Recombinant immunotoxin on the basis of diphtheria toxin and interleukin-2 (dt 482-il2) and method thereof

 

(57) Abstract:

The invention relates to medicine. Developed recombinant immunotoxin on the basis of diphtheria toxin and interleukin-2 in which the catalytic-transmembrane portion of diphtheria toxin has a length of 482 amino acids. Proposed also a method of obtaining a recombinant immunotoxin DT482-IL2. New immunotoxin can be used to create medicines for the treatment of cancer and autoimmune diseases. The method provides high toxicity of the protein and the ability to secretariats in the extracellular space, in contrast to known methods. 2 C. p. F.-ly, 3 ill.

The invention relates to medicine and can be used to create medicines.

A new direction, which was born about ten years ago and received active practical output in recent years, dedicated to the creation of new generation medications, the meaning of which lies in the direct delivery of drugs into the cell. In this direction lies the peculiarity of the high-affinity interaction of the complex ligand-receptor, members of which are, on the one hand, a variety of ligands, which svoeobrazen of the cell membrane, having the appropriate "knowing" areas. The use of such natural features of organisms gave the prerequisites for the development and creation of a number of drugs protein nature, so-called fusion proteins with a specific address. Changing the address part, you can "force" the correct receptor cells "learn" the ligand containing the new address by using the so-called phenomenon of "targeted delivery".

The highest preference in this sense, given bacterial toxins that can damage the host cell, in one way or another causing her death. The present invention relates to immunotoxin protein-based, toxic part of which presents catalytic and transmembrane parts of diphtheria toxin (DT), and the address part of the human interleukin - 2 (IL-2).

This protein has both cytotoxic activity against cells producing IL-2 receptors is and immunosuppressive effect. Therefore, it can be applied for the treatment of such pathologies as T-cell leukemia, lymphogranulomatosis, various autoimmune diseases, including type 1 diabetes, rheumatoid arthritis, etc., and for the transplantation of organs and tissues.

Most Eason has three structurally separate domain with different functions [2]. In Fig. 1 shows a three-dimensional spatial structure of DT was performed using the program Visualizer WebLab Viewer [7]. The coordinates of the atoms were taken from the Brookhaven data Bank [8]. In particular, the catalytic domain is responsible for ADP-ribosylating of elongation factor 2, which leads to disruption of the protein-synthesizing apparatus of the cell and, further, to her death. Transmembrane domain bears a hydrophobic, membrane-associated areas, penetrating through the membrane; it is necessary for translocation of the catalytic part of the toxin into the cytosol of the cell. The receptor domain is used for recognition of toxin cell through the corresponding surface receptors, penetrating into the cell in response to a decrease in pH in endosome [1,3]. OK this receptor is a heparin-binding epidermal growth factor (HB-EGF-like) [4] . The consistent location of all the domains is shown in Fig. 2, namely: trehdolnaja organization of diphtheria toxin: C - catalytic, T - transmembrane, R - receptor domains, respectively; numbers indicate the number of amino acids corresponding to the domains. The numbering of amino acid residues corresponds to the Mature protein, without signee accumulated quite an extensive material, concerning both structural and functional characteristics of recombinant immunotoxins, including those created on the basis of diphtheria toxin. The genetic diversity of forms of chimeric toxins caused by the search for the most optimal design from the point of view of its toxicity and high affinity interaction with the receptor. In this regard, existing recombinant toxins differ, first, the address part, and secondly, as a point amino acid substitutions, aimed at improving the activity of the newly synthesized protein, and, thirdly, the length of the linker connecting the enzyme-transmembrane part of the toxin with the "new" address.

Known immunotoxins based on DT, in which the N-terminal fragment of toxic part presents the first two domains and is characterized, mainly, two types of sequences, length and 486 389 amino acid residues. In addition to the address parts, they differ in the length of the linker connecting the transmembrane domain DT and the newly joined sequence of addresses [5].

The closest in technical essence and the achieved result of the proposed invention is a recombinant immunotoxin nasab its receipt, consisting in the construction of plasmids GTI, and cloning of a fragment of the sequence of interleukin-2 [6].

In the above technical solution for the expression and experience fused protein was used strain producer on the basis of E. coli. However, this can entail a number of problems. First, using Taurus enable expression creates a purely technological difficulties related to the separation, purification and stability of the chimeric protein. Secondly, being a gram-negative bacterium, the shell of E. coli contain toxic lipopolysaccharides, which may be contaminated with the drug. In addition, the system of proteolysis in E. coli is configured to recognize "friend or foe", so there is a high probability of proteolytic cleavage of the hybrid protein, which leads to segregation and structural instability and, as a consequence, reduction in the productivity of recombinant populations.

The present invention is the creation of a fused protein DT-IL2 and designing method thereof, allowing to provide high toxicity and ability to secretariats in the extracellular space. The problem is solved by the described recombinant immunotoxin, sod is, presents human interleukin-2, and having the amino acid sequence represented at the end of the description text.

The problem is solved also described a method of obtaining a recombinant immunotoxin DT-IL2, including the construction of a hybrid plasmid-based vector pBR322 at the restriction sites EcoRI-Hindlll, point mutagenesis to obtain the ApaLI site in the area of 482 amino acid residue DT by replacing the last of thymine in the website gtgcat on cytosine, modification of the protein-synthesizing apparatus of the producer strain PW8 the introduction of the necessary tRNA that binds tRNA formed with latinoam the codon cta IL2, cloning of the fragment sequence IL2 sites ApaLI-ApaLI, followed by the introduction of the received fragment in the ApaLI site of the vector pSUL17M, sorting, cloning and selection of canonical clones containing the desired recombinant immunotoxin DT-IL2.

The invention is based on the study of the length of the linker immunotoxin, which allowed us to conclude that it should not be too large, because a few changes in the three-dimensional structure of immunotoxin attaching a "foreign" domain may contribute to the increased proteolytic degrades the amino acids, respectively. When designing it was also necessary to consider that the linker section should not contain the site responsible for binding to the receptor to the native diphtheria toxin (wild type). This area starts in the area 482 residue. Thus, the proposed design, named DT482-IL2, contains a shorter linker, which contributes, on the one hand, greater resistance to proteases, and on the other allows the address part to be more flexible, thereby increasing the affinity of the interaction with the receptor. Moreover, the proposed design, in contrast to the known, allows you to save the catalytically important amino acid residues, Ser466 and Arg458, which is an integral part of the active centre.

The choice of the producer strain Corynebacterium diphtheriae is dictated by the existence of regulations on the production of DT and its derivatives. In accordance with accepted industry regulations in the Russian Federation this strain is PW8.

Thus, the present invention has the following advantages over the existing analogues, including the prototype. First, the linker is characterized by the preservation of all amino acid residues necessary for performing catalytic fu is elinee, than E. coli. In particular, the synthesized immunotoxin is secreted in the extracellular space, which is technologically more effectively. And additionally, the strain PW8 permitted for industrial applications.

Method of constructing fused protein DT482-IL2 includes the following stages:

1. Obtaining hybrid plasmids pSUL17.

After induction of bacteriophage nalidixic acid was carried out the isolation of the DNA of bacteriophage containing the full sequence of diphtheria toxin. After processing the obtained DNA restrictase EcoRI-HindUI spend the slice encoding DT. The next phase will enable the selected DNA fragment DT in plasmid pBR322 by the indicated restriction enzymes cut sites for hybrid plasmids pSUL17.

2. Point mutagenesis to obtain the ApaLI site.

With the aim of creating a fused protein DT-IL-2 and accounting for structural and functional features of both proteins using ApaLI site as a "docking station" between catalytic-transmembrane part of DT and IL-2. The latter has this unique site at the 5'-end. As for the DT sequence, then the district 482 residue is part of the gtgcat (VaI482His483), in which replacement of Parata strain PW8.

Because as a producer strain using Corynebacterium diphtheriae PW8, it is necessary to consider features of the protein-synthesizing apparatus of this producer to further error-free synthesis of fused protein containing interleukin-2 people. It was found that the pool latinovich codons cta IL-2 is minor for Corynebacterium diphtheriae. In this connection it is necessary to modify the protein-synthesizing apparatus, which is introduced into the chromosome of strain-producer tRNA gene is necessary so that the resulting tRNA was able to contact the above codon.

4. Cloning of the coding fragment of the sequence of IL-2.

After extraction of total mRNA of IL-2 from the culture of thymocytes person conducting polymerase chain reaction coupled with reverse transcription (primers 5'GTGCACCTACTTCAAGT3' and 3'GGGGTGCACTTAATTATCAAGTTAGTG 5' AMV-revertase, PFU-1 polymerase for PCR). The resulting amplicon is treated with a restriction enzyme ApaLI. After selecting the required DNA fragment conduct introduction ApaLI - ApaLI fragment in ApaLI site pSUL17M. Thus obtained hybrid plasmids that differ by the direction of the embedded fragment is subjected to sorting and cloning for the selection of the canonical clones containing the desired UL178.

The implementation of the selection of stable clones secreting the desired protein DT482-IL2.

In the result, the method of the obtained target product having the amino acid sequence shown in Fig. 3 (primary sequence of the recombinant protein; signal sequence in italics internaciona part - small font).

Thus, the proposed genetically engineered design allows to obtain a fused protein is the most effective way that can be easily adapted to existing industrial technologies. The drug DT482-IL2 has antitumor activity, destroying malignization T cells and IMMUNOSUPRESSIVE activity that can be used in the treatment of autoimmune diseases and transplantation of organs and tissues.

Literature

1. Bell, C. E., Eisenberg, D. Crystal structure of reagent grade toxin bound to nicotinamide adenine dinucleotide. Biochemistry 35, 1996, 1137-1149.

2. Bennett, M. J., Choe, S. Eisenberg, D. Refined structure of dimeric reagent grade toxin at 2.0 A resolution, Protein Sci 3, 1994, 1444-1463.

3. London, E. How bacterial protein toxins enter cells: the role of partial unfolding in membrane translocation, Mol. Microb. 22, 1992, 3277-3282.

4. Mitamura, T., Higashiyama, S., Taniguchi, N., Klagsbrun, M., Mekada, E. reagent grade toxin binds to the epidermal growth factor (EGF) - li, .P., Akiyoshi, D. E., Arrigo, D., A., Rhoad, A. E., Sullivan, B. , Thomas, J., Genbauffe, F. S. Bacha, P., Nichols, J. C. Cytotoxic properties of DAB486EGF and DAB389EGF, epidermal growth factor (EGF) receptor-targered fusion toxins. J. Biol Chem. 266, 1991, 21118-21124.

6. Application EN 93055180, BI N23, 1996.

7. WebLab Viewer: http://www.msi.com.

8. Bernstein, F. C. , Koetzie, T. F., Williams, G. J. B., Meyer Jr.E.F., Brice, M. D., Rodgers, J. R., Kennard, O., Shimanouchi, T. and Tasumi, M. The Protein Data Bank: A computer-based archival file for macromolecular structures. J. Mol. Biol. 112, 1977, 535-542.

1. Recombinant immunotoxin containing a catalytic and transmembrane parts of diphtheria toxin and the address part, presents the human interleukin-2, characterized in that the catalytic-transmembrane portion of diphtheria toxin has a length of 482 amino acids, and recombinant immunotoxin has the amino acid sequence represented in the North .

2. A method of obtaining a recombinant immunotoxin based on the catalytic and transmembrane parts of diphtheria toxin and interleukin-2, including the construction of hybrid plasmids and cloning of the fragment sequence of interleukin-2, characterized in that the construction of hybrid plasmids carried out on the basis of the vector pBR 322 by the restriction sites EcoRI - Hind III, before the cloning of the fragment consequently the ka of diphtheria toxin by replacing the last of thymine in the website gtgcat on cytosine, modification of the protein-synthesizing apparatus of the producer strain PW8 the introduction of the necessary tRNA to bind to latinoam the codon cta JL 2, cloning a fragment of the sequence of interleukin-2 carried out by APaLI sites-ApaLI, followed by the introduction of the received fragment in the ApaLI site pSUL17, sorting, cloning and selection of canonical clones containing the desired recombinant immunotoxin DT-JL2.

 

Same patents:
The invention relates to medicine, in particular to Virology

The invention relates to medicine and can be used in clinical practice for the early prediction phase of acute pyelonephritis

The invention relates to the field of medicine, primarily to Pediatrics, and will find use for the prevention of iron deficiency anemia in children from families of participants of liquidation of consequences of the accident at the Chernobyl nuclear power plant and in children living in areas contaminated with radionuclides

The invention relates to medicine, namely to dermatology and concerns a method for predicting psoriasis

The invention relates to medicine and can be used for dewatering and treatment of the inflammatory process without initiating proteinuria

The invention relates to medicine, namely to obstetrics and gynecology, and can be used to predict the development of late gestosis pregnancy
The invention relates to medicine, namely cardiology, and can be used in cardiology and internal medicine hospitals, clinics, local health centers and resorts
The invention relates to medicine, in particular to emergency surgery, and can be used in clinical practice to predict the development of postoperative pancreatitis

The invention relates to medicine, in particular to the treatment of severe conditions in humans caused by infection
The invention relates to medicine, namely to a gastroenterologist may be used in the treatment of stomach polyps
The invention relates to medicine, is used, in particular, in the treatment of patients with purulent-septic processes

The invention relates to medicine and veterinary

FIELD: medicine, phthisiology.

SUBSTANCE: method involves administration of roncoleukin by lymphotropic route: subcutaneously, in region of pretracheal cellular tissue in the equal dose 1/4-1/5 of the average daily therapeutic dose, once in one or two days, 3 injections for a course. Invention provides the local delivery of roncoleukin to the injure zone directly that promotes to making depot of the latter in the injure focus and to the rapid elimination of pathogen from body of patients. Invention can be used for correction of immune insufficiency in patients with pulmonary tuberculosis.

EFFECT: improved method for correction.

2 ex

FIELD: medicine, immunology.

SUBSTANCE: method involves inhalation administration of combination of immunocorrecting agents wherein recombinant interleukin-2 is used or its combination with genetic engineering α2-interferon and with the complex immunoglobulin preparation in the daily doses for 5 days depending on age of patient. Before sanitation with an immunocorrecting agent the method involves assay of carrying type by anti-lysozyme activity of microorganisms (resident or transitory) and repeated examination after sanitation course is carried out. Carriers are subjected for additional sanitation with anti-bacterial preparations in change of carrying type from resident to transitory and with taking into account antibiotic-resistance property of the carrier strain. Method allows carrying out the effective sanitation and immune reablement of germ carriers due to recovery of the adequate natural resistance and complex of nonspecific factor of regional and systemic immunity.

EFFECT: improved and effective method for sanitation.

2 cl, 2 tbl, 5 ex

FIELD: cardiovascular disorders.

SUBSTANCE: invention provides methods for modulating tissue antiogenesis using Raf and/or Ras protein, modified Raf and Ras proteins, nucleic acids encoding them. Antiogenesis is inhibited using inactive Raf or Ras proteins or nucleic acids encoding them, and antiogenesis is potentiated using active Raf or Ras proteins or nucleic acids encoding them. Use of gene transportation system to provide nucleic acids encoding Raf or Ras proteins or modified forms thereof.

EFFECT: enlarged choice of tissue antiogenesis control methods and means.

44 cl, 20 dwg

FIELD: medicine, gastroenterology, pharmacy.

SUBSTANCE: invention relates to agents used in treatment of ulcerous-erosion injures in gastroduodenal region. Method involves diluting 100 mcg of dry lyophilized powder of immunomodulating agent "Superlimf" in 3-5 ml of 0.9% isotonic solution and irrigation of ulcer or erosion with this solution 1 time per a day by the endoscopy method. The treatment course is 3-4 procedures with break for 4-5 days. Method provides alteration of cytokine pattern of tissues, induction of influx of mononuclear phagocytes to the injure focus that results to localization of inflammation and the complete epithelization of ulcers and erosions.

EFFECT: improved and effective method for treatment.

1 ex

FIELD: medicine, oncology.

SUBSTANCE: after removing malignant cerebral tumor one should conduct successive course of: cytokinotherapy consisting of 3 intramuscular injections of leukineferon at 48-h-long interval, adaptive immunotherapy with lymphokine-activated killer cells (LAKC) generated in the presence of recombinant interleukin-2 (IL-2). Moreover, LAKC should be introduced into the channel of removed tumor in combination with IL-2 as 2 procedures at 24-h-long interval. Then comes the course of adaptive immunotherapy with cytotoxic lymphocytes (CTL) generated due to cultivating patient's mononuclear blood cells together with dendritic cells loaded with a tumor antigen, in the presence of recombinant IL-2 to be introduced in combination with it into the channel of removed tumor as 2 procedures at 48-h-long interval. For obtaining dendritic cells in patients before operation it is necessary to isolate monocytes to cultivate with granulocytic-macrophageal colony-stimulating factor and interferon-α at maturating dendritic cells in the presence of monocytic conditioned medium and incubation of dendritic cells in the presence of tumor antigenic material for their loading with a tumor antigen. After immunotherapy with CTL on should conduct the course of vaccinotherapy with dendritic cells loaded with a tumor antigen in combination with subcutaneous injections of IL-2. The method enables to induce high specific anti-tumor immune response along with improved quality of life and prolonged duration of relapse-free period.

EFFECT: higher efficiency of immunotherapy.

2 cl, 2 ex

FIELD: medicine.

SUBSTANCE: method involves combining vaccine prepared from 107 cells of autologic tumor lysate with 60 mg of betaleukine and introducing it strictly in intracutaneous paravertebral mode in three points arranged 3 cm far from each other. The introduction takes place every 3 weeks so that the first two vaccinations are combined with 470 mg of betaleukine introduced into anterior abdominal wall. Vaccination treatment is continued on receiving positive retarded type hypersensitivity response to injection after every vaccination with tumor lysate without betaleukine.

EFFECT: enhanced effectiveness in inducing and supporting antitumor immune response.

Up!