Recombinant plasmid encoding a hybrid protein, the precursor of human insulin (options), the bacterial strain of e. coli producing a hybrid protein is the precursor of human insulin (options), a method of producing human insulin

 

(57) Abstract:

The invention relates to biotechnology. Created new recombinant plasmids expressing a hybrid protein in which the amino acid sequence of the leader peptide, which represents an IgG - binding domain of protein A, and human proinsulin connected by two arginine residues (plasmid pRRproins) or residues of lysine and arginine (plasmid - pKRproins). Human insulin is produced by the method comprising culturing the strain E/coli IM-109-pRRproins carrying plasmid pRRproins, or strain E/coli IM-109-pKRproins carrying plasmid pKRproins, separation of inclusion bodies, solubilization, sulfites and denaturirovannaya heritage protein purification denaturirovannogo hybrid protein by the method of ion exchange chromatography, and its trypsin-like cleavage, carboxypeptidase-B-like enzymes and insulin secretion. The invention simplifies the process of obtaining human insulin and increases the release of insulin. 5 c. and 1 C.p. f-crystals, 4 Il.

The invention relates to the field of biotechnology and concerns the means for receiving recombinant human insulin.

Insulin is a pancreatic hormone, is a globular protein consisting of the disease is insulin-dependent diabetes mellitus. The only way therapy are regular insulin injections. Initially, for these purposes, use only the insulin of animal origin, secreted from the pancreas of farm animals, usually pigs. But this approach does not allow for all those who need regular injections of insulin. In this regard, we developed methods for producing the hormone by means of genetic engineering, based on the creation of cell-based E. coli strains-producers of hybrid protein precursor of human insulin, which in large quantities are accumulated in the cells as inclusion bodies. The hybrid protein comprises a leader peptide and a peptide with the amino acid sequence of proinsulin, in which A - and B-chains are connected by the so-called C-peptide. For the biologically active hormone, you need to split a leader peptide, denaturiruet proinsulin, forming three disulfide bonds, and remove the connecting C-peptide.

Known [FEBS Letters, 402, 1997, 124-130] a method of obtaining a genetically engineered human insulin, based on the cultivation of the strain, producing a hybrid protein in which amino is the overall strain carries a plasmid, obtained in the following way: as the matrix used was a commercially available cDNA library from the pancreas of a person; cDNA hybrid protein was obtained using polymerase chain reaction, the primers were synthesized in such a way as to enter in amplificatory fragment sites restricts BamH 1 and Sal I at the 5'- and 3'-ends, respectively, for cloning in expressing the vector pQE-31 (Qiagene); additionally was introduced triplet that encodes methionine, directly in front of the 5'-end of the sequence encoding proinsulin; amplificatory fragment after cleavage by restrictase BamH I and Sal I, ligated processed in the same restrictases and dephosphorylating vector using T4 DNA ligase. The obtained plasmid was used to transform competent cells of E. coli strain XL2-Blue MRF'. The transformed strain-producer of the hybrid protein was grown in LB medium containing 100 μg/ml ampicillin inducyruya gene expression isopropyl --D - thiogalactopyranoside (IPTG). Upon completion of the cultivation of biomass allocated body switching, hybrid protein was dissolved in 70% formic acid and tsalala leader peptide by the action of bromine cyan. Then the peptide with the amino acid sequence p is ovale. Further purified, denaturirovannyj proinsulin was converted to the biologically active hormone treatment with trypsin and carboxypeptidase B method Kemler. The technological scheme is the most common.

The disadvantages of this process are, first, a multi-stage process, and, secondly, the removal of the leader peptide highly toxic reagent - bromine cyan.

It is known [Journal of Biotechnology, 48, 1996, 241-250] use for obtaining human insulin plasmids pTrpZZ-R-proinsulin, expressing a hybrid protein in which two IgG-binding domains of protein A and peptide sequence of proinsulin is connected via the arginine residue, eliminating in the process flowsheet from the use of highly toxic reagent - bromine cyan. As a host for plasmids in this case were used E. coli cells, strain O17 and receiving insulin included the following stages: cultivation of the producer strain, separation of inclusion bodies, solubilization of the hybrid protein, sulfites and denaturirovannaya hybrid protein and its purification by affinity chromatography on IgG-Sepharose and cleavage of the hybrid protein by trypsin and carboxypeptidase such the prototype method are the use of affinity chromatography, that low-tech large-scale production and low output stages of the enzymatic conversion of the hybrid protein in insulin (44%).

The invention is aimed at simplifying the process of obtaining human insulin with a simultaneous increase in the yield of the final product.

To achieve this result, the method for obtaining human insulin, including the cultivation of E. coli cells, separation of inclusion bodies, consistently the solubilization, sulfites and denaturirovannaya hybrid protein purification denaturirovannogo hybrid protein, its trypsin-like cleavage, carboxypeptidase-B-like enzymes and insulin secretion, thus cultivate a new strain of E. coli JM-109-pRRproins carrying a new plasmid pRRproins, or the second new strain of E. coli JM-109-pKRproins carrying another new plasmid pKRproins, denaturirovannyj protein purified by the method of ion exchange chromatography. To increase the purity of the target product hybrid protein after sulfatase before denaturirovannym it further clear anion-exchange chromatography.

The strain E. coli JM-109-pRRproins carrying plasmid pRRproins, is the producer of the hybrid protein, protein A, and proinsulin person connected by two arginine residues.

The strain E. coli JM-109-pKRproins carrying plasmid pKRproins, is the producer of the hybrid protein in which the amino acid sequence of the leader peptide, which represents an IgG-binding domain of protein A, and proinsulin person connected residues lysine and arginine.

The new recombinant plasmid pRRproins expressing a hybrid protein in which the amino acid sequence of the leader peptide, which represents an IgG-binding domain of protein A, and human proinsulin connected by two arginine residues, has a size 5025 p. O. and consists of the following elements: EcoR I - Hpa I fragment (212 p. O.), encoding a leader peptide, two binder residue arginine and the first two amino acids of the B-chain of insulin; Hpa I-Hind III fragment (257 p. O.), encoding the remainder of the B3-B30 of the B-chain of insulin, C-peptide and a-Nepi insulin; Hind III - EcoR I fragment (4556 p. O.), carrying tac-promoter and the gene for resistance to ampicillin.

Another new recombinant plasmid pKRproins expressing a hybrid protein in which the amino acid sequence of the leader peptide, which represents an IgG-binding domain of protein A, and proinsulin person connected to tiraumea leader peptide, spanning residues lysine and arginine, and the first two amino acids of the B-chain of insulin; Hpa I-Hind III fragment (257 p. O.), encoding the remainder of the B3-B30 of the B-chain of insulin, C-peptide and A-chain of insulin; Hind III - EcoR I fragment (4556 p. O. ), carrying tac-promoter and the gene for resistance to ampicillin.

In Fig. 1 is a diagram of plasmid pNY1, which is the source for obtaining the plasmid pRRproins and pKRproins. In Fig. 2 and Fig.3 shows a schematic construction of plasmids pRRproins and pKRproins respectively. In Fig.4 is a diagram of the technological process of obtaining human insulin.

Plasmids pRRproins and pKRproins obtained by site-directed mutagenesis known plasmids pNY1 [Antibiotics and chemotherapy, 39, 1994, N4, 3-7; Bioorganic chemistry, 18, 1992, N12, 1478 - 1486] that encodes a hybrid protein in which the amino acid sequence of human proinsulin and its leader peptide, which is one IgG - binding domain of protein A, is connected through the remainder of methionine. Plasmid pNY1 (Fig. 1) in the E. coli strain JM-109-I is stored in the culture collections of the State scientific center of antibiotics (GNCA) number of 1864 and, if necessary, extracted from it by the method of Birnboim-Share [Nucleic Acids Res., 7,1979,1513-1523].

The purpose of mutagenesis is: for plasmids plasmid pKRproins - replacement of the same triplet ATG on hexanucleotide AAACGC encoding couple of lysine - arginine (Fig. 3). A fragment of the original plasmid, encoding a leader peptide, amplified by polymerase chain reaction using chemically synthesized oligonucleotides, one of which instead of a triplet CAT corresponding to methionine (referring to the complementary chain), contains hexanucleotide GCGACG corresponding pair arginine-arginine (for plasmids pRRproins) or hexanucleotide GCGTTT corresponding pair lysine-arginine (for plasmids pKRproins). Variable sites in Fig. 2 and Fig. 3 are marked in bold. Amplificatory fragment cleaved by restrictase EcoR I and Hpa I and are ligated into a plasmid pNY1, from which the same sites cut out the original sequence encoding a leader peptide. Each of the obtained recombinant plasmid contains the structural gene of the corresponding hybrid protein expressed under the control of the strong tac-promoter, and the gene for resistance to ampicillin.

Strains-producers of E. coli JM-109-pRRproins or E. coli JM-109-pKRproins obtained by transformation of E. coli cells strain JM-109 respectively plasmid pRRproins or pKRproins. After transformation randomly selected colonies grown on the medium with ampicillin, is OK carrying a plasmid with a given mutation, repeatedly subcultured on a medium with ampicillin and received monoclonal culture inoculant 5 ml of liquid medium with ampicillin. Part of the culture is used to verify induced expression of the hybrid protein by SDS-polyacrylamide gel electrophoresis (SDS page). To the other add the glycerin and the cells stored at minus 40oC.

The obtained strains-producers are characterized by the following features:

Morphological features. Cells are straight, rod-shaped, with a size of about 2 microns, grammatically, risperadone, with distinct inclusion bodies after the induction of the synthesis of a hybrid protein.

Cultural characteristics. Cells grow well on standard LB medium containing lactotropes and yeast extract. On agar LB medium after 24 hours of growth at 37oC are large (3-4 mm) colonies yellowish color. With the growth in liquid medium forms a uniform haze of yellow.

Physiological and biochemical characteristics. Cells grow at 15-39oC with an optimum at 37oC at a pH of 6.8 to 7.0. The carbon source is glucose. Sources of nitrogen - lactotropes, bactopeptone, yeast extract, etc.

Ustoichivy in the strain. While maintaining the cells for 6 months on agar medium containing ampicillin, there is not loss or rearrangement of plasmid influencing the expression of a hybrid protein.

B invented the strains of a hybrid protein is synthesized endogenously in the form of inclusion bodies, and its content is 30-40% of the total cellular proteins.

Invented a method of producing human insulin as follows (Fig.4):

- cultivated strain of E. coli JM-109-pRRproins or E. coli JM-109 - pKRproins on any suitable medium, such as rich media LB medium. Superbroth, TY medium, etc.;

the loop body including, for example, suspending the biomass of cells in a suitable buffer solution, dezintegrarea her and subjecting to centrifugation or micro - or ultrafiltration;

- solubilizing hybrid protein in any suitable solvent that does not violate its primary structure, such as urea solutions, guanidine chloride, phosphoric or formic acid;

- known methods consistently perform sulfites and denaturirovannaya hybrid protein;

- denaturirovannyj hybrid protein is purified by ion-exchange chromatography;

- cleaned denaturirovannyj hybrid is t be a consistent application of these enzymes or the more frequently used one-step method of Kemira [J. Biol. Chem., 246, 1971, 6786- 6791];

- secrete insulin from the reaction solution by any known method, for example preparative reversed-phase (RP) HPLC, cation exchange chromatography on S-Sepharose or Phospho-Biochrome To, anion-exchange chromatography on a TSK-DEAE-650M or Q-Biochrome A, gel chromatography on Sephadex G-50 or a combination of these methods.

To obtain highly purified insulin, corresponding pharmacopoeial requirements, it is advisable after sulfatase before denaturirovannym to expose a hybrid protein purification using anion-exchange chromatography may be performed, for example, on such sorbents, as DEAE-Sepharose, DEAE-Sepharose FF, DEAE-Toyopearl, Mono Q HR, DEAE-Spernit HE, Q-Biochrom.

Thus, the use in the invented method or producer strain, obtained on the basis of the new plasmids pRRproins or producer strain, obtained on the basis of the new plasmids pKRproins, gives the possibility to exclude using technological scheme of highly toxic reagent of bromine cyan and use for cleaning denaturirovannogo protein ion-exchange chromatography instead affinity chromatography on IgG-sepharose that simplifies the process and makes it more ProStreet to increase the yield of the final product per unit of biomass dry cell by reducing the molecular weight of the ballast part of the hybrid protein leader peptide (M. C. hybrid protein in the method-prototype - 25 kDa; M. C. hybrid protein in a contrived way of 16.8 kDa) and due to the greater level of expression (25% - in method prototype to 40% in a contrived way). In the present invention is a method of producing insulin output stage enzymatic cleavage is 65% when using E. coli strain JM-109-pRRproins and 80% when using E. coli strain JM-109-pKRproins that is significantly higher than in the method-prototype (44%).

Example 1. Obtaining plasmids pRRproins.

Plasmid pRRproins obtained by site-directed mutagenesis known plasmids pNY1 (Fig. 1) in accordance with the scheme shown in Fig. 2.

Plasmid pNY1 separated from the producer strain E. coli JM-109-I N1864 stored in the collection of strains GNCA. For this collection strain scatter on plates with LB-agar containing 100 μg/ml ampicillin, and free-standing colony inoculant 5 ml liquid LB medium containing 100 μg/ml ampicillin. The culture is incubated at 37oC and intense shaking during the night. 1 ml of the prepared night culture make 500 ml of LB medium with ampicillin and incubated at 37oC to saturation (OD6004,0). Cells precipitated by centrifugation at 6000g for 10 min and resuspending) and incubated 10 min at room temperature. Next, add 10 ml of 0.2 M NaOH with 1% SDS and mixed until a complete clarification of the suspension. Stand in ice for 10 minutes To the resulting solution was added 7.5 ml of 3M potassium acetate and again incubated in ice for 10 minutes the Formed precipitate was separated by centrifugation at 20000g, and the supernatant planted plasmid of 0.6 volumes of isopropanol. The circular form of the plasmid receive equilibrium centrifugation in cesium chloride in the presence of ethidium bromide (500000g, 14 h), and used for site-directed mutagenesis.

For inclusion in the nucleotide sequence of the plasmid pNY1 mutations synthesize oligonucleotides:

I - 5'GAAACAGAATTCATGGCTGAC 3' and

II - 5'TTGGTTAACAAAGCGACGGGATCCTTT 3'.

100 μl of the reaction mixture for polymerase chain reaction containing 1 μg plasmid and 2.5 units of Tag polymerase and the following components in the indicated concentrations: 1 μm primer I, 1 µm primer II, 10 mm Tris-HCl (pH of 8.4), 50 mm KCl, 1.5 mm MgCl2, 20 μg/ml gelatin, 0.8 mm mixture of all four deoxynucleotides. The reaction is carried out according to the following scheme: 94oC - denaturing (1 min), 45oC - annealing (2 min), 72oC - polymerization (1 min). Just spend 30 cycles of amplification. Upon completion of the reaction, 1 μl of the mixture analyze electrophorese what about the ethidium. Amplificatory fragment purified ion-exchange HPLC on a column of DEAE-NPR (2,h mm) NaCl gradient from 0 to 1M.

1 µg of plasmid pNY1 split restrictase EcoR I and Hind III in the following conditions: 6 mm Tris-HCl (pH of 7.6), 6 mm MgCl2, 6 mm 2-mercaptoethanol and 50 mm NaCl, 2 units of EcoR I, 2 units of Hind III. The volume of the reaction mixture of 30 μl. The reaction is performed for 1 hour at 37oC and stopped by heating at 65oC. EcoR I-Hind III fragment of plasmid pNY1 (4556 p. O.) are elektrobudowa from 1% agarose gel and dephosphorylated bacterial alkaline phosphatase.

Similarly decompose amplificatory fragment are ligated and its in the prepared plasmid using T4-DNA ligase at 11,8oC during the night. Obtained after ligation mixture to transform cells of E. coli strain TG-1 for selection of plasmids carrying a given mutation.

The transformation is carried out as follows. The culture is grown to an optical density of 0.6 Units at 600 nm, centrifuged and the cells are gently suspended in 0.1 M ice-cold solution of CaCl2. The suspension is placed on a 40 min in ice bath, collected by centrifugation and resuspended in 1/20 of the original volume of calcium chloride. It received 100 μl of the competent cells add 30 µl of the mixture is swagat 10 times the LB medium, pokasivaut at 37oC for 1 hour and plated on agar plates with LB medium containing 100 μg/ml ampicillin.

Randomly selected colonies able to grow on medium containing 100 μg/ml ampicillin. Isolated from individual colonies plasmid is subjected restriction analysis and is sequenced by the method of Singer. In the selected cell line carrying plasmid pRRproins.

Example 2. Obtaining plasmids pKRproins.

Plasmid pKRproins obtained by site-directed mutagenesis known plasmids pNY in accordance with the scheme shown in Fig.3. To do this, synthesize oligonucleotides:

I - 5'GAAACAGAATTCATGGCTGAC 3'

II - 5'TTGGTTAACAAACGCTTTGCATCCTTT 3'.

The obtaining is performed by the method described in example 1. In the selected cell line carrying plasmid pKRproins.

Example 3. Obtaining E. coli strain JM-109-pRRproins.

The plasmid pRRproins transform competent cells of E. coli strain JM-109 by the method described in example 1. Separately localized colony subcultured three times on the Cup with LB medium containing 100 μg/ml ampicillin. Received monoclonal culture inoculant 5 ml liquid LB medium and incubated overnight with vigorous shaking at 37oStory tolerate 2.7 ml of warmed LB medium and grown at 37oC before reaching the late logarithmic phase (1 h 50 min). Culture add IPTG to the concentration of 0.1 mm and incubated at 37oC for another 4 hours. Cells are harvested by centrifugation and washed with water to remove the medium, the precipitate is dissolved by boiling for 5 minutes in the presence of SDS and 2-mercaptoethanol and the presence of induced expression of the hybrid protein check SDS-electrophoresis in SDS page. The results of the scan stained Coomassie R-250 gel content of the hybrid protein is 355% of the total protein of the cell.

The resulting E. coli strain JM-109-pRRproins stored in 20% glycerol at a minus 40oC.

Example 4. The cultivation of the producer strain E. coli JM-109 - pRRproins.

Producing strains grown in 15 ml of liquid medium containing 10 g/l of bacteriophora (Difco), 5 g/l yeast extract (Difco), 5 g/l NaCl and 100 μg/ml ampicillin, at 37oC, during the night. Retrieved night culture inoculant 10 flasks containing 100 ml of the same medium in a ratio of 1:100. The culture is incubated at 37oC and vigorous shaking until reaching late logarithmic phase (1 hour 50 min). The hybrid protein biosynthesis induce added on Wednesday IPTG to the concentration of 0.1 mm. 4 hours after induction gather to 8.57 g Bereza in SDS page).

Example 5. Isolation and culturing of E. coli strain JM-109-pKRproins.

The E. coli strain JM-109-pKRproins obtained by transformation of E. coli strain JM-109 plasmid pKRproins. Receiving, checking and cultivation of the strain is carried out according to the methods described in examples 3 and 4.

Get 8,17 g cell biomass 70% moisture content of the hybrid protein of 355% of the total protein of the cell.

Example 6. Obtaining human insulin using E. coli strain JM-109-pRRproins.

Producing strains of E. coli JM-109-pRRproins cultivated by the method described in example 4.

For isolation of inclusion bodies cells are suspended in 70 ml of aqueous buffer solution containing 50 mm Tris-HCl (pH 7.5), 0.1 M NaCl and 0.1 M Trilon B, then destroy ultrasonic disintegrator. In the resulting suspension the total protein content determined by the method of Lowry, 850 mg. of inclusion Body is separated from water-soluble impurities by centrifugation (15000 g, 30 min).

Solubilizing hybrid protein dissolving body turning in for 6 hours, 30oC in 60 ml of 8 M urea containing 0.1 M NaCl, 0.01 M of dithiothreitol, 0.01 M Trilon B, 50 mm Tris-HCl (pH 7.5). Any insoluble particles are removed by centrifugation (15000 g, 30 min).

The hybrid protein is s and 120 mg tetrathionate sodium, bring pH to 9.0 using 2 M NaOH and leave the solution is mixed for 6 hours. S-sulfonate hybrid protein is precipitated by bringing the pH to 5.2 25% acetic acid, and diluting the solution 3 times with distilled water. The formed precipitate was separated by centrifugation (5000 g, 10 min), dissolved in 25 ml of 30 mm Tris-HCl (pH 7.5) and chromatographic in the same buffer on a column of DEAE-Separate FF (1 x 25 cm) in the concentration gradient from 0 to 1 M NaCl for 4 hours. The rate of elution of 40 ml/hour. Fractions examined for the presence of S-sulfonate hybrid protein ion-exchange HPLC (column Protein CANCER DEAE 5 PW (7.5 mm x 7.5 cm) (Waters), 30 mm Tris-HCl (pH 7.5), 1 ml/min, gradient of NaCl from 0 to 1 M), using the known-clean S-sulfonate. Fractions with S-sulfonate hybrid protein combined absoluut in column (2.5 x 20 cm Sephadex G-25 F 50 mm NH4HCO3and lyophilizers. The result is 177 mg S-sulfonate hybrid protein 90% purity, the output of which at this stage is 53% of the hybrid protein in the biomass.

Next S-sulfonate hybrid protein is subjected to denaturirovannaya: it is dissolved in 265 ml) cooled to +4oC 50 mm glycine buffer (pH of 10.5) add to 12.7 mg cystine and after its dissolution add 7,54 ál 2-mercapto denaturirovannogo hybrid protein in solution is controlled by reversed-phase (RP) HPLC, using the known-clean sample denaturirovannogo hybrid protein. Upon completion of the reaction solution is concentrated on the installation Minitan with PTGC membrane (Millipore, USA) to 20 ml, absoluut, as described above, and lyophilizers. The result is 169 mg of product containing 48 mg denaturirovannogo hybrid protein (output stage 30%; the output at this stage in relation to hybrid protein in biomass -15,9%).

Cleaning denaturirovannogo hybrid protein is performed on column 1 x 11 cm S-Separate. 167 mg of sample dissolved in 15 ml of 50 mm CH3COONa (pH 4,2) containing 6 M urea, and chromatographic in the same buffer in a concentration gradient from 0 to 0.5 M NaCl for 4 hours at a flow rate of 40 ml/hour. Fractions with denaturirovannym hybrid protein (according to RP HPLC) combined absoluut and lyophilizers. The result is 48 mg denaturirovannogo hybrid protein 90% purity. (Exit at this stage 90%, the output phase with respect to the hybrid protein in biomass - 14,34%).

Enzymatic proteolysis is as follows: received 45 mg of sample dissolved in 2 ml of 50 mm Tris-HCl (pH 7.8), heated to 37oC in thermostat, add 9 ál of freshly prepared trypsin solution (5 mg/ml, 35 U/mg) and 9 m is acetic acid. Two main products of the reaction are identified by comparison with standard samples by the method OF HPLC as human insulin and C-peptide. The insulin content in the reaction mixture is 8.8 mg, which corresponds to 65% of the output on this enzymatic stage.

The hydrolyzate is subjected to preparative RP HPLC in two cycles on the cartridge RAD CANCER micro Bondapak C 18 in the holder Z-module firms Waters (USA). As the mobile phase using a gradient of acetonitrile from 29.6% to 35.2% in for 1 hour in 0.25 M acetate-ammonium buffer (pH 4.5). The rate of elution 1 ml/min Collect and combine the fractions containing insulin more than 97% (according to RP HPLC). After lyophilization of the combined fractions get 4.4 mg purified human insulin (the content of the basic substance - 98%). The output of the cleanup phase is 50%, the total yield with 4.65%.

Additionally, the authenticity of the obtained product insulin human is confirmed by the definition of N-terminal amino acid sequences of A - and B-chains; comparison of peptide maps obtained preparation and the standard sample after treatment with V8 protease from S. aureus and mass spectrometry (m m 5807).

Example 7. Obtaining human insulin using E. coli strain JM-109-pKRproinli JM-109-pKRproins in example 5.

The method is carried out according to the method described in example 6. The protein content of the suspension obtained after ultrasonic cell disruption is 817 mg of S-sulfonate obtained after purification (169 mg), has a purity of 90%. The output stage 53%.

After renaturation obtain 152 mg of product containing 45,6 mg denaturirovannogo hybrid protein 90% purity (yield on stage - 30%, the output at this stage in relation to hybrid protein in biomass - 15,9%).

The treatment received 45 mg denaturirovannogo hybrid protein 90% purity. The output stage is 90%, the total output of 14.3%.

The output of insulin on stage enzymatic proteolysis - 80%, which corresponds to 10.8 mg of insulin in the reaction mixture.

After cleaning they receive 5.4 mg purified human insulin with the content of the main substance of 97%. The output of the cleanup phase is 50%, the total output - 5,72%.

1. Recombinant plasmid pRRproins expressing a hybrid protein in which the amino acid sequence of the leader peptide, which represents an IgG-binding domain of protein a and human proinsulin connected by two arginine residues, has a size 5025 p. O. and consists of the following elements: EcoR I - Hpa I fragment (212 p. ind III fragment (257 p. O.), encoding the remainder of the B3-B30 of the b-chain of insulin, C-peptide and a-chain of insulin; Hind III - EcoR I fragment (4556 p. O.), carrying tac-promoter and the gene for resistance to ampicillin.

2. Recombinant plasmid pKRproins expressing a hybrid protein in which the amino acid sequence of the leader peptide, which represents an IgG-binding domain of protein a and human proinsulin, connected residues lysine and arginine, has a size 5025 p. O. and consists of the following elements: EcoR I - Hpa I fragment (212 p. O.), encoding a leader peptide spanning residues lysine and arginine, and the first two amino acids of the b-chain of insulin; Hpa I - Hind III fragment (257 p. O.), encoding the remainder of the B3-B30 of the b-chain of insulin, C-peptide and a-chain of insulin; Hind III - EcoR I fragment (4556 p. O. ), carrying tac-promoter and the gene for resistance to ampicillin.

3. The Escherichia coli strain JM-109-pRRproins carrying plasmid pRRproins on p. 1 producing a hybrid protein in which the amino acid sequence of the leader peptide, which represents an IgG-binding domain of protein a and human proinsulin connected by two arginine residues.

4. The Escherichia coli strain JM-109-pKRproins carrying plasmid pKRproins on p. 2 producing a hybrid protein in which amino acid posledovateli residues lysine and arginine.

5. A method of producing human insulin, including the cultivation of E. coli cells, separation of inclusion bodies, solubilization, sulfites and denaturirovannaya hybrid protein purification denaturirovannogo hybrid protein, its trypsin-like cleavage, carboxypeptidase-b-like enzymes and insulin secretion, characterized in that cultivation of E. coli strain JM-109-pRRproins under item 3 or E. coli JM-109-pKRproins under item 4, and denaturirovannyj hybrid protein purified by the method of ion exchange chromatography.

6. The method according to p. 5, characterized in that it further hybrid protein after sulfatase before denaturirovannym purified by anion-exchange chromatography.

 

Same patents:

The invention relates to means of protection of plants from diseases and relates to a new strain Pseudomonas chlororaphis to get this tool and to use it

-aminobutyric acid" target="_blank">

The invention relates to microbiological and medical industry and the receipt-aminobutyric acid from L-glutamic acid or its salts using biomass bacteria Escherichia coli

The invention relates to the microbiological industry, and can be used for cleaning oil-contaminated surfaces

The invention relates to the microbiological industry, and can be used for cleaning oil-contaminated surfaces

The invention relates to biotechnology, in particular Microbiology, and can be used for growing cultures of Escherichia simple and cheap nutrient medium without losing its effectiveness

The invention relates to biotechnology, in particular Microbiology, and can be used for growing cultures of Escherichia simple and cheap nutrient medium without losing its effectiveness

The invention relates to biotechnology, in particular Microbiology, and can be used for growing cultures of Escherichia simple and cheap structure without losing its effectiveness

The invention relates to biotechnology, in particular Microbiology, and can be used for growing cultures of Escherichia simple and cheap structure without losing its effectiveness

The invention relates to propertytaxsession systems that require cleavage product a predecessor to the new polypeptide capable of restoring dichloroindophenol and oxidized glutathione to DNA that encodes this polypetide, farmkompanijam comprising the polypeptide, monoclonal antibodies against the indicated polypeptide

The invention relates to biotechnology and can be used in the production of recombinant human interferon in industrial scale

The invention relates to biotechnology

The invention relates to biotechnology

The invention relates to medicine, in particular to Oncology and immunology, and for the treatment of b-cell lymphoma

The invention relates to biotechnology
Up!