Recombinant plasmid dna psav27 encoding the synthesis of soluble streptavidin from streptomyces avidinii, and bacterial strain escherichia coli producing soluble streptavidin from streptomyces avidinii

 

(57) Abstract:

The invention relates to the microbiological industry, medical biotechnology and genetic engineering. The proposed recombinant plasmid DNA pSAV27 encoding the synthesis of soluble, secreted in periplasm streptavidin, on the basis of which the engineered Escherichia coli strain VKPM B-7758, which is the producer of streptavidin. 1 - 14 h of fermentation of this strain accumulates in the culture fluid 180 - 240 mg/l of streptavidin. 2 C. p. F.-ly, 3 ill.

The invention relates to the microbiological industry, medical biotechnology, genetic engineering and is a engineered in vitro recombinant plasmid DNA, providing heterologous expression of soluble streptavidin from Streptomyces avidinii, and containing recombinant plasmid strain of Escherichia coli producing streptavidin.

Streptavidin (SAV) is chetyrehtysyacheletny non-protein that specifically binds vitamin H (d-Biotin) [Biochemistry. 1992. V. 31. P. 9350-9354]. The biological function of this protein in cells of S. avidinii not fully elucidated, but it is assumed that he, like glycoprotein avidin (a protein of eggs), plays protective of obnarujeny in S. venezuelae [Biochim. Biophys. Acta, Gene Struct. Expr. 1995. V. 1263. P. 60-66].

Tetramer protein streptavidin binds four molecules of Biotin (Kd= 10-15). In modern medicine and biology this property streptavidin is widely used when creating a range of products intended for highly sensitive nonradioactive detection of biomolecules [Bioorgan. chemistry. 1989. So 15. C. 354-357; Clin. Chem. 1991. V. 37. R. 625-636; Proc. Natl. Acad. Sci. 1995. V. 92. P. 7590-7594]. Recently, increased attention is called research aimed at the creation of therapeutic drugs based on the streptavidin used in the treatment of human cancers. The study of the distribution of streptavidin when exogenous introduction in mammals, on the selective accumulation of SAV in the human kidney [Kidney Intern. 1995. 47. P. 1327-1335], as well as on the use of streptavidin in chimeric constructs as a protein carrier that is attached to the addressing part and therapeutic agent is a chemical or protein nature [Proc. Natl. Acad. Sci. 1992. V. 89. P. 1534-1538; Bioconjugate Chem. 1995. V. 6. P. 139-144].

Industrial receiving streptavidin is now based on the cultivation of S. avidinii ADS 27419 and has a number Asistencia when the binding of Biotin. In addition, long cultivation producer S. avidinii (5 - 8 day) and high natural antibioticassociated genus Streptomyces (resistant to a range of standard available selective agents) makes the process not effective [Proc. Natl. Acad. Sci. 1980. V. 77. R. 4666-4668; Biochem. Biophys. Methods. 1986. V. 13. P. 103-112; J. lmmunol. Methods. 1988. V. 113. P. 83-91].

To date, studies aimed at overcoming the above drawbacks and create a cheaper source of recombinant streptavidin, not containing impurities of Biotin. The nucleotide sequence of the streptavidin gene from S. avidinii known [Nucleic Acids Res. 1986. V. 14. P. 1871-1882], the literature describes a number of producers of recombinant streptavidin, its mutant forms, and chimeric proteins based on it [Gene. 1993. V. 136. R. 243-246; Proc. Natl. Acad. Sci. V. 87. R. 142-146; BioTechnology. 1995. V. 13. P. 11]. However, the optimal design expression plasmids for producing streptavidin was not found. The closest equivalents to the claimed group of inventions are recombinant plasmid DNA and producing strains of streptavidin in the work of T. Sano, C. Cantor [Proc.Natl. Acad.Sci. 1990. V. 87. R. 142-146], which shows the receipt of the producer of recombinant streptavidin-based cells of E. coli. Pervonachalnoj part, and an additional fragment of plasmid DNA encoding 25 amino acids. The obtained protein was not detected primary biological function of streptavidin - binding Biotin. The authors have abandoned the use of the fragment leader peptide, suggesting that either the leader peptide or peptide fragment encoded by plasmid DNA, leading to inactivation of the protein. Further design led to the preparation of recombinant plasmid under the regulation of the inducible promoter closed gymnasium T10 cloned only the structural region of the gene of streptavidin from the 15th amino acid of the Mature protein. Disadvantages strain of E. coli that produce the streptavidin on the basis of the above expression system are:

1) accumulation of streptavidin in the cytoplasm of cells in the insoluble biologically inactive in the composition Taurus inclusion, and therefore further isolation and purification of this protein require several stages of denaturation-renaturation using ionic detergent type handinhand, which can lead to irreversible loss of biological activity of the protein, reduces the yield of the final product and increases its cost.

2) a low level of accumulation of SAV, which is the creation of an effective producer of streptavidin on the basis of strains of E. coli, ensuring a high level of accumulation of the protein in a biologically active soluble state.

For solving the problem of getting the recombinant plasmid DNA pSAV27 consisting of a fragment of the chromosomal DNA of Streptomyces avidinii, including the structural part of the streptavidin gene (the nucleotide sequence of the leader peptide in conjunction with nucleotide sequence of a Mature protein) and multicopying vector for highly effective gene expression of streptavidin in the cells of E. coli. And leader peptide protriptyline provides secretion protriptyline in periplasmatic space of the cells of E. coli, where the cleavage of the leader peptide and streptavidin is localized in a biologically active soluble state. The strain E. coli JM110, transformed with recombinant plasmid pSAV27 for 12-14 hours of fermentation at 37oC on semi-synthetic medium accumulates 180-240 mg soluble streptavidin for 1 l culture fluid. The observed effect is achieved, firstly, by introducing into the recipient cell is E. coli multicopying vector (the number of copies of the cloned gene is 300-500 copies per genome equivalent), and secondly, through the use of the SIL the frame of the gene, and, thirdly, through the use of a leader peptide streptavidin, resulting in excretion of the protein product in periplasm and post any soexciting his removal.

The inventive strain of E. coli JM110/pSAV27 deposited in Russian national collection of industrial microorganisms and has a registration number VKPM B - 7758.

Construction of strain consisted of several stages.

Step 1. Selection from Streptomyces avidinii M170791 DNA fragment encoding the leader peptide streptavidin, together with the Mature protein (prostration), and the introduction to this movie sites for restriction endonucleases.

Step 2. Construction of recombinant plasmids SAV27 which main characteristics are high chopinot (300-500 copies per genome equivalent), convenient selective marker (ampicillinresistant), a strong promoter that provides strains of E. coli efficient expression of cloned gene streptavidin.

Step 3. Transformation of E. coli strain JM110 constructed recombinant plasmid, confirmation of compliance with the nucleotide sequence of the cloned gene streptavidin, together with the leader sequence of the natural gene from S. avidinii.

Step 5. Determination of biological activity of soluble streptavidin produced by E. coli strain VKPM B-7758.

The E. coli strain VKPM B-7758 has the following cultural-morphological and physiological - biochemical characteristics.

1. Morphological features. Cells are straight rods, 1,1-1,5 2.0 to 6.0 μm, moving through puritanically flagella, gram-negative, risperadone.

2. Cultural characteristics. Cells of strains grow well on standard described for E. coli environments. When grown on complete agar medium (LB agar, agar environment Hottinger) colony shiny, smooth, round, with smooth edges. At 37oC enough 12 - 14 hours of growth. When grown in liquid medium in test tubes cells form a uniform haze, reaching an optical density of 2.4 to 2.6 when A600for 10-12 hours growth at 37oC.

3. Physiological and biochemical characteristics. The temperature optimum for growth of the cells of the 37oC, optional gone anaerobic, oxidatively, catalanopolonesa, negative signs of the formation of H2S, hydrolysis of urea and the activity of lipase, catabolizing D-glucose and other carbohydrates with the production of acid and gas, istochnikov, yeast extract and amino acids.

4. Genotypic characteristics.

The main genotypic characteristic of the proposed E. coli strain VKPM B-7758 (thi, thr, leu, lacY, supE44, galK, tonA, recA, dam, dcm, (lac-proAB), [F', traD36, proAB, lacIqZM15] ) is under the control of the promoter of the gene fragment udp from E. coli nucleotide sequence of the coding region of the gene of streptavidin with leader sequence, integrated into mnogoopytnogo expression vector, containing a selective marker gene-lactamase.

5. Resistance to antibiotics. Resistance to ampicillin in strain not less than 150 µg/ml on solid agar media, while building in full liquid environments - not less than 100 µg/ml.

6. The stability of plasmids pSAV27 in E. coli strain VKPM B-7758.

When storing cells on agar medium (up to 1 month), when a series of successive subcultures (for at least 6 months) and during cultivation in liquid medium with antibiotic not loss and rebuilding plasmids pSAV27.

The process of biosynthesis of streptavidin in strains of E. coli includes the stage of obtaining seed, the main fermentation, the allocation of biomass and getting peril Aut in aerobic conditions conventionally used for culturing E. coli nutrient media, containing assimilated sources of carbon, nitrogen, mineral salts, growth factors, for example, in the form of tryptone, peptone, yeast autolysates, or extracts. In the nutrient environment contribute ampicillin at a concentration of 100 mg/L. Biomass is grown at a pH of 7-7.4 and a temperature of 37oC to the concentration determined by the composition of the nutrient medium and mass transfer characteristics of the fermenter.

After completion of fermentation, the bacterial cells are separated from culture medium by centrifugation and resuspended in the appropriate buffer solution, and then separated by centrifugation periplasmatic fraction of soluble proteins (supernatant), which is used for subsequent selection of the target product. To do this, use the methods of ion-exchange chromatography on a column of Q-separate, or affinity chromatography on a column with 2 iminobiotin. Data cleaning methods provide a high yield of the target protein and its 95-97% purity. The degree of purification of streptavidin in the allocation process analyzed by SDS-polyacrylamide electrophoresis. The yield of the final product is 180-240 mg/l of culture fluid. Determination of N-terminal sequence be the s amino acids carried out by HPLC on columns "Bond PTH".

The claimed group of inventions is illustrated by the following figures of graphical images.

Fig. 1. Physical-genetic map of the recombinant plasmid pSAV27.

Recombinant plasmid constructed using the following DNA fragments: 1). Sac1-Sa1G1 fragment (size 2684 N. p.) plasmid pUC18, which contains the pMB1 replicon, rop gene involved in the regulation of the copy number of plasmids, gene-lactamase, which determines resistance to the antibiotic ampicillin. The fragment obtained by restriction of the plasmid pUC18. 2). Sacl-BamHI fragment (about the size of 169 N. p.) promotor region of the gene urediniospores from E. coli containing all of the elements required for efficient initiation of transcription and translation. The Sac1 sites and BamH1 introduced in promoter fragment by PCR. The fragment obtained by the method of restriction designed us plasmids pUU18 [Bioorgan. chemistry. 1995. So 21. C. 354-358]. 3). BamH1-Sa1G1 fragment (size 571 N. p.) streptavidin gene comprising the nucleotide sequence of the leader peptide. Sites for BamH1 and Sa1G1 entered upon receipt of a fragment by PCR.

Fig. 2. Electrophoretic separation in denaturing 12% SDS page of fractions of cellular proteins of Escherichia coli.

Proteins periplasmatic (lanes 1 and 2), qi is ipient (tracks 1, 3, 5). M - protein markers with molecular masses 66, 45, 36, 29, 24, 20.1, 14.2 kDa. The arrow shows the band corresponding to the streptavidin (lane 2).

Fig. 3. Electrophoretic separation in 12% SDS page dedicated purified streptavidin.

Electrophoretic mobility of purified streptavidin under denaturing (A2) and adenocarinoma (A3) conditions. Staining of the gel Kumasi blue. Radioautogram electrophoretic separation Undenatured complex purified with streptavidin abioterrorism (B2) and biotinylated (B1) radioactively labeled oligonucleotide. A1 - marker proteins 16.4, 14.4, 10.6, 8.1, 6.2 kDa. SAV-olig - complex streptavidin-radioactivedecay biotinylated oligonucleotide. Olig - radioactivedecay abietinaria oligonucleotide in the absence of binding with streptavidin.

The claimed group of inventions is illustrated by examples.

Example 1. The selection of a DNA fragment containing the structural part of the gene streptavidin, and the introduction of plots for recognition restriction endonucleases.

A fragment of the streptavidin gene comprising the nucleotide sequence of the leader peptide and the coding region of streptavidin floor is such oligonucleotides (1) 5'CGTGGGATC CATGCGCAAAATCGTCGTTG3' and (2) 5'CGGGGTCGACTTACTGCTGAACTGC GTC3'. Amplication mixture (50 μl) contains 10 mm Tris-HCl (pH 8.4), 0.5 mm MgCl2, 50 mm KCl2, 0.2 mm dNTP, 10 ng of chromosomal DNA of S. avidinii, 50 pmol of primers (1) and (2), 2.5 units of the act. Taq polymerase. Mode amplification (oC/s): 1 cycle -95/120 - denaturation of chromosomal DNA; 7 cycles of denaturation 95/10, annealing 48/10, elongation 72/30; 25 cycles of denaturation 95/10, annealing 60/10, elongation 72/30. The obtained DNA fragment size 571 N. p., encoding the structural part of the gene protriptyline, isolated by preparative electrophoresis in 1.2% agarose gel. In the oligonucleotides in the synthesis of introducing the nucleotide sequence of the sites of the restriction endonucleases BamH1 and Sa1G1 necessary for the subsequent cloning of the gene in the composition expression vector.

Example 2. Construction of recombinant plasmids pSAV27 and receiving E. coli strain VKPM B-7758 - producer soluble streptavidin.

To prepare the expression vector used multicopying plasmid pUC18 [Maniatis T. and other Molecular cloning. M.: Mir, 1984], the replicon which under favorable conditions, provides for the accumulation of up to 300-500 copies of plasmid DNA per cell. For this purpose, plasmid DNA pUC18 digested with restrictase Sac1 and BamH1 under conditions recommended by the manufacturer is 1 and BamH1 from a previously obtained [DAN. 1994. So 339. N. 4. C. 1-3; Bioorganic chemistry. 1995. So 21. N 5. C. 354-358] plasmids pUU18 because the DNA fragment of the promoter udp provides an efficient transcription of both homologous and heterologous genes in E. coli.

After transformation and selection of the target clone containing plasmid DNA with a promoter udp, the received vector is split by restrictase BamH1 and Sa1G1 and are ligated as described in example 1 and split across sites BamH1 and Sa1G1 a DNA fragment comprising the structural part of the gene of streptavidin with a leader sequence. The transformation is carried out in a competent culture of the strain E. coli JM110 (VKPM B-6527). Transformation efficiency is about 105clones 1 μg of plasmid DNA. Transformants are selected on medium containing ampicillin, changing the genotype determined by PCR using primers (1) and (2), the structure of which is given in the description of example 1.

Selected from the target plasmid clones identified pSAV27 (Fig. 1). The nucleotide sequence of the cloned fragment is confirmed by sequencing according to Sanger [J. Mol.Biol. 1975. V. 94. P. 441-446]. The determination of the level of accumulation of streptavidin and its localization in the cells of the producer strain examined by electrophoresis in 12.5% SDS page under denaturing conditions the keys 100 μl of buffer, containing 30 mm Tris HCl pH 8.0, 5 mm EDTA pH 8.0, 20% sucrose, 1 mg/ml lysozyme. After incubation of the cells for 10 min in an ice bath, the suspension is centrifuged (12000 g, 1 min), selected supernatant represents periplasmatic cell fraction. To the precipitate add 100 ál of 100 mm Tris HCl pH 8.0 and three times conduct rapid freezing at - 70oC, and slow thawing at 37oC. After centrifugation the supernatant contains the total proteins of the cytoplasmic fraction of cells and precipitate proteins in membrane fractions. To solubilize membrane proteins to the precipitate add 100 ál of 1% Triton X-100. Until analyzed in SDS page fraction stored in ice. Analysis of the compositions of the fractions under denaturing 12.5% SDS page showed (Fig. 2), which is described expression system leads to the accumulation of streptavidin (protein size 18 kDa) in periplasmatic space cells of the producer strain. When this protein remains active, as evidenced by experiments on binding biotinidase of the oligonucleotide (see example 4) total proteins of the corresponding fractions of the cells of the producer strain.

In the above-described procedures get producing strains of soluble streptavidin coli VKPM B-7758.

For preparative developments streptavidin, and determine the productivity of the strain plateosauridae cells grown on agar LB-medium with ampicillin (150 µg/ml) at 37oC for 12-14 hours, then use a grown biomass for obtaining seed. For this cell is transferred into an Erlenmeyer flask with 750 ml 100 ml LB-medium containing 2 g/l glucose and 100 μg/ml ampicillin. The culture is grown on the rocking chair with vigorous stirring at 37oC to a density of 2.4 - 2.6 if A600. The main cultivation is carried out in fermenters "Anglicon with a volume of 750 ml of medium of the following composition, g/l: bactopeptone - 20, yeast extract 5, NaCl - 6, (NH4)2SO44, K2HPO4- 2, MgSO4- 0.4, FeSO4- 0.02, MnSO4- 0.02. The fermentation is carried out in conditions of thermo - and pH-strirovaniya dose planting 2%, ampicillin to 100 μg/ml, dissolved oxygen in the medium is maintained at the level of 5%, as a carbon source use glucose in the fractional flow in the amount of 1-2 g/l/hour, maintaining the pH 7.0-7.2 achieve automatic poltically ammonia water, at 37oC culture grow for 12-14 hours.

After fermentation, the biomass is separated centrifuging staticheskoi fraction of cells. To do this, cells are suspended in buffer containing 30 mm Tris-HCl pH 8.0, 5 mm EDTA pH 8.0, 20% sucrose, 1 mg/ml lysozyme, incubated 10 min in an ice bath and centrifuged at about 6-10 thousand. The supernatant is used for the production of purified streptavidin method of affinity chromatography on columns with 2 minoritymajority ("Sigma") and to determine the productivity of the strain by the method of SDS-page, which is 180 mg of streptavidin, accumulating in 1 liter of culture fluid.

Purification of streptavidin proteins from periplasmatic faction carried out using 2-iminobiotin. To this end, periplasmatic faction transferred using ultrafiltration cell "Amicon" with a YM30 membrane in a buffer of the following composition: 0.5 M NaCl, 50 mM Na2CO3, pH 11.0. A column containing 10 ml of gel 2-iminobiotin balance buffer 0.5 M NaCl, 50 mM Na2CO3, pH 11.0, make periplasmatic fraction and the column washed with 50 ml of 1 M NaCl (pH 7.0). The elution of streptavidin lead a buffer containing 50 mM CH3COOH, pH 4.0. Suirvey streptavidin transferred to the buffer 5 mM Tris-HCl, pH 7.5, containing 0.01% NaN3in the cell ultrafiltration YM30 membrane, and dried on the plant for lyophilization "Hetosicc (USA). The level of treatment davidina, produced by E. coli strain VKPM B-7758.

To study the binding obtained with streptavidin d-Biotin using synthetic biotinylated oligonucleotide obtained by the previously proposed scheme [Bioorgan. chemistry. 1991. So 17. C. 625-629].

< / BR>
This oligonucleotide contains a Biotin residue, introduced by mezhnukleotidnyh phosphate group, which allows additional radioactive labelling phosphorylation with polynucleotide kinase bacteriophage T4 and [32P]ATP. After complexation (can withstand a mixture of the oligonucleotide to streptavidin at room temperature for 10 min) the mixture is separated in a SDS page and the resulting complex is detected by radioautography. This approach allows measuring the radioactivity of the respective areas of the page to conduct a comparative quantitative assessment of the efficiency of binding. The obtained data confirm that the selected recombinant streptavidin binds 3.7 - 3.8 mmol remainder of Biotin per 1 mmol of the streptavidin tetramer, which corresponds to almost full biological activity.

As shown by analysis of the N-terminal sequence of the selected protein, flake the locations of the cleavage-S-A-S-A24/25D-P-S-K - S. avidinii [Nucl. Acids Res. 1986. V. 14. P. 1871-1882].

Thus, the claimed group of inventions allows you to get streptavidin in bacterial cells of E. coli as a soluble protein with full biological activity and in quantities of three or more times greater than those of the closest analogue.

1. Recombinant plasmid DNA pSAV27 encoding the synthesis of soluble streptavidin, having a length 3424 p. N. and consisting of the following elements: a) Sacl-SalG1-fragment (size 2684 p. N.) plasmid pUC18 (contains the pMB1 replicon, mountains gene involved in the regulation of the copy number of plasmids, gene-lactamase, which determines resistance to the antibiotic ampicillin); b) Sacl-BamH1 fragment (size 169 N. p.) promotor region of the gene urediniospores from E. coli containing all of the elements required for efficient initiation of transcription and translation;) BamH1-SalG1-fragment (size 571 N. p.) coding region streptavidin gene comprising the nucleotide sequence of the leader peptide, obtained using synthetic primers with the nucleotide sequence 5'CGTGGGATCCATGCGCAAAATCGTCGTTG3' and 5'CGGGGTCGACTTACTGCTGAACTGCGTC3'.

2. Bacterial strain E. coli VKPM B-7758 - producer soluble streptavidin from St

 

Same patents:

The invention relates to molecular biology and biotechnology

The invention relates to biotechnology

The invention relates to biotechnology

The invention relates to biotechnology

The invention relates to biotechnology and genetic engineering

The invention relates to biotechnology and can be used to produce interferon

The invention relates to the field of biochemistry and biotechnology and can be used to obtain tumor necrosis factor-beta (TNF-beta)

The invention relates to genetic engineering, namely genetic engineering methods for producing antithrombin polypeptides, used for the treatment of venous thrombosis

The invention relates to biotechnology, protein engineering and medicine, specifically to obtain the crustal antigen of hepatitis B virus(HBcAg), allowing to expose on the surface of the alien epitopes

The invention relates to biotechnology, in particular genetic engineering, and is designed in vitro recombinant plasmid DNA containing the synthetic gene for granulocyte-macrophage colony-stimulating factor, human (GM-CSF), tandem promoters (ptrpx2) tryptophan operon of E. coli and synthetic sites of translation initiation, contributing to the efficient biosynthesis of the polypeptide with the biological activity of GM-CSF, and Escherichia coli strain producer of this polypeptide
The invention relates to the field of biotechnology, in particular genetic engineering, and can be used to create the plasmid and the corresponding strains-producers of recombinant proteins, as well as for purification of protein products
Up!