Polynucleotide, the retrieval method, hybridization analysis of nucleic acids

 

(57) Abstract:

The invention relates to the chemistry of nucleic acids and biochemical analyses, rather grabdevice-branched polynucleotides, which are used as cumulative multimers in hybridization studies of nucleic acids. Describes a new large grabdevice-branched polynucleotide, including: (a) the skeleton of polynucleotide with 1) not less than 15 multifunctional nucleotides, each of which has the place of attachment of the side chain, and 2) the first unit of single-stranded oligonucleotide capable of specifically bind to a first single-stranded polynucleotide sequence of interest, and (b) suspended polynucleotide side chains extending from the said multifunctional nucleotides, each of which includes a repetition of the second single-stranded oligonucleotide unit that can specifically bind with the second single-stranded polynucleotide sequence of interest, when the total number of repetitions in all side chains of at least 20. Describes how to obtain it, and hybridization analysis of nucleic acids. 7 C. and 18 h.p. F.-L. more Precisely, it concerns a large grabdevice-branched polynucleotides, which are used as cumulative multimers in hybridization studies of nucleic acids.

The state of the question

Hybridization analysis of nucleic acids typically used in research in genetics and medical biochemistry and clinical diagnosis. In hybridization analysis of primary nucleic acid of the investigated single-stranded nucleic acid to form a hybrid with labeled single-stranded probe nucleic acid and investigate the resulting labeled duplex. To facilitate the separation of the duplex to recognize foreign material and/or amplify the signal, subject to investigation, were developed variants of this basic scheme. One way to amplify the signal for the research described in the application in the European patent office (EPA) 883096976 (corresponding application U.S. serial N 340031 filed April 18, 1989). It signal is amplified by means of cumulative multimers. These multimer are polynucleotide, which is designed to have the first segment, which specifically forms a hybrid with the analyzed nucleic acid, or the thread nuclei the d with the labeled probe. Amplification is theoretically proportional to the number of repetitions of the second segment. Multimer can be either linear or branched. Describe the two major types of branched multimers: fork and grabdevice.

In the study two types of branched multimers it was found that the fork structure with a large number of branches than about 8, create a spatial barrier, which prevents fixation of labeled probe on multimeric. On the other hand, grebnevidnoi structures was not spatial obstacles, and therefore considered the preferred type branched multimer. However, unfortunately, repeated attempts to create grabdevice patterns with more than 10 branches were unsuccessful. Applicants have developed in the present methods of obtaining large grabdevice-branched multimers. These large grabdevice patterns allow you to achieve a greater degree of amplification than was previously possible.

Disclosure of the invention

One aspect of the invention is large, grabdevice-branched polynucleotide, including:

a) skeleton polynucleotide with:

(I) not less than 15 multifunctional nucleotides, each of which is specifically bind with interest the first single-stranded polynucleotide sequence; and

b) suspension polynucleotide side chains extending from the said multifunctional nucleotides, each of which includes a repetition of the second single-stranded oligonucleotide unit that can specifically bind with the second interesting single-stranded nucleotide sequence.

Another aspect of this invention is a method of creating large grabdevice-branched polynucleotide, suitable as PCR setup multimer in the analysis of hybridization of nucleic acid, including:

a) synthesis of the skeleton of a stranded polynucleotide, including:

(I) not less than 15 multifunctional nucleotides, each of which has a protected functional group that serves as a discharge nucleotides side chain, and

(II) the first segment of the staple position;

b) removing the protection from these functional groups;

b) the elongation of each of these places, at least up to 5 nucleotides to create the second segments designated stapling;

d) stitching the first unit of single-stranded oligonucleotide with the first place of the stitching so that this first unit of single-stranded oligonucleotide kazaliste, of interest; and

d) crosslinking the second units of single-stranded oligonucleotide with the second segments of the staple position so that the second unit of single-stranded oligonucleotide consisted of a repetition sequence capable of forming a specific communication with the second a single-stranded oligonucleotide of interest.

Another aspect of this invention is an alternative method of creating large grabdevice-branched polynucleotide, suitable as PCR setup multimer for analysis of nucleic acid hybridization method; this method includes:

a) synthesis of the skeleton of a stranded polynucleotide, including:

(I) not less than 15 multifunctional nucleotides, each of which has a protected functional group that serves as a place of increasing the side chain of nucleotides, and

(II) the first unit of single-stranded oligonucleotide capable of forming a specific communication with the first single-stranded sequence of polynucleotide of interest;

b) removing the protection from these functional groups;

b) the elongation of each of these places, at least up to 5 nucleate segments designated stapling these second units of single-stranded oligonucleotide, including repeating sequence, the ability to communicate with the second a single-stranded oligonucleotide of interest.

Another aspect of this invention is the use of these large grabdevice-branched polynucleotides in the analysis of nucleic acids by hybridization. In these tests:

a) branched polynucleotide forms a hybrid, through the first oligonucleotide unit, with single-stranded analyzed nucleic acid bound to the solid phase, or a single-stranded oligonucleotide associated with the subject of the analysis;

b) unbound extensive polynucleotide deleted;

C) single-stranded labeled oligonucleotide probe forms a hybrid with an extensive polynucleotide through the second oligonucleotide units;

g) unbound labeled oligonucleotide is removed and

d) determined by the presence of the label associated with the branched polynucleotide.

The terms used in the description of the invention

"Large" is used here to describe grabdevice-branched polynucleotides invention means a molecule that has at least 15 seats branching and at least 20 repetitions of the sequence linking the sword of the invention and means polynucleotide, having a linear skeleton with many branching of lateral branches.

"Multifunctional" or "modified" nucleotide indicates the nucleotide monomer, which can stably be included in polynucleotide with incremental functional group (mostly cytosine, which has 4 position changed to functional hydroxy-group), with which the nucleotide can form a covalent bond to the formation of the side chain.

"Biodegradable linker molecule" means a molecule that can stably integrated into the chain of polynucleotide and forming a covalent bond, which can break or be broken down by chemical treatment or physical effects, such as radiation.

"Amplication of multimer" means polynucleotide, which is capable, directly or indirectly, to form a hybrid with the analyzed nucleic acid, and create multiple copies with labeled probes.

Description large grabdevice-branched polynucleotides

Polynucleotide of multimer invention consists of a linear skeleton and pendant side chains. The skeleton includes a segment that provides a specific place hybridization DL the side chains include repeating segment, which provides specific places hybridization to the labeled probe.

Preferred embodiments of these grebnevidnoi of polynucleotides can be represented by the following schematic formula:

< / BR>
where S is first spacer elements segment of at least 15 nucleotides, preferably from 15 to 50 nucleotides;

X - multifunctional nucleotide that provides a place of branching;

S' - spacer elements segment designated branch of 0-15 nucleotides, preferably 0-10 nucleotides;

m is an integer equal to or more than 15, preferably 15-100;

R - molecule tsepliaeva linker;

n is 0 or 1;

S - second spacer elements segment from 0 to 10 nucleotides, preferably 5-10 nucleotides;

A segment capable of forming a hybrid specifically to a target nucleic acid or nucleic acid associated with the analyzed;

S"' is the third spacer elements segment from 0-10 nucleotides;

L - segment containing 2-10 repetitions, preferably 3-6 reps, nucleotide sequence, capable of forming a hybrid specifically with labeled oligonucleotide probe;

E - oligonucleotide extension segment of 5-10 nucleotides.

The whole skeleton muli methods and equipment for conventional automated solid-phase synthesis of oligonucleotides, as a single unit. In this regard, the spacer elements of the segment S is the separation of parts of the molecule that contains the designated branch, with the solid phase (S' S end is connected with the surface of the solid phase).

Modified nucleotides or branched monomers denoted by the letter X in the above formula, are multifunctional nucleotides, in which one functional group is used for increasing the side chain, and the other is used to link the skeleton. Examples of multifunctional nucleotides described in EPA 883096976 (USA, serial N 340031), the disclosure of which is incorporated here by reference. These modified nucleotides on advantage have the formula

< / BR>
where R3is hydrogen, methyl, I, Br or F;

R4is hydrogen or methyl;

Z - is selected from the group consisting of:

< / BR>
< / BR>
< / BR>
< / BR>
(2)-(CH2-CH2-O)x-(1)and(2)-(CH2)x-O(1),

where x and y can be the same or different integers in the range from 1 to 8, inclusive. (Labels (1) and (2) to Z communications indicate the orientation of the Z half of the linker).

As mentioned, spacery segment S' is optional and can be used optionally for Raich places branching from flanking rows of seats branching. The second spacer elements segment S ' is also optional and can be used to separate the branched part of the molecule with segment A, which, in the end, communicates the analyzed material. It was found that this separation improves the fixation of the analyzed material on multimer. In the same way is the optional third spacer elements segment S'. It is mainly poly-T.

Segment A has the sequence and length, allowing it to form a specific and stable relationship with the analyzed nucleic acid or nucleic acid, which is connected with the analyzed material. To achieve such specificity and stability of a segment of A normally should consist of 15-50, preferably from 15 to 30, nucleotides in length and have a GC content in the range from 40 to 60%. Specific length and sequence of this segment will, of course, vary depending on the nucleic acid with which it should form a hybrid.

Segment E is the extension segment of the side chain, which is synthesized with the help of equipment and technologies for automated solid-phase chemical synthesis of oligonucleotides. He usually long Occam repetition oligomeric units, which can form a specific and stable hybrid with a labeled oligonucleotide probe. These units also generally in the 15-150 nucleotides, preferably 20-120 nucleotides, and have a GC content in the range from 40 to 60%. Each segment L contains normal from 2 to 10 repetitions units, preferably from 3 to 6 repetitions. Some side chains may not include the L segment. Normally not less than 50% of the side chains, preferably at least 70% of the side chains, should include the L segment.

Biodegradable linker molecules (R) in the skeleton and/or side chains are optional, but preferred. They contain space splitting, which can be selected so that the samples are large grabdevice of polynucleotide can be split for analysis and characterization. In this regard, it is preferable to splitting was present in each side chain and the location of cleavage were in the position 5', when it falls on the place of branching. Examples of degradable linker molecules that can be embedded in polynucleotide are disclosed in EPA 883096976 and in the examples below.

Synthesis of large grabdevice-branched multimers

Assembly polynucleotides invention ensures EBNA, includes spacer on the side 3' (S), branching (X), of the optional segments S', S" and S"', A segment, an optional set of linker molecules (R) and lengthening the side chain segment E, is synthesized according to the technology of automated solid-phase synthesis of oligonucleotides. The preferred solid phase is a glass with a specified pore size of at least 2000 angstroms. In this synthesis of spacer elements, the segment S up from the solid phase. For convenience, this segment is poly-T. Then added to the chain multifunctional nucleotide that contains the designated branches, with or without insertion of nucleotides in the form of spacers between places of branching. On the modified nucleotides are orthogonal protective or blocking groups so that the protective group, which allows you to build the skeleton, can be removed without damaging the protective group, which allows you to build a side chain.

Examples of suitable protective groups are also described in EPA 883096976. As a blocking group on the carbohydrate portion of the nucleotide is preferably used dimethoxytrityl (DMT). As a blocking group on the hydroxyl portion of the modified nucleotide is preferably used levulinic or as the be the same or different and selected from the group consisting of amino-, nitro-, halo-, hydroxyl, lower alkyl and lower alkoxy;

Rjmay be the same or different and selected from the group consisting of amino-, nitro-, halo-, hydroxyl, lower alkyl and lower alkoxy;

i - 0, 1, 2 or 3;

j - 0, 1, 2, 3, or 4.

After it was built, the specified number of places of branching, the 5' end of the molecule built up by the segments S (optional) and A or just a short segment S ' (5-10 nucleotides) containing a site for enzymatic crosslinking with segment A. As mentioned above, elected place of cleavage is preferably embedded in the extension segment. If a segment is synthesized directly, and not added by stitching, for protection of the side chains of the modified nucleotides is necessary to use a protective group, such as 2-methylanthraquinone, which can be removed selectively without undesirable damage to the remainder of the molecule.

After a given elongation of the 5' end of the body of the comb is removed group protecting the hydroxyl portion of the modified nucleotides, and at the same time lengthened designated branching preferably with the inclusion of an elected place of splitting so that each location branching had lengthening segmentations directly) then sewn with lengthening segments of the side chains by adding T4-ligase and appropriate matrices linker. Segments A and L as it is possible to synthesize, using available methods and equipment for automated solid-phase synthesis of oligonucleotides.

Analysis by hybridization

In the analysis of nucleic acids by hybridization large greneway of multimer of the invention binds to a target nucleic acid or a single-stranded oligonucleotide associated with the studied material. As multimer includes a large number (20 or more) repetitions of the sequence, intended for specific hybridization with a labeled oligonucleotide, with the analyzed material can contact a lot more labeled groups than in similar techniques. A large number of labeled groups reduces the detection threshold of the studied material.

Multimer can be used basically in any known types of hybridization of nucleic acids, as in those where the material is bound directly to the solid phase, and hybridization sandwich method, in which the analysed material associated with the oligonucleotide, which, in turn, binds to the solid phase. This is particularly useful when the sandwich hybridization in liquid phase, the EP is used as follows. Single-stranded analyzed nucleic acid is incubated under conditions for hybridization with an excess of two sets of probes are single-stranded nucleic acids: (1) set of capturing probes, each having first locking sequence complementary to the analyzed material, and the second locking sequence complementary to the single-stranded oligonucleotide that is associated with the solid phase, and (2) the set of amplification probes, each having first locking sequence that can specifically bind to a target material, the second locking sequence that can specifically bind to A segment of multimer. Using amplification probe multimer can be turned into a universal reagent, so no need to do different multimeric for each of the analyzed material. The resulting product is a three-component complex of nucleic acid from two probes, crossed with the test material with the first locking sequences. The second locking sequence probes are stored in the form of single-stranded tails, as they are not complementary of the analyzed material.

Then, under conditions of hybridization to the complex solid phase with the analyzed material and probe type large greneway amplication of multimer to give multimer to form a hybrid with the available second locking sequence amplification probe complex. The resulting solid complex is then separated by washing away unbound multimer. Then add the labeled oligonucleotide under conditions that allow him to form a hybrid oligonucleotide units of the side chains of multimer. The resulting complex of the solid phase with a labeled nucleic acid is then separated from the excess of labeled oligonucleotide by washing, removing unbound labeled oligonucleotide, and read.

The analyzed nucleotide acid can be from different sources, such as a biological fluid or solid substances, food etc ways, for example proteinase K/sodium dodecyl sulphate, chaotrope salt, etc. may Also be advantageous to reduce the average size of the analyzed nucleic acid enzymatic, physical or chemical methods, such as enzymes, ultrasonic disintegration, chemical degradation (e.g., metal ions), etc., the Fragments can be as small as 0.1 thousand reasons, usually of a size not less than 0.5 thousand reasons and can be 1 thousand bases or more. For the analysis of the sequence must be in single-stranded form. If the sequence has a natural single-stranded form, the denaturation is not required. However, when the sequence represented by double-stranded form, it should denaturing. Denaturation can be performed in various ways, such as exposure to alkali, usually from about 0.05 to 0.2 M hydroxide, formamide, salts, heat, or their combinations.

The first locking sequence exciting and amplification probes, complementary to the analyzed sequence, must have each at least 15 nucleotides, usually at least 25 nucleotides, and no more than 5 thousand reasons, usually not more than 1 t is In the room they should be selected for communication with different sequences of the analyzed material. The first locking sequence can be selected for various reasons. Depending on the nature of the analyzed material can be interested in generalizing the typical sequence, the sequence associated with polimorfismo, with a particular phenotype or genotype, a special strain or etc.

The appropriate selection of the first locking sequence amplification and exciting probes can be used to identify molecules specific nucleic acid comprising a single gene or other sequences that are part of different nucleic acid molecules. In order to distinguish interested nucleic acid molecule from other molecules that also contain this sequence, one of the probes is complementary to this sequence, and the other to a different sequence, which is unique to this molecule (i.e., not present in other molecules containing this sequence).

The second locking sequence exciting and amplification probes are selected on the basis of complementarity, respectively, to the oligonucleotide attached to the solid phase, and to segment the sample/analyze the material. The second locking sequence may come in contact with the first locking sequence or to separate from the intermediate complementary sequence. Optionally, the probes can include other complementary sequence. These complementary sequence should not interfere with the connection of the clamping sequences or cause nonspecific binding.

Exciting and amplifying the probes can be obtained by the methods of synthesis of oligonucleotides or cloning, is preferable to the first.

You need to be aware that the locking sequence does not require perfect complementarity to form homoduplexes. In many situations it is enough education heteroduplexes where mistakenly paired less than 10% of the bases, ignoring loops of 5 or more nucleotides. Accordingly, as used herein, the term "complementary" means the degree of complementarity sufficient to ensure the formation of a stable structure of the duplex.

The solid phase used for analysis, may be in the form of particles or surface of any of a variety of containers, such as centrifuge about the tion, so they had sizes in the range of 0.4-200 microns, usually from 0.8 to 4.0 μm. The particles may be of any conventional material, such as latex or glass. Titration microplates are preferred hard surface. Oligonucleotides complementary to the second locking sequence for exciting the probe, can stably be attached to a solid surface functional groups by known methods.

You must realize that you can replace the second locking sequence for exciting the probe and the oligonucleotide attached to the solid phase, the respective pair of ligand-receptor, which then forms a stable connection between the solid phase with the first locking exciting sequence of the probe. Examples of such pairs are Biotin/avidin, thyroxine/thyroxine binding globulin, antigen/antibody, carbohydrate/lectin, etc.

Labeled oligonucleotide should include a sequence complementary to the oligonucleotide units of the side chains multimer. Labeled oligonucleotide must include one or more molecules ("marks") that directly or indirectly provide a detectable signal. Tags movem member or tail, with many labels. The literature describes various ways to create a link tag sequence. See, for example, Leary et al., Proc. Nat. Acad. Sci. USA (1983) 80:4045; Renz and Kurz, Nucl. Acids Res. (1984) 12:3435; Richardson and Gumport, Nucl. Acids Res. (1983) 11:6167; Smitf et al., Nucl. Acids Res. (1985) 13:2399; Meinkoth and Wahl, Anal. Biochem. (1984) 138:267. Labels can be contacted with a complementary sequence covalently or ecovalence. In can be used as labels, radionuclides, fluorescent, chemiluminescent, dyes, enzymes, substrates, enzymes, cofactors of enzymes, enzyme inhibitors, subunit enzymes, metal ions, etc., Illustrative of specific labels include fluorescein, rhodamine, Texas red, phycoerythrin, umbelliferone, luminal, ABOVE.N, alpha -, beta-galactosidase, peroxidase horseradish, etc.

The ratio of the exciting probe and amplifier probe to the estimated number of moles of the analyte should be on everybody, at least stoichiometric and preferably redundant. Preferably the ratio is at least 1.5:1 and more preferably at least 2:1. Normal would be the range from 2:1 to 10,000:1. The concentration of each of the probes, in General, should be in the range of about 10-10up to 10-6M at concentration, in General, from 10 minutes to 2 hours, usually ending within one hour. Hybridization can be carried out at slightly elevated temperatures, in General, in the range from about 20oC to 80oC, more often from about 35oC to 70oC, especially 65oC.

The hybridization reaction is usually conducted in the aquatic environment, especially in buffered aqueous medium, which may include various additives. Additives that can be used include low concentrations of detergent (0.1 to 1%), salt, for example sodium citrate (0,017-0.17 M), ficoll, polyvinylpyrrolidine, carriers of nucleic acids, the native proteins, etc. To the aquatic environment, you can add non-aqueous solvents, such as dimethylformamide, dimethyl sulfoxide, alcohols, and formamide. These and other solvents may be present in an amount of from 2 to 50%.

The severity of the environment hybridization can be regulated by temperature, salt concentrations, solvent, etc., So depending on the length and nature of interest of consistency, the severity of the environment should be changed.

The method of separation stages in the analysis should vary depending on the nature of the solid phase. When using particles for separation use centrifuge washed, usually 1-5 times a suitable buffered environment, for example SFR containing such detergent like sodium dodecyl sulphate. When the separating means is a wall or the supporting substrate, the supernatant can be drained or removed, and the wall should be washed as well as particles.

Depending on the nature of the label, you can use a variety of techniques to identify the presence of the label. For fluorescents there are many system. For chemiluminescent have luminometry or film. Enzymes can be obtained fluorescent, chemiluminescent or painted products identified fluorometrically, luminometric, spectrophotometrically or visually. The different labels used for immunoassay and immunoassay techniques can be used for data analysis.

In the hybridization analysis, in which the analyzed nucleic acid is directly linked to the solid phase as in the analysis of dot-blotting, multimer hybrid forms directly associated with the analyzed material. In these cases, the segment multimer complementary sequences of the studied material, and oligonucleotide units in the side chains of complementary Macheret hybrid with an associated complex: the analyzed material-multimer. Remove excess labeled oligomer and read the labeled associated complex.

Multimer can also be used in other analyses, such as direct, indirect and sandwich immunoassays. In these cases, the reagent, playing the role of the labeled antibody or other ligand that is associated with the analyzed material, directly or indirectly, has an oligonucleotide probe complementary to A segment of multimer, more associated with it than with the label. For example, in sandwich immunoassay for antigen analyzed material analyzed sample is incubated with the solid phase, which is associated with the first antibody to this antigen. Nesvyazannie the sample is removed from the solid phase and the second antibody to this antigen, which is associated with the oligonucleotide, complementary to the unit multimer, reacts with the associated complex, forming a ternary complex. After removal of excess second antibody multimer forms a hybrid with the complex via oligonucleotide associated with the second antibody. Excess multimer removed, and labeled oligonucleotide probe forms a hybrid with other oligonucleotide units of multimer. After removal of excess labeled oligonucleotide read complex.

Sets analizowa reagents in one package: multimer; the corresponding labeled oligonucleotide; solid phase capable of binding the analyzed material; optional-exciting the probe, if the analysis type is one of those in which the analyzed material is fixed to the solid phase via an intermediate oligonucleotide or other ligand; and optionally amplifying the probe, if the analysis type is one of those which of multimer does not form a hybrid right from the analyzed material. Each of these reagents must be in a separate container. The kit can also include a reagent for denaturing the analyzed material, the buffers for hybridization, the solutions for washing, substrates for enzymes, materials for positive and negative controls and written instructions for carrying out analysis.

The following examples of the invention are offered by way of illustration and not limitation.

Example 1

This example illustrates the synthesis grabdevice-branched polynucleotide with 15 seats branching and the region of elongation of the side chains with three locking positions labeled probe. This polynucleotide was designed for use in hybridization in liquid phase, as described in EPA 883096976.

TM(ABN). They used standard methods ABI with specified exceptions. According to the testimony enjoyed the animation cycle (for example, 1.5 x cycle, 4.5 x cycle), in a specific cycle was used fold increase in the standard number of amidite recommended by the ABI. Here are the program cycle of 0.4, 1,5, 4,5 and CAP-PRIM to control the synthesizer Applied Biosystems model 380 A/B.

First received the body of the comb of the following structure:

3'T20-X15(GTCAGTp5')15-(GTTTGTp-5')1< / BR>
where X is a modified nucleotide, as described earlier.

First synthesized part of the body of the comb with 15 repetitions using glass with adjustable pores (PSA) 40 mg thymidine (3000 angstroms, 3 μm thymidine per gram of substrate) using 1.5 x cycles. Place the branch nucleotide had formula

< / BR>
where R2presents or

< / BR>
The monomer where R2is MAC made in the following way. To a solution of N-4-(6-hydroxyhexyl)-5'-DMT-5-methyl-2' deoxycytidine (17 mmol), prepared as described previously (Horn and Urdea, NAR vol. 17:17, p. 6959-6967 (1989)), in 200 ml of methylene chloride is iformata (MAC-Cl) (20 mmol) in 200 ml of CH2Cl2and stirred for 10 minutes. The TLC analysis (silicone plates, treated with 10% methanol/CH2Cl2) showed that the starting material is completely consumed. The reaction mixture was diluted with 400 ml ethyl acetate and the organic phase was extracted 2 times with 300 ml of 5% NaHCO3and 80% saturated aqueous NaCl. After drying the organic phase over Na2SO4within 30 minutes followed by filtration the solvent was removed in vacuum. The product was purified by chromatography on silica gel with a gradient of methanol (0-6%) in CH2Cl2to obtain 13 g of pure product (85% yield).

Received a 0.1 M solution of 2-(hydroxymethyl) anthraquinone (MAG-OH) dissolving 25 mmol (5,95 g) in 250 ml of dioxane. The yellow solution was filtered and the solvent evaporated to remove moisture. The residue was re-dissolved in 200 ml of dioxane was added pyridine (2 ml, 25 mmol). This solution was added in drops to stir the solution triphosgene (2.5 g, 25 MEq) in 50 ml of CH2Cl2. After adding, the mixture was stirred at 20oC for 18 hours. The mixture was diluted with 800 ml ethyl acetate and the organic phase is washed 3 times with 60 ml 80% saturated aqueous NaCl. After drying the organic phase over Na2SO4the solvent is Tim solution was used without further purification.

Nucleoside N-4-(O-anthracenemethanol-6-oxohexyl)-5'-DMT-5 - methyl-2 deoxycytidine (14.4 mmol) was dissolved in CH2Cl2(50 ml) containing 70 mmol DiPEA. After cooling to 4oC was added N,N-diisopropylaminomethyl (2,72 ml, 14 mmol). Hospitalise reagent was added in small portions until until absorbed 95% of the source material. Then the reaction mixture was diluted with ethyl acetate (300 ml), was extracted with 5% solution of NaHCO3(2 x 300 ml), then 2 x 300 ml 80% saturated aqueous NaCl, and finally was dried over solid Na2SO4. The solvent was removed in vacuum.

The crude phosphoramidite was purified by chromatography on silica gel. Purified phosphoramidite was dissolved in toluene and added, quickly stirring to 800 ml of cold hexanol (-50oC). The formed precipitate was quickly collected by filtration and dried under high vacuum for 18 hours to obtain 12.4 g (4.5 mmol, 80% yield) of a slightly yellowish powder. To unprotect a protected MAC nucleotide is carried out by processing dithionite sodium in neutral conditions.

For the synthesis of the body of the comb (not including side chains), the concentration of monomers of methylphosphonite is ALOS 3% trichloroacetic acid in methylene chloride in a continuous stream during the entire period unprotect. In conclusion, the 5' DMT was replaced by acetyl group.

The field of lengthening the side chain of the six bases of the formula 3'-GTCAGTp synthesized at each branching monomer as follows. Delete a group that protects the base (R2in the above formula), was carried out manually, while keeping the substrate PSA on the same column, where synthesized the body of the comb. If R2- levulinic, injected with a solution of 0.5 M hydrazine hydrate is added in a mixture of pyridine/glacial acetic acid (volume ratio 1: 1) and left in contact with the substrate PSA 90 minutes, every 15 minutes changing the fluid. After copious rinsing with a mixture of pyridine/glacial acetic acid (volume ratio 4:1) and then acetonitrile filters in the column was replaced. If R2- 2-methylanthraquinone, injected with a solution of dithionite sodium (1 g dithionite sodium dissolved in 20 ml of 1 M bicarbonate trimethylammonium) followed by the addition of 20 ml of dioxane and left in contact with the substrate PSA 90 minutes. After removing the protection was added to the field of elongation of the side chains of 6 bases, hold 4.5 x cycles and monomer concentrations of 0.2 M

In these reactions the synthesis of the concentration of monomers was 0.2 M (including R and reviewsnow acid in methylene chloride (volume ratio 1:1) in a continuous flow. The protective group was removed as follows. Phosphate protective group was removed with fragments of the product on a solid substrate processing PSA solution: thiophenol/triethylamine/acetonitrile (volume ratio 1:1:2) for 1 hour at 20oC followed by washing with acetonitrile (10 x 1 ml) and methanol. The slice product is removed from the PSA substrate was treated with 0.5 ml of concentrated ammonium hydroxide for 20 min and remove supernatant. The treatment was repeated twice with a total duration of exposure within one hour. United supernatant transferred into the vial with screw cap and heated at 60oC for 18 hours. After cooling to room temperature the solvent was removed in the evaporator Speed-Vac and the residue was dissolved in 100 μl of water.

When using an automatic synthesizer were collected 5'-region of elongation of the skeleton (segment A), region of elongation of the side chains and the matrix/linkers stapling the following structure:

The region of elongation of the skeleton 5'

3'-AGGTGCTCCGTATCCTGGGCACAG-5'

The region of elongation of the side chain

3'-GATGCGR(TTCATGCTGTTGGTGTAG)3-5'

Matrix ligating to stitch areas elongation of the skeleton 5'

3'-GCACCTACAAAC-5'

Matrix ligation of Allen the following linker with the electoral breakdown:

< / BR>
where DMT - dimethoxytrityl,

Bz is benzoyl,

R5- methyl or beta-cyanoethyl and

iPr is isopropyl.

The splitting in the field of R is achieved dvustaini chemical reaction: (1) oxidation of water NaIO4in for 1 hour and then (2) processing of water-n-Propylamine.

The crude body crest was purified in the usual way in polyacrylamide gel (10% with 7 M urea).

5'-region of elongation of the skeleton and the region of elongation of the side chains was sutured to the body of the comb T4 ligase according to the standard recipe (Urdea (1987) Methods in Enzymol. 146: 22-41), with the exception of a longer reaction time (>8 hours), was used by 14% polyethylene glycol at a neutral temperature.

After crosslinking and purification of the product were labeled32P and conducted stepwise cleavage described above. Then there was the analysis of samples by polyacrylamide gel electrophoresis to determine the number of built-in areas of elongation of the side chains, counting the number of bands on the gel. It was discovered, that the product has 24 labeled designated communication in General.

Example 2

This example illustrates the receipt of the same multimer as in example 1 using the substrate PSA middle resortes produced from substrate PSA 30 mg thymidine (1000 angstroms; 20 mmol of thymidine per gram of substrate). The first 20 cycles connection with T were made in the mode of 0.4 x cycle, to reduce the load below 10 mmol per gram of substrate. That was followed by 20 cycles of connection with T, 15 cycles with X (modified nucleotide) and, finally, the embedding sequence 3'-GTTTGTGGp using 1.5 x cycle. Remove the terminal 5-DMT-group and completed the sequence program CAP-PRIM cycle on the machine ABI. The column was removed from the apparatus and further manipulations were done manually. Remove levulinate protective groups from the point of branching was performed as described above, after which the PSA substrate is transferred into a new column ABI. The extension of the side chains was carried out as described above to embed the sequence 3'-GTCAGTp using 4.5 x cycle. The protective group was removed as described in example 1 (see above), and the crude product was dissolved in 100 μl of water.

The crosslinking groups A and L was produced as in example 1.

Example 3

Polynucleotide example 1 with 24 seats grabdevice branching was used for the composite analysis in the liquid phase N. gonorrhoeae using polynovo gene-specific exciting and amplification probes and probes, labeled and alkaline fzdae whether any spatial problems Grebneva structure with 24 branches for use probes, labeled alkaline phosphatase. The results were compared with those obtained by use of the structure of the comb with 5 branches, which did not show any spatial constraints.

When applied to the probe, labeled32P, a molecule with 24 branches were given the increase in the relative release in 4,76 compared with a standard comb with 5 branches (theoretically - 4,8; 195.000 10,000 pulses per minute against 41.000 1,200 pulses per minute to 10 atom-moles, respectively). When used probe-labeled alkaline phosphatase, a molecule with 24 branches were given the increase in the relative products of 3.94 times compared to standard comb with 5 branches (50,1 1.7 outbreaks against 12.7 0.2 to 10 atom-moles, respectively). The difference in efficiency labels for these two types of probes indicates that the enzyme label is well adapted to the structure of the ridge.

Tests for other nucleic acids described in examples EPA 883096976, can be carried out in the same way.

Modifications of the above methods of carrying out the invention that are obvious to experts in the field of chemistry of nucleic acids and hybridization protection of the following claims:

< / BR>
< / BR>
< / BR>
< / BR>
(2)Synthesis of comb-shaped branched polynucleotide

This example illustrates the synthesis of comb-shaped branched polynucleotide with 15 sites of branching and extension sections of the side chain containing three binding site with the labeled probe. The specified polynucleotide was designed for use in liquid-phase hybridization as described in EPA 883096976.

All procedures chemical synthesis of oligonucleotides was performed on an automatic DNA synthesizer (Applied Biosystems Inc. (ABI) model 380 B). When this was used phosphoramidite method type beta cyanoethylidene providing 5'-phosphorylation using the reagent (ABN). Except for specified changes were used standard protocols (ABI). In the case of a multiple cycle (for example, cycle 1,2), in this particular cycle used an appropriate multiple of the standard number of amidite recommended by the ABI. Proposed in this program description for rounds 1,2 and 6.4 was performed on a DNA synthesizer (Applied Biosystems Model 380 B).

First received the following comb-like structure:

< / BR>
where X' is a branching monomer, and R is a fissionable periodata the linker.

First of all si with controlled pore size, on which was applied to 33.8 mg aminopropyl-derivatizing thymidine (2000 , of 7.4 μm thymidine per 1 g of carrier) in accordance with the scheme implementation cycle of 1.2. The nucleotide site of branching had the following formula:

< / BR>
where R2is

For the synthesis of comb-like structures (not including side chains), the concentration of beta-cyanomethylphosphonate monomer is 0.1 M for A, C, G and T; 0.15 M for monomer E, having a website branching; and 0.2 M for the reagent PhostelTM. Datetimerange was performed using a 3% trichloroacetic acid in methylene chloride and using a stepped line method in the release process. In conclusion, the 5'-DMT was replaced by acetyl group.

Split the linker R and extending the areas of the side chain consisting of six bases and having the formula 3'-RGTCAGTp (SEQ ID No. 1), synthesized in each monomer website branching in the following way. The protective group was removed by hand (R2in the above formula), and CPG-media (CPG - glass with controlled pore size) were left in the same column, which was used for the synthesis of comb-shaped structure. If R2was levulinic, it was introduced a solution of 0.5 M hydrate hydras the update of fluid every 15 minutes, and then extensively washed with pyridine/glacial acetic acid (1:1, about. /vol.), and then acetonitrile. After the release of the cleaved linker R attach the extension sections of the side chain consisting of 6 bases, using cycle 6,4.

In this synthesis, the concentration of phosphoramidites was 0.1 M (with the exception of 0.2 M R and reagent PhostelTMwhere R was a 2-(4-(4-(2-dimethoxytrityl)ethyl)-phenoxy-2,3-di(benzoyloxy)- Butylochka)phenyl)ethyl-2-cyanoethyl-N,N-diisopropylphosphoramidite).

Datetimerange was carried out using a solution of 3% trichloroacetic acid in methylene chloride in a continuous flow, followed by washing with a solution of toluene/chloromethane (1:1, vol/vol.). The branched polynucleotide chain was separated from the solid media automatically 380 B cycle "CENH3". The ammonium hydroxide solution was collected in 4-militray flask Wheaton with a screw cap and heated for 12 hours at 60oC to delete all nucleotide-protecting groups. After cooling to room temperature, the solvent was removed in vacuum speed evaporator (Speed-Vac), and the residue was dissolved in 100 μl of water.

Lengthening CEE following structure, synthesized using the automated synthesizer:

Lengthening the segment of the 3'-end of the frame:

3'-TCCGTATCCTGGGCACAGAGGTGCp-5' (SEQ ID N 2)

Lengthening the segment of the side chain: 3'-GATGCG(TTCATGCTGTTGGTGTAG)3-5' (SEQ ID NO. 3)

Ligiously matrix for attachment of the extension segment to the 3'-end of frame: 3'-AAAAAAAAAACCACCTp-5' (SEQ ID # 4)

Ligiously matrix for attachment of the extension segment to the side-chain: 3'-CGCATCACTCAC-5' (SEQ ID No. 5)

The crude comb polynucleotide was purified by a standard method using polyacrylamide gel (7% with 7 M urea and IX TBE buffer for electrophoresis).

3'-extending segment of the frame and extending segments of the side chain was attached to a comb-like structure in the following way. Comb-like structure (4 PM/ál), 3'-extending segment of the frame (at 6.25 PM/ál), lengthening the side chain segment (93,75 PM/ál), the matrix for attachment to the side chain (75 PM/ál) and the matrix to attach to the frame (5 PM/ál) were combined in 1 mm ATP/5 mm DTT/50 mm Tris-HCl, pH 8.0/10 mm MgCl2/2 mm spermidine with 0.5 units/μl of polynucleotide kinase T4. The resulting mixture was incubated for 2 hours at 37oC, and then heated in a water bath to 95oC and slowly over 1 hour and was cooled to Tenno mixture were incubated for 16-24 hours at 23oC. DNA was besieged in NaCl/ethanol, resuspendable in water and subjected to the second procedure of ligation as follows. The mixture is brought up to the following concentrations: 1 mm ATP, 5 mm DTT, 14% polyethylene glycol, 50 mm Tris-HCl, pH 7.5, 10 mm MgCl2, 2 mm spermidine and 0.5 units/μl of polynucleotide-kinase T4 and added to 0.21 units /μl of T4 ligase, after which the mixture is incubated for 16-24 hours at 23oC. Then, the ligation products were purified by electrophoresis on polyacrylamide gel.

After ligation and purification of the product was subjected to32P-tagging and cleavage site R by oxidation of water NaIO4within 1 hour. Then, to determine the number included an extension of the side chain, the sample was analyzed by electrophoresis in SDS page through the quantification of the radioactive label in the bands on the gel. It was found that the obtained product had, in General, 45 binding sites with labeled probe.

Example 5

The "sandwich"hybridization analysis of HBV DNA using multimer

This example illustrates the use of a large comb multimer, obtained as described in example 1, in hybridization analysis for the presence of HBV DNA.sovan liquid-phase method "sandwich"hybridization analysis using a 15 x 3"-amplified nucleic acid. "15 x 3" means that this method used two multimer: (1) probe-amplifier having a first segment (A), which binds to nucleic acid HBV, and the second segment (B) that's hybrid with (2) multimeter-amplifier having a first segment (B*) that's hybrid with a segment (B), and 15 iterations of a segment (C), where the specified segment C's hybrid with three labeled oligonucleotides.

In this analysis we used the segments of the probe amplifier and the capture probe is provided at the end of the description.

Each probe-amplifier, in addition to sequences, mainly complementary HB sequences, contained the following 5'-extension segment, complementary to the segment multimer-amplifier:

AGGCATAGGACCCGTGTCTT (SEQ ID NO. 54).

Each capture probe, in addition to sequences, mainly, complementary to the HBV-DNA contained below the sequence of the complementary DNA associated with the solid phase (i.e., complementary XT1*): CTTTCTTTGGAGAAAGTGGTG (SEQ ID No. 55).

Tablets for micrometrology was prepared as follows. Polystyrene 96-well plates to micrometrology (White Microlitell Removawell) were purchased from a company Dynatech Inc. Each LUN is twice washed with 1X PBS, and from the wells was removed liquid by suction. After that, the wells were filled with 200 Microlitre 1 N. NaOH and incubated for 15-20 minutes at room temperature. Then the tablets again 4 times washed with 1X PBS, and remove liquid from the wells by suction.

Poly(phe-lys) were purchased by the company Sigma Chemicals, Inc. This polypeptide had a molar ratio of phe:lys 1:1; srednevekovoy molecular weight 47900 g/M; the average length of 309 amino acids and contained 155 amines/M 1 mg/Il-solution of the specified polypeptide was mixed with 2 M NaCl/1X PBS to a final concentration of 0.1 mg/ml (pH of 6.0). To each well was added 10 μl of this solution. Avoid drying the tablets were wrapped with plastic film and incubated overnight at 30oC. Then 4 tablets twice washed with 1X PBS, and the wells were removed liquid by sucking.

For binding of the oligonucleotide XT1*with tablets was carried out by the following procedure. XT1*synthesized as described in EPA 883096976. 20 mg of disuccinimidyl was dissolved in 300 μl of dimethylformamide (DMF). To 100 μl of buffer for binding (50 mm phosphate, pH 7.8) was added 26 (OP260) units XT1*. Then to DSS-DMF-solution was added to the mixture to bind, and the mixture is stirred in a magnetic stirrer for vsli DSS-DMF-solution mixture to bind. This mixture was intensively mixed and loaded in a balanced column NAP-25. DSS-activated XT1*DNA was suirable column with 3.5 ml of 10 mm nativespace (pH 6.5). Then 5,6 (so260) units elyuirovaniya DSS-activated XT1*DNA was added to 1500 ml of 50 mm nativespace (pH 7.8). After that, 50 μl of this solution was added to each well and the plates were incubated over night. Then tablets 4 times washed with 1X PBS, and the wells were removed liquid by sucking.

Final purification tablets was carried out as follows. To each well was added 200 μl of 0.2 N. NaOH containing 0.5% (wt./about.) LTOs. Then the tablets were wrapped with plastic film and incubated for 60 minutes at 65oC. After that, the tablets 4 times washed with 1X PBS, and the liquid from the wells was removed by sucking. Treated thus, the tablets were stored at 2-8oC in the presence of desiccant beads (desiccant).

The sample was obtained by adding to each well of 12.5 μl of buffer P-K (2 mg/ml proteinase K in 10 mm Tris-HCl, pH 8.0/0.15 M aCl/10 mm E TA, pH 8.0/1% LTOs/40 mg/ml treated with ultrasound DNA salmon sperm). Standard HBV DNA was obtained by breeding the cloned DNA HBV subtype adw, in HBV-negative human serum and BB is strong hybridization with heterologous DNA was performed by adding to each well or purified DNA or infected cells. The amount of each of the microorganisms shown in table.

The tablets covered and stirred for mixing samples, after which the plates were incubated at 65oC to release nucleic acids.

To each well was added a mixture consisting of HBV-specific probe amplifier and the capture probe (5 FM of each probe per well, diluted in 1 N. NaOH). Then the tablets were coated and lightly stirring his for mixing of reagents, and then incubated for 30 minutes at 65oC.

Then to each well was added a buffer to neutralize (0,77 M 3-(N-morpholino)propanesulfonic acid/1,845 M NaCl/0.185 citrate). Then the tablets were covered and incubated for 12-18 hours at 65oC.

After keeping the tablets for a further 10 minutes at room temperature, the contents of each well was aspirated to remove all the liquid, and the wells were washed 2X-buffer for washing (0.1% of LTOs/0.15 M NaCl/0.0015 citrate).

Then to each well was added by the amplifier-multimer (30 FM per well). The tablets covered and the contents of the wells were mixed, after which the plates were incubated for 30 minutes at 55oC.

use.

Then to each well was added labeled alkaline phosphatase probe described in EP 883096976 (40 μl/well of 2.5 FM/μl). After incubation for 15 minutes at 55oC and incubation for 5 minutes at room temperature, the wells are washed twice as described above and then washed 3X-a mixture of 0.015 M NaCl/0,0015 M sodium citrate.

Was used-stimulated enzyme dioxetane (Schaap et al., Tet. Lett. (1987) 28:1159-1162; and publ. EPA N 0254051) obtained from the company Lumigen Inc. To each well was added 30 μl of Lumiphos 530 (Lumigen). The holes were slightly tapped so that the reagent is deposited on the bottom, and to ensure that the reagent is distributed evenly on the bottom of the wells, these wells are slightly rotated in a circular motion. Then the wells were covered and incubated for 40 minutes at 37oC.

Read the tablets were performed on a luminometer Dynatech ML 1000. The output data received in the form of a fully integrated value of amounts of light produced in the reaction.

Results exclusion of the study of HBV probes presented in the table. The results for each standard sample was expressed as the difference between the mean value for the negative control plus two standard deviations and average values for sample mine is ATA showed as described series of probes can distinguish HBV DNA from heterologous organisms, and that the sensitivity of the described analysis is about 1000-3000 molecules of HBV.

Example 6

Extensive nukleinovokisly polymer with two 5'-ends

In this example, a comb-like multimer described above, was produced by ligating a comb-like structure with L through an extensive nukleinovokisly polymer having a 3'-end and two 5'-end, which are entered by the branch having the following structure:

< / BR>
where S1is a T6, H' represents a 5'-CGCATC-3'; V' represents a 5'-ACTGAC-3' (complementary to the site of ligation of E in a comb-like structure described in example 1); X' represents a modified nucleotide, as described above in example 1; H represents a 5'-GCGTAG-3', S3is a T2; S4there is no (i.e., S4= 0), Y is equivalent to L in example 1 and has the sequence 5'-GACGTGGTTGTCGTACTT-3' (SEQ ID No. 56) (B A3c), and n = 3.

For ligating branched nukleinovokisly polymer with 15x3"-comb-like structure received the following mixture of 15x3-comb-like structure (1500 gr), the linker sequence 5-TCCA the polymer (35,137 am) in 50 mm Tris-HCl, pH 7.5/10 mm NgCl2/2 mm spermidine/1 mm ATP/5 mm dithiothreitol (DTT). After a light mixing was added polynucleotide-T4 kinase (0,74 units/ál) and the reaction mixture (total volume 255 μl) were incubated for 2 hours at 37oC. the Reaction mixture was heated in a water bath to 95oC, and then slowly over 60 minutes, cooled to 37oC. the Mixture was brought to 2 mm ATP, 5 mm DTT, 14% polyethylene glycol, and then added a T4 ligase (0,21 units/μl), and incubated (total volume of the mixture was 375 ál) for 16-24 hours at 23oC. was Then added NaCl to a final concentration of 0.25 M, and for precipitation of nucleic acids was added 2.5 volumes of ethanol (95-100%).

After that, the DNA resuspendable in water and subjected to the second procedure of ligation. The mixture was brought to a concentration of 1 mm ATP, 5 mm DTT, 14% polyethylene glycol, 50 mm Tris-HCl, pH 7.5, 10 mm MgCl2, 2 mm spermidine, and then added polynucleotide-T4 kinase (of 0.5 units/μl) and T4 ligase (0,21 units/μl). The reaction mixture (total volume of 375 µl) were incubated for 16-24 hours at 23oC and precipitated as described above using NaCl/ethanol. The precipitate was dissolved in buffer to load gel (90% vol./about the formamide/1% wt./about. ficoll/0,05% wt. /about. bromatologia blue) and rayed, terasul legirovannye product, cut out of the gel. DNA was subjected to electroelution from the gel and precipitated NaCl/ethanol as described above.

The amplifier-multimer, thus obtained, was tested in the analysis of hepatitis C virus (HCV) in the following way. Conditions analysis and sequence probes for HCV are disclosed in the concurrently pending application by the same authors reg. N 07/697326, which is introduced in the present description by reference.

A standard curve HCV RNA was obtained by serial dilution of HCV RNA in buffer RK (2 mg/ml proteinase K/40 mm Tris-HCl, pH 8/8 mm EDTA/1% LTOs/12 µg/ml treated with ultrasound DNA salmon sperm/4X SSC/5% formamide) to 500; 250; 50; 25; 12,5; or 0 TM/150 ál (1 TM = 602 molecules or 10-21M). The capture probes and amplification for HCV was added to a final concentration of 0.83 FM/μl. HCV-specific parts of the probe amplifiers and capture probes are shown at the end of the description.

Each probe-amplifier, in addition to sequences, mainly, complementary to the HCV sequences contained below 5'-extension segment, complementary to the segment multimer-amplifier:

AGGCATAGGACCCGTGTCTT (SEQ ID NO. 54).

Each capture probe, in addition to sequences related to the solid phase (XT1*):

CTTCTTTGGAGAAAGTGGTG (SEQ ID NO. 55).

In tablets for micrometrology, prepared as described above in example 1, was added to the reaction mixture and 50 ál of negative human serum. These plates were incubated overnight at 65oC. Then, the tablets were removed from the incubator and left for 10 minutes at room temperature to cool. The wells were washed 2X-buffer flushing (1% LTOs/of 0.015 M NaCl/0,0015 M sodium citrate). To each well was added 100 FM (50 µl) of the amplifier multimer, and the plates were incubated for 30 minutes at 55oC. Then to each well was added 100 FM labeled alkaline phosphatase (AP) probe described above, and the plates were incubated for 30 minutes at 55oC. the tablets were cooled for 10 minutes at room temperature, and then washed 2X with a solution of 0.015 M NaCl/0.0015 citrate.

Was used-stimulated enzyme dioxetane (Schaap et al., Tet. Lett. (1987) 28:1159-1162 and publ. EPA 0254051) obtained from the company Lumigen Inc. To each well was added 50 μl of Lumiphos 530 (Lumigen). In this case, the hole was gently tapped to the reagent deposited on the bottom, and to ensure that the reagent is distributed evenly on the bottom of the wells, these wells are slightly rotated in a circular motion. Then the hole is metre Dynatech ML 1000. The output data received in the form of a fully integrated value of the amount of light produced in the reaction.

The results obtained are presented below. The results for each standard sample was expressed as the difference between the mean value for the negative control plus two standard deviations and the mean for the sample minus two standard deviation (Delta). If Delta is greater than zero, then the sample was considered positive. These results are obtained by conducting the above analysis showed that the sensitivity of this assay is less than 12.5 TM DNA HCV.

TM HC - Delta

500 - 27,24

250 - 8,07

50 - 0,81

25 - 1,13

12,5 - 0,50

0 - 0

Example 7

Attach flex extender" to the probe-amplifier

Attaching nucleic acid "flex extender" was carried out as described below. The sequence "flex extender has a 5'segment, which includes the sequence 5'-GCGTAG-3'; four iterations of the second segment, which is largely complementary sequences present in multimale-amplifier; and a third segment at the 3'end comprising sequence, mainly complementary posledovatelnostyakh segment of the six timelinemax residues (T6). the 3'segment of the specified flex extender" serves as a matrix for ligation probe-amplifier. Ligation was performed using the "linker" molecule comprising a segment is mainly complementary to the 3'sequence of the molecule end "extender"; and the segment is mainly complementary to a unique sequence at the 5'end of the probe amplifier. In this example, the 3'-segment "flex extender" is a 5'-TGAXTG-3', and the segment with iterations represents a 5'-AGGCATAGGACCCGTGTC-3' (SEQ ID No. 86). The linker molecule has the sequence 5'-ATGCCTCAGTCA-3' (SEQ ID No. 87).

"Flex extender" was attached to the probe-amplifier. For this he received a mixture of probes amplification for HBV (as described in example 2, just PM 15625), linker (12500 PM) and "flex extender" (10000 PM). To this mixture was added 50 mm Tris-HCl, pH 7.5/10 mm MgCl2/ 2 mm trihydrochloride spermidine/1 mm ATP/50 mm DTT and 250 units of T4 kinase to a final volume of 250 μl. The mixture was incubated for 1-2 hours at 37oC, and then cooled to room temperature. After this was added 90 units of T4 ligase, and the mixture is incubated overnight at room temperature.

The ligation products were purified as follows. DNA was besieged in NaCl/ethanol and subjected to electrophoresis on a teacher who has Dorgali electroelution, resuspendable in 10 mm Tris-HCl, pH 8.0/ 1 mm EDTA and diluted to 100 FM/μl.

This elongated probe was designed for use in the analysis of HBV DNA described in example 2 (see above). Probes-amplifiers of example 2 were used together with the "flex extender" described above, and the capture probes were used as described in example 2.

To each well was added a mixture of HBV-specific probe "amplifier-flex extender" and the capture probe (25 FM in 5 µl/well). The tablets were coated and lightly stirring his mixing of reagents, and then incubated for 30 minutes at 65oC.

Then to each well was added a buffer to neutralize (0,77 M 3-(N-morpholino)propanesulfonic acid/1,845 M NaCl/0.185 sodium citrate, 3 µl/well). Then the tablets were covered and incubated for 12-18 hours at 65oC.

After incubation for a further 10 minutes at room temperature, the contents of each well was aspirated to remove all the liquid, and the wells were washed 2X-buffer for washing (200 ál) of 0.1% LTOs/of 0.015 M NaCl/0.0015 citrate).

Then to each well was added multimer - amplifier (25 FM in 40 μl of buffer for hybridization/well). After that the tablet was covered and stirred the contents, and santoy temperature, the wells were washed as described above.

Then to each well was added to the probe-labeled alkaline phosphatase, as described in EP 883096976 (40 μl/well of 2.5 FM/μl). After incubation for 15 minutes at 55oC and 5 minutes at room temperature, the wells are washed twice as described above and then washed 3X-buffer (200 μl of 0.015 M NaCl/0,0015 M sodium citrate).

Was used stimulating enzyme dioxetane (Schaap et al., Tet. Lett. (1987) 28:1159-1162 and publ. EPA N 0254051) obtained from the company Lumigen Inc. To each well was added 30 μl of Lumiphos 530 (Lumigen). The hole was gently tapped to the reagent deposited on the bottom, and to ensure that the reagent is distributed evenly on the bottom of the wells, these wells are slightly rotated in a circular motion. Then the wells were covered and incubated for 40 minutes at 37oC.

Read the tablets were performed on a luminometer Dynatech ML 1000. The output data received in the form of a fully integrated value of the amount of light produced in the reaction.

The results (see below) for each standard sample was expressed as the difference between the mean value for the negative control plus two standard deviations and the mean for the sample minus two standard deviations (Delta). If Delta is greater than zero, then the sample was considered to be pelta

500 - 155,59

250 - of 87.87

50 - 19,61

10 is 5.54

5 - -0,73

0 - o

1. Large, grabdevice extensive polynucleotide, including: (a) the skeleton of polynucleotide with 1) not less than 15 multifunctional nucleotides, each of which has the place of attachment of the side chain, and 2) the first unit of single-stranded oligonucleotide capable of specifically bind to a first single-stranded polynucleotide sequence of interest; and (b) suspended polynucleotide side chains extending from the said multifunctional nucleotides, each of which includes a repetition of the second single-stranded polynucleotide sequence of interest, when the total number of repetitions of all side chains is not less than 20.

2. Polynucleotide under item 1, characterized in that the first single-stranded polynucleotide sequence of interest is analyzed nucleic acid or polynucleotide associated with the test nucleic acid and the second single-stranded polynucleotide sequence of interest is labeled by polynucleotide.

3. Polynucleotide under item 2, characterized in that antifunctionalist nucleotide has the formula

< / BR>
where R3is hydrogen, methyl, I, Br or F;

R4is hydrogen or methyl;

Z is selected from the group consisting of:

< / BR>
< / BR>
< / BR>
< / BR>
(2)- (CH2- CH2- O)x-(1)< / BR>
(2)- (CH2)x- O(1)< / BR>
where X and Y may be the same or different and are integers in the range from 1 to 8 inclusive.

5. Polynucleotide under item 2, characterized in that the first and second single-stranded oligonucleotide units, each has about 15 to 20 nucleotides.

6. Polynucleotide under item 2, wherein each side chain contains from 2 to 10 repetitions.

7. Polynucleotide under item 1, characterized in that polynucleotide has the formula

< / BR>
where S is first spacer elements segment of at least 15 nucleotides;

X - multifunctional nucleotide that provides a place for branching;

S' - spacer elements segment designated branch containing from 0 to about 15 nucleotides;

m is an integer equal to or more than 15;

R - molecule cleaved linker;

n is 0 or 1;

S - second spacer elements segment, containing from 0 to about 10 nucleotides;

A - nucleotide segment capable of specifically forming a hybrid with S"' - the third spacer elements segment, containing from 0 to 10 nucleotides,

E - extension oligonucleotide segment, consisting of 5 to 10 nucleotides;

L - segment, containing from 2 to 10 repetitions nucleotide sequence capable of specific hybridization with a labeled oligonucleotide probe.

8. Polynucleotide under item 7, characterized in that it comprises from 15 to 50 nucleotides, and X has the formula

< / BR>
where R3is hydrogen, methyl, I, Br or F;

R4is hydrogen or methyl;

Z is selected from the group consisting of:

< / BR>
< / BR>
< / BR>
< / BR>
(2)- (CH2- CH2- O)x-(1)< / BR>
(2)- (CH2)x- O(1)< / BR>
where X and Y may be the same or different and are integers from 1 to 8;

S' contains from 5 to 10 nucleotides;

L contains from 3 to 6 repetitions.

9. Polynucleotide under item 8, characterized in that it is poliamidnom.

10. Polynucleotide under item 8, characterized in that n = 1.

11. Polynucleotide under item 10, wherein the molecule is cleaved linker has the General formula

< / BR>
where DMT - dimethoxytrityl;

Bz is benzoyl;

R5- methyl or beta-cyanoethyl;

iPr is isopropyl.

13. The method according to p. 12, characterized in that the synthesis and extension are carried out by solid-phase method, in which the 3'end of the skeleton is attached to a solid is b on p. 13, characterized in that the solid phase is glass with adjustable pore size of not less than 2000

15. The method according to p. 14, wherein the specified region nucleotide deletion extends 5 to 10 nucleotides.

16. The method according to p. 13, characterized in that the multifunctional nucleotide has the formula

< / BR>
where R2is

or

17. The method of obtaining large grabdevice branched polynucleotide, suitable as PCR setup multimer in hybridization analysis of nucleic acid, characterized in that the conduct and synthesis of single-stranded polynucleotide of the skeleton, including: (I) not less than 15 multifunctional nucleotides, each of which has a protected functional group that serves as a place of increasing nucleotides side chain, and (II) a first single-stranded oligonucleotide unit that can specifically bind to a first single-stranded polynucleotide sequence of interest; b) removing the protection from these functional groups; b) the elongation of each of these places, at least 5 nucleotides, to create the segments of the staple position; and g) the binding of the second single-stranded oligonucleotide of adiposity sequence, the ability to communicate with the second a single-stranded oligonucleotide of interest.

18. The method according to p. 17, characterized in that the multifunctional nucleotide has the formula

< / BR>
where R2is

or

19. The method according to p. 18, characterized in that the synthesis and extension are carried out by solid-phase method, in which the 3'end of the skeleton is fixed to the solid phase, and the skeleton includes the 3'spacer elements sequence consisting of at least 15 nucleotides.

20. The method according to p. 18, characterized in that the solid phase is a glass with adjustable pore size of not less than 2000

21. The method according to p. 18, characterized in that the space capacity of nucleotides extended 5 to 10 nucleotides.

22. Hybridization analysis of nucleic acids, where the analyzed nucleic acid forms a hybrid with the labeled probe of nucleic acid, characterized in that hybridizers extensive polynucleotide under item 2, directly or indirectly, with the analyzed material through the first single-stranded oligonucleotide unit, and hybridizing labeled probe of nucleic acids with branched polynucleotides through the second single-stranded oligonucleotide unit.

24. Hybridization analysis of nucleic acid, characterized in that: a) extensive polynucleotide on p. 2 forms a hybrid through the first oligonucleotide unit with single-stranded analyzed nucleic acid bound to the solid phase, or a single-stranded oligonucleotide associated with the analyzed material, b) unbound extensive polynucleotide removed; C) single-stranded labeled oligonucleotide probe forms a hybrid with an extensive polynucleotide through the second oligonucleotide unit; g) unbound labeled oligonucleotide is removed; and d) set the presence of the label associated with the branched polynucleotide.

25. Hybridization analysis of nucleic acid, characterized in that: a) extensive polynucleotide on p. 7 forms a hybrid through the first oligonucleotide unit with single-stranded analyzed nucleic sour is b) unbound extensive polynucleotide removed; C) single-stranded labeled oligonucleotide probe forms a hybrid with an extensive polynucleotide through the second oligonucleotide units; g) unbound labeled oligonucleotide is removed; and d) set the presence of the label associated with the branched polynucleotide.

 

Same patents:

The invention relates to chemical-pharmaceutical industry, namely to antiviral drugs exhibiting in-vitro high activity against human immunodeficiency virus, against herpes virus and cytomegalovirus
The invention relates to a method for adenosine triphosphate (ATP) by phosphorylation by acid (ADP) in the presence of oxygen at a temperature of +37oWith by introducing an aqueous solution of ADP phosphide of hydrogen PH3that as a result of decomposition and oxidation gives phosphoric acid.

The invention relates to bioenergy

The invention relates to the field of Bioorganic chemistry, in particular to a method for the preparation of 3'-phosphate, N,P - unprotected phosphothioate analogues oligodeoxyribonucleotides General formula I, where In residue thymine, cytosine, adenine or guanine; n = 1 to 20, which can be used as starting compounds to obtain phosphothioate oligonucleotide reagents for biotechnological purposes

The invention relates to the field of Bioorganic chemistry, in particular to a method for the preparation of 3'-phosphate, N,P - unprotected phosphothioate analogues oligodeoxyribonucleotides General formula I, where In residue thymine, cytosine, adenine or guanine; n = 1 to 20, which can be used as starting compounds to obtain phosphothioate oligonucleotide reagents for biotechnological purposes
The invention relates to biotechnology and the food industry and can be used to obtain nucleic acids and amino acids
The invention relates to biotechnology, in particular genetic engineering
The invention relates to the field of biochemistry and can be used in applied biochemistry for the production of medical biological preparations

FIELD: biotechnology.

SUBSTANCE: nucleic acids are extracted from biomass in the presence of hydrogen peroxide in the low concentration as retaining substance. Obtained extract is treated with proteolytic enzyme and RNA is precipitated with acid in the presence of calcium salt. Purification of product is carried out with aqueous solutions of acetone and calcium and sodium chlorides followed by purification of sodium nucleate with an aqueous-acetone solution in the presence of activated carbon. Invention provides elevating yield of the end product and to improve its quality. Invention can be used for preparing sodium nucleate from baking yeast.

EFFECT: improved preparing method.

1 ex

FIELD: biotechnology, medicine, proteins.

SUBSTANCE: invention describes new polypeptide in isolated form relating to subfamily of superfamily human immunoglobulins (Ig-Sf). This polypeptide shows at least 70% of homology level with amino acid sequence of murine molecules CRAM-1 or CRAM-2 regulated by the confluence of adhesive (figures 3, 6 are represented in the claim). Also, invention relates to antibodies showing specificity with respect to the polypeptide. Antibodies and soluble polypeptide can be used for treatment of inflammation and tumors. Invention describes polynucleotide or oligonucleotide encoding the full-size polypeptide or its moiety and represents primer, probe, anti-sense RNA and shows the nucleotide sequence that is identical conceptually with human CRAM-1. Invention provides preparing new adhesive proteins from superfamily Ig-Sf that are regulated at the transcription level in endothelium by effect of tumors. Invention can be used for treatment of different diseases, in particular, inflammatory responses.

EFFECT: valuable medicinal properties of polypeptide.

19 cl, 33 dwg, 1 ex

FIELD: biochemistry.

SUBSTANCE: the present innovation deals with an anti-sense oligonucleotide or one of its derivatives which can inhibit expression of human eg5 protein being relative to kinesin of motor proteins. The oligonucleotide has got a sequence being correspondent to that of nucleic acid coding certain part of human eg5. This innovation deals with the way to obtain the above-mentioned oligonucleotides, pharmaceutical composition for inhibiting human eg5 and its application. Advantage of the innovation deals with developing e new preparation to be applied for inhibiting cell proliferation.

EFFECT: higher efficiency of inhibition.

11 cl, 1 dwg, 2 ex, 3 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: raw soft roe should be reduced, treated at certain temperature with 0.2%-acetic acid solution, dehydrated with alcohol, dried to obtain granules, granules should be extracted with sulfuric acid solution at three stages, proteins should be precipitated out of extract by adding triple volume of ethanol, residue should be dissolved, solution should be treated with barium hydroxide up to pH being 7.0-7.5 followed by addition of ammonia up to pH being 10.5-11.5 to separate the residue due to decanting and centrifuging. Solution obtained after decanting and centrifugate should be treated with kieselguhr at heating up to 80 C and filtered upon a Nutch filter, one should apply filtrate through cationite in "H+"-form, eluate should be concentrated due to vacuum evaporation or by applying baromembranous technique, then one should precipitate the product out of eluate with triple volume of alcohol due to a 5-fold reprecipitation along with centrifuging and drying the residue to remove residual moisture and dry ready-to-use product at 55-65 C for 24 h. The present innovation enables to increase the degree of purification of protamine sulfate due to purifying against accompanying foreign proteins.

EFFECT: increased anti-heparin activity.

FIELD: genetic engineering, medicine.

SUBSTANCE: invention relates to T-cell receptor sequence being detected in patients with extended sclerosis and is useful in diagnosis and therapy. Oligonucleotide including sequence which represents or is derived from 5'-CTAGGGCGGGCGGGACTCACCTAC-3' or nucleotide sequence being fully complementary thereto. Oligonucleotide together with nuclear acid including nearly 15-30 oligonucleotides, which doesn't comprise oligonucleotide sequence and presents in region from Vβ to Jβ of Vβ13.1 gene in T-cell Vβ13.1-subgroup, wherein oligonucleotide and nuclear acid sequences don't present in the same chain of pair sequences of Vβ13.1 gene, is used in Vβ13.1 gene part amplification. In method for detection of LGRAGLTY motive, which is present in T-cell receptors of T-cell Vβ13.1-subgroup, oligonucleotide is used in combination with labeling particle. Once LGRAGLTY motive is detected, development monitoring and treatment are carried out by removing of LGRAGLTY motive-containing peptide.

EFFECT: simplified methods for detection of LGRAGLTY motive in T-cell receptors and treatment of patients with extended sclerosis.

21 cl, 7 dwg, 3 tbl, 3 ex

FIELD: genetic engineering, medicine.

SUBSTANCE: invention relates to T-cell receptor sequence being detected in patients with extended sclerosis and is useful in diagnosis and therapy. Oligonucleotide including sequence which represents or is derived from 5'-CTAGGGCGGGCGGGACTCACCTAC-3' or nucleotide sequence being fully complementary thereto. Oligonucleotide together with nuclear acid including nearly 15-30 oligonucleotides, which doesn't comprise oligonucleotide sequence and presents in region from Vβ to Jβ of Vβ13.1 gene in T-cell Vβ13.1-subgroup, wherein oligonucleotide and nuclear acid sequences don't present in the same chain of pair sequences of Vβ13.1 gene, is used in Vβ13.1 gene part amplification. In method for detection of LGRAGLTY motive, which is present in T-cell receptors of T-cell Vβ13.1-subgroup, oligonucleotide is used in combination with labeling particle. Once LGRAGLTY motive is detected, development monitoring and treatment are carried out by removing of LGRAGLTY motive-containing peptide.

EFFECT: simplified methods for detection of LGRAGLTY motive in T-cell receptors and treatment of patients with extended sclerosis.

21 cl, 7 dwg, 3 tbl, 3 ex

FIELD: medicine, genetics, biochemistry.

SUBSTANCE: invention relates to new NOS-variants or mutants that comprise structural modifications in site Akt-dependent phosphorylation. Modified NOS-proteins or peptides, in particular, human proteins or eNOS-peptides having change of amino acid residue corresponding to S/T in motif of the consensus-sequence RXRXXS/T of NOS-polypeptide of wild type and nucleic acid molecules encoding thereof can be used in genetic therapy and proteins and NOS-peptides can be used in screening methods of agents modulating activity of NOS. The advantage of invention involves the creature of new NOS-variants or mutants that can be used in genetic therapy.

EFFECT: valuable medicinal properties of mutants.

25 cl, 1 tbl, 9 dwg, 3 ex

FIELD: organic chemistry, biochemistry.

SUBSTANCE: invention relates to oligomer comprising at least one nucleoside analogue of L-ribo-CNA of the general formula (Ia) wherein X represents -O-; B represents nitrogen base; P means radical position in an internucleoside linkage followed by monomer or 5'-terminal hydroxy-group; P* means an internucleoside linkage with precede monomer or 3'-terminal hydroxy-group; R2* and R4* mean in common biradical -(CH2)0-1-O-(CH2)1-3-(CH2)0-1-S-(CH2)1-3- or -(CH2)0-1-NR-(CH2)1-3- wherein R means hydrogen atom, alkyl or acyl; R1*, R2, R3*, R5 and R5* mean hydrogen atom. Also, invention proposes nucleoside analogues used in preparing oligomers. Proposed oligomers elicit the enhanced affinity to complementary nucleic acids and can be used as a tool in molecular-biological investigations and as antisense, antigen agents of agents activating genes.

EFFECT: valuable properties of analogues.

15 cl, 3 tbl, 4 dwg, 17 ex

FIELD: molecular biology, medicine, pharmaceutical industry.

SUBSTANCE: method for detecting analyzed DNA sequence involves DNA hybridization with probes and visualization the prepared product wherein probes represent oligonucleotides with length of nucleotide sequence 12-30 nucleotides showing complementary to site of the same size in analyzed DNA that are modified with insertions based on alkyldiols or ethylene glycols. Applying the proposed method provides obtaining more reliable and selective results in detecting analyzed DNA sequences.

EFFECT: improved detecting method of DNA sequence.

11 cl, 12 dwg, 13 ex

FIELD: biotechnology.

SUBSTANCE: invention relates to polynucleotide encoding zwal gene product containing polynucleotide sequence selected from group including a) polynucleotide encoding polupeptide with amino acid sequence with at least 90 % identity to amino acid sequence represented in SEQ ID NO:2; b) polynucleotide which is complementary to polynucleotides from a), as well as primer representing polynucleotide containing at least 15 sequential base pairs of abovementioned polynucleotide.

EFFECT: new zwal gene encoding ionic zwal product.

6 cl, 1 dwg, 1 tbl, 5 ex

Up!