The dna fragment, a recombinant polypeptide with antithrombins activity, its production method (variants), pharmaceutical composition, the recombinant vector (options)

 

(57) Abstract:

The invention relates to genetic engineering, namely genetic engineering methods for producing antithrombin polypeptides, used for the treatment of venous thrombosis. Get the DNA sequence encoding the precursor of the target polypeptide that is associated with the leader peptide. The DNA sequence or inserted into a suitable expression vector, containing the gene for resistance to the antibiotic and bacterial promoter. Vector transform E. Li type C. Culturing of the transformed strain in the conditions necessary for expression. Produce the target product. Or build in vector transfer and are contractively of insect cells with this vector and baculovirus DNA of the wild type. From the transformed cells produce recombinant virus containing DNA coding for the precursor of the target polypeptide DNA sequence under the control of polentinos promoter, which is used to infect cultures of insect cells. The DNA fragment that encodes a polypeptide having antithrombine activity, has established the nucleotide sequence. Recombinant expression vectors and transfer reac what it contains as active principle an effective concentration of the recombinant polypeptide with antithrombins activity and a pharmaceutically acceptable carrier or diluent. The use of the invention improves the efficiency of treatment of venous thrombosis. 9 C. p. f-crystals, 15 ill.

The invention relates to polypeptides and receiving them. These polypeptides were isolated from the leech Hirudinaria manillensis. These polypeptides have antithrombine properties.

The most famous antikoaguliruyuschee peptides, obviously, belong to the family of hirudinea. Hirudin, which was isolated from the medicinal leech Hirudo medicinalis, is well known in the art as a polypeptide inhibitor of thrombin1,2. In particular, hirudin binds to thrombin through ionic interactions, thus preventing the transformation of fibrinogen in fibrin and subsequent formation of fibrin clots. Animal studies hirudin showed efficacy in the prevention of venous thrombosis, occlusion anastomoticheskih vessels and thrombin-induced disseminated intravascular coagulation. Furthermore, hirudin detects low toxicity, low antigenicity, or its complete absence, and short time of removal from blood circulation3.

Polypeptides with antikoaguliruyuschee properties have been isolated from various species of leech Hirudinaria manillens reservati antikoaguliruyuschee peptides, amino acid sequence which may differ from the amino acid sequence of hirudin and other well-known variants.

The authors of this proposal, studies have been conducted to obtain drugs from the leech Hirudinaria manillensis. As a result of these studies revealed three new polypeptide having antithrombine activity. In accordance with this present invention relates to a polypeptide containing the amino acid sequence (see the end of the description), and its pharmaceutically acceptable salts.

Amino acid residues are represented in accordance with their standard three-letter code (Eur. J. Biochem. 138. 9-37, 1984). The remainder Yaa represents Asp or Tyr-residues, and Zaa represents-OH, -NH2or Gly-OH. These salts can be acid additive salts. These salts can be formed with inorganic acids such as halogen acids, such as hydrochloric acid, sulfuric acid, phosphoric acid, or pyrophosphoryl acid, or organic acids, such as benzolsulfonat, p-toluensulfonate, methanesulfonate, acetic, lactic, palmitic, stearic, malic, tartaric, ascorbic, or limonaderies, potassium, calcium, magnesium or ammonium salt, or these salts can be formed of a physiologically acceptable organic nitrogen-containing bases. The polypeptides may also be in the form of internal salts.

The polypeptides of the present invention consist essentially of the above amino acid sequence (i) - (iii). Natural polypeptides isolated from Hirudinaria manillensis, have the amino acid sequence (i) or (ii) where Yaa is Asp, a Zaa is-OH or a partial amino acid sequence (iii). The polypeptides of the present invention can be isolated and purified for use as antagonists of thrombin.

The polypeptides can be obtained using the previous all or part of the leader sequence. This leader sequence may be native or alien leader sequence with respect to the cage from which the polypeptide. Leader sequence has the ability to direct the secretion of the polypeptide from the cell. Both natural polypeptide of the present invention expressed a leader sequence, which is then cleaved. So can prisutstvie: Met Phe Ser Leu Lys Leu Phe Val Val Phe Leu Ala Val Cys Ile Cys Val Ser Gln Ala.

Natural polypeptide of the present invention or its salt can be obtained by allocating a specified polypeptide or its pharmaceutically acceptable salt of the tissue or secrets leech species Hirudinaria manillensis. In particular, the polypeptide of the present invention can be obtained by producing in accordance with WO 90/05143 and purification using liquid chromatography high pressure.

The polypeptide of the present invention or its salt can be obtained by

a) use the host transformed with the expression vector containing the DNA sequence encoding the specified polypeptide under conditions that ensure the expression of the polypeptide in the host;

b) allocation thus obtained polypeptide or its pharmaceutically acceptable salt.

This method mainly consists in obtaining a nucleotide sequence that encodes the desired polypeptide, and expression of the specified polypeptide in recombinant organisms. The cultivation of genetically modified organisms leads to the production of the desired product with full biological activity. In addition, the present invention relates

to expressionism, transformed using a compatible expression vector in accordance with the present invention;

to a DNA sequence that encodes a polypeptide of the present invention.

The host used for expression of the polypeptide of the present invention can be obtained by transformation of the host cell using a compatible expression vector of the present invention. This expression vector can be obtained by:

a) chemical synthesis of a DNA sequence that encodes a polypeptide of the present invention;

b) inserting a specified DNA in an expression vector.

Alternatively, the expression vector can be obtained by

a) production and allocation of cDNA that encodes a polypeptide of the present invention, mRNA leech species Hirudinaria manillensis; and

b) inserting the selected cDNA in the expression vector.

Thus, according to the present invention the polypeptide produced by obtaining transformed host under conditions that ensure the expression of the polypeptide in the host. If the host is a eukaryotic cell, the resulting polypeptide can be glycosylamines. The resulting polypeptide can be is bretania or its salt can be obtained in pure form.

The polypeptides of the present invention can be modified by amino acid extension inserts one or both ends. Polypeptide consisting of such elongated sequence, must, of course, still have antithrombine activity. For example, a short sequence of 30 amino acid residues can be introduced at either or both ends.

The polypeptides of the present invention may be subjected to one or more post-translational modifications such as sulfation, COOH-amidation, acylation or chemical change of the polypeptide chain. For example, a polypeptide having at its carboxyl end glycine residue may be subjected to amidation enzyme using peptidyl-glycine--lidiruyushey monooxygenase (RAM enzyme).

For production of the polypeptide with protivotromboznoe activity by using techniques of recombinant DNA get the gene encoding the polypeptide of the present invention. The coding DNA sequence usually does not contain introns. This DNA is isolated and purified. The gene inserted into the expression vector capable of producing the recombinant product. DNA paleostage. The synthetic gene is usually obtained by chemical synthesis of oligonucleotides, which generally correspond to the desired gene. Then, to obtain gene assemble these oligonucleotides.

Specified gene can be constructed from six chemically synthesized oligonucleotides, each of which represents about 1/3 of the threads of the double-strand gene DNA. To obtain a desired gene oligonucleotides sew and annealed. Optionally, a gene sequence can be modified using site-directed mutagenesis by replacing one or more codons. Usually, the gene construct using restricteduse sites at each end to facilitate subsequent manipulations.

As mentioned above, can be obtained a DNA sequence that encodes a leader peptide. The specified leader peptide has the ability to the direction of the secretion of the polypeptide from the cells in which this peptide was expressed. A sequence encoding a leader peptide, typically, are ligated to the 5'-end DNA sequence that encodes the polypeptide.

This leader peptide may be OmpA-leader peptide, if necessary expression in bacterially vesicular stomatitis virus G (VSV-G protein). The appropriate DNA sequence encoding a leader sequence, OmpA and VSV-G protein, to the following:

< / BR>
In accordance with the present invention can be obtained from a DNA sequence encoding a protein, which is cleaved to release the desired polypeptide. This can be used a DNA sequence that encodes a carrier polypeptide sequence made by tsepliaeva connection with the N-end of the polypeptide of the present invention. This mixture can be converted cyanide bromide.

For expression of the polypeptide construct an expression vector that contains a DNA sequence encoding the polypeptide and capable of expression of the polypeptide in an appropriate host. Can be used transcriptional and translational regulatory elements including a promoter for the DNA sequence and the site of transcription termination and initiation codons and translation termination. DNA sequence get in the correct reading frame so that the expression of the polypeptide occurred in the host that is compatible with the vector.

The expression vector typically includes a region of the beginning of the replication and posledovatelnostyu, encoding the polypeptide. The specified expression vector may be a plasmid. In this case, the promoter is preferably selected from Ptrpand Plcc/lac-promoters, stitched to the DNA sequence. Alternatively, the expression vector can be a virus. This virus may be a recombinant baculovirus in which the polyhedrin promoter operatively associated with a DNA sequence that encodes a polypeptide.

The expression vector which is capable of expression of the polypeptide may be obtained using standard techniques. A DNA fragment encoding the polypeptide, can be inserted into the corresponding restriction site of the expression vector, e.g. plasmid vector. Recombinant baculovirus can be obtained by

(i) cloning of the gene encoding the polypeptide into a baculovirus vector-vector in restricteduse site, located behind (in the direction 5 __ 3) poliakrilovymi promoter; and

(ii) co-transfection of insect cells susceptible to baculovirus infection with a recombinant vector as defined in stage (i), and intact baculovirus DNA of the wild type.

As a result of homologous recombination, allowing pirosky vector-vector can have a unique cloning site, located behind (5 __ 3) initiating ATG-codon polyhedrin. The product, expressed obtained by recombinant baculovirus, is a hybrid protein in which the N-terminal part of the polyhedrin protein fused to the N-end of the polypeptide. As mentioned above, split the connection may be in place ligating.

In stage (ii) as insect cells are commonly used cells of Spodoptera frugiperda. As wild-type baculovirus usually use the nuclear polyhedrosis virus of Autographa californica NPV (AcNPV).

The expression vector encoding the polypeptide, get in the appropriate host. Cells transformed with the polypeptide gene. Transformed host cells under conditions enabling expression of the polypeptide. Transformed cells, for example, is cultivated in such a way as to create the possibility for realization of the specified expression. In this case, can be used with any system compatible host and vector.

Transformed host may be prokaryotic or eukaryotic. Can be used for bacterial or yeast host, such as E. coli or S. cerevisiae. In particular, can be used gram-politicaleconomy cells of the insect, if baculovirus expressing the system in this case is appropriate, Such cells insect cells are Spodoptera frugiperda. In another alternative embodiment, can be transformed cells belonging to the cell lines of the mammal. In this case, can be used non-human transgenic animals in which is produced the desired polypeptide.

Expressed polypeptide can be isolated and purified. This can be obtained polypeptide having one of the above amino acid sequence (i), (ii) or (iii), preceded by a Met residue encoded by the initiation codon of translation. Alternatively, as mentioned above, can be obtained hybrid protein containing the amino acid sequence of the polypeptide of the present invention, i.e., the sequence (i), (ii) or (iii), legirovannoi sequence carrier. If specified in hybrid protein between the amino acid sequence (i) and (ii) or (iii) and sequence-carrier has a corresponding connection, the polypeptide having the above amino acid sequence (i), (ii) or (iii) may be isolated by splitting this regard Sool can also be obtained by

(a) chemical synthesis of the specified polypeptide; and

(b) the allocation thus obtained polypeptide or its pharmaceutically acceptable salt.

Thus, the polypeptide may be constructed by chemical synthesis of certain amino acids and/or peptides, pre-formed from two or more amino acids in the order corresponding to the sequence of the desired polypeptide. This can be used in solid-phase or solvent methods. The resulting polypeptide may be necessary, converted into its pharmaceutically acceptable salt.

In solid-phase synthesis of amino acid sequence of the desired polypeptide consistently design of the C-terminal amino acids, is associated with an insoluble resin. After production of the desired polypeptide, it can be allocated from the resin. When using synthesis in the liquid phase of the desired polypeptide can be re-constructed from the C-terminal amino acids. Carboxyl group of these amino acid residues, corresponding blocked by a protective group, at the end of the synthesis are removed.

Regardless of whether tverdofaznogo and activated carboxypropyl. Functional side groups are also protected. After each synthesis, aminosidine groups are removed. The functional group of the side chain is usually removed at the end of the synthesis.

The polypeptide can be transformed into its pharmaceutically acceptable salt. It can be converted into an acid additive salt with organic or inorganic acids. This acid is acetic, succinic and hydrochloric acid. Alternatively, the specified peptide can be converted into a salt of carboxylic acid, such as ammonium salt or salt of an alkali metal, e.g. sodium or potassium salt.

The polypeptide or its pharmaceutically acceptable salt can be used in pharmaceutical compositions in combination with pharmaceutically acceptable carrier or excipient. Such a composition may be, for example, intravenous drugs (in this case, the carrier is usually sterile saline or water with an acceptable degree of purity). The polypeptide of the present invention is an antagonist of thrombin and can be used in the treatment of thromboembolism, such as clotting of blood. The polypeptide can also be used for lescovich States (for example, in septic shock or polytraumatised shock), in the treatment of consumption coagulopathy, in hemodialysis, gamosepala under artificial circulation. In one of the embodiments of the present invention the polypeptide or its salt can be introduced together with a plasminogen activator, such as tissue plasma activator.

The dose of the polypeptide, mainly depends on the specific forms of introduction, and goals of treatment or prevention. The size of the individual doses and the scheme of injection can be determined by a specialist, depending on the disease, because every specialist known methods of determining factors of blood necessary for adequate treatment, mainly in the case of injection, a therapeutically effective amount of the compounds of the present invention is in the range of about 0.005 to 0.1 mg per kg of body weight. The preferred dose is approximately in the range from 0.01 to 0.05 mg/kg of body weight. An effective method of administration are intravenous, intramuscular or subcutaneous injection. In accordance with this a single dose of the composition for parenteral administration depends on a way of introduction and is approximately from 0.4 to 7.5 mg the same contains a buffer (for example, phosphate buffer) which is used to maintain a pH in the range of about 3.5 to 7, and other components such as sodium chloride, mannitol or sorbitol for regulating the isotonicity of the solution. These compositions can be in liofilizovannyh form or in the form of solutions, preferably containing antibacterial active preservatives, for example from 0.2 to 0.3% of methyl or ethyl ether complex of 4-hydroxybenzoic acid.

The composition for external use can be obtained in the form of an aqueous solution, lotion or gel, oil solution or suspension, or fat-containing, or, in particular, emulsifying ointment. The composition in the form of an aqueous solution get, for example, by dissolving the active ingredients of the present invention, or its therapeutically acceptable salts, in an aqueous buffer solution (e.g., pH 4-6,5), in which, if desired, in addition to the active ingredient can be added anti-inflammatory agent, and/or polymeric binder such as polyvinylpyrrolidone, and/or preservative. The concentration of active ingredient is from about 0.1 to 1.5 kg, and preferably from 0.25 to 1.0 mg / 10 ml or 10 g of gel.

Oil form for etenia or its therapeutically acceptable salt oil optionally, with the addition of an agent that causes swelling, such as aluminum stearate, and/or surface-active substances (surfactants) having an HLB value ("hydrophilic-lipophilic balance) below 10, such as imokalee monetary polyhydric alcohols, such as glycerylmonostearate, sorbitanoleat, servicemonitor or servicemanual. Fat-containing ointments can be obtained, for example, by suspension of the active ingredient of the present invention or its salts in a suitable for the deposition of fatty base, and optionally adding a surfactant having a HLB value below 10. Emulsifying ointment is obtained by mixing an aqueous solution of the active ingredient of the present invention or its salts in the soft fatty base, capable of spreading, and with the addition of detergent having a HLB value below 10. All forms intended for external use may also contain preservatives. The concentration of active ingredient is from about 0.1 to 1.5 mg, and preferably from 0.25 to 1.0 mg to about 10 g basis.

In addition to the above compositions and their pharmaceutical counterparts, designed to be inserted directly into organisms medical use outside the body of man or animal. Such compositions and preparations are usually used as anti-coagulants funds added to the blood subjected to circulation or processing outside the body (for example, artificial blood or dialysis, artificial kidneys), preservation or modification (for example, gamosepala). These drugs, such as uterine solutions or alternative medicines in single doses, its composition is similar to that described above drugs for injection; however, the amount or concentration of the active ingredient depends mainly on the volume of blood, and more precisely from the content of thrombin. In this regard, it should be considered that the active ingredient of the present invention in free form completely deactivates approximately 5-fold amount by weight of thrombin and is physiologically harmless even in relatively large quantities and quickly withdrawn from circulation even at high concentrations, so the risk of overdose is virtually absent, for example, even when the transfusion. Depending on the specific goals of a suitable dose of active ingredient is from about 0.01 to 1.0 mg per liter of blood, even though prevysheniee the invention together with the accompanying figures.

In Fig. 1 shows a chromatogram representing the results of HPLC analysis of example 1, P1 - P3 indicate the three different peaks obtained according to the description in example 1. FT corresponds to the flow, and 4-AB corresponds to the 4-aminobenzamidine.

In Fig. 2 shows the elution profiles obtained in example 2 (b) for trypsin-digested PE-P1 (A) and PE-P2 (B).

In Fig. 3 shows the nucleotide sequence of the six oligonucleotides that encode most of the protein corresponding to peak 2 (P2), in which the amino acid residue at position 61 is Asp, and the last amino acid polypeptide chain is Asn64. Bold font shows the BalI site, which was used for further constructions. In the lower part of the figure shows how to build six oligonucleotides. For subsequent manipulations were used Hind III and > PST -sites.

In Fig. 4 shows a diagram of the construction of the intermediate plasmid M13-P2, which is the source of BalI-BamHI fragment DNA for all subsequent designs P2.

In Fig. 5 schematically shows the construction of a new recombinant M13 labeled OMP P2, which is solely P2 gene associated with leader peptide OmpA. Leader peptide poligeneticheskie shows the design of pFC-P2, which is a plasmid used for producing protein P2 in E. coli.

In Fig. 7 shows in outline the structure of the plasmid pOMPA-P2 used for the production of P2 in E. coli. To obtain this new plasmid, where P2 gene is under the transcriptional control of a hybrid promoter Plpp/lacwas used the traditional technique of gene recombination. Even in this case, the leader peptide OmpA directs the secretion of P2 in periplasm E. coli.

In Fig. 8 shows the nucleotide sequence and Assembly of synthetic oligonucleotides used for the secretion of P2 from insect cells. The sequence is shown in bold refers to a leader peptide of the protein VSV-G.

In Fig. 9 schematically shows the construction of a new recombinant M13 labeled VSV-P2, where P2 gene is associated with the leader peptide of the protein VSV-G.

In Fig. 10 schematically shows the construction pAc-P2, which was used as vector-vector in the baculovirus genome. pAcYM1 is the starting plasmid, is widely used as the acceptor of a heterologous sequence to be transferred to the virus.

In Fig. 11 shows the nucleotide posledovatelnyi additional meinenemy the rest.

In Fig. 12 schematically shows the construction of pAcFT1, which is used for intracellular expression.

In Fig. 13 schematically shows a new transport plasmid, designated pAcFT1-P2, which contains the full P2-sequence associated with the first 18 amino acids polyhedrin. This plasmid was used to transfer heterologous sequence in the baculovirus genome.

In Fig. 14 shows schematically the RACE Protocol for amplification of the 3'-ends. In this figure, "***TTTT..." means adaptery dT17 primer. In each phase diagrams for simplicity shows only how to use the new product obtained in the previous stage.

In Fig. 15 shows schematically the RACE Protocol for amplification of 5'-ends. In this figure, "***TTTT..." and "***" indicate adaptery dT17 primer and adaptery primer, respectively. For simplicity, in each stage of the diagram shows only how to use the new product obtained in the previous stage.

Example 1

Antithrombine the drug was received from the leech Hirudinaria manillensis in accordance with WO 90/05143, according to the following procedures (a) and (b).

a) Extraction of acetone l). After homogenization by stirring at room temperature the mixture was centrifuged for 15 min at 2700 rpm, the supernatant was decanted, and the precipitate resuspendable in a mixture (40: 60) of acetone and water, stirred for 30 minutes and the resulting mixture was centrifuged for 15 minutes at 2700 rpm, the Supernatant was collected and combined, and then acidified glacial acetic acid to pH 4.5 (volume of 8.5 liters). The resulting mixture was centrifuged for 15 minutes at 2700 rpm, after which the supernatant decantation, and the pH of the solution was brought to pH of 6.0 by addition of 30% ammonia. After rotary evaporation at 35oC pH of the concentrated solution was diluted to 1.8, precipitated impurities were removed by cetrifugation and raw antithrombine material besieged from the mixture using a 9-fold excess of acetone. The mixture is then centrifuged, the precipitate resuspendable in acetone and again centrifuged. After that, the precipitated material was liofilizovane.

b) Ion-exchange purification

Raw antithrombin material was recovered in the water, were dialyzed against 10 mm AMMONIATING buffer at pH 4.0 and loaded into a column about carboxymethylate separate (CM Sepharose, Pharmacia, 2,6 x 30 cm), previously equilibrated the ammonium (pH 4.5), collected and combined (1.3 l). For the subsequent stages of purification combined fractions were concentrated to 0.5 l in the apparatus of Minican (Millipore); the concentrated solution was neutralized with NaOH and then was loaded into a column of Q-Separate, balanced 20 mm Tris-HCl (pH 7.0). Bound material was suirable linear gradient of 0 - 1 M NaCl in the source buffer. Fractions with antithrombin activity were combined, concentrated and absoluely on a column of Superdex S-200, elwira 20 mm Tris-HCl (pH 7.5) at a flow rate of 4 ml/min Active pool from the gel filtration were concentrated in the apparatus of Minican, and then was purified by weak ion-exchange chromatography (DEAE FPLC). The active material was then loaded into a column with Protein Pak DEAE-5PW (Waters) and suirable gradient of 0 - 1 M NaCl in 20 mm Trio-HCl (pH 6.5), at a flow rate of 1.0 ml/min Active fractions were pooled, analyzed for protein content and activity (specific activity: 800 ATU/mg), and liofilizovane concentrator (Speed Vac, Savants).

Thus obtained partially purified material (specific activity 800 ATU/mg) was then subjected to two additional stages chromatography to obtain a homogeneous polypeptides in accordance with the following descriptions (C) and (d).

(C) T IS(*), and then subjected to binding with activated Separate CL 6B (Pharmacia) according to the manufacturers instructions. Column 1.7 ml balanced 50 mm Tris-HCl (pH 8,3) and downloaded liofilizovannye material obtained after DEAE-FPLC (restored in the buffer). Then the column was subjected to three washing in the source buffer, and then in the same buffer containing 3.0 M NaCl, and again in the source buffer (each wash was three times the column volume). The flow rate was 0.3 ml/min Bound material was suirable 10 ml of 0.1 M 4-aminobenzamidine in 25 mm HCl. Active fractions were collected, combined, with ion exchange buffer 50 mm Tris-HCl pH 8.3 per column PD-10 (Pharmacia).

Unbound material was suirable from the column by washing away in the source buffer and the material, even with antithrombin activity was again loaded into the column until such time as all this material will not be linked and chromatographical.

(*) Lundblad, R. L., 1971, Biochemistry, 10: 2501-2506

(d) RP-HPLC

The material obtained after affinity chromatography was purified using reverse-phase high-performance chromatography (RP-HPLC) on a column (C4-Vidak 4.6 x 250 mm, 5 μm) using 20 mm sodium phosphate (pH 7.5) as the first eluent, and 50% aceo 55% eluent B within 45 minutes, at room temperature at a speed of 1.0 ml/min. and the resulting chromatogram is shown in Fig. 1.

Peaks protein (detected at 220 nm) were collected manually, concentrated in vacuum and again chromatographically under the same conditions.

Purified after HPLC C4 antithrombine polypeptides were analyzed for protein content, amino acid composition, N-terminal sequence, C-end, and their activity was determined using the in vitro analysis (ATU/NIH-test and test "thrombin time"). As a result of these analyses, it was found that each of the three peaks of the protein had significant antithrombin activity.

Complete amino acid sequence of the polypeptide, labeled P1 and P2 in Fig. 1, was determined by N-terminal sequencing of peptides derived from tripticase and V8-proteasome Perevalov. These sequences correspond to the above sequences (i) and (ii). Partial amino acid sequence of another polypeptide (P3) corresponds to the sequence indicated above (iii).

Example 2: Trypticase digestion and peptide mapping pyridylmethylamine (PE) P1 and P2

(a) Recovery/aydinali and subjected to ion exchange buffer 10 mm Tris-HCl (pH 8,3) on PD-10-column. The active pool (about 50 μg) were concentrated in the centrifuge Speed-Vac (Savant) and was treated with 100 μl of 1% b-mercaptoethanol, 6 M guanidine-HCl/ 50 mm Tris-HCl (pH 8.5) in the presence of nitrogen, in the dark, for 2 hours at room temperature. Then were added 4 μl of 4-vinylpyridine) - derivatives (net) and the mixture incubated for 2 hours as above4.

Pyridylmethylamine polypeptides were first isolated from the reaction mixture by RP-HPLC on a C4 column (Vydac) (4.6 x 250 mm, 5 μm), elyuirovaniya within 90 minutes linear gradient of 5-65% acetonitrile in 0.1% TFA, flow rate 1.0 ml/min. Under these conditions, the mixture antithrombin polypeptides badly divided, so they were re-chromatography on the same column using as eluent a mixture of sodium phosphate and acetonitrile in the conditions already described in example 1d.

(b) Trypsinogen digestion and peptide mapping PE-P1 and PE-P2

Purified PE-P1 and PE-P2 (10 and 20 mcg, respectively) were digested TPCK-treated trypsin (Sigma) in 200 μl of 1% ammonium bicarbonate (pH 8.0) in the presence of 0.2 M phosphate. Trypsin was added in the ratio of enzyme to substrate of 1:20 (wt./mass.) and incubated for 4 hours at 37oC. the Digestion was stopped is I, were separated on a C18-column (MK Bondapak, 3.9 x 300 mm, 10 MK Waters) or on a C4 Vydac-column (4.6 x 250 mm, 5 μm), elwira within 60 minute linear gradient of 5 to 65% acetonitrile in 0.1% TFA, at a flow rate of 1.0 ml/min (Fig. 2). Erwerbende peaks were collected manually, concentrated in a Savant, and then were analyzed by amino acid sequence and N-terminal sequence for pulsed liquid-phase sequencing machine ser. 477A (Applied Biosystems).

The results of this peptide mapping trypsinization PE-P1 (A) and PE-P2 (B) are shown at the end of the description.

Example 3: Chemical synthesis of P2-gene.

Nucleotidases sequence was designed on the basis of preferred codons5E. coli. In addition, BalI restriction site was designed in close proximity to the 5'-end of the synthetic gene for insertion sequence in different expression vectors. In fact, the same synthetic gene was used for expression of recombinant protein P2 in bacteria or insect. In the case of insect cells have developed methods that allowed you to get protein P2 in the form of secreted or cytoplasmic product.

Sinteticheskih complementary oligonucleotides were obtained using an automatic DNA synthesizer (Applied Biosystems) (received sequence shown in Fig. 3). After enzymatic phosphorylation of these 6 oligonucleotides were assembled using DNA ligase and the resulting double-strand sequence was inserted into M13-phage mp18 vector, thereby obtaining a plasmid M13-P2, which is shown in Fig. 4. In order to be able to insert a P2-M13 gene in the vector to the specified synthetic oligonucleotides have also added Hind III and > PST -sites. The correct nucleotide sequence was checked by the method of Sanger conducted on single-stranded ragovoy DNA7.

Recombinant plasmid M13-P2 was used as the source of the P2 gene for all expression vectors used in the examples.

Example 4: Expression and secretion of P2 from cells of E. coli.

To obtain secretion in periplasm recombinant product you need the P2 molecule to synthesize in the form of protein-predecessor. In particular, amino acid sequence, called "leader peptide", and responsible for the efficient secretion must be present in the NH2-end P28,9. This additional sequence was then useplease in vivo during secretion by specific leader peptidases E. coli, resulting received the correct Mature posledovatelnoy system based on the signal, stimulating the secretion of vneshnemembrannye protein of E. coli (OmpA) (PREV. publ.13). For this we have built two additional complementary oligonucleotide encoding a leader peptide OmpA, which was preceded by the sequence of the Shine - Dalgarno OmpA, known as the sequence responsible for the efficient translation of a messenger RNA14.

This sequence is shown in Fig. 5, also includes the beginning of the P2 gene encoding the first 10 amino acids. The presence BalI-site allows you to link these two synthetic fragment with the remaining P2-coding sequence, whereas the presence of the above (in the direction 3 __ 5) Hind III site allows you to associate them with the M13 vector. So, for example, synthetic Hind III-BalI fragment ligated with BalI-BamHI-cut from M13-P2 and inserted into M13 mp18, resulting received a new plasmid, designated OMP P2. Specified new plasmid is shown schematically in Fig. 5.

From OMP P2 can be cut P2 gene in the form of a Hind III-BamHI fragment, which encodes OmpA-Shine-Dalgarno and leader peptide, followed by P2-coding sequence. This restriction fragment already can be easily inserted into the appropriate expression vector. theoretical is ANO expressing several systems. Previously14in the laboratory of the authors of this application was successfully used the system on the basis of promoter Ptrp. Moreover, even if the selected promoter levels of expression of this polypeptide are almost unpredictable.

Plasmid pFC33 shown in Fig. 6, has already been described in literature14. This plasmid is resistant to ampicillin and contains a bacterial promoter Ptrpthat controls the expression of propolypeptide Al. After digestion pFC33 by Hind III and BamHI large Hind III-BamHI fragment carrying the gene of resistance to antibiotics and the promoter was isolated and ligated with Hind III-BamHI fragment obtained from OMP P2 coding P2 gene. The details of this design is shown in Fig. 6. Selected new plasmid, designated pFC-P2, represented the end of plasmids for the production of P2 in E. coli.

The object of the present invention is the use of strains of E. coli type B for the expression and secretion in periplasm P2 and other antithrombin polypeptides of the present invention. Indeed, it was found that the insertion of the plasmid pFC-P2 strains of the bacterium E. coli type B allows to obtain a high level of production P2. In this regard, inchoata selection of this strain of the host is very important for the production of Borodin.

For producing P2 can be used several strains of type B E. coli. Preferred strains are ATCC 12407, ATCC 11303, NCTC 10537. Below is an example of transformation strain NCTC 10537 using plasmids F-P2, and subsequently culturing the obtained transformant.

Competent cells of strain NCTC 10537 received by treatments with calcium chloride, described by Mandel and Higa15. Approximately 200 μl of the preparation of these cells (at a concentration of 1 to 109cells in one milliliter) were transformed with 2 μl of plasmid DNA (approx. concentration of 5 μg/ml). Transformants were selected on plates with L-agar containing 100 μg/ml ampicillin. Two small colonies inflicted stripes tipped wooden sticks, with each colony was applied in the form of three bands with a length of 1 cm on L-agar containing the same antibiotic. After a 12-hour incubation at 37oC part of the bands analyzed for the production of P2 protein by inoculation of 10 ml of LB-medium containing ampicillin at a concentration of 150 μg/ml) and incubated overnight at 37oC. the next day the culture was diluted 1:100 in M9 medium containing the same concentration of ampicillin, and incubated in Capri 4oC. Bacterial sludge resuspendable in 2 ml of 33 mm HCl-Tris (pH 8), then added an equivalent volume of the second volume 33 mm etc, 40% sucrose, and the mixture incubated under conditions of mild shaking for 10 minutes at 37oC. After centrifugation cells with artificially increased membrane permeability resuspendable in 2 ml of cold water and kept on ice for 10 minutes. The obtained supernatant was isolated by centrifugation and resulted periplasmatic fraction of bacterial cells.

Using chromogenic analysis, which is based on the inhibition of the ability of thrombin to the hydrolysis of the synthetic substrate S-223816has detected the presence antithrombine activity in periplasmatic fraction P2-producing cells, whereas in the control periplasmatic fractions this activity was absent.

Similarly designed a new plasmid expression/secretion for P2, where instead of the promoter Ptrpused the promoter Plpp/lac17. This plasmid, designated pOMP-P2, shown in Fig. 7. After insert of this plasmid in strains of E. coli type B also received high levels of active P2. As the source of dps is up and induce expression using isopropyl--D-thiogalactopyranoside (IPTG) were also similar conditions, described previously17.

Example 5: Expression and secretion of the protein P2 from insect cells

For secretion of the protein P2 from recombinant cells of the insect P2-encoding sequence connected with a leader peptide, which is well recognized by these cells. Used for this purpose leader peptide G-protein of vesicular stomatitis virus (VSV)18. In a similar way (see above) was obtained synthetic DNA sequence encoding a leader peptide G protein of VSV, which was located at the beginning of the P2 gene; the resulting nucleotide sequence is shown in Fig. 8. In this case, were also constructed the corresponding restriction sites (Hind III-BamHI and BalI, which you can ligitamate this sequence to the remaining part of the P2 gene and expression vector.

Synthetic fragment Hind III-BalI ligated with purified BalI-BamHI fragment from M13-P2 bearing P2-gene, and inserted into M13mp18, pre-cut Hind III and BamHI. As a result of this design received a new plasmid, designated VSV-P2, which is shown schematically in Fig. 9. From VSV-P2 cut DNA fragment BamHI-BamHI bearing P2-gene legirovannye with leader peptide VSV, which is La the implementation of the expression in insect cells is necessary to P2-coding sequence (VSV) was transferred into the baculovirus gene under transcriptional control of the polyhedrin promoter. For these purposes, the cells of the insect was co-transferrable baculovirus DNA of wild-type and vector-vector pAc-P2. As the host cells used cells of Spodoptera frugiperda. In more detail, the experiment was carried out as follows.

Cells of S. frugiperda was transferrable a mixture of DNA infectious AcNPV and plasmid DNA, which was a separate recombinant vectors-vectors, using a modification of the procedure described Summer and other20One microgram of viral DNA was mixed with 25-100 μg of plasmid DNA and besieged 0.125 M (final concentration) of calcium chloride in the presence of 20 mm HEPES buffer (pH 7.5), 1 mm dinatriumfosfaatti, 5 mm KCl, 140 mm sodium chloride and 10 mm glucose (total volume 1 ml).

The DNA suspension was inoculable in the monolayer 106S. frugiperda cells in a Cup with tissue culture (35 mm) and held for 1 hour at room temperature to its adsorption to the cells, and then was replaced with 1 ml of medium. After incubation for 3 days at 28oC the supernatant was collected and used for the production of plaques is edroza using an optical microscope. Then from these plaques were removed virus and after cleaning these plaques were used to produce poliakin-negative viral product.

The above procedure was used for selection of recombinant baculovirus, the genome of which contains P2-gene under control of the polyhedrin promoter and leader peptide of the protein CVSV. This virus was used to infect the cells of S. frugiperda in accordance with well known procedure20(multiplicity of infection of 10). Then the infected cells were maintained in culture with constant stirring (spin-culture) or in monolayers in the presence of 10% serum amniotic calf in accordance with standard methods20. In both conditions, S-2238-chromogenic analysis showed the presence of antithrombine activity in supernatant cultures of infected cells.

Example 6: Expression of protein P2 in the cytoplasm of cells of the insect

Protein P2 can also be produced and accumulated in the cytoplasm of cells of S. frugiperda. This method generally gives higher yield of heterologous proteins because it uses signals in the expression of polyhedrin, which is secretively viral protein.

The way this izobreteny the first 18 amino acids polyhedrin connected with the preservation of the reading frame with 64 amino acids of P2. The presence of NH2-terminal sequence of the polyhedrin allows to obtain high level expression21. In addition, between the polyhedrin site and P2 sequence is meinenemy balance, which promotes the release of the P2 part in the processing of the hybrid protein CNBr.

Similarly to the previous method was initially provided to a synthetic DNA fragment, which allows you to connect BalI-BamHI fragment from M13-P2 with an appropriate expression vector. New synthetic fragment shown in Fig. 11, also includes BamHI and BalI-sites that are necessary for subsequent manipulations.

Then was received by the other vector-vector, pAcFTl carrying the nucleotide sequence encoding the first 18 amino acids polyhedrin (Fig. 12). In short, EcoRV-BamHI fragment pAcYMl19was replaced with a synthetic oligonucleotide containing the sequence of the polyhedrin gene from nucleotide -92 to nucleotide +55. The corresponding BamHI site is after this sequence and was used for insertion of the full P2 coding sequence in accordance with the scheme illustrated in Fig. 13. With this design was the new plasmid, designated pAcFTl-P2, which is received in accordance with the description in example 5. Infection of cells of S. frugiperda were performed according to standard procedures20. Cultivation of infected insect cells resulted in cytoplasmic accumulation of the hybrid protein. This hybrid protein was used as a source of recombinant protein P2. For cleavage of the hybrid by CNBr22,23can be used several ways, described in the literature. The application of the method of Olson and others23allows you to obtain the correct polypeptide sequence P2. This molecule showed antithrombin activity.

Example 7

To obtain Tyr61option P2-protein nucleotides 5 and 6, described above in the dreamer 3 and shown in Fig. 3, was replaced with the following oligonucleotides:

Oligo 5-Tyr

5'-CGAAATCTCAGACTGAAGGTGACTTCGAAGAAATTCCGGACGAATACATCCTG AACTAGTAACTGCA 3'

Oligo 6-Tyr

5'-GTTACTAGTTCAGGATGTATTCGTCCGGAATTTCTTCGAAGTCACCTTCA 3'

In Oligo-Tyr-5, triplet TAC (which is underlined) encodes the tyrosine residue and replaces the originally present GAC-triplet encoding aspartic acid. Oligo-Tyr-6 appropriately corrected for complete complementarity between the two strands. Subsequent, stage, leading to the expression and/or secretion of the specified option in the in-elongated derived P2-protein, the above-described oligonucleotides 5 and 6 (see example 3) and shown in Fig. 3, was replaced with the following oligonucleotides:

Oligo 5-Gly

5'-CGAAATCTCAGACTGAAGGTGACTTCGAAGAAATTCCGGACGAAGACATCCTGAAC - GGTTAGTAACTGCA-3'

Oligo 6-Gly

5'-GTTACTAACCGTTCAGGATGTCTTCGTCCGGAATTTCTTCGAAGTCACCTTCA-3'

In oligo-5-Gly, triplet GGT (underlined), which encodes a glycine, inserted before the stop codon. Oligo 6-Gly was correspondingly corrected in order to achieve full complementarity of the two strands. Subsequent phases leading to the expression and/or secretion Gly-elongated derived in insect cells or E. coli, were already described above in examples 4-6.

Example 9: Cloning of cDNA P1 and P2

(a) total RNA from heads Hirudinaria manillensis received in accordance with the method of Cathala and other24< / BR>
(b) the reverse transcription Reaction was carried out as follows:

10 μg total RNA, obtained from the heads of leeches

1 µg dT17-adapting primer

8 μl of 5 mm dNTPs mixture

8 µl AMV buffer 5X

H2O up to 40 ál

United and kept on ice, then mixed and the mixture was heated for 2 minutes at 65oC followed by cooling with ice. After this was added 10% Araneina (Promega) and 20 units of AMV reverse transcriptase (Boehringer Mannheim) and incubated for 2 hours at 42oulali polymerase chain reaction (PCR). Below shows the basic scheme of this reaction:

PCR-mix:

5 µl of the back-transcribed RNA

10 µl of 10 x PCR buffer (Cetus /Perkin - Elmer)

16 μl dNTPs mix (1.25 mm each dNTP)

2 µl MgCl20.1 M

25-500 mm of each primer

H2O to 100 ál

The reaction mixture was denaturiruet at 95oC for 5 minutes, then was added 2.5 units of Taq polymerase (Cetus /Perkin - Elmer) and covered the top 80 ál of mineral oil. The reaction was conducted in thermoacetica for the reaction of DNA (Cetus /Perkin - Elmer).

Listed below are circular profiles:

3 min 94oC

2 min 60oC

2 min 30 sec 72oC 1 cycle

1 min 94oC

2 min 60oC

3 min 30 sec 72oC 30 cycles

1 min 94oC

2 min 60oC

5 min 72oC 1 cycle

7 min 72oC

left at 25oC

Residual Taq polymerase iactiveaware precipitation with phenolchloroform and ethanol and the samples were stored at -20oC. To obtain complete sequences P1 and P2 cDNA was performed three rounds of PCR amplification. The sequence of each primer is shown below. Provisions, which was introduced in the oligonucleotide sequence degeneration, listed below primerno sequence the sites, added to facilitate cloning of amplification products, are underlined.

dT17-adaptery primer:

5' - GAC TCG AGT CGA CAT CGA TTT TTT TTT TTT TTT TT 3'

XhoI SalI

Adaptery primer:

5' - GAC TCG AGT CGA CAT CG-3'

XhoI SalI

Primer 3-8

5' ATC GAA GCT TTA TAG CGA TTG TAG NGA 3'

Hind III C A C C

Primer 52-56

5' CTA AGG ATC CTT CTT CGA AGT CNCC 3'

BamHI C A A

Primer 32-37

5'ATC GGA ATT CAG TTC TGG AAA TCA GTG CGT 3'

EcoRI

Primer 5'I

5' CTA AGA ATT CTT CGC AAC TTA TAT GCG TT 3'

EcoRI

Primer 5' II

5' ATC GGA ATT CTT AAT TCA ATA TAT CTT CAT 3'

EcoRI

The first round of amplification

500 gr completely degenerated primers having a length of from 3 to 8 residue and from 56 to 52 amino acid residue sequence P2, was used as the opposition of the primers in the PCR reaction.

Amplification of 3'cDNA ends (RACE Protocol), Frohman and other25< / BR>
Gene specific primer, having a length of from 32 to 37 of the remainder, were designed based on the nucleotide sequence of the P2 specified in the first round of amplification. This primer is used together with dT-adapternum primer for amplification of cDNA (Fig. 14).

Amplification of 5'-cDNA ends (RACE Protocol), Frohman and other25< / BR>
10 μg total RNA, obtained from the heads of leeches, evaluation of the first primer was replaced with 1 μg of gene specific primer (5'I) (Fig. 15). Then the reaction mixture was precipitated with isopropanol and the products of single-stranded cDNA was subjected to polyadenylated at its 5'-ends using terminal deoxynucleotidyltransferase (TdT) as follows:

22 μl of cDNA

1 μl of 6 mm dATP

6 ál of 5X TdT buffer (BRL)

1,1 μl TdT (BRL)

These samples were incubated for 10 minutes at 37oC and heated for 16 minutes at 65oC. Then the reaction mixture was diluted to 500 μl with distilled water.

10 μl polyadenylation product amplified using 10 PM dT17-adapting primer, 25 PM adaptorname primer and 25 PM of the second gene-specific primer located behind (in the direction 3 __ 5) the first specific primer used for transcription (5' II, see Fig. 15).

(d) Analysis of PCR-products

Amplificatoare products were digested at restriction sites present in each primer. Digested product was subjected to gel purification and was subcloned into the vector pUC13, pre-digested with the same restricteduse enzymes. Plasmids carrying the desired insertion identified using restriction analysis. Plasmid DNA sequenced using Sequenase (USB), following p is P2, and the deduced amino acid sequence (leader sequence underlined).

Sources of information

1) Markwardt, F. 1970, Methods in Enzymology, 19, p. 924.

2) Markwardt, F. 1985, Biomed. Biochim. Acta. 44, p. 1007.

3) Markwardt, F. Hauptmann, J., Nowak, G., Klessen, C., and Walsmann, P. 1982. Thromb. Haemostasis 47, p. 226.

4) Dupont D., Keim, P., Chui, A., Bello and R. K. Wilson, Derivatizer-Analyser User Bulletin No. 1, Applied Biosystems Inc., 1987.

5) Grosjeans H. and Fiers W. 1982. Gene, 18, p. 199.

6) Maniatis, T., Fritsch E. F. and Sambrook, J. 1982. Cold Spring Harbor, NY.

7) Sanger, F. , Nicklen, S., and Coulson, A. R. 1977, Proc. Natl. Acad. Sci. USA 74, p. 5463.

8) G. Blobel and Dobberstain B. 1975. J. Cell Biology, 67, p. 83.

9) Pages J. M. 1983, Biochimie, 65, p. 531.

10) Wolfe, P. B. 1983. J. Biol. Chem. 258, p. 12073.

11) Talmadge K. , Stahl, S. and Gilbert W. 1980. Proc. Natl. Acad. Sci. USA, 77, p. 3369.

12) Oka, T., Sakamoto, S., Miyoshi K, Fuwa, T., Yoda, K., Yamasaki, M., Tamura G. and Miyake K. 1985. Proc. Natl. Acad. Sci. USA, 82, p. 7212.

13) Henning V., Royer, H. D., Teather, R. M., Hindennach I. and C. P. Hollenberg 1979. Proc. Natl. Acad. Sci. USA, 76, p. 4360.

14) A. Isacchi, Sarmientos P., Lorenzetti R. and M. Soria 1989, Gene 81, p. 129.

15) Mandel, M. and Higa, A. J. 1970. J. Mol. Biology, 53, p. 154.

16) Krstenansky, J. K., and Mao, S. J. T. 1987. FEBS Lett. 211, p. 10.

17) Ghrayeb J., Kimura H., Takahara, M., Hsiung, H., Masui Y. and Inouye, M. 1984. EMBO Journal 3, p. 2437.

18) Bailey, M. J., McLeod, D. A., Kang, C., and Bishop, D. H. L. 1989. Virology 169, p. 323.

19) Matsuura, Y., Possee, R. D., Overton, H. A. and Bishop. D. H. L. 1987. J. Gen. Virol. 68, p. 1233.

20) Summers, M. D., and Smith, G. E. 1987, Texas Agricultural Experiment Station Bulletin No. 1555.

21) Luckow, V., Jornvall, H., Josephson, S., Uhlen, M. and Lake, M. 1987, Peptides, 9, p. 301.

24) Cathala, G., Savouret, J.-F., Mendez, B., West, B. L., Karin, M., Martial, J. A. and Baxter, J. D. (1983) DNA, 2,4:329-335.

25) Frohman, M. A., Dush, M. K. and Martin, G. R. (1988) Proc. Natl. Acad. Sci. USA 85: 8998-9002.9

1. The DNA fragment that encodes a polypeptide having antithrombine activity and having the following nucleotide sequence

GTTTCTTACACCGACTGCACCGAATCTGGCCAGAACTACTGCCTGTGCGTTGGTTCTAACGTTTGCGGTGAAGGTAAAAACTGCCAGCTGTCTTCTTCTGGTAACCAGTGCGTTCACGGTGAAGGTACCCCGAAACCGAAATCTCAGACTGAAGGTGACTTCGAAGAAATTCCGGACGAAGACATCCTGAACTAG.

2. Recombinant polypeptide with antithrombins activity encoded by the DNA fragment under item 1.

3. The way of expression and secretion of the polypeptide with antithrombins activity, including the production of a DNA sequence that encodes the precursor of the target polypeptide, in which the N-end of the said polypeptide linked to a leader peptide, the embedding obtained DNA sequence into a suitable expression vector, containing the gene for resistance to the antibiotic and bacterial promoter, the transformation of the specified vector strain of bacteria that is able to split used leader peptide, culturing of the transformed strain in the conditions necessary for the expression of introduced DNA, and selection of the target product, characterized the peptide, ottsepleny in E. coli, is consistently associated DNA fragment under item 1, and as a transformable bacterial strain used an E. coli strain of type B.

4. The way of expression and secretion of the polypeptide with antithrombins activity, including the production of a DNA sequence that encodes the precursor of the target peptide in which the N-end of the said peptide linked to a leader peptide, the introduction of the DNA sequences in recombinant constructs, providing its expression in the host cell, can also used to split a leader peptide, culturing the transformed cell under conditions that are required for the expression of introduced DNA, and the allocation of the obtained product from the culture medium, characterized in that the DNA sequence, which DNA fragment coding for a leader peptide, ottsepleny in insect cells, consistently associated DNA fragment under item 1, the DNA sequence is first inserted into the vector transfer and are cotransfection insect cells specified by a vector and baculovirus DNA of wild type and transformed cells secrete recombinant virus containing DNA coding for the precursor of zainteresowania culture of insect cells.

5. Pharmaceutical composition for treating cardiovascular disease, comprising as active principle an effective concentration of the recombinant polypeptide with antithrombins activity and a pharmaceutically acceptable carrier or diluent, wherein as the active agent contains the polypeptide under item 2.

6. Recombinant vector pFC-P2 for expression and secretion in E. coli of a polypeptide with antithrombins activity, consisting of a large Hind III - Bam HI fragment vector plasmids pFC33 containing bacterial trp-promoter and the gene of resistance to ampicillin, and the DNA fragment formed by sequentially interconnected Omp A - Shine - Dalgarno sequence, a sequence that encodes the Omp A - leader peptide, and a DNA fragment under item 1.

7. Recombinant vector OMP-P2for expression in E. coli of a polypeptide with antithrombins activity, consisting of a Hind III - Bam HI fragment of the vector plasmid pIN-III Omp A3 containing bacterial promoter PLpp/Lac and the gene of resistance to ampicillin, and the DNA fragment formed by sequentially interconnected Omp And - Shine - Dalgarno sequence, a sequence that encodes the Omp A - leader peptide, and fragmented control of the polyhedrin gene promoter, representing a vector plasmid pACYMI, Bam HI site which is included subject to the transfer of heterologous DNA formed sequentially interconnected sequence that encodes a leader peptide of vesicular stomatitis virus, and DNA fragment under item 1.

9. Recombinant vector pAc FTI-P2 for transferring heterologous DNA into the genome of the baculovirus, consisting of a synthetic DNA fragment having the sequence of the polyhedrin gene from nucleotide -92 to nucleotide +55, and the DNA fragment under item 1.

 

Same patents:

The invention relates to genetic engineering

The invention relates to genetic engineering and the cloning of the human erythropoietin gene

The invention relates to the field of biotechnology, in particular to the field of immobilization of enzymes

The invention relates to protein - antagonist of the growth factor hepatocyte (HGF) and is intended for use in biotechnology and medicine

The invention relates to biotechnology and can be used to produce vaccines

The invention relates to the field of genetic engineering and biotechnology, in particular, to obtain the recombinant plasmid DNA RS-NS3 integrating the complex of genes C, prM, E, NSI, NS2A, NS2B, NS3 virus tick-borne encephalitis (tick-borne encephalitis) into the genome of vaccinia virus (WWII), and the corresponding strain of the great Patriotic war

The invention relates to biotechnology, in particular genetic engineering, is a recombinant plasmid pCVA designed for the transcription of the genes of the ribozymes in the composition of sequences of virus-associated PHK (VA PHK) adenovirus birds FAV1 (CELO) in eukaryotic cells

The invention relates to biotechnology, in particular genetic engineering, is a recombinant strain of vaccinia virus, causing the synthesis of structural proteins of the virus Venezuelan encephalomyelitis of horses (VAL) in infected cells and protective immunity against VAL have them vaccinated laboratory animals, as well as the method of construction of this strain

The invention relates to biotechnology, protein engineering and medicine, specifically to obtain the crustal antigen of hepatitis B virus(HBcAg), allowing to expose on the surface of the alien epitopes

The invention relates to biotechnology, in particular genetic engineering, and is designed in vitro recombinant plasmid DNA containing the synthetic gene for granulocyte-macrophage colony-stimulating factor, human (GM-CSF), tandem promoters (ptrpx2) tryptophan operon of E. coli and synthetic sites of translation initiation, contributing to the efficient biosynthesis of the polypeptide with the biological activity of GM-CSF, and Escherichia coli strain producer of this polypeptide
Up!