describe an invention which satisfies these requirements.

Summary of the invention

This invention provides a conditionally lethal mutants of the virus pseudoleskeella (PRV), which can be used for vaccination against Aujeszky's disease and the AMB 50 gp, the protein shell of the virus, which is essential for the infectivity of the virus. Gene gp 50 was inactivated either by the insertion of the alien of the oligonucleotide, or by deletions or by both (substitution). In particular, the gene gp 50 was inactivated by insertion of a synthetic oligonucleotide, which contains stop codons translation in all three reading frames, or a deletion of part of the PRV genome, which contains a gene is 50 gp, and gp gene 63. These mutant viruses were grown on complementary cell line, which expresses viral gene gp 50. Progeny virions produced from these cells, phenotypic complementarian, i.e. they have a gp 50, which is provided complementary cell line. Such phenotypic complementarian mutant virions capable of infecting cells both in vitro and in vivo and are able to multiply and spread by direct transmission from cell to cell. However, progeny virions released these infected cells are not infectious, because they do not contain 50 gp. Because they can't initiate a new cycle of infection, these viruses cannot spread from vaccinated unvaccinated animal to animal. the Kim way the invention concerns the use of gp 50 mutant virus pseudoleskeella for the preparation of vaccines against animal diseases or for the preparation of a vaccine against Aujeszky's disease or for the preparation of vector vaccines against other diseases of animals by including nucleotide sequences encoding antigens or part antigens from other related to the matter of pathogens in these mutants.

The invention further relates to vaccines for the control of animal diseases, containing the virus pseudoleskeella with glycoprotein gp 50, and a mutation in the gene gp 50. Such a vaccine could be to protect against Aujeszky's disease, if the mutation is a deletion, or to protect against other diseases of animals, if the mutations are insertions containing a heterologous nucleotide sequence encoding the antigen or the part of the antigen from another pathogen, inducing another animal disease. Virus pseudoleskeella may contain other mutations in its genome such as deletions and / or insertions in the genes gp 63, gI, gIII, gX, 11K, gene timedancing (TK) ribonucleotides (RR) protein kinase or 28K gene, especially in the genes gI or gp 63.

Detailed description is R122 and R332 are unable to Express functional gp 50, while strains D560 and D1200 unable to Express any functional gp 50 or functional gp 63. Since gp 50 is important for penetration of the virus, these mutants are grown on complementary cell lines expressing gp 50. Although all strains were able to complete a full replication cycle in complementary cells, progeny virions released from such cells, reinfection, because they do not contain 50 gp. The observation that mutants gp 50 capable of forming plaques (sterile spots) on complementary cell lines suggests that this virus can be transmitted from infected cells to uninfected.

Synthetic oligonucleotide with the sequence 5'-TAGGTAGAATTCTAGCCTA-3' (SEQ 1D N 1), which contains the restriction site EcoRI (GAATTC) and stop codons translation in all three reading frames, was built in two different positions in the gene gp 50 plasmids pN3HB, as described in de Wind et al. (J. Virol. 64, 4691 - 4696 (1990)) (see Fig. 1), to obtain strains of PRV R122 and R332. Plasmid pN3HB consists of a fragment of the PRV Hind III - B, cloned in the plasmid pBR322 (van Zijl et al., J. Virol. 65, 2761 - 2765 (1988)). The resulting plasmid, in which the oligonucleotide was inserted between nucleotides 366 - 367, 996 - 997 gene gp 50, were named R1 and 322, kis et al., J. Virol. 59, 216 - 223 (1986)). It should be noted, however, that the nucleotide sequence of 50 gp gene of strain NIA-3 PRV differs from the sequence of a strain of Rice in position 364 (G instead of A), which leads to the presence of the restriction site Bgl II 50 gp gene of strain NIA-3.

Reconstituirea (reconstruction) of viral genomes was performed by overlapping recombination (van Zijl et al., J. Virol. 65, 2761 - 2765 (1988)) using a combination of mathenesserlaan fragment (RI or 322) and three overlapping subgenomic fragments of wild-type PRV obtained from cosmid c-178, c-27 and c-443, together contain the complete viral genome. Overlapping recombination was performed in complementary cell line (cell line G-5), constitutively expressing gp 50 (Peeters et al., J. Virol. 66, 894 - 905 (1992)). Derived viral strains were named, respectively, R122 and R332.

To obtain strain D560 we used plasmid 322 (see above) and other derived plasmids pN3HB named 149 (de Wind et al., J. Virol. 64, 4691 - 4696 (1990)), in which oligonucleotide was inserted in gp 50 gene between nucleotides 352 - 353 (numbering according to Fig. 5 Petrovskis et al., J. Virol. 60, 185 - 193 (1986)) (see Fig. 1). By replacing the Bgl II-EcoRI fragment of plasmid 149 Bgl II-EcoRI fragment of plasmid 322 received a new plasmid, what elnett SEQ ID No. 1 (i.e., the sequence of the mutagenic oligonucleotide). This plasmid was used together with overlapping fragments of the wild-type virus recovery overlapping recombination in G5 cells. The resulting virus was named D560.

To obtain strain D1200 plasmid 149 digested by restrictase Bgl II and EcoRI and the resulting large fragment did ring using T4 DNA ligase after processing the ends of the fragments maple DNA polymerase I of E. coli. In the resulting plasmid nucleotide sequence between positions 336 50 gp gene and 353 gp 63 gene was replaced by the sequence AATTCTAGCCTA (SEQ ID No. 2; i.e., the remainder of the mutagenic oligonucleotide). This plasmid was used together with overlapping fragments of the wild-type virus recovery overlapping recombination in G5 cells. The resulting virus was named D1200.

gp 50 mutants R122 and R332 and 50 gp - gp 63 mutants D560 and D1200 able to form plaques (sterile spots) on complementary SK6 cells. Plaques formed on SK6 cells by strains of R122 and R332, similar in size to the plaques formed by the parent wild-type strain NIA-3. Plaques formed on SK6 cells strains D560 and D1200, smaller in size, which indicates the participation of gp 63 in the replication cycle P is to meatsa in a noticeable extent in live animals. The virulence of the virus is usually the result of replication in primary sites of infection and subsequent spread of progeny in the form of virions to other parts of the body and intensive reproduction using multiple cycles of infection. Since gp 50 mutants are able to replicate only in the primary site of infection, we expected that these mutants will not be virulent. In addition, there were doubts whether these mutants immunogenic, as he gp 50 has high immunogenicity, which is proved by the discovery that gp 50 is able to induce a protective immune response in pigs (Marchioli et al., J. Virol. 61, 3977 - 3982 (1987); Mukamoto et al., Vet. Environ. 29, 109 - 121 (1991); Riviere et al., J. Virol. 66, 3424 - 3434 (1992)). Therefore, inactivation gp 50 can significantly reduce immunogenic properties gp 50 gp 50 + gp 63 mutants. Also had no idea that mutant viruses could be able to reach the Central nervous system, as this would result in the transfer of virus from infected tissue to peripheral nerves with subsequent transport to the Central nervous system. If TRANS-synaptic transport of the virus includes re-infection post-synaptic neurons infectious progeny virions (Lycke et al., 't be locked in place synapses. This would prevent entry of the virus into the Central nervous system, interfering with his unichtozhayuschego action on pathogens in the brain.

To determine the ability of gp 50 mutant viruses to spread in the tissue of the animals we studied the replication gp 50 mutants R122 and R332 and 50 gp + gp 63 mutants D560 and D1200 in explants nasal mucosa of pigs by immunohistochemistry. In addition, mice infected subcutaneously or intraperitoneally to determine whether the replication and spread of these viruses in vivo. Our results showed that all the mutants are able to replicate in the nasal mucosa of pigs.

To our surprise gp 50 mutants and 50 gp + gp 63 mutants were flying for mice after intraperitoneal or subcutaneous inoculation. Virulence (expressed as the average time to death of the infected animal) strain R122 was only moderately reduced compared with the wild-type strain NIA-3. However, the virulence of the strains D560 and D1200 was much more reduced, indicating the participation of gp 63 in virulence for mice. Study post mortem (post-mortem) of infected animals showed that the mutants were able to proliferate in the brain. Immunohistochemical study organizer is a mini nerves. When growing strain R122 on complementary cells not containing 50 gp, infection by intraperitoneal was unsuccessful. This discovery indicates that 50 gp for primary infection. The observation that phenotypic complementary g 11 mutant PRV (which also forms a non-infectious progeny, but does not form plaques on complementary lines) completely harmless to mice, indicates that after the primary infection, the successful spread of the virus depends on transfer from cell to cell. The discovery that infectious virus could not be distinguished from animals infected with gp 50 or 50 gp + gp 63 mutants shows that progeny virions produced in living animals these mutants, non-infective.

Taken together, these results show that 50 gp for primary infection, but not for subsequent replication and transmission of the virus, indicating that direct transmission from one cell to another is the main mechanism of spread of the virus in vivo. In addition, these results indicate that TRANS-synaptic transport of the virus is not dependent on gp 50 and does not lead to infection de novo post-synaptic neurons extracellular virions. The discovery that infectious virus produced in living animals 50 gp mutants, non-infective. Therefore, replication of these mutants occurs only in infected/vaccinated animals. The use of gp 50 mutant as the basis of a vaccine against Aujeszky's disease or as a recombinant virus carrier for the expression of heterologous genes will produce a very reliable vaccine, which replicates only in the vaccinated animal and is not transmitted to other animals, including other species. In addition, if you embed a heterologous gene at position 50 gp gene in the virus-carrier recombination with wild-type virus will always produce a non-infectious recombinants.

Pigs vaccinated with 50 gp mutant R122, were fully protected against clinical signs of Aujeszky's disease after infection with virulent wild-type strain NIA-3. Pigs vaccinated with gp's 5 + gp 63 mutants D560 and D1200, found short periods of feverish condition and the slowdown in growth, but found no neurological signs after inoculation NIA-3. These results show that mutants of PRV, is able to spread only by passing from cell to cell, are still vysokokonditsionnymi. Further, these results showed for the first time that the expression of gp 50, predstavili pigs against Aujeszky's disease. This result was unexpected.

The vaccine of the present invention to prevent or control infections virus pseudoleskeella (Aujeszky's disease) contains the PRV with gp 50 in the shell of the virus and have lost their function gene gp 50, described above, as the active ingredient. In addition, it contains the usual components such as a suitable carrier, sometimes stabilizers, adjuvants, soljubilizatory, emulsifiers, etc. the Introduction of this vaccine may be performed in different ways, for example, intradermally, subcutaneously, intramuscularly, intravenously or intranasally. Preferably intranasal introduction. The vaccine may also contain other immunogen related to other diseases, to obtain multivalent vaccine.

When using gp 50 mutant PRV as a viral vector, it contains, in addition to mutations in its 50 gp gene, and preferably in the form of insertion of the gp in his 50 gene, genetic information produced from other pathogens, including viruses such as virus cholera pigs (swine fever), parvovirus, transmissible virus gastroenteritis syndrome epidemic abortion pigs and respiratory syndrome (REARS or MSD "mysterious" disease of pigs), Bordetella bronchiseptia, Actinobacillus pleuropneumoniae and Streptococcus suis, Treponema hyodysenteria, Escherichia coli, Leptospira, and mycoplasmas, such as M. hyopneumoniae and M. lyorhinis. Methods cloning of sequences of nucleic acids of pathogens in subgenomic fragments of PRV and their subsequent integration into the genome of PRV, mostly known. The example described by van Zijl et al., J. Virol. 62, 2191-2195 (1988).

At that time, as gp 50 PRV mutants are still able to spread by transmission from cell to cell, mutations in homologous genes of herpes simplex virus type 1 (HSV-1) and herpes virus type 1 bull (BHV-1) lead to viral mutants that are unable to spread transmission from cell to cell (Ligas and Johnson, J. Virol. 62, 1486-1494 (1988); Fehler et al., J. Virol, 66, 831-839 (1992)). This suggests that there are differences in the function gp 50, on the one hand, and gD of HSV-1 and gIV BHV-1, on the other hand. Using methods of recombinant DNA can be modified HSV-1, BHV-1 and other herpes viruses in such a way that they will be able to spread transmission from cell to cell without the production of infectious progeny, like gp 50 mutants of PRV. This could give some reliable herpes (media) vaccines that can be applied for the elimination of foci of infection and control of many diseases of animals and humans.< the early stop codons, introduced by mutagenesis by insertion through the linker, in the gene gp 50 gp gene 63 plasmid pN 3HB and the corresponding viral mutants R122, R332, M102 and M105 (Peeters et al., J. Virol. 66, 894-905 (1992); de Wind et al. , J. Virol, 64, 4691-4696 (1990)). Horizontal lines show the position and level of deletions in mutants D560 and D1200. The top line shows the BstXI-StuI fragment of PRV, which is present in G5 cells, constitutively expressing gp 50 (Peeters et al., J. Virol. 66, 894-905 (1992)).

Fig. 2

Plasmid pEVhis13HCVEI containing the E1 gene of the virus cholera pigs (classical swine fever), together with the enhancer/promoter of the human cytomegalovirus applied to construct 50 gp mutant PRV containing the heterologous gene (see example 6).

Fig. 3

Plasmid pBP53E1 containing the E1 gene of the virus cholera pigs (classical swine fever), together with the enhancer/promoter of the human cytomegalovirus inside part of the genome of PRV in the website deletirovanie gene gp 50 applied to construct 50 gp mutant PRV containing the heterologous gene (see example 6).

Example 1

Cloning of the gene gp 50 strain NIA-3 PRV and construction of cell lines expressing gp 50

All methods of recombinant DNA were performed according to standard methods (Maniatis et al., Molecular cloning Natl, Acad, Sci. USA 85, 8047-8051 (1988)) by the replacement of the EcoRI-BamHI fragment by fragment, containing the early enhancer/promoter of the human cytomegalovirus (hCMV) (Bernard et al. , EMBNO J. 6, 133-138 (1987)), followed by a synthetic oligonucleotide containing stop codons in all three reading frames and the polyadenylation site. Plasmid pEVhis 10 was obtained from the plasmid pEVhis 14 deletions BamHI fragment containing the enhancer/promoter of hCMV. Gene gp 50 PRV cloned in the form of BstXI-Stu 1 fragmenta (not containing the promoter gp 50) into the EcoRV site located to the right of the hCMV promoter in pEVhis 14, receiving plasmid pEVhis14 50 gp. Design and characterization of cosmid s, on 27 and s containing overlapping subgenomic fragments of PRV, and plasmids pN3HB containing HindIII B fragment of PRV into the HindIII site of pBR322 derived as described (van Zijl et al., J. Virol. 65, 2761-2765 (1988)). Inactivation of expression of gp 50 by means of the linker insertions in two different positions in the gene gp 50 pN3HB (insertions R1 and 322) are described (de Wind et al., J. Virol. 64. 4691-4696 (1990)).

SK-6 cells were transfusional the plasmid pEVhis 14 gp 50 using electroporation. SK-6 cells were collected by trypsinization, washed once with saline phosphate buffer (PBS) at room temperature and resuspendable at concentrations of 2 to 107cells/ml in ohla the gas cuvette for electroporation (0.4 cm length of the inner electrode; BioRad Laboratory), and setting the capacitance of 25 F filed a discharge of 1000 volts using a Biorad GenePulser. The cells were left at 0oC for 15 minutes, transferred into a flask 75 cm3containing 50 ml of medium and incubated overnight. Then transfetsirovannyh cells were trypsinization and perseval at several dilutions on Petri dishes (100 mm) in the medium containing 2.5 mm histidinol. The medium was replaced every 3-4 days until colonies did not become clearly visible (7-10 days). Individual colonies were viscerale and were grown on microtiter culture plates. The expression of gp 50 was determined using immunoperoxidase test and radioimmunoprecipitation using monoclonal antibodies G50N2. Cell line expressing large amounts of gp 50 defined by radioimmunoprecipitation, called G5 (Peeters et al., J. Virol, 66, 894-905 (1992)).

Example 2

Construction of mutant viruses

Mutant viruses R122 and R322 designed using overlapping recombination in cells G5 using 3 cosmid (C-179, C-27 and C-443, described by van Zijl et al., J. Virol, 65, 2761-2765 (1988)) containing overlapping sequences of wild-type PRV, and HindIII-B fragments derived plasmids pN3HB RI or 322 (de Wind et al., J. Virol. 64, 46997 in the gene gp 50, respectively (Fig. 1). Viral fragments were isolated from the plasmid by EcoRI digestion (cosmid) or by digestion of Hind III (clone RI and 322) and has not been further separated from vector sequences. Transfection was performed using electroporation (see above) using the BioRad Gene-Pulser and Capacitance Extender at 250 volts and 960 F respectively. Cells were sown on 6-hole tablets, and after incubation for 3 hours at 37oC the medium was replaced with minimum primary environment Needle containing 2% fetal calf serum, 1% methylcellulose and incubated at 37oC until plaques appeared (2-3 days).

To obtain strain D560 BglII-EcoRI fragment of plasmid 149 (derived pN3HB containing mutagenic oligonucleotide between nucleotides 352-353 gene gp 63 (de Wind et al., J. Virol. 64, 4691-4696 (1990); numbering according to Fig. 5 Petrovskis et al., J. Virol, 60, 185-193 (1986)) was replaced by a BglII-EcoRI fragment of plasmid 322 (see Fig. 1). The resulting plasmid, in which the nucleotide sequence between positions 996 gene gp 50 and 353 gene gp 63 was replaced by the sequence TAGGCTAGAATTCTAGCCTA (SEQ ID No. 1; the sequence of the mutagenic oligonucleotide) was used together with overlapping fragments of the wild-type virus recovery overlapping ramalinaceae in G5 cells, kacy larger fragment was treated with the fragment maple DNA polymerase I E. coli for the formation of blunt ends, followed by zameshivaniem. The resulting plasmid, in which the nucleotide sequence between positions 336 gene gp 50 and 353 gene gp 63 was replaced by the sequence AATTCTAGCCTA (SEQ ID No. 2; i.e., the remainder of the mutagenic oligonucleotide) was used together with overlapping fragments of the wild-type virus recovery by overlapping recombination in G5 cells, as described above.

Example 3

Replication gp 50 gp 50 + gp 63 mutants in explants nasal mucosa of pigs

To determine whether these mutants also be distributed in the tissues of the animal, we used explants nasal mucosa of pigs. These explants provide natural combination of epithelial cells and stromal fibroblasts, and it has been shown that infection of these explants closely mimics infection in vivo nasal mucosa (Pol et al. , Res. Vet. Sci, 50, 45-53 (1991)). The explants were infected by a strain NIA-3 wild-type PRV, 50 gp mutants with linker-insertion R122 and R332 and 50 gp + gp 63 mutants with deletions D1200 and D560.

Immunohistochemical study of 24 hours after infection using rabbit serum against PRV (Pol et al., Res. Vet. Sc is concentrated in large areas of epithelial cells. Similar results were obtained with 50 gp mutants R122 and R322 and 50 gp + gp 63 mutants D1200 and D560. After 24 hours of infection, viral replication was almost exclusively in the epithelial cells. However, all strains were able to infect the underlying fibroblasts after long periods of incubation. Differential immunological staining using rabbit antisera against PRV and monoclonal antibodies (G50N2 specific to gp 50) confirmed that gp 50 not expressively 50 gp + gp 63 mutants or gp 50 mutants. These observations show that gp 50 unimportant for the spread of the virus in the nasal mucosa of pigs.

Example 4

Virulence gp 50 gp 50 + gp 63 mutants in mice

a. gp 50 + gp 63 null mutants are lethal for mice

The observation that 50 gp mutants were able to replicate and spread in tissue explants, suggests that they are also able to replicate and spread in live animals. As the test animals were selected mouse because they are sensitive to herpes viruses and is often used as a model system for the study of virulence and neural distribution (Fraser and Ramachandran, J. Comp. Path 79. 435-444 (1969); Cook and StevensArch. Virol, 63, 107-114 (1980); Dix et al., Infect. Immun. 40, 103-112 (1983)).

In the first experiment, we used 50 gp + gp 63 mutants with deletions D560 and D1200 instead mutants R122 or R332 with the linker insertion to exclude the presence of revertants wild type in the inoculum. Such revertant may appear in the lines of mutants with the linker insertions in the homologous recombination of viral sequences present in complementary cell lines and viral genome (Cai et.al., J. Virol. 62 2596-2604 (1988); Peeters et al., J. Virol. 66, 3388-3892 (1992)). Because the sequences on the 3'side of the 50 gp + gp 63 deletions strains D560 and D1200 not have homologous copies in complementary G5 cells (Fig. 1), the formation of revertants wild-type must be possible during replication of these mutants in complementary G5 cells.

Five 6-8-week-old female BALB/c mice (Charles River, Suldzfeld, FRG) were infected subcutaneously in the neck 105plaque-forming units strains NIA-3, D560, D-1200 gp 63 mutant M. Mice inoculated with strain NIA-3, found severe symptoms of Aujeszky's disease, such as severe combing hind legs, "face wash" and paralysis, and died in approximately 70 hours after infection. Animals infected with strain M105 not detect the s died after about 90 hours after infection. Mice infected with strains D560 or D1200, found symptoms similar to the symptoms of animals infected with strains of M105. They became apathetic and found signs of paralysis before the entry into agenerous state, which sometimes lasted up to 42 hours, while the animals did not die in approximately 130-140 hours after infection (table 1, experiment 10). These results show that 50 gp + gp 63 nu11 mutants still lethal for mice. Their virulence but significantly reduced compared with wild-type virus or gp 63 mutant virus.

b. gp 50 + gp 63 null mutants are able to reach the Central nervous system and replicate it

Because the symptoms of neurological disorders were much less evident in mice infected with gp 63 or 50 gp + gp 63 mutants, compared with mice infected with strain NIA-3, the brain of infected animals examined for the presence of virus by immunohistochemistry. Cryostate slices of the brain and organs of infected mice were fixed and processed for immunohistochemistry as described previously (Pol et al., Microb Path. 7, 361-371 (1989)). When using monoclonal antibodies against gp 50 as the primary antibody in the second incubation was used goat antimurine the Ali large number of infected neurons in slices of mouse brain, infected D1200 and D560, while only a small number of infected neurons were present in slices of mouse brain infected with NIA-3 or M105. The virus that was present in the brain of animals infected with the D1200 and D560, not expressed gp 50, as determined by differential staining using rabbit antisera against PRV (Pol et al., Res. Vet. Sci, 50, 45-53 (1991)). When allocation of a virus from the brain and the titration on the SK-6 cells infectious virus was easily extracted from animals infected with NIA-3 or M105, but not from animals infected D560 or D1200 (table 1, experiment 1). These results show that 50 gp + gp 63 null mutants, which are unable to produce infectious progeny, still able to reach the Central nervous system and replicate it.

c. gp 50 null mutants have high virulence

Although gp 63 dispensable for viral growth (Petrovskis et al., J. Virol. 60, 1166-1169 (1986)), the plaques produced complementary G5 cells and complementary

SK-6 cells 50 gp + gp 63 mutants were much less than the plaques formed by gp 50 mutants. In addition, gp 63, has been shown to be involved in virulence in pigs (Kimman et al., J. Gen Virol. 73, 253-251 (1992)). As these findings suggest, F. mice. However, for the application of gp 50 mutant to infect the mice we had to be absolutely sure that the inoculum does not contain revertants wild type (see above). Culture phenotypic complementarianism virus R122, which was actually free from revertants wild type, were prepared by infection of SK-6 cells one plaque formed R122 on G5 cells. Viral DNA was isolated from infected SK-6 cells and used for transfection of monolayers G5 cells (which have significantly reduced the effectiveness of seeding PRV (Peeters et al., J. Virol. 66, 894-905 (1992)). From transfected cells were prepared by viral culture, which contained 2,1107plaque-forming units pfu/ml, as determined by titration on SK-6 cells. This culture was named R122-that indicates that it is produced from complementary cells containing 150 pfu/ml. However, when we were immunoperoxidase staining using monoclonal antibodies against gp 50 (Peeters et al., J. Virol. 66, 894-905 (1992)), it was found that these plaques were 50 gp-negative. This discovery indicated that this virus line did not contain wild-type virus, but still contained some amount of infectious viral particles. It is possible that these particles of praise virions may be able to re-enable gp 50, which was deposited in the plasma membrane of the SR-6 cells infecting R122+the virions. Another possibility is that the virions, not containing 50 gp, absorbed in the result of endocytosis (Campadelli-Fiume et al., J. Virol. 62, 159-167 (1988)) and accidentally avoid degradation, leading to productive infection. Physical titer R122+and R122-lines were determined using electron microscopy with the use of pellets made of latex (diameter of 91 nm; Serva) as internal standard.

In addition to studies of virulence R122+we also determined whether the virulence of different viruses from the path of introduction of infection. Groups of five mice were inoculable 105pfu strains NIA-3, M105, R122+and D1200 subcutaneous or intraperitoneal injection. Mice infected with the strain R122+found signs of Aujeszky's disease, which were similar to the characteristics found in animals infected with NIA-3 (see above). In animals infected subcutaneously NIA-3, the first symptoms were visible at approximately 34-40 hours after infection, and in animals infected subcutaneously R122+- with 42 hours after infection. The animals died after about 56 and 68 hours after infection, the CE is th for mice and was much more virulent than 50 gp + gp 63 mutant D1200 or gp 63 mutant M105. Intraperitoneal injection of strains NIA-3, R122+and M105 resulted in average time to death, which was about 10-13 hours compared with those for subcutaneous injection (table 1, experiment 2). For all tested strains of symptoms and clinical signs do not depend on the method of infection. Thus, although there are differences in the time course of infection, both of insulinopenia lead to lethal infection. The virus was detected by immunohistochemistry in sections of the brain of all animals used in experiment 2 (table 1). Again, replication of the virus was much more intense in the brain of animals infected with D1200 compared to animals infected with NIA-3, R122+or M105.

d. Preferred viral replication in the peripheral nerves of infected organs

In the study of organs for the presence of viral antigens by immunohistochemistry viral antigens could be detected only in animals that were infected intraperitoneally. The virus was detected in the liver, spleen, kidney, intestine and adrenal glands, but not in the lungs. Viral infection in the organs were completely confined to the nerve fibers PRV, and suggests that the virus is transported from the organs to the Central nervous system using catabolic transport in axons, as it was shown earlier (Cook and Stevens, Infect. Immun. 7, 272-288 (1973); Field and Hill, J. Gen Virol, 23, 145-157 (1974), Field and Hill, J. Gen Virol. 26, 145-148 (1975); MeCracken et al., J. Gen Virol. 20, 17-28 (1973); Strack and Loewy, J. Neurosci, 10, 2139-2147 (1990); Card et al. , J. Neurosci. 10,1974-1994 (1990)). The observation that gp 50 null mutant is efficiently transported to the Central nervous system, suggests that neural transport is not dependent on the presence of 50 gp.

Infectious virus was recovered from extracts of animal organs, which were infected intraperitoneally strain NIA-3 and M105. As expected, infectious virus was not isolated from animals infected R122+or D1200, that once again proves the inefficiency of the offspring of these viruses. Suddenly 3 of 5 animals subcutaneously infected with strain NIA-3, yielded infectious virus after titration extracts of organs (table 1, experiment 2). This could mean that the virus is transported from the Central nervous system in these bodies. The absence of infectious virus in the organs of mice infected subcutaneously strain M105, perhaps, indicates that there is a delay in the transport of this is that 50 gp required for penetration, but not to spread from cell to cell (Peeters et al., J. Virol. 66, 894-905 (1992)), assume that the same thing occurs in the case of infection in vivo. Although the possibility that gp 50 not important for penetration in vivo, it is highly unlikely, we had to prove formally that in this case, gp 50 is also required for primary infection. To study the involvement of gp 50 used line R122, growing on complementary SR-6 cells and, therefore, not containing 50 gp (R122-; see above). Because 105pfu R122+consistent with 3,3 106physical particles, we used the same number of particles R122-for insulinopenia mice. As expected, all mice, injected intraperitoneally or subcutaneously, R122+died (table 1, experiment 3). However, all mice infected R122-survived after intraperitoneal infection, while one out of five mice died after subcutaneous infection. These results indicate that the presence of gp 50 in the shell of the virus is necessary for the successful infection of animals.

Study of the animal, which died after infection R122-showed that the virus was present in the brain, i.e., infectious virus was still present in the inoculum. During the titration of the inoculum in two what immunohistochemistry, these plaques were formed 50 gp mutants. The possible origin of these infectious virions discussed above. Because LD50strain NIA-3 PRV after intraperitoneal infection is approximately 70 pfu (plaque-forming units), it is possible that particles of infectious virus present in the inoculum R122-responsible for airborne infection, one died in this embodiment, the mouse.

f. The virus is unable to produce infectious progeny and unable to spread transmission from cell to cell, is avirulent for mice

Previously, we showed that similar to a gp 50 null mutant replication gII or gH null mutants of PRV in complementary cell lines resulted in the formation of non-infectious virions (Peeters et al., J. Virol. 66, 894-905 (1992); Peeters et al., J. Virol. 66, 3388-3892 (1992)). However, in contrast to gp 50 mutants gII and gH mutants were unable to form plaques on complementary cells. This discovery indicates that gII and gH is required for the transmission of the virus from cell to cell. To determine whether the transmission from one cell to another is also a necessary condition for the successful spread of the virus in vivo, we used phenotypic complementary gII null mutant B05pfu B145 virus none of the animals had not found any signs of Aujeszky's disease (table 1, experiment 3). This result suggests that the virus that is unable to produce infectious progeny and unable to spread transmission from cell to cell, is avirulent for mice.

Example 5

The virulence and immunogenicity 50 gp mutants and 50 gp + gp 63 mutants in pigs

To study the virulence and immunogenicity of the mutant strains of pigs was inoculable strains R122+, D560 and D1200. Strain M209 wild-type and gp 63 mutant M102 (Fig. 1) (Kimman et al., J. Gen Virol, 73, 243-251 (1992)) was used as control. After immunization, animals were infected by the virulent strain NIA-3 PRV.

A group of 5 4-6-week-old pigs (Dutch landrace pigs from nestorgames specific pathogens herds Central Veterinary Institute) were infected intranasally 105pfu of the virus by slow injection of 0.5 ml of the virus suspension into each nostril while inhaling. 4 weeks after vaccination of pigs were infected intranasally 105pfu virulent strain NIA-3 PRV. Pigs were examined for the presence of clinical signs twice daily and measured rectal temperature daily. Three Rania and neurological signs. The period of inhibition of growth was determined as the number of days needed to restore the weight of the animal on the day of infection. Fever was defined as rectal temperature exceeding 40oC. Neurological signs considered itching, ataxia, paralysis, tremor and convulsions (seizures).

Pigs infected with the strain M209 wild-type, developed symptoms typical of Aujeszky's disease, such as fever, loss of appetite, growth retardation and neurological signs such as ataxia and paralysis (table 2). Mutants R122+and M102 caused short periods of fever and stunting, but did not cause neurological symptoms. Mutants D560 and D1200 did not cause the appearance of neurological signs, as well as heat or stunted growth. These results indicate that gp 50 gp 63 mutants D560 and D1200 were absolutely avirulent for pigs, whereas gp 50 mutant R122+and gp 63 mutant M102 had significantly reduced virulence compared to the wild-type PRV.

Pigs vaccinated with strains R122+and M102, found no heat or delay growth and found no clinical signs after infection NIA-3 (table 3). Pigs vaccinated D1200, found short who were sluggish in a few days and two pigs vomited. Pigs from unvaccinated control group encountered heavy signs of Aujeszky's disease and relatively long periods of feverish condition and stunting; two pigs died (table 3). These results indicate that pigs vaccinated with 50 gp mutant R122+and gp 63 mutant M102, were fully protected against clinical signs of Aujeszky's disease, whereas pigs vaccinated with 50 gp + gp 63 mutants D560 and D1200, were partially protected against clinical signs of Aujeszky's disease.

These examples show that gp 50 PRV is important for the infectivity of the virus (penetration), but not for transmission from cell to cell. Phenotypic complementarian 50 gp mutants and 50 gp + gp 63 mutants were able to replicate and spread in infected animals. However, the progeny virus released from infected cells, is non-infectious and, therefore, infected animals are unable to spread of infectious virus. This property together with a wide range of hosts PRV and the ability to transfer large amounts of foreign DNA makes 50 gp mutants of PRV ideal for making reliable vaccine carriers against Aujeszky's disease and other diseases the n shell EI virus cholera pigs (swine)

To test whether gp 50 mutant with a deletion to be used as a virus vector for expression of heterologous genes, 50 gp gene of strain NIA-3 PRV was replaced by a DNA fragment containing a gene EI nod Cholera Virus (HChV= classical swine fever) under the transcriptional control of the hCMV promoter.

ScaI fragment-DraI (ScaI site in position 317-322 gene gX, the numbering of the nucleotide sequence Rea et al., J. Virol. 54, 21-29 (1985); Dral site in position 1181-1186 between genes gp 63 and gI, the numbering of the nucleotide sequence Petrovskis et al., J. Virol. 60, 185-193 (1986)) of the Us district PRV cloned into blunt NdeI site of plasmid pVC19M (Clontech). Using site-specific mutagenesis in vitro (Transformer kit, Clontech) were created sites recognition unique restrictase directly in front of the gene gp 50 and immediately behind the gene gp 50. Using mutagenic primers 5'-AGGTTCCCATACACTAGTCCGCCAGCGCCATGC-3'(SEQ ID No. 3) and 5'-CCCGGTCCGTAGCCTAGGCAGTACCGGCGTCG-3' (SEQ ID No. 4) were created sequence recognition for restricted SpeI (ACTAGT) and AvrII (CCTAGG) in provisions from -17 to -12 and from 1210 to 1215, respectively (numbering of the nucleotide sequence of the gene gp 50 according Petrovskis et al., J. Virol. 59, 216-223 (1986)). Gene gp 50 was deleterows digesting plasmid DNA with restrictase SpeI and AvrII and was replaced by the synthetic fragment obtained by annealing (hybridization) equimolar amounts of the two single-stranded oligonucleotides with the sequences 5'-CTAGTAATTCGATATCAAGCTTC-3' (SEQ ID No. 5) and 5'-CTAGGAAGCTTGATATCGAATTCA-3' (SEQ ID No. 6), respectively. Then NcoI- > PST fragment (NcoI site at position 883-888 gene) gX, the numbering of the nucleotide sequence Rea et al. , J. Virol. 54, 21-29 (1985); > PST site position 439-444 gene gp 63, the numbering of the nucleotide sequence Petrovskis et al., J. Virol. 60, 185-193 (1986)) containing a deletion gp 50, was cloned in the plasmid pG EM5Zf(+) (Promega) after digestion of the latter plasmid NcoI and > PST. The obtained plasmid was named pBP53.

EI gene HChV was obtained from a cDNA clone of strain Brescia HChV (Moormann et al. , Virology 177, 184-198 (1990)). This gene was cloned in the form of DsaI-EcoRV fragment Dsal website filled fragment maple DNA polymerase IE. coli; nucleotides 2337-3804 according to the numbering of the nucleotide sequence Moormann et al., Virology 177, 184-198 (1990)) between the EcoRI site (filled fragment maple DNA polymerase IE. coli) and EcoRV site of plasmid pEVhis 13. The latter plasmid is produced from a plasmid pSV2his (Hartman and Mulligan, Proc. Natl. Acad. Sci. USA 85, 8047-8051 (1988)), which contains the hCMV promoter, followed by the start codon ATG, and a number of unique restriction sites and stop codons translation in all three reading frames (Peeters et al. , J. Virol. 66, 894-905 (1992); see also example 1). In the resulting plasmid EI gene fused in the same reading frame with the start codon pEVhis13. This plasmid was named pEVhis13 HCVEI (Fig. 2). After parivartana broadcast. HpaI- > PST fragment was treated with T4 DNA polymerase for the formation of blunt ends and then cloned into the EcoRV site pBP53. A plasmid in which this fragment was embedded in such an orientation that the direction of transcription EI gene was similar to the direction of transcription of the gX and gp 63 genes pBP53, was dedicated and named pBP53 EI (Fig. 3).

To determine whether the cloned EI gene, were temporary expression EI in G5 cells. The cells were transfusional the plasmid pBP5XEI or plasmid pEVhis13 HCVEI using lipofectin (GIBCO BRL). After 2 days the monolayers of cells were fixed and the expression EI tested immunological staining using monoclonal antibodies 3 and 4, conjugated to horseradish peroxidase-specific glycoprotein EI HChV (Wensvoort, J. Gen. Virol. 70, 2685-2876 (1989)). The expression of EI cells, transfitsirovannykh pBP53 EI, was clearly visible and the staining was even more intense than the staining of cells transfected pEVhis13 HCVEI. These results showed that EI effectively expressively inside pBP53 EI, i.e., when planirovanie sequences PRV.

Plasmid pBP53 EI digested plasmids PvuII and > PST and co-transfusional together with the viral DNA of strain NIA-3 PRV in G5 cells using lipofectin. Two days later, when the and temporal expression. The presence of the painted plaques showed that EI gene is transferred into the viral genome by homologous recombination, and that EI gene expressively recombinant viruses. For selection of recombinant virus experiment with the transfection was repeated and highlighted the 400 individual plaques. To identify recombinants expressing EI, some of these isolates were transferred to microtiter plates, containing SK-6 cells. After incubation for 2 days, plaques were visible and infected monolayers were fixed and tested on the expression EI immunological staining. Finally, the recombinant virus expressing EI, was cleared of plaque from the original isolates, which gave the painted plaques on the SK-6 cells.

It was shown that recombinant PRV vaccine strain expressing EI HChV, protects pigs against classical swine fever after infection HChV (van Zijl et al., J. Virol. 65, 2761-2765 (1991)). On the basis of these discoveries retransmissions expressing EI 50 gp mutant with a deletion described above, will also be able to induce a protective immune response against classical swine fever in pigs.

1. The use of mutant gp50 Pseudorabies virus as the source of the mutant for the within the mutation in the gene gp50, as a result of which the specified mutant unable to Express a functional protein gp50.

2. Application under item 1, characterized in that the Pseudorabies virus in addition to mutations in the gp50 gene carries a mutation in one of its other genes, such as gp63 gene or gene gl.

3. A method of obtaining a vector vaccines against diseases other than Aujeszky's disease containing the mutant gp50 of Pseudorabies virus with a mutation in the gene gp50, by including gp50 heterologous nucleotide sequence that encodes the antigen or the part of the antigen derived from the pathogen that induces disease different from Aujeszky's disease.

4. Vector vaccine for the prevention and/or treatment of a disease caused by swine pathogen, including mutant gp50 Pseudorabies virus containing glycoprotein gp50 with a mutation in the gene gp50, and having an insert, including heterological nucleotide sequence encoding the antigen or the part of the antigen derived from the pathogen that induces disease different from Aujeszky's disease, a carrier and, optionally, other components such as stabilizers, adjuvants, solvents and emulsifiers.

 

Same patents:

The invention relates to medicine, namely to methods of specific prophylaxis of viral infections

The invention relates to the field of genetic engineering and biotechnology, in particular, to obtain the recombinant plasmid DNA RS-NS3 integrating the complex of genes C, prM, E, NSI, NS2A, NS2B, NS3 virus tick-borne encephalitis (tick-borne encephalitis) into the genome of vaccinia virus (WWII), and the corresponding strain of the great Patriotic war

The invention relates to methods and compositions for improved biological control of insect pests

The invention relates to biotechnology, in particular genetic engineering, and is a recombinant phage DNA M13polT7, containing the gene for RNA polymerase of phage T7 and strain of phage M13polT7 producing RNA polymerase of phage T7

The invention relates to medicine and can be used for selective destruction of cells infected with RNA of hepatitis C virus(HCV)

The invention relates to medicine, namely to methods of specific prophylaxis of viral infections

The invention relates to genetic engineering, namely genetic engineering methods for producing antithrombin polypeptides, used for the treatment of venous thrombosis

The invention relates to biotechnology and can be used to produce vaccines

The invention relates to the field of genetic engineering and biotechnology, in particular, to obtain the recombinant plasmid DNA RS-NS3 integrating the complex of genes C, prM, E, NSI, NS2A, NS2B, NS3 virus tick-borne encephalitis (tick-borne encephalitis) into the genome of vaccinia virus (WWII), and the corresponding strain of the great Patriotic war

The invention relates to biotechnology, in particular genetic engineering, is a recombinant plasmid pCVA designed for the transcription of the genes of the ribozymes in the composition of sequences of virus-associated PHK (VA PHK) adenovirus birds FAV1 (CELO) in eukaryotic cells

The invention relates to biotechnology, in particular genetic engineering, is a recombinant strain of vaccinia virus, causing the synthesis of structural proteins of the virus Venezuelan encephalomyelitis of horses (VAL) in infected cells and protective immunity against VAL have them vaccinated laboratory animals, as well as the method of construction of this strain
The invention relates to medicine, in particular to immunology

The invention relates to medicine and for the production of therapeutic drugs from plasma or serum of donor blood, namely, the method of obtaining lgM-containing concentrate of immunoglobulin

The invention relates to medicine, namely to trombozitopatiam the chimeric immunoglobulins and their application

The invention relates to medicine and biology and can be used to stimulate an immune response in laboratory animals
Up!