Imaging agent and method for detecting material containing fibrin

 

(57) Abstract:

Imaging agent can be used to detect containing fibrin material, such as thrombus or atherosclerotic plaque. The agent is a labeled imaging marker recombinant polypeptide having an amino acid sequence identical to the region of the natural binding of human fibronectin to fibrin. The marker is a radioactive isotope of the element that is opaque to x-rays, or paramagnetic ion. Visualizing agent is effective for the early detection of intravascular atherosclerotic plaques and blood clots. 2 C. and 12 C.p. f-crystals, 29 ill., 5 table.

The invention relates to the diagnosis and treatment of diseases such as atherosclerosis and thrombosis.

Most of the existing procedures for the diagnosis and treatment of atherosclerosis and thrombosis are invasive, costly and have limited efficacy in a significant proportion of patients.

Known methods, which are based on the principle of "gain" plaques using dyes, which was proposed Spears, J. and others (J. Clin. Invest. so 71, S. 395-399, 1983). Such dyes mark the surface of the plaques fluorescenceactivated, implemented using intraluminal transmitting the laser radiation, an optical fiber. In addition, it was also suggested that the use of tetracycline dyes (Murphy-Chutorian, D. and others, Am. J. Cardiol., so 55, S. 1293-1297, 1985).

The above dyes are selected on their ability to communicate with components of atherosclerotic plaques. Further, the dye absorbs the laser light, focusing it on the painted surface. However, there is some staining and healthy tissue, which leads to the identification of the surrounding tissue as invalid.

Proposed several experimental approaches for non-invasive detection of blood clots with the use of radiopharmaceutical agents, but none has gained wide clinical recognition because of the specific shortcomings of each agent.

The main characteristics of radiopharmaceutical agents for early detection of intravascular atherosclerotic plaques and blood clots are the following: a high affinity to the components of the thrombus; relatively high pharmacokinetic speed cleansing blood; safety: toxicity and nianagement; ease of access and use.

1111P: this procedure is very laborious, time-consuming, and the purification of the blood is relatively large, namely 2 days [2]; b)1311-fibrinogen: the analysis is based on the affinity injectisome radiochango fibrinogen relative to the clot, but it is not suitable for testing for faster rendering because of the large residence time in the blood, not suitable for old blood clots and may not be used in the presence of heparin [3, 36]; C) a fragment of the E1 human fibrin: most appropriate for fibrinogen, but it is difficult to obtain in sufficient quantities for wide clinical use [4]; g) mouse antifibrin monoclonal antibodies: are specific and have a high affinity relative to the thrombus, but are characterized by relatively long time cleansing the blood and are potentially immunogenic to the human body [5, 33, 34]; d) mouse monoclonal antibody specific relative to activated platelets [6, 7]: the same drawbacks as in the case of g); (e) labeled fibronectin [1] (prototype): fibronectin has an affinity to several materials contained in the clot, but differs quite a long time cleansing neobhodimosti in specific relative thrombus radiopharmaceutical agents for fast visualization of thrombus.

In U.S. patent N 4343734 (Lian and others) proposed specific antibodies to gamma carboxyglutamic acid (GLA), which can be marked fluorescein agent for immunofluorescence staining of tissue with the purpose of establishing the presence of GLA. Specific GLA-antibodies bind with the GLA, which is contained in a developing the atherosclerotic plaque with calcium deposits. Lian and others argue that the GLA is not detected in non-calcined plaques and that the GLA is not detected in heart valves and the aorta, and in such circulating proteins as prothrombin, factors of the blood coagulation system VII, IX and X, protein C and protein S. in Addition, antibodies that bind GLA, do not provide selective binding to atherosclerotic plaques.

Fibronectin is a glycoprotein consisting of two identical subunits, each of which has a mol. M. approximately 220000. Human cells in culture and in vivo produced and are secreted two basic forms of fibronectin [8]. Fibronectin associated with the cell is poorly soluble and is involved in cell adhesion, wound healing, cell differentiation, and phagocytosis. Fibronectin plasma produced in basically the m properties of cellular fibronectin.

Fibronectin is a multifunctional modulator, as a limited proteolytic cleavage produces polypeptides with different activities. Received major functional areas of the molecule fibronectin using partial proteolytic digestion, they include domains, binds heparin, DNA, fibrin, collagen or gelatin and cells [8-13].

Baralle, F. E. in European patent publication N 207751, published January 7, 1989, described the full cDNA sequence of fibronectin. He also describes the expression of the fused proteins containing a portion linking the collagen region of fibronectin, and a-galactosidase of Escherichia coli. Similar fused proteins suggested Owens and Baralle [14]. Obara and others (1987) described the expression of the part connecting the cells of the human fibronectin, merged with galactosidases Escherichia coli. Obara and others (1988) describe the expression of the connecting parts of the cell region, merged with-galactosidase after preliminary site-specific mutagenesis [16]. Carboxy-end linking of the fibrin human fibronectin expressed in L-cells of the mouse as a protein fusion with the signal sequence of an inhibitor of human protein binds fibrin region of fibronectin; in addition, all of the recombinant proteins described earlier, are fused proteins.

In accordance with the invention offers imaging agents based on polypeptides containing the amino acid sequence that essentially corresponds to the N-terminal part connecting the fibrin region of fibronectin. These polypeptides are approximate mol. m 31, 20, 18.5 and 12 KD, defined using markers comparisons on SDS-gels in reducing conditions. They have the following characteristics that make them promising pharmaceutical agents: contain the amino acid sequence contained in a human protein and, thus, is neimenovanog; possess specificity of fibrin, which is based on their ability to covalent cross-linking catalyzed TRANS-glutaminase reaction formed and educated with previously thrombus (clot); contact with extracellular matrix, which gives the opportunity to detect atherosclerotic plaques; have relatively short period of cleansing blood; included in clots in the presence of heparin; produced by using recombinant the visualizing agent mark visualized by a marker.

In accordance with the invention offers an inexpensive, accurate method of visualization containing fibrin materials, i.e., blood clots and atherosclerotic plaques both in vitro and in vivo. It includes contacting containing fibrin material subject visualization, imaging agent, as described above, under such conditions that the agent is associated with containing fibrin material, and visualization of the associated agent, providing for the simultaneous detection containing fibrin material.

In Fig. 1-29 describes the construction of plasmids expressing the polypeptide containing the amino acid sequence essentially corresponding to the amino-terminal part, which links the fibrin region (FBD) of fibronectin. FBD begins with amino acid 1 of the Mature fibronectin, which is glutamine, and corresponds to the fourth amino acid (Q), shown in Fig. 2. Thus, the N-end FBD-sequence is Q-A-Q-Q-(glutamine-alanine-glutamine-glutamine); corresponding to the first nucleotide in the cDNA sequence in Fig. 2 is, therefore, room 14, indicated by the arrow. All recombinant FBD polypeptides shown in Fig. and in the description text, numbered from this Pervov the>/P>Determination of polypeptides expressed in the form of 31, 20, 18,5, 12 KD, is an operational definition based on their approximate molecular mass determined by SDS-polyacrylamide gel in reducing conditions by comparison with markers of known molecular weight.

In Fig. 1 shows images of various regions of fibronectin and design of recombinant polypeptides of Fig. 2-9 - nucleotide cDNA sequence of human fibronectin.

In Fig. 10 and 11 receive seven pairs of chemically synthesized oligomers. Synthetic oligomers encode the first 153 N-terminal amino acids of human fibronectin (FN), Fig. 10 and 11 shows the sequence of these 7 pairs of synthetic oligomers.

In Fig. 12 presents a DNA fragment encoding amino acids 1 through 153 N-terminal region of human FN, composed of 7 pairs of chemically synthesized oligomers shown in Fig. 10 and 11. The synthesis can be described as follows.

a) Oligomers 3/4, 5/6, 7/8 and 9/10 (each pair in a separate tube) are annealed, and then fosforanowanie at the 5'-end using the enzyme T4-polynucleotide.

b) the second is by a pair of 7/8 and 9/10 are legirovanie with each other. After each step of ligating portion of the ligation mixture analyzed on the gel to determine the size of the generated fragments and the efficiency of the binding.

C) In the third stage, two of the above ligation mixture are mixed together and the mixture was added a couple 6, oligomers 11/12, which had previously annealed and fosforilirovanii in a separate test tube. The DNA fragment of 326 base pairs, obtained from the above mixture, isolated from the agarose gel and purified.

Purified synthetic 326-fragment was added to two additional pairs of synthetic linkers: pair 1, oligomers 1/2, and pair 7, oligomers 13/14. In pair 1 oligomer 2 is phosphorylated in the 5'-end and paired only 7 oligomer 13 is phosphorylated in the 5'-end.

After ligating the DNA T4 ligase mixture without any additional insulation was added to the DNA of the vector pBR322, digested with endonucleases EcoRI and BamHI.

The resulting plasmid designated pFN 932-18 contained full synthetic EcoRI fragment (5'end)-BamHI (3'end), encoding the N-terminal 153 amino acids of human FN in the vector pBR322.

In Fig. 13 shows the expression of N-terminal sequences of 153 amino acids FN.

Land the CII RBS).

The obtained plasmid was designated as pFN 949-2.

In Fig. 14 shows the insertion of the termination codon TAA 3'-end of the N-terminal region of FN (the position of the amino acid 262).

A synthetic oligonucleotide containing the termination codon TAA and the site Bgl II, having the following sequence:

< / BR>
ligated with the 3'-end (PvuII site) EcoRI-PvuII, NF-fragment isolated from CDNA plasmids p931-5, digested with the enzymes EcoRI and PvuII. Ligation was carried out in the presence of plasmids PBR322, digested with the enzymes EcoRI and BamHI (large fragment). The obtained plasmid was designated as PFN935-12.

In Fig. 15 presents recombinant polypeptides regions of fibronectin in comparison with fibronectin full length.

Fig. 15 shows the ratio of cDNA clones encoding the recombinant polypeptides with each other and with the sequence of the full length cDNA of fibronectin and General scheme of the domains contained within the molecule Chet FBD polypeptide r12 KD.

Great BspMI fragment-HindIII, obtained by digestion of plasmid PFN 975-25 using BspMI and HindIII, subjected to legirovanie using DNA ligase T4 with a synthetic pair of linkers A (Fig. 18). The obtained plasmid PFN 196-2 transformed into Escherichia coli strain A1645, and then transferred into Escherichia coli strain A4255. Plasmid PFN 196-2 contains a 5'-terminal cDNA sequence of fibronectin from nucleotide 14 to nucleotide 340, i.e., it encodes the first 109 amino acids FBD-fibronectin ending arginine residue. In the final polypeptide contains an additional N-terminal methionine. Plasmid pFN 196-2 gives a good expression FBD polypeptide r12 KD under the control of the promoter and the binding site of the ribosome-lactamase: she deposited at the ATCC under the code storage N 68328.

In Fig. 17 shows the structure of plasmid pFN 197-10, which expresses a modified FBD polypeptide 12 KD (12 KD').

Plasmid pFN 975-25 processed, as shown in Fig. 16, except that he used another pair of linkers B (Fig. 18). Ligation gave plasmid pFN 197-10, which encodes the N-terminal sequence FBD FN; however, after modification of the nucleotide 340 with the aim of obtaining NdeI site (CATATG) before with the indicated amino acids of the polypeptide r12 KD, and two additional amino acid residue represented by histidine and methionine. In the final polypeptide also contains an additional N-terminal meinenemy balance. Plasmid pFN 197-10 transformed into Escherichia coli strain A1645, and then in the Escherichia coli strain A4255 and got a good expression of the modified FBD polypeptide r12 KD (12 KD') under the control of the promoter and binding of ribosomes-lactamase.

In Fig. 18 presents oligonucleotide linkers used in the construction of plasmids.

Got two pairs of chemically synthesized oligomers (A, B) and used them in the construction of plasmids, as shown in Fig. 16 and 17, respectively.

In Fig. 19 presents a comparison of labeled FBD polypeptides r12 KD, r20 KD and r31 KD in a model of venous thrombus in rats.

Columns and vertical console represent the average value of the average standard error (N = 5) specific radioactivity associated with isolated thrombi (T) or blood (B) 24 h after the application of125I-labeled recombinant polypeptides, as indicated.

In Fig. 20 shows the binding polypeptides of the area linking of fibrin by fibrin clots.

This experiment oscow region, linking fibrin, as described above, incubated at 37oC with pre-formed fibrin clots obtained from 20 l treated with citrate whole blood. Binding was measured in the presence of 5 mm CaCl2and 0.02 units/ml of TRANS-glutaminase. The reaction was stopped after 45 min of incubation by centrifugation; the precipitate was washed three times using phosphate-saline buffer (PBS), and radioactivity was measured in a gamma counter.

1. Plasma FBD 31 KD (p 31 KD)

2. r12 KD

3. r20 KD

4. r21 KD (Portion A)

5. r31 KD (Portion B)

6. r31 KD (Portion C)

In Fig. 21 presents twisting and purification of the polypeptide of the r20 KD observed using profiles of elution from the column type Superose 12 [connected with jhud (liquid chromatography high pressure)].

Portion 200 l polypeptide r20 KD at various stages of the procedures twisting and purification were injected with the upper part of the column Superose 12 (combined with GHUR). The column was balanced and was suirable solution of 150 mm NaCl (20 mm Tris HCl, pH 7.8) with a volumetric flow rate of 0.8 ml/min A. Residue polypeptide r20 KD was solubilizers in 6 M guanidine-HCl and restored 50 mm-mercaptoethanol. B. was Senatoriable and oxidized by air polyparse. E. Flow through a column of heparin-sepharose material, separated from the purified r20 KD. F. was Purified polypeptide 20 KD (retention time 18,16 min) was suirable column of heparin-sepharose using 0.5 M NaCl. The peak with retention time 18,16 min was absent in the profile A, where the material is located in a restored form, but also in profiles C and E, which contain improperly formed shape polypeptides 20 KD.

In Fig. 22 presents resaturate and purification of the polypeptide r12 KD according to the profile of elution from a column of Superose 12 (connected to the system Ehud waters).

Portions of 25 - 100 l polypeptide r12 KD at various stages of the processes renaturation and purification were injected with the upper part of the column Superose 12 connected to the system Ehud waters. The column was balanced and was suirable solution of 150 mm NaCl/20 mm Tris HCl, pH 7.8, with a volumetric flow rate of 0.8 ml/min A. Residue polypeptide r12 KD was solubilizers in 6 M guanidine-HCl and restored 50 mm-mercaptoethanol. B. Polypeptide r12 KD was senatoriable and oxidized by air. C. Polypeptides associated with Q-separate (materials, which were separated from the r12 KD). D. allow flow through the column Q - and heparin-sepharose (in this case, the columns were connected in series and the flow through Sefiros is, what was lurvely with a column of heparin-sepharose 0.5 M NaCl. The peak with retention time of 18,83 min was absent in the profile A, where the material is located in a restored form, but also in profiles C and D, which contain malformed form of the polypeptide r12 KD.

In Fig. 23 shows the structure of plasmid pFN 208-13.

Two portions of the plasmid pFN 975-25 (ATCC N 67832) was separately digested by enzymes Xmn I and XbaI-StyI, respectively. Large fragments were isolated from each digested mixture and mixed together with a synthetic oligomer shown in Fig. 16. Then this mixture was boiled for 2.5 min, slowly cooled to 60 min to 30oC, then 60 min 40oC and then 30 min to 0oC. DNA subjected to the re-annealing, took a slice of maple and subjected to legirovanie using DNA T4 ligase. This DNA was transformed in E. coli A1645, and the transformed cells were tested for the presence of clones positive with respect to the content of the oligomer. The plasmids from the positive clone was designated pFN 208-13 (she deposited at the ATCC in the host E. coli A4255 under the code storage N 68456). This plasmid expresses the polypeptide N-Terminus FBD size 18.5 KD running PL-promoter and the binding site is dy pFN 208-13.

This figure presents a synthetic oligomer used in the construction of plasmid pFN 208-13 (Fig. 23).

In Fig. 25 shows the structure of plasmid pFN 201-3.

A large fragment isolated from HindIII - StyI-parivara plasmid pFN 949-2 (ATCC, code storage N 67831) and were subjected to legirovanie with a small fragment, isolated from HindIII - StyI-parivara plasmid pFN 196-2 (ATCC, code storage N 68328). The resulting plasmid designated pFN 201-3, expresses the polypeptide FBD 12 KD under the control of the PL-promoter and the binding site of the ribosome S.

In Fig. 26 shows the structure of plasmid pFN203-2.

A large fragment isolated from a mixture Ndel - Hindlll-parivara plasmid pMLK-100 (deposited in E. coli 4300 in the ATCC under the code storage N 68605) and were subjected to legirovanie with a small fragment, isolated from a mixture Ndel - Hindlll-parivara plasmid pFN 201-3. The result obtained plasmid designated pFN 203-2, which expresses the polypeptide FBD 12 KD under the control of the PL-promoter binding site of ribosomes CII and contains the sequence of termination of transcription of the trp ("ter"). Named plasmid deposited at the ATCC in E. coli A4255 under the code storage ATCC N 68606. Plasmid pFN 203-2 also known as pFN 203-2-3.

In Fig. 27 PR is I.

This figure presents the specificity of different FBD polypeptides to a pre-formed fibrin clot, as described in example 8. Experienced FBD polypeptides: 31 KD, 20 KD, and 18.5 KD and 12 KD. In addition, experienced fused polypeptide 45 KD, consisting of a fragment FBD 12 KD CBD and 33 KD. As control was used polypeptide CBD 33 KD (described in PCT publication N WO/90/07577, 62-64 C., tah same applicants). All test FBD polypeptides, including fused polypeptide 45 KD, was associated with a pre-formed clot in similar proportions (25-38% binding).

In Fig. 28 presents the introduction of the label in thrombi in vivo using fragments of the polypeptides FBD 12 KD and 18.5 KD (example 10). In Fig. 28 presents data specific radioactivity of the blood clot (shaded columns) and blood (where there's no shading columns) in rats with inductor stainless steel after 24 h after intravenous administration IIIIn-labeled recombinant proteins FBD. Rectangles and vertical segments represent average values and average values of the standard deviation of counts in 1 min/g wet weight, respectively. Relations thrombus/blood shown in Fig. 29.

In Fig. 29 shows the relationship take, equipped with an inductor rats, shown in Fig. 28.

Plasmid pFN 975-25, pFN 949-2, pFN 137-2 and pFN 196-2 deposited in accordance with the conditions and requirements of the Budapest Treaty in the American type culture collection (ATCC) under the ciphers storage NN 67832, 67831, 67910 and 68328, respectively. Similarly deposited with the ATCC other-deposits referenced in this patent application.

The main sequence of the human fibronectin has been shown to be organized of the three types of homologous repeats (types I, II and III). The realm fibrin (FBD), consisting of 259 amino acids with an average mol. m 31 KD, composed of five repetitions of type I ("fingers"), each of which consists of approximately 45 amino acids and contains two disulfide bonds.

A General schematic representation of the structure of the regions of fibronectin and recombinant molecules, constructed in accordance with the present invention, given in Fig. 1.

Recombinant polypeptides that comprise visualizing agent, provided in accordance with the invention, amino acid sequence essentially identical to the corresponding portions of the area of the binding.

In su is homologous loops of type I or "fingers", mentioned above (i.e. 10 disulfide bonds), the polypeptide r20 KD and polypeptide r18,5 KD, which contain three loops (i.e., 6 disulfide bonds) and the polypeptide r12 KD has two loops (i.e., 4 disulfide bonds). The presence of these disulfide bonds determines the need for, and difficulty of recovery procedures conformation of the polypeptide corresponding natively. Correctly denaturirovannyj FBD polypeptides are biologically active, i.e., can communicate with fibrin.

The original recombinant FBD polypeptides are produced as inclusion bodies that form after the destruction of the cells insoluble precipitate.

In accordance with the invention features the production of a recombinant polypeptide fragments of the region linking of fibrin (FBD) for use in the visualization of blood clots and prevent their formation. These polypeptide may also be associated with thrombolytic agent for delivery of the agent to the thrombus.

Recombinant cells that produce polypeptide fragments FBD can be any cell, using techniques of recombinant DNA was introduced DNA sequence encoding a fragment of the polypeptide FBD, which are able expressly cell can belong to any strain, including auxotrophic, prototroph and lytic strains, F+and F--strains; strains carrying the sequence of c1857 repressor-propaga; strains with remote repressor substances or genome deo.

Examples of the used strains of Escherichia coli wild-type are prototroph ATCC N 12435 and auxotroph MC1061 (code storage N 67361).

Examples of strains of Escherichia coli, which are a sequence of c1857 repressor, are auxotroph A1645 carrying plasmid pTYR 279-8 (ATCC N 53216), A1637, carrying plasmid pTY 104/2 (ATCC N 39384) and A2097: carrying plasmid pSOD 2 (ATCC N 39786), prototroph A4255 carrying plasmid pFN 975-25 (ATCC N 67832) and independent of Biotin A4346 carrying plasmid pHG 44 (ATCC N 53218).

An example of a suitable lytic strain of Escherichia coli is A4048, which carries plasmid pHG 44 (ATCC N 53217).

Examples F--Escherichia coli strains is 930 S (F-) carrying plasmid pMF 5534, deposited under the designation ATCC N 67703, and Escherichia coli W31100 (F-) carrying plasmid pMFS 929, deposited under the designation ATCC N 67705.

Examples of strains of Escherichia coli with the deleted gene deo or repressor deo are S 732 carrying plasmid pMF 2005 (ATCC N 67362), S 540 carrying plasmid pJBF 5401 (ATCC N 67359), and S 930 carrying plasmid pEFF 920 (ATCC N 67706) (see publication of the European patent is to use other strains of Escherichia coli, as well as other bacteria. Such bacteria include Pseudomonas aeruginosa and Bacillus subtilis.

Plasmids used for producing FBD polypeptides, can carry a variety of promoters such as the promoter for the deo promoter.

Among the plasmids that can be used for producing FBD polypeptides, you can specify the following:

a) plasmid pFN 975-25, which expresses FBD r31 KD and which is deposited in the strain A4255 Escherichia coli ATCC N 67832;

b) plasmid pFN 949-2, which expresses FBD r20 KD and which is deposited in the strain A4255 Escherichia coli ATCC N 67831;

c) plasmid pFN 196-2, which expresses FBD r12 KD and which is deposited in the strain A4255 Escherichia coli ATCC N 68328;

(d) plasmid pFN 197-10, which expresses the modified polypeptide FBD 12 KD and which is shown in Fig. 17;

e) plasmid pFN 201-3, which expresses the polypeptide fragment FBD 12 KD under the control of the PLand CIIrbs binding site of the ribosome and which is shown in Fig. 25;

f) plasmid pFN 203-2, which expresses the polypeptide fragment FBD 12 KD under the control of the PLand CIIrbs and further comprises a transcription terminator, denoted "ter", and which is shown in Fig. 26 (deposited in the strain Escherichia coli A4255 under the code storage (deposited in the strain A4255 Escherichia coli ATCC under the code storage N 68456);

In accordance with the invention offers a visualizing agent, which contains a polypeptide labeled with the rendered label/marker.

In preferred embodiments of the invention are polypeptides 20 to KD and 18.5 KD and 12 KD.

Rendered token used in accordance with the invention, can be selected according to the circumstances, however, in the preferred embodiment, this marker is a radioactive isotope of an element which is opaque to X-rays, or paramagnetic ion.

Among the radioactive isotopes preferred markers are indium-111, technetium-99M, iodine-123, iodine-125, iodine-131, krypton-M, xenon-133, helium-67 or mixtures thereof. In the most preferred embodiment, the marker is technetium-99M or indium-111.

Examples of paramagnetic ions are ions of the following metals: chromium (III), manganese (II), iron (III), iron (II), cobalt (II), Nickel (II), copper (II), praseodymium (III), neodymium (III), samarium (III), gadolinium (III), terbium (III), dysprosium (III), holmium (III), erbium (III), ytterbium (III) or mixtures thereof.

Polypeptide 20 KD corresponds to the amino acid sequence of fragment area linking of fibrin human fibronectins; the polypeptide of 18.5 KD corresponds to the amino acid sequence of fragment area linking of fibrin in human fibronectin from 1 to 154 amino acid residue, as shown in Fig. 2-9; 12 polypeptide KD corresponds to the amino acid sequence of fragment area linking of fibrin in human fibronectin from 1 to 109 amino acid residue, as shown in Fig. 2-9. Using a partial analysis of the amino acid sequence of the applicant have shown that polypeptides 12 KD and 20 KD, and also full-length polypeptide 31 KD contain additional N-terminal methionine.

However, the scope of the claims of the invention also includes polypeptides without additional N-terminal methionine.

In accordance with the invention it is also proposed visualization method containing fibrin materials, namely thrombus or atherosclerotic plaques, which involves contacting containing fibrin material that is being rendered, agent, described above, are suitable for their binding conditions and visualization of the associated agent with the appropriate visualization containing fibrin material.

Visualization can be carried out by any of aceveda full list) x-ray analysis, CAT scan (computerized axial tomography), PET scan, NMRI, such as fluoroscopy. In a preferred embodiment, the visualization fibrinogenesis material using the above techniques carried out using a gamma camera.

All references to nucleotide positions correspond to positions in the nucleotide sequence of the cDNA of human fibronectin, shown in Fig. 2-9 (see also Fig. 10 and 11 at Baralle F. E., Publication of the European patent N 207751, published January 7, 1987).

The present patent application is directed to imaging agents containing polypeptides corresponding to the N-terminal region of the binding domain of fibrin (FBD). Experimental results with the polypeptide 31 KD are presented in order to compare with shorter fragments.

Example 1. Obtaining a cDNA library of fibronectin.

CDNA library received gtII of field A + mRNA isolated from human liver in accordance with the published procedures (13, 14). CDNA fragments were cloned using EcoRI-linkers and selected positive relative FBD-plasmids using the following synthetic DNA probes:

(3') GGGGGTCGGAGGGATACCGGTGACACAGTCTTAA (817-850)

(3') CGACGGGTGCTCCTTTA the major depression and purification of polypeptides region linking of fibrin (FBD).

A. Expression of partial FBD polypeptide in 20 KD.

The cDNA clones obtained as described in example 1 and depicted in Fig. 15, do not include DNA encoding amino acids 1 to 190 of FN molecules. These amino acids are part of FBD. DNA corresponding to nucleotides 14 through 472 and encoding amino acids 1-153 (Fig. 2), were designed using a ligating 7 pairs of chemically synthesized nucleotides (Fig. 10 and 11). A synthetic DNA fragment constructed so that it contains the initiation codon ATG at the 5'end, and a convenient restriction sites for insertion into various expression vectors. To be able to further manipulation of the DNA sequence that encodes a FBD, nucleotide number 19, thymidine (T) has been replaced by an adenine (A), excluding the DdeI restriction site and without changing the amino acid sequence (the site of nucleotide changes is indicated by an asterisk in the linker # 1 shown in Fig. 10). Various stages of cloning the above synthetic DNA fragment into the vector plasmid pBR 322, digested with the enzymes EcoRI and BamHI as described in Fig. 11. The resulting plasmid designated pFN 932-18. A DNA fragment encoding the first 153 N-terminal amino acids of fibronectin from a plasmid pFN 932-18, inserted in pTY arm growth (hGH) in the plasmid pTY 301 (Fig. 12).

The resulting plasmid, pFN 949-2, deposited in the American type culture collection (ATCC) under the code storage N 67831. Plasmid pFN 949-2 used for transformation of prototroph Escherichia coli A4255. These transformed cells of Escherichia coli was found to Express a partial FBD polypeptide in quantities amounting to approximately 5% of the total cellular protein. This polypeptide has a mobility corresponding to about 20 KD on SDS-polyacrylamide gels in reducing conditions. It contains the first 153 amino acids of fibronectin, followed by 4 amino acids, encoding the synthetic linker, and several amino acids, the resulting read into the vector pBR322, i.e., only 153 amino acids plus less than 20 additional amino acids and an additional N-terminal methionine. For a patent describing the polypeptide referred to as the r20 KD or FBD r20 KD.

B. the Expression "full" polypeptide.

In order to obtain the expression of full FBD polypeptide containing amino acids 1-262, designed following plasmids.

1. Insert the termination codon TAA at the 3'-end.

A synthetic oligonucleotide containing terminera the enta EcoRI - PvuII isolated from p931-5 cDNA clone FN, and vector pBR322, digested EcoRI and MamHI, as described in Fig. 14. The resulting plasmid designated pFN 935-12.

2. Subclavian carboxy-terminal region FBD in the expression vector of PL.

DNA fragment EcoRI-HincII encoding carboxy-terminal region FBD, isolated from the plasmid pFN 935-12 and subjected to legirovanie with plasmid pTY 194-80, digested with the enzymes EcoRI and SmaI, as described in PCT publication N WO90/07577 the present applicant (figure 46). The resulting plasmid designated pFN 946-12.

3. Synthesis and cloning DNA corresponding to nucleotides 468-599 in FN.

Three pairs of chemically synthesized nucleotides were subjected to legirovanie with EcoRI-DdeI fragment FN, isolated from the plasmid pFN 932-18 (Fig. 11) in the presence of a DNA vector pU19 (obtained from the company GIBCO BRL CO.,), digested with the enzymes EcoRI and XbaI as described in detail in the aforementioned PCT publication (figure 47). The resulting plasmid designated pFN 938-4.

4. Construction of a plasmid that encodes a full FBD-area.

In order to construct a plasmid, which encodes the full FBD, from amino acid 1 to amino acids 262, a DNA fragment EcoRI-XbaI encoding FN, isolated from the plasmid pFN 948-4 48). The resulting plasmid designated pFN-957. This plasmid contains the complete coding sequence for the FBD, but not expresses this FBD polypeptide, lacks the binding site of the ribosome (RBS).

5. Expression FBD under the control of R1promoter RBS S.

NdeI-HindIII fragment containing FBD-coding region and transcription terminators T1T2isolated from the plasmid pFN-957 and inserted into plasmid pTY 301, digested with the enzymes NdeI and HindIII as described in the aforementioned PCT publication (figure 49). The resulting plasmid, designated pFN 962-3, directs the expression of FBD-polypeptide under the control of the PLpromoter and the binding site of the CII ribosome. Strains of Escherichia coli Al645 and A4255 transformed by this plasmid expressed only a small number of FBD polypeptide. Expression FBD polypeptide is detected only by analyzing spots Westerna using polyclonal antibodies directed against FN, derived from human plasma.

6. Expression FBD polypeptide under the control of the PLpromoter , promoter - lactamase and the binding site of the ribosome.

Since the level of expression of FBD polypeptide obtained using plasmid pFN-3, bilouxi PBLA, isolated from the plasmid PBLAll (code storage ATSS N 39788) and inserted into plasmid pFN 962-3, digested by the enzyme NdeI were added enzyme maple and EcoRl digested (see the above-mentioned PCT publication). The resulting plasmid designated pFN 975-25, deposited in the American type culture collection under the designation storing ATSS N 67832. This plasmid was used for transformation of prototroph Escherichia coli A4255 (F+).

These cells Eschericnia coli was found, expressed "full" FBD polypeptide at concentrations of around 5-8% of the total cellular protein. Polypeptide migrated on SDS-PAGE gels under reducing conditions with an average mol. m 31 KD, so it was identified as a polypeptide 31 KD FBD r31 KD.

C. Conditions of fermentation and growth

The clone expressing the FBD polypeptide r31 KD, were subjected to fermentation in enriched medium (yeast extract and casein hydrolysate) containing ampicillin. The cultivation was performed at 30oC. Expression was obtained after induction at 42oC for 2 h, and then separating the precipitate bacterial cells containing FBD polypeptide r31 KD. Similarly, the clone expressing the FBD r20 KD, were subjected to fermentation and received sediment bacterial) region linking of fibrin.

The whole procedure consisted of three stages.

1. Rough treatment of bacterial sludge.

2. Resaturate/re-oxidation.

3. The cleanup.

1. Rough handling.

The precipitate is first suspended in 5 volumes of 50 mm Tris-HCl/50 mm Na-ADTD, pH 8 (buffer 1); then treated with 1.2 volumes of buffer 1 containing 100 mg/l of lysozyme (2 h, stirred at 37oC). In the resulting suspension was added Triton X-100 (1%), after 30 min at room temperature, the suspension was centrifuged, and the residue is again suspended and washed twice with water. r31 KD remained in the sediment, as determined using SDS-PAGE gels.

The washed precipitate is suspended in 14 volumes of 10 mm Tris-HCl/5 mm EDTA/ 2 mm PMSF/2 mm 6-aminocaproic, pH 7.5 (buffer A), and then were treated with buffer A, containing: a) 1% decyl sulfate; b) 1% decyl sulfate/5% glycerol; 5% glycerol. Final processing was performed with buffer And without additives.

2. Resaturate/re-oxidation

Principle: the precipitate was dissolved in 6 m guanidine-HCl (GuCl) in the presence of a reducing (thiol)agent, such as glutathione (GSH), and senatoriable/re-oxidized at a lower concentration of CUCl by GSH in buffer A. The GuCl concentration gradually decreased initially up to 2 m, and then up to 1 m and 0.5 m, while keeping the concentration of all other components constant (the volume at this stage corresponded to the 500 - to 1000-fold volume of sediment). When one of the intermediate concentrations GuCl, namely between 0.5 and 2 m, initiated the restoration of the conformation by adding 0.3 mm GSSG and incubation at room temperature for 24 to 28 hours Denaturirovannyj 31 KD then dialyzed against buffer without additives.

3. The cleanup.

Concentration: a large amount of reactivated 31 KD was first subjected to centrifugation to remove insoluble portion, which does not contain a 31 KD, and then before concentration and initial purification on a column of heparin-separate dialyzed against Tris-HCl, pH 7.8.

An improved procedure for reactivation and purification of the polypeptide fragments described in example 5.

Example 3. Pharmacodynamics of fragments of the polypeptide region linking of fibrin r 31 KD, r 20 KD, r and 18.5 KD and r12 KD.

The intensity and resolution of the clot ( thrombus) is regulated by the interaction of the closing speed of radiopharmaceutical agent and the rate of purification from him what OnAction (FN), in the region of the binding of fibrin r31 KD and fibronectin plasma include125I with the help of ICI-treatment (24) and a labeled form was administered intravenously to rats.

It is established that the rate of purification of the two radioactive molecules are different, and after 5 h circulates only 3% FBD r31 KD, but 20% of the FN key.

Several rats were kept in individual metabolic cages, and the accumulated urine and feces were collected after 7 h and 24 h Approximately 30% of the injected radioactivity1251-r31 KD was eliminated in the urine during the first 7 h, and after 24 h were derived more than 90%. All the radioactivity in the urine was soluble in trichloroacetic acid, which is an indication of proteolytic destruction. Analysis of various organs (kidneys, stomach, liver, lungs, uterus, ovaries, adrenal glands, colon, ileum intestine, skin, brain, eyes, muscles, bladder, heart, spleen, trachea, aorta and Vena cava) did not find any specific accumulation. In most bodies of specific radioactivity (counts /min/g tissue) was lower than for the serum.

These results indicate that exogenous recombinant amino-terminal polypeptide FBD size 31 KD is gradually destroyed and you is that this polypeptide is moderately distributed in the tissues and parts of the body other than blood. It also follows from the detected fact, namely that the degree of destruction is not increased during the period of 4 to 24 h, which may be a result of the gradual release of the polypeptide from separate parts of the body. Characteristic and relatively early appearance of metabolites in the urine indicates that the polypeptide is easily eliminated via the kidneys. The lack of accumulation in the liver may serve as an indication that this body is not the main point of this destruction and is not included in detoxification.

The relatively short half-life FBD 31 KD is an important factor for its use in order diagnostic imaging of thrombus. In recombinant FBD 31 KD (r31 KD) can include a radioactive label or a label of a different type, and then enter it into the blood to visualize thrombus.

The shorter the half-life of the molecule is also an important factor, when it is used to prevent the formation of clots. It should be noted that heparin, therapeutic agent, currently used for these purposes, "suffering" is too great period of polyhybrid 31 KD plasma fibronectin: it was noted the same pharmacokinetics and distribution of radioactivity.

Note that plasma FBD 31 CD contains the first 259 amino acids FN, while recombinant FBL 21 CD contains the first 262 amino acids FN key and the additional N-terminal methionine.

Pharmacokinetics polypeptide region linking of fibrin r20 KD, r18,5 KD and r12 KD.

Similar experiments were performed using polypeptides region linking of fibrin r20 KD, r18,5 KD and r 12 KD, obtained as described in examples 2, 4 and 5. As was established, the pharmacokinetics of these polypeptides are very similar to the pharmacokinetics of the polypeptide r 31 KD.

Example 4. Expression and fermentation of other polypeptides region linking of fibrin (FBD).

In example 2 described the expression of partial FBD r20 KD and FBD full length r31 KD, and in PCT publication N WO 90/07577 of the applicant (example 24) proposed an improved procedure for reactivation and cleaning FBD 31 KD. The following describes the construction of plasmids for the expression of other polypeptide fragments FBD.

A. the expression of the polypeptides FBD r12 KD.

Plasmid pFN 975-25 (FNCC N 67832) expresses FBD fibronectin full length r 31 KD. It plasmid pFN 196-2, which expresses the part of the FBD, designed, as shown in Fig. 16. This plasmid transformera the I N 68328. These transformed cells are efficiently Express part of the FBD polypeptide in quantities amounting to approximately 5% of the total cellular protein. This polypeptide has a mobility corresponding to approximately 14.4 KD on SDS-polyacrylamide gels in reducing conditions. It contains the first 109 amino acids of fibronectin and additional meinenemy residue at N-end. Throughout this patent application, such a polypeptide is referred to as a fragment of the polypeptide r12 KD or FBD r12 KD.

B. Enhanced expression of the polypeptide in FBD 12 KD.

Plasmid pFN 196-2 (ATCC N 68328) expressing a fragment of the polypeptide FBD 12 KD (2 "finger") under the control of the promoter PLand the binding site of the ribosome-lactamase, was described above. In order to increase the rate of expression of a fragment of 12 KD, plasmid pFN 203-2 designed as shown in Fig. 25 and 26 and listed in the description of figures. Plasmid pFN 203-2 expresses a fragment of the 12 KD under the control of the PL-promoter binding site of ribosomes CII and the sequence is complete transcription of trp size 36. Plasmid pFN 203-2 deposited at the ATCC in E. coli A4255 under the code storage N 68606. These transformed cells was found to Express a fragment of the polypeptide FBD is growth.

The clone expressing the polypeptide FBD r12 KD, was fermentatively in enriched medium (yeast extract and casein hydrolysate) containing ampicillin. The cultivation was performed at 30oC. Expression was obtained by induction at 42oC for 2 h, and then received the pellet of bacterial cells containing the polypeptide FBD r12 KD. Similarly received sediment cells containing other proteins.

C. Expression of the modified FBD polypeptide 12 KD (12 KD').

Plasmid pFN 975-25 (ATCC N 67832), which provides the expression of FBD full length (r31 KD) was used to construct plasmid pFN 197-10, which expresses the modified polypeptide r12 KD (r12 KD'), as shown in Fig. 17. The sequence FBD-fibronectin modified in order to obtain the NdeI site immediately after nucleotide 340. This plasmid was used to transform the Escherichia coli strain A1645, and then the Escherichia coli strain A4255. These transformed cells have been shown to efficiently Express a modified r12 KD in quantities amounting to approximately 5% of the total cellular protein. This polypeptide has a mobility similar to remotefilename FBD 12 KD (installed on the restored SDS-polyacrylamide gels). It contains the research Institute of the polypeptide has an additional methionine. This polypeptide was identified as a polypeptide r12 KD' or FBD r12 KD'.

D. the expression of the polypeptide FBD of 18.5 KD.

As described above (example 2A), the fragment FBD 20 KD, expressed by plasmid pFN 949-2 (ATCC N 68456), contains up to 20 additional amino acids from the vector pBR 322 for reading after the end of the FN gene in the absence of a properly positioned codon complete transcription TAA. In order to provide a more authentic "3-finger" a fragment of the polypeptide FBD, designed a plasmid encoding a polypeptide FBD of 18.5 KD.

This design is shown in Fig. 23 and described in the description of the figures. The resulting plasmid designated pFN 208-13, expresses a fragment of the polypeptide FBD of 18.5 KD under the control of the PL-promoter and the binding site of the ribosome-lactamase. Plasmid pFN 208-13 deposited at the ATCC in E. coli A4255 under the code storage N 68456. This plasmid expresses the first 154 amino acids of fibronectin with an additional N-terminal methionine.

Example 5. Recovery conformation and purification of recombinant polypeptides 20 KD and 12 KD region linking of fibrin in fibronectin.

The recovery procedure patterns and purification of the polypeptides of the r20 KD and r12 KD consists of three phases:

1. ptx2">

1. Rough handling.

1.1. Leaching and extraction of sediment.

Sediment bacterial cells, obtained as described in example 2 for polypeptide r20 KD and as described in example 4 for the polypeptide r12 KD, was destroyed and washed essentially the same as for polypeptide r31 KD (see PCT publication N WO 90/07577 applicant, S. 121 et seq.); however, in the extraction procedure used for polypeptide r20 KD and r12 KD, was amended. The following is an example of the washing procedure and the extraction carried out on the sediment cells containing the polypeptide r20 KD; polypeptide r12 KD were extracted in the same way.

1.2. Method.

Bacterial sludge containing polypeptide r20 KD, obtained as described in example 2, using for fermentation of Escherichia coli strain A4255 carrying plasmid pFN 949-2. Part of the sediment (14.8 g) suspended in 10 volumes of 50 mm Tris-HCl, 50 mm EDTA (buffer B), pH 7.5. The suspension is homogenized for 15 to 30 s with an average speed, and treated with ultrasound 3 times in 4 min with pulsations and centrifuged with a speed of 15,000 rpm for 30 minutes the Precipitate is again suspended in 2.4 volumes (36 ml) of buffer b was Added lysozyme (0.1 mg/ml) and the suspension was incubated in a water bath Ave the room temperature for 30 min and centrifuged. The precipitate is again suspended three times in 148 ml of water (i.e., 10 volumes of sediment source), homogenized, was stirred for 30 min at room temperature and centrifuged. The resulting precipitate had a weight of approximately 1.5 g, i.e., only 10% of the initial mass, but both polypeptide r20 KD and r12 KD remain in this volume, which was established by electrophoresis in SDS-polyacrylamide gel. The washed and extracted sediment was stored frozen at -20oC until further processing.

2. Solubilization and resaturate polypeptide.

2.1. Reagents and procedure differ from those used for polypeptide r31 KD. The residue polypeptide r20 KD or r12 KD was dissolved in 6 M guanidine-HCl (GuCl) in the presence of 50 mm-mercaptoethanol, and then after a tenfold dilution was subjected to air oxidation.

2.2. Method.

Frozen sediment r20 KD (1.5 g) was subjected to solubilization and homogenization in 10 volumes of 10 mm Tris-HCl, 5 mm EDTA (buffer C), pH 8.0, containing 6 M guanidine-HCl. The sample was reduced by adding 57 l undiluted-mercaptoethanol (final concentration 50 mm) and stirred in a sealed vessel in the Wali able to oxidize. When this content is regularly and carefully mixed (open beaker) for 48 - 72 h at room temperature. As an alternative oxidation was carried out in a closed vessel in the presence of 0.3 mm GSSG. Although at this stage already, there is some precipitation of the polypeptide, the suspension containing the precipitated, dialyzed for 24 h against 15 volumes of buffer C, pH 8.5 with three changes of buffer. Dialysate then was subjected to centrifugation for 45 min with a speed of 15,000 rpm (22500 g) in high-speed centrifuge Beckman, equipped engine JA-17. This removes many contaminating proteins and aggregates r20 KD or r12 KD, which are produced during oxidation.

3. Purification and characterization of the polypeptide.

Because the location of the binding site of heparin within the scope of the binding of fibrin unknown, they did not believe that the new, shorter polypeptides r20 KD and r12 KD will bind to heparin-separate. However, the applicant has found that shorter molecules possess this property.

The applicant has found that a column of phenyl-sepharose, as in the case of r31 KD to clean oxidized polypeptides r20 KD or r12 KD is not needed. Here a significant blockerase subjected to chromatography on a column of Q-sepharose, and before you realize chromatography on a column of heparin-sepharose. In some cases, the polypeptide has concentrated on the system type Pellicon, Millipore Corp.), by using membranes with the appropriate restriction, namely 10 KD for a polypeptide r20 KD and 3 KD for a polypeptide r12 KD, before downloading the material on a column of Q-sepharose. A column of heparin-sepharose also used for concentration of both polypeptides. Below is a sample cleanup procedure used in the case of polypeptide r20 KD.

3.1. Chromatography on Q-sepharose.

One third of the oxidized r20 KD (47 ml) were applied to 10 ml of the flowing column of Q-sepharose, which is pre-balanced buffer C, pH 8.5 (flow rate of 1.2 ml/min). The resulting fraction was collected and stored (70 ml). Polypeptides associated with the column, was suirable buffer C, pH 8.5, containing 0.5 M NaCl, and the column was regenerated using 0.5 M NaOH.

3.2. Chromatography on heparin-sepharose.

The flow that has passed through a column of Q-sepharose, was applied to a 10 ml column of heparin-sepharose, pre-equilibrated with buffer pH 8.5 (volumetric rate of 0.5 ml/min). The resulting fraction contained mainly impurities and improperly denaturirovannyj polsku regenerates in the same buffer, containing dopolnitelno 6 M guanidine-HCl. The tables for General cleaning r20 KD (table. 1) and r12 KD (table. 2).

3.3. Characterization of polypeptides.

The supernatant after separation of the bacterial sludge to obtain polypeptides r20 KD and r12 KD, as well as portions of successive fractions from the column were analyzed for the presence of the polypeptide and analyzed by electrophoresis in SDS-polyacrylamide gel; elution profiles were obtained on a column of Superose 12, connected either with FPLC, or jhud. These profiles at different stages of reactivation and the treatment given for r20 KD (Fig.21) and r12 KD (Fig. 22). Purified polypeptides r20 KD or r12 KD elute in the form of separate and distinct bands. These profiles confirm the results obtained in SDS-PAGE gels under non conditions; bands for samples of both polypeptides (r20 KD and r12 KD) are rediffusion that indicates the presence of one molecular form. In the case of the r20 KD band unrestored polypeptide emerges (as in the case of polypeptide r31 KD) faster than the band for the restored form. This difference, however, was not observed in the case of polypeptide r12 KD. For more details about the properties of the FBD polypeptides shown in the example of the political agents for visualization of thrombi and atherosclerotic lesions.

Advantages of use for the aforementioned purposes than the r31 KD FBD polypeptide (r20 KD and r12 KD) caused directional search by the applicant simpler way of obtaining them. The techniques described above are faster and more simple in comparison with the methods proposed for the reactivation and purification of the polypeptide r31 KD. In addition, the proposed procedure leads to a higher output than the procedure for polypeptide r31 KD, and the higher output of the polypeptide (10 mg/ml).

Example 6. The biological activity of the polypeptides of the area linking of fibrin r31 KD, r20 KD and r12 KD.

The biological activity of the polypeptide FBD r31 KD, which concerns its binding to fibrin clots in vivo and in vitro binding to bacteria and bind to extracellular matrix, described in PCT publication N WO 90/07577 applicant, S. 134 et seq. This example provides information on the biological activity of FBD polypeptides r20 KD and r12 KD.

A. Comparison of binding with pre-formed fibrin clot125I-labeled r31 KD, r20 KD, r12 KD and plasma FBD.

Binding to fibrin clots was determined as follows (reaction II).

Stay procedures .

a) using incubation at 37oC 20 l treated with citrate of whole human blood with 5 mm CaCl2, 1 u/ml thrombin and PBS in a final volume of 250 L. the Reaction was stopped after 45 min by centrifugation and washing the precipitate twice with 1 ml PBS.

b) using incubation at 37oC 20 l not treated with citrate whole human blood. The reaction was stopped after 150 min by centrifugation and washing, as in procedure a).

Stage 2. Binding125I-FBD polypeptide with a pre-formed fibrin clot.

The clots were incubated at 37oC in a final volume of 260 l of PBS with125I-rFBD-polypeptide. As indicated in each experiment, you can add other components. The binding reaction was stopped after 45 min by centrifugation and washing three times with PBS. Tubes containing sediment125I-rFBD-fibrin was measured for radioactivity using a gamma counter.

Results.

The results show (Fig. 20) that the plasma 31 KD binds to the same extent that the r31 KD, while the polypeptides of the r20 KD and r12 KD associated only about half of the cases compared to the full-size (31 KD) moznosti application radiometric polypeptides r20 KD and r12 KD as radiopharmaceutical agents for visualization of blood clots.

B. Binding125I-r12 KD with fresh or frozen clots.

In order to study the effect of freezing clots before use in experiments with binding FBD polypeptides, carried out the following experiment. Fibrin clots either used fresh or after storage at -70oC in the two-stage binding assays with125I-r12 KD FBD, obtained as described in example 6.

This experiment was carried out in the presence of transglutaminase or without it. The results showed that there is only a small effect of freezing on the ability of the clot to link FBD r12 KD. In the General case, the frozen clots without adding transglutaminase give results similar to the fresh clots in the presence of transglutaminase; the effect on the reaction of binding of exogenous transglutaminase when using frozen clots is missing.

C. Comparison of recombinant FBD polypeptides 12 KD, 20 KD and 31 KD in a model of venous thrombus-induced spiral of stainless steel.

Three recombinant polypeptide, labeled125I, as described in example 3 was used in the model rats, described below.

Female rats Vista is concealed interior Vena cava. The spiral of stainless steel wire was inserted into the lumen of the vein at a point slightly below the connection, and the incision was sutured. Each inserted tool separately weighed before inserting and each weight was recorded. After 3 h after surgery, the animals intravenously method was introduced 1 ml of 0.9% solution of NaI in order to saturate the iodide in the thyroid gland. One hour later the rats were injected intravenously way125I rFBD/5 106counts/min; 100 g/kg). The polypeptide was labeled as described in example 3. After 24 h after application of labeled polypeptide took the blood in a shot in the heart, after which the rats were euthanized. The segment of Vienna, bearing IUD, was removed. In one group the segments carrying the spiral weighed as such and used to change radioactivity (group "a blood Clot on the spot"). In another group cut a vein in the longitudinal direction and the spiral bearing clots, were carefully removed, weighed and measured the radioactivity. The levels of radioactivity in the blood was measured using peripheral blood.

The results, shown in Fig. 19 shows that each of the three molecules are specifically localized in the clots. It turned out that the specific radioactivity of clots is higher for more of the lengths of the polypeptides, respectively), but these differences were not statistically significant. Values of specific radioactively for blood (after 24 h) similarly associated with molecular size (7040, 5016 and 3300 counts/min/g for polypeptides r31 KD, r20 KD and r12 KD, respectively) and may reflect differences in the rate of blood clearance of these molecular species. Therefore, calculating the ratio of specific radioactively clot the blood produced results, values are similar for the three different polypeptides and change in the region close to 20. These results indicate that all three types of FBD (or other fragments FBD) can be used for visualization of blood clots.

Example 7. The introduction of the label in the polypeptides to apply for visualization of atherosclerotic lesions and blood clots.

In the polypeptides of the area linking of fibrin, is described in this patent application (polypeptides r31 KD, r20 KD and r12 KD), can be entered radioactive label. Example 3 the procedure of introduction of the label in these three polypeptide using iodine-125 (125I), which has a large half-life (60 days).

Other radioactive iodine, which can be used for the introduction of the mark in the FBD polypeptides, using known techniques, for example, one of copolarized (8 days).

In the optimal case, the radiopharmaceutical agent for clinical imaging of atherosclerotic plaques and blood clots should give positive results within the first few hours after injection (33). So for this test you can use more short-lived RFID tags, for example indium-III (IIIIn), and technetium-99M (99mTC) (half-life of 67 h and 6 h, respectively (32).

The introduction of the mark in the FBD polypeptides using99mTc can be carried out using well-known techniques(21, 33, 34, 35).99mTc is a very effective diagnostic radionucleotides because of its short half-life, level detection 140 KeB gamma counter, lack of exposure to other particles, low cost and wide availability.

Another short-lived label with low energy is iodine-123 (123I) with a half-life of 13.3 hours

can be used for introduction into the FBD polypeptides also krypton-m (MKr) and xenon-133 (133Xe), which have a half-life of 5.3 days, as specified by the knight (4). Potential tag is gallium-67 (67Ga): as indicated Yamamoto (36), 67Ga has a half-life of 78 hours In one and the t 31 KD usingIIIIn, following the procedure described for human serum albumin in Hnatowich, D. J., Layne, W. W. and Chilcs, R. L., J. Appl. Radiat.Inst., so 33, S. 327, (1982). Preliminary experiments showed that labeled IIIIn FBD polypeptides associated with previously educated by blood clots in vitro (the measurements were carried out using a two-stage reaction, example 6) and blood clots in vivo (the measurements were carried out using the model described in example 6.C). Identified high thrombus:blood in the region of 80 - 200 after 24 hours

The procedure for radiolabelling protein of 12 KD and 18.5 KD.

TPC - modification (diethylenetriaminepentaacetic acid) fragments of the polypeptide FBD 12 KD and 18.5 KD carried out generally in accordance with known techniques (Hnatowich, D. J. Layne, W. W., and Childs, R. L. (1982) Int. J. Appl.Radiat-Isot T. 33, pp. 327-332; Knight, L. C., and others (1987) Biochim, Biophys. Acta 924 so, S. 45-53), using cyclic anhydride DTPC. Portions of a solution of dry chloroform containing the calculated amount DTPC equivalents, evaporated and carried out the reaction with proteins in buffered or phosphate or bicarbonate saline solution (pH of 7.4 and 8.0 and 0.2, respectively). Excess (gidralizovanny) TPC was removed by deep dialysis. Tagging was carried out using does not contain mediaIIIIn HCl ptid 12 KD, obtained in accordance with the description of example 5, which gave the content of the thrombus/blood (in the model rats), equal to 86. Used the calculated molar excess TPC equal to 5, because the prototype of the 12 KD has 5 librovich-amino groups and 1-amino group. When tagging usingIIIIn the concentration of free (unbound)IIIIn was estimated as less than 15% (with TCX).

In another series of experiments (BBS) used the relationship between the anhydride DTPC and any protein of 12 KD or protein 18.5 CD 1:1.

In order to estimate the number of TPC residues included in each molecule of the polypeptide 12 KD, TPC - modified protein (before separation of the excess DTPC) were labeled usingIIIIn (knight and others, see above). A number of include DTPC residues, as has been established, is 0.12 per mole of polypeptide 12 KD. TPC-labeled fragments FBD r12 KD and r18,5 KD had an identical elution profiles on a Superose 12 gel-filtration) with elution profile for the control of the modified protein (retention time 19,17 min and 18,29 min, respectively, and control values are given in table.4). With the introduction of tagsIIIIn, after separation of the excess DTPC it was found that the amount of free (nesb/blood (in the model rats), respectively, 27 and 25.

Visualization using metals with ionic NMR, ultrasound and x-ray radiation is described in U.S. patent N 4647447. In addition, in column 7, line 42, referred to the binding of an antibody with chelates metals. Monoclonal antibodies labeled polymeric paramagnetic chelates and their use in accordance with the methods EMR (ion nuclear magnetic resonance) is also known (Shreve, P. and others, Magnetic Resonance in Medicine, so 3, S. 336-340. 1986 and Brady, T. and others, Proceedings of the Society of Magnetic Resonance in Medicine, Second Annual Meetinge, Soc. of Magnetic Resonance in Medicine, Inc. San Fransisco 1983, which contains a link to Koutcher, J. and others, J. Nucl.Med., so 25, S. 506-513, 1984).

Example 8. Additional experiments, confirming the biological activity of various FBD polypeptides.

Biological activity FBD polypeptides r31 KD, r20 KD, r12 KD described in example 6. In this example, will be given additional results obtained using fragment FBD 12 KD, which was obtained in accordance with the description given in examples 4 and 5, and fragment FBD of 18.5 KD, obtained as described in example 4.

I. Binding to the fibrin clot.

The formation of clot and FBD-linking was carried out as described below (modified PERC is s, final centrifugation was removed, and the clot was transferred into a new tube and thoroughly washed.

A. Coagulation pre-formed clot."

The reaction mixture (300 l) obtained in siliconized plastic vials (7 ml) from gamma counter, contained 150 l 1 mixture consisting of 0.2 X buffer Tirade ("1 x buffer Tired": 1 mm HEPES, pH of 7.35, dextrose and 0.2%, 27 mm NaCl, 0.76 mm NaH2PO4, 0,54 mm KCl, 0.2 mm MgCl2), 3 u/ml Thrombin (firm Sigma), 0.6% BSA, Sigma), 15 mm CaCl2, 150 mm NaCl, 20 mM NaHCO3, pH 8.0, and 150 l fresh treated with citrate, human blood.

Incubation was carried out at 37oC for 3 hours the Serum was removed under vacuum, and the tubes containing fibrin clot, and kept frozen at -70oC. Pre-formed clots can be used for several months.

century Link FBD with "pre-formed clot."

In vials containing pre-formed clots" (after thawing at room temperature) was added to 300 l of 150 mm NaCl, 20 mm NaCOH3, pH 8.0, containing 1 buffer Tired, 0,6: BSA, 5 mm CaCl2and 0.15 M125I-FBD. The binding reaction was carried out (in otsutstvovanie transglutaminase, factor XIIIa) at 37oC for 18 hours Then the clot was transferred to a siliconized bubble, washed 3 times with 1 ml washing buffer (20 mm NaCHO3, 1% BSA, 1 mm PMSF, 2 mm EDTA) and were counted in the gamma counter.

The results of the comparison of plasma and recombinant 31 KD with recombinant of 18.5 KD, 12 KD, 45 KD (FBD 12 KD, merged with CBD 33 KD obtained, as shown in Fig.20) and CBD 33 KD shown in Fig. 27. All fragments FBD polypeptide was associated equally at that time, as CBD-polypeptide associated only in a very small degree. 50 - 75% inhibition caused by the addition of an inhibitor of factor XIII iodoacetate shows that transglutaminase is active in binding assays. The lack of effect of inhibitors on the binding of CBD 33 KD with clot indicates that binding of CBD with clots is another, possibly non-specific mechanism.

II. Binding to vascular components.

In addition to the specific binding to fibrin FBD polypeptides also exhibit some degree of nonspecific binding with other vascular components with which they come in contact. Examples of such vascular component is e which is one of the factors who defines the "reference level" in the implementation of procedures diagnostic imaging. The lower non-specific binding, the more effective visualization and the less you need to apply radioactive reagent to the patient. A comparison was made between non-specific binding to vascular fragment components FBD 12 KD and FBD polypeptide of 31 KD.

Portions containing 0.3 M125I - 12 KD or125I - 31 KD (5 of 105counts/min g and 7.5 of 105counts/min g in 1 ml PBS, containing 0.1% of BCA added in a dual analysis in 35 mm Petri dishes (firm Falcon) containing confluent endothelial cells (EC), extracellular matrix (ECM), (Eldor and others, Blood, I. 65, S. 1477, 1985) or immobilized human fibronectin (FN) (1 ml were applied to the plate with PBS containing 50 g/ml FB, after incubation at 4oC during the night, and were incubated for 2 h at room temperature with 1 ml of PBS containing 1% BCA to lock). The symbol "+TG" means that the plates also contained transglutaminase at a concentration of 0.02 Units/ml, Sigma). Experimental plates were incubated 60 min at 37oC CO2-the incubator, washed 3 times with 1 ml washing solution (PBS containing 2 mm PMSF and 2 mm EDTA). Catastor, containing 1% deoxycholate Na, 2 mm PMSF, 2 mm EDTA, 2 mm NME and 2 mm iodixanol acid). This solution is then transferred into vials and radioactivity was measured in a gamma counter.

The results show that FBD polypeptide 12 KD is associated with vascular components (endothelial cells, extracellular matrix and fibronectin) is significantly weaker than the 31 KD.

III. Bacterial binding.

Linking FBD polypeptide 31 KD with S. aureus has previously been described (see PCT Publication WO 90/07577 applicant S. 146 - 153). Similar to the experiments described below indicate that in contrast to the FBD polypeptide 31 KD fragments of the polypeptides in FBD KD and 18.5 KD is not associated with S. aureus directly and does not inhibit the binding of S. aureus to endothelial cells. However, the polypeptide 20 KD reduces the binding of S. aureus, which may be attributed to additional (inauthentic) C-terminal amino acids (see example 2), which can interfere with its activity.

In table. 3 summarizes and compares the various activity fragments FBD according to the invention.

Thus, it is obvious that the fragments of the polypeptide FBD 18.5 KD and 12 KD is highly specific covalent binding to fibrin, together with b is s, such as vascular components and bacteria. It is a preferred feature for the agent visualization of thrombus, which ensures that as a diagnostic reagent it has a high affinity against fibrinogenesis clot and gives low background levels.

Example 9. Characteristic fragments FBD.

I. Procedure.

Fragments of the FBD polypeptides obtained in accordance with the proposed in the present patent application methods were analyzed and compared in a series of tests carried out using the following techniques, well known in this technical field.

1. SDS - PAGE+ME (-mercaptoethanol).

12.5% acrylamide flat gels were loaded protein, which was pre-treated by boiling for 5 min in sample buffer containing 1% SDS under reducing conditions (+1% ME). Electrophoresis was performed using 20 g on the strip, and the gels were stained with brilliant blue of Kumasi. We measured the following parameters: a) mobility, which when compared with molecular weight markers(94, 67, 43, 30, 20,1 and 14.4 KD) can be expressed as the average molecular weight of the target protein; (b) homogeneity or purity, koorumine flat gels were loaded with protein, which was pre-treated for 5 min in sample buffer containing 1% SDS at non conditions (-ME). Electrophoresis was performed using 20 g of the strip and the gels were stained with brilliant blue of Kumasi. We measured the following parameters: a) mobility, which when compared with molecular weight markers(94, 67, 43, 30, 20,1 and 14.4 KD) can be expressed as the average molecular weight of the target protein; (b) homogeneity or purity that can be obtained from the relative intensities of strong and weak bands (in particular, under these conditions, we can estimate the number of dimers, linked by a disulfide bond).

3. Gel filtration on Superose 12. The average molecular weight and homogeneity of the preparations of the protein was estimated from the elution profiles obtained on a column of Superose 12 (HR10) 30, the firm Pharmacia Fine Chemicals, connected either with FPLC apparatus (liquid chromatography with programming flow velocity) with controller for liquid chromatography LCC-500 and the recording means (firm Pharmacia Fine Chemicals), or with jhud (firm Waters Associates), consisting of 2 pumps (model 501), injector (model U6K) and automated gradient controller (model 580), supplied by the detector is subjected to calibration using the following molecular weight standards, for which the determined retention time: BSA (67 KD), egg albumin (43 KD), chymotrypsinogen (25 KD) and ribonuclease (13.7 to CD). Flow rate was 0.8 ml/min (using a standard work buffer, namely, 150 mm NaCl - 20 mm Tris.HCl, pH 7.8 to 8.0). Watched two parameters: retention time and bandwidth, half-height.

4. UV spectroscopy. Spectra were obtained at room temperature in BBS or PBS at concentrations of 0.2 - 1 kg/ml spectrophotometer (scanning) type Philips UV/Vis model RU (band width 2 nm), equipped with a printer/plotter. Spectra were measured on a silica type Pye Unicam UV with a path length of 10 mm is Watched by two parameters: the absorption coefficient, namely1%inmaxspectra and the relationship between acquisitions in maxandmin.

5. Native fluorescence. Data received on spectrofluorometer model FP-770 at 25 of 0.1oC. the wavelength of excitation was 2250 nm and two slits for excitation and emission were set at 5 nm. The concentration of protein in the analysis was 8 to 25 g/ml of either PBS or fresh BBS, pH 7.5. A significant pH dependence of both measured parameters, i.e.max(the wavelength of maximum range) and specific of intensive the ptx2">

6. Amino acid composition. This test was performed in accordance with generally accepted methodology of Stein and Moore for amino acid analysis.

Used the analyzer type Biotronic LC 5000, serial number 515-01. Parameter analyzed by this method is the number of residues of each amino acid except Cys and Trp.

7. Chromatography on heparin-sepharose. Samples of up to 200 l were injected with the analytical column of heparin-sepharose (5,5 0,5 cm), connected with jhud system (firm Waters Associates). The column was pre-balanced 10 mm sodium phosphate, pH 6.5 mm NaCl with a volume rate of 0.5 ml/min and washed for 5 min with the same buffer. Proteins were suirable in a linear gradient from 75 to 500 mm NaCl in buffer at 37.5 minutes were Analyzed by two parameters: retention time (ret.time and bandwidth, half-height half-ht.b.w.), which determines the uniformity of the peak.

8. Reversed-phase Ehud chromatography. Samples were injected with analytical column for reversed-phase chromatography type Waters C18Bondapak (30 0,39 cm) connected to a system ghvd, which is pre-balanced 80% H2O with 0.1% TFA% acetonitrile, and 0.08% TFA with a volume rate of 1 ml/min and washed for 5 min with the same RA is Analyzed two parameters: retention time (ret.time and bandwidth, half-height half-ht.b.w.), which determines the uniformity of the peak.

9. Trypticase card. Samples of 200 g with different modes of sample was digested for 10 min at 37oC with different parts of trypsin (m/m in%: 0,25, 0,5, 1,0, 2,5, 5,0 and 10.0. The reaction was stopped by addition of 5 mm PMSF and subsequent keeping 30 min on ice; then, the sample was treated with buffers IU samples (see sections 1.1 and 1.2) and were analyzed on a 20% acrylamide flat gels as described above. The degree of equivalence between the structures of the bands was evaluated after staining brilliant blue of Kumasi.

10. Method of Ellman for the determination of thiol protein. Such determination was performed on denaturirovannykh proteins in order to provide full access to thiol groups.

Solutions 1. Guanidine-HCl (the cleanest available quality) 7.2 M in 10 mm Tris-HCl, pH 8 (GuCl).

2. DTNB (reagent of Allman) 5 10-3M in 100 mm K-phosphate buffer, pH 7.

Method. The protein samples containing 10 - 100 M thiol groups, brought up to a volume of 0.15 ml was added pure DTNB (without traces of protein) and 0.75 ml of 7.5 M GuCl (final concentration of 6 m). After incubation for 15-30 min at room temperature up protein solutions were analyzed in the h at room temperature, the samples were read in the area of 412 nm is relatively "clean" DTNB. The concentration was calculated using the = 13600 M-1cm-1.

11. The deposition/adsorption.

The Eppendorf tubes containing the frozen125I-FBD, was allowed to thaw at room temperature, and then abruptly stirred. Two portions of 5 l were taken for analysis of radioactivity. The solution was centrifuged at high speed in an Eppendorf centrifuge, the upper layer was decanted into another siliconized tube. Two portions 5 l again analyzed for the number of samples. Differences between the radioactivity obtained before and after centrifugation, represent the percentage of precipitation".

If125I-FBD should be stored frozen (at 70oC) in siliconized test tubes and the buffer with a high salt content (0.6 M NaCl), the protein is very stable. However, if the storage was carried out in desiliconizing tubes in a buffer with low salt (150 mm NaCl),125I-FBD-deposition may reach 60-80% within 2-3 days. Under these conditions, and precipitation and adsorption in vitro are significant.

12. The reaction of polypeptides with FBD14C - putrescine.

Method. The reaction mixture (100 l) in siliconized Eppendorf tubes containing: 10 mm the Yeni Guinea pigs (Sigma). After incubation at room temperature for 0,15, 30, and 60 min servings (10 l) was added to tubes containing 200 l of stop solution (0.4 mg/ml BSA, 50 mm EDTA, 150 mm NaCl, 20 mm NaHCO, pH 8.0) at 0oC (on ice). Added cold 20% THU (250 l) and then incubated 10 min on ice, was added 3 ml of cold 20% THU and the contents of the tubes were filtered on glass fiber filter (Whatmab GFC). Filters were washed 3 times with cold 20% THU and once with 70% ethanol. Deposited THU radioactive material was analyzed in a beta counter. Availability Gln#3 FBD for transglutaminase was calculated on the basis of the specific activity14C-putrescine and concentration of FBD in the reaction mixture; the inclusion of 5% of the total number of samples equivalent to 100% availability.

13. Self-Association.

The reaction was carried out in 300 l of 150 mm NaCl - 20 mm NaHCO3, pH 8.0, containing also 0.1 x buffer Tired; 0.6% BSA, 5 mm CaCl2; 0.15 M125I-FBD, 6 l transglutaminase (0.02 units/ml) (see section 12).

The reaction mixture was incubated at 37oC for 18 h, then was carried out by vacuum extraction of the reaction solution, washed 3 times with 1 ml washing buffer and measured the radioactivity in a gamma counter.

II. Results.

All FB is th is blocked by the N-end in p31 KD (resulting from post-translational modification of the encoded Gln) for N-terminal Met is followed by a Gln residue. Positive identification FBD-fragments is also confirmed by the analysis of spots Western on the gels, which are shown under the action of anti-20 KD.

In table. 4 shows the measurement results for the analyzed FBD polypeptides (r12 KD and r18,5 KD resulting expression plasmid pFN 203-2 and pFN 208-13, respectively).

Example 10. Tagging in vivo thrombus usingIIIIn FBD 12 KD and 18.5 KD in model rats with spiral stainless steel.

The model used is essentially the same as was described in example 6.With. Fragments of the recombinant polypeptide in 12 to KD and 18.5 KD and 31 KD were marked usingIIIIn using TPC - procedure (example 7). Labeled materials (specific activity approximately 5 to 106counts/min/g) was administered intravenously (5 of 106counts/min/rat) bearing spiral rats 5 h after injection of spirals. Spiral bearing clots were removed and carried counting after 24 h after application of the label. In Fig. 28 shows the results of specific radioactivity in spirals and blood, and Fig. 29 shows the corresponding relationship of a blood clot in the blood. The highest values were found in the thrombus group FBD 31 KD (compared with groups containing trasnaction for blood compared with FBD 31 KD. This can be explained by the narrow range of specificdate and activities shorter fragments compared to the polypeptide of 31 KD (example 8, table. 3).

Example 11. The use ofIIIIn-TPC-modifitsirovannyh FBD proteins with high radiochemical purity in order to obtain a high ratio of thrombus to blood in the model rats.

1. Modification and Radiometrie TPC-modified proteins FBD.

Methodology TPC-modification and radiolabelling TPC-modified proteins FBD described in example 7, previously perfected. It is possible to obtain high thrombus/blood in the model rats with the spiral.

1.1. TPC-modification. All three recombinant molecules (r31 KD, r18 KD and r12 KD) was modified using a 20-fold excess DTPC in 0.1 M HEPES-buffer, pH 7.0, and excess DTPC were removed using gel filtration.

1.2. The introduction of a radioactive label. One of the changes introduced in the procedure consisted in the introduction of RFID tags using theIIIInCl3at low pH (0.2 M citrate buffer, pH 5,7) (to reduce the minimum number of radiocolloids).

Removal of heavy metal ions, which can displace galatyIII

2. Protocol modifications and the introduction of RFID tags in the FBD proteins.

Detailed description of an improved procedure TPC-modification and the introduction of RFID tags in polypeptides r31 KD, r18,5 KD and r12 KD FBD is shown below.

2.1. Desalting. Proteins (all at 0.5 m NaCl in the presence of EDTA and other protease inhibitors) was absoluely and transferred in HEPES buffer (0.1 M, pH 7). FBD 31 KD (27 ml, 0.6 mg/ml) was absoluely using dialysis, while the FBD polypeptides of 18.5 KD (5 ml, of 8.7 mg/ml) and 12 KD (5 ml, 5.6 mg/ml) was absoluely on columns, gel filtration type PD-10.

2.2. TPC-modification. It was carried out with 20-fold excess of anhydride DTPC for 1 h at room temperature in a volume of 27 ml in the case of FBD 31 KD and 7 ml in the case of FBD 12 KD and 18.5 KD. Portions (100 l) of the modified mixture was taken to determine the number DTPC residues that were included in the proteins, and free DTPC removed from the remaining material by means of gel filtration on a column of Sephadex G-25, 2,6 60 cm, which is pre-balanced with HEPES buffer. Fractions (30 ml) containing proteins, was collected and given to the concentration of fragments in the 0.35 mg/ml, 0.8 mg/ml and 0.9 mg/ml for FBD r31 KD, r18?5 KD and r12 KD, respectively. It has been found that the degree of modification, which determine the respectively. TPC-modified fragments FBD kept frozen at -10oC, and thawed portions gave reproducible results with the introduction of RFID tags using the IIIIn.

2.3. The introduction of RFID tags. Tagging was performed using IIIIn-Cl3pre-translated in 0.2 M sodium citrate, pH 5,7, by adding 125 l of 1 M sodium citrate, pH 5,7, 500 l not containing medium raw solutionIIIInCl3(IIIIn: the 3.2 MCI/ml). The reaction mixture for introduction of labels contained (final concentrations): FBD polypeptide 0.2 g/ml, 60 mm HEPES, HCl 10 mm, sodium citrate 0.2 M andIIIIn the 0.8 Ci/L. the Reaction was allowed to proceed for 1 h at room temperature. Radiochemical purity was analyzed using TLC on silica gel (showed in 85% methanol), and for all fragments FBD polypeptides she changed in the field of 91-95%. Thus, the specific activity radiometric FBD proteins is about 3.6 Ci/g as metal ions, potentially contained as trace impurities in the buffers used in the process of introducing RFID tags can displace IIIIn that is associated with DTPC modified FBD-fragments, Radiometrie polypeptides skip the and, BBS, treated with Chelex-100 (to remove impurity ions of metals).

3. Biological activity.

The biological activity was tested in vitro by binding IIIIn-labeled, TPC-modified FBD with pre-formed clots, as well as in vivo in rats (in the model with induced spiral venous blood clots).

3.1. Linking with pre-formed clots.

This test was carried out as described in example 6 for iodirovannoi FBD. The specific activity of the threeIIIIn-labeled TPC-modified fragments FBD was 6 of 106counts/min g protein. The results of the experiments are given in table. 5 (second column).

3.2. Venous thrombi in rats.

The model used (venous blood clots caused by spiral) described in example 6.With. In these experiments, each group consisted of 7 rats, which were injected with 5 106counts/minIIIIn-labeled, TPC-modified fragment FBD with specific activity of 6 to 106counts/min/year the Results of these experiments are given in table. 5.

IIIIn-labeled TPC-modified fragment FBD (specific activity 6 106counts/min/is et al., J. Nuclear Med. 29: 1264-1267, 1988.

2. Zoqhbi, S. S., et al., Invest. Radio. 20: 198-202, 1985.

3. Kakkar, V. V., et al., Lancet 1: 540-542, 1970.

4. Knight, L. C., Nuclear Med. Commun. 9: 849-857, 1988.

5. Knight, L. C., Nuclear Med. Commun. 9: 823-829, 1988.

6. Som. P., et al., J. Of Nuc. Med. 27: 1315-1320, 1986.

7. Palabrica, T. M., et al., Proc. Nat. Acad. Sci. USA 86: 1036-40, 1989.

8. Akiyama, S. K. and Yamada, K. M., Adv. Enzymol. 57: 1-57, 1987.

9. Pierschbacher, M. D., et al., J. Biol. Chem. 257: 9593-9597, 1982.

10. Pande, H. and Shively, J. E., Arch. Biochem. Biophys. 213: 258- 265, 1982.

11. Hayashi, M. and Yamada, K. M., J. Biol. Chem. 258: 3332-3340, 1983.

12. Sekiguchi, K. and Hakomori, S.-I., Proc. Natl. Acad. Sci. USA 77: 2661-2665, 1980.

13. Ruoslahti, E., et al., J. Biol. Chem. 256: 7277-7281, 1981.

14. Owens, R. J. and Baralle, F. E., EMBO J. 5: 2825-2830, 1988.

15. Obara, M., et al., FEBS Letters 213: 261-264, 1987.

16. Obara, M., et al., Cell 53: 699, 1988.

17. Ichihara-Tanaka, K., et al., J. Biol. Chem. 265: 401-407, 1990.

18. Mandel, et al. , Principal and Practice of Infectious Disease 2: 1531-1552, 1979.

19. Proctor, R. A., et al., J. Biol. Chem. 255: 1181-1188, 1980.

20. Eldor, A., et al., Thrombosis and Haemostatis 56(3): 333-339, 1986.

21. Fritzberg, A. R., Nucl. Med. 26: 7-12, 1987.

22. Young, R. A. and Davis, R. W., Proc. Natl. Acad. Sci. USA 80: 1194 - 1198, 1983.

23. Hugh, T., et al., In DNA Cloning: A Practical Approach (D. Glover, ed.), IRL Press, Oxford, 1984.

24. Vogel, et al., Proc. Natl. Acad. Sci. USA 69: 3180-3184, 1972.

25. Bagly, D., et al., Methods in Enzymol. 45: 669-678 1976.

26. Wagner and Hyn.

29. Russel, P. B., et al., J. Clin. Micro. 25: 1083-1087, 1987.

30. Bolton, A. E. and Hunter, W. M., Biochem. J. 133: 529, 1973.

31. Obara, et al., Cell 53: 649-657, 1988.

32. Fritzberg, A. R. , et al., Proc. Natl. Acad. Sci. 85: 4025- 4029, 1988.

33. Knight, L. C., et al., Radiology 173: 163-169, 1989.

34. Wasser, M. N. J. M., et al., Blood 74: 708-714, 1989.

35. Burger, J. J., et al., Methods in Enzymology 112: 43-56, 1985.

36. Yamamoto, K., et al., Eur. J. Nucl. Med. 14: 60-64, 1988.

37. Peterson, et al., in Fibronectin, edited by Moshen, Academic Press, USA, 1989: p. 1-24, particularly figure 2 on page 5.

1. Visualizing agent representing labeled imaging marker recombinant polypeptide with the following properties: has an amino acid sequence that is essentially identical to the sequence field of the natural binding of human fibronectin to fibrin, is able to connect with fibrin has a mol.m. 12 - 20 KD, has the amino acid sequence gln - Ala - gln - gln or met - gln - ala - gln - gln at the N-end.

2. Agent p. 1, wherein the polypeptide contains an intramolecular disulfide bond, characteristic of natural human fibronectin.

3. Agent p. 1, wherein the polypeptide has a mol.m. approximately 12 KD or more.

4. Agent p. 1, characterized in that polypeptid is ome of 18.5 KD or less.

6. Agent p. 1, wherein the marker is a radioactive isotope, element, not transparent to x-rays, or paramagnetic ion.

7. Agent p. 6, wherein the marker is a radioactive isotope.

8. Agent p. 7, wherein the radioactive isotope is indium-III.

9. Agent p. 7, wherein the radioactive isotope is technetium-99M.

10. Agent p. 7, wherein the radioactive element is iodine-123, iodine-125, iodine-131, krypton-M, xenon-133 or gallium-67.

11. A method for detecting material containing fibrin, involving contacting the investigated material with a visualizing agent, and the visualization of the material with subsequent registration, characterized in that as a visualizing agent use the agent under item 1.

12. The method according to p. 11, characterized in that the studied material is a blood clot.

13. The method according to p. 11, characterized in that the test material is atherosclerotic plaque.

14. The method according to p. 11, wherein the marker is a radioactive isotope, element, not transparent to X-rays, or paramagnetic ion.

 

Same patents:

The invention relates to medicine, specifically to pharmacology, and relates to the use of previously known antimicrobial colloidal preparations of silver of the protargol and colloid for a new purpose as antihypoxants
The invention relates to medicine and, more specifically, to ophthalmology, and can be used in surgical treatment of patients with glaucoma
The invention relates to medicine, and more specifically to ophthalmology, and can be used to prepare materials in surgical treatment of myopia of high to medium to obtain scleroplastic material in surgical treatment of glaucoma for receiving antiglaucoma drainage, as well as a source of solutions of collagen in the treatment of myopia, mild and manufacturing exterior dosage forms

2-globulin cystic fluid associated with the true disease" target="_blank">

The invention relates to medicine, in particular dermatology, namely the method of obtaining2globulin cystic fluid associated with the true disease

FIELD: medicine.

SUBSTANCE: method involves applying surgical intervention and antitumor therapy. After having removed a part or the whole lung, mediastinum is opened by cutting out horseshoe-shaped or rectangular flap of mediastinal pleura and carrying out lymphodissection. Then, hemostatic sponge is placed in mediastinum. The sponge is impregnated with antitumor chemotherapeutical preparations in intraoperative mode. Pleura is sutured above the sponge. Another hemostatic sponge impregnated with cytostatic preparations in intraoperative mode is attached to visceral pleura of interlobular sulcus.

EFFECT: prolonged chemotherapeutical preparations delivery to malignant neoplasm foci or subclinical metastases.

FIELD: medicine.

SUBSTANCE: the suggested multi-purpose heterogeneous collagen matrix for implantation is being flexible-elastic mass obtained out of two collagen sources, moreover, one source is a tissue of vertebrates of one and the same class, and another source - that of an animal of another class, moreover, collagen sources are animal tissues of, for example, mammalian class and avian class, matrix consists of two phases: solid phase - as microspheres out of mammalian tissue collagen, and liquid phase - out of denaturated avian tissue collagen at the ratio of phases being (1-10) : (1-10), at microspheres size being 100-300 mcm, as for final products of biodegradation they are represented by CO2 and H2O. Matrix, additionally, contains components of physiological culture media, and, also, additives that favor the growth and differentiation of cells and tissues, antibacterial and/or antiviral components, and, also, antiaggregation preparations in their efficient quantity, for example, additionally, it contains embryonic cells of nervous tissue. Another aspect of the present innovation deals with the method to obtain the matrix due to preparing mammalian collagen solution (MCS) and denaturated avian collagen solution (ACS), moreover, it is necessary to apply 0.3 M acetic acid, at final concentration for MCS being approximately 0.5-1.5%, and for ACS - approximately 3.0-5.0%, then MCS should be treated with γ -irradiation at the dosage of 1.0 Mrad to be further homogenized to obtain microspheres. Then both MCS and ACS should be washed off with distilled water up to pH of not less than 6.0 and with phosphate buffer solution to mix washed off mammalian collagen and avian collagen at 1:1 ratio at obtaining matrix. The matrix obtained should be additionally supplemented with antibacterial and/or antiviral components, and, also, stimulating agents for tissue regeneration and antiaggregation preparations. The matrix obtained should be sterilized due to γ -irradiation at the dosage of 0.5 Mrad/1 ml. The present innovation enables to obtain new heterogeneous collagen matrix which is considered to be a multi-purpose one applied for transplantology and substitution surgery of different tissues and organs in alive body in case of tissue lesions. Moreover, it is distinguished by controlled terms of biodegradation.

EFFECT: higher efficiency of application.

13 cl, 16 ex, 4 tbl

FIELD: medicine, traumatology.

SUBSTANCE: osseous defect after filling with collapan and usage of metallofixative should be covered with absorbable collagen film that provides orientation of osseous regenerate's organization.

EFFECT: higher efficiency of therapy.

2 ex

FIELD: peptides, pharmacy.

SUBSTANCE: invention relates to low-molecular derivatives of peptides that are able to act as inhibitors in interaction between laminine and nidogen (interactions laminine/nidogen). Also, invention relates to a method for their preparing, pharmaceutical composition prepared on thereof and their using for preparing pharmaceutical agents, and for identification of inhibitors in interaction laminine/nidogen.

EFFECT: valuable properties of peptides.

5 cl, 12 dwg

FIELD: medicine, experimental medicine.

SUBSTANCE: one should introduce tripeptide Pro-Gly-Pro for laboratory animals as injections at the quantity of 0.09-1.0 mg/kg body weight, and, also, gelatin as fodder additive. The method suggested enables to suppress appetite, decrease the quantity of fodder intake that leads to decreased body weight as a result.

EFFECT: higher efficiency.

2 cl, 5 dwg, 5 ex

FIELD: medicine, dermatology, in particular treatment of trophic ulcer (TU) and long-term open septic wound (LTOSW).

SUBSTANCE: claimed method includes application of wound-healthing composition onto TU and LTOSW in the first step of wound process. Said composition contains (mass %): methyluracil 0.9-1.1; pepsin 3.4-4.4; bentaine hydrochloride 3.6-4.4; sodium chloride 9.0-11.0; and balance up to 100,0: distilled water. In the second and third phases fine cut collagen preparations in form of 3-4 mm thickness layer are applied on purified TU and LTOSW surface. Then cotton carrier freely moistened with wound-healthing composition diluted with water in ratio of 1:2 is layered onto collagen layer. Multihole microirrigator and further sterile cotton carrier are sequentially applied over abovementioned cotton carrier.

EFFECT: effective treatment due to accelerated abruption of necrotic tissues, inhibition of microbial growth, decreased risk of infective, toxic and allergic affects, and improved tissue regeneration.

2 ex, 3 cl

FIELD: medicine.

SUBSTANCE: the present innovation deals with the method to accelerate mucosal healing due to the following technique: one should apply a membrane consisted of purified collagenic material obtained out of natural collagen-containing tissue onto the part of affected mucosa to provide the chance for mucosal reconstruction in this part and, also, it deals with mucosa-regenerating preparation and application of purified collagenic material obtained out of collagen-containing natural tissue for preparing mucosa-regenerating preparation. The innovation provides more modified method that accelerates mucosal regeneration, as a whole, and, particularly, after surgical operations associated with the plasty of oral fornix.

EFFECT: higher efficiency.

12 cl, 3 dwg, 5 ex

FIELD: chemical engineering.

SUBSTANCE: method involves pretreating bone tissue of stock-farm animals, comminuting it, precipitating the end product and drying it by lyophilizing. The bone tissue is degreased with alcohol-ether mixture. Demineralization 0.5 and HCl is carried out after grinding during 20 h. Non-resolvable matrix is subjected to proteolysis in HCl of pH=2.0 in pepsin presence at 37°C during 18 h. Then it is centrifuged at 40000g. The end product is precipitated from supernatant with ammonium sulfate to 25% saturation and centrifuged at 6000g. The precipitate is lyophilized against distilled water and chromatographically purified using CM-Sephadex at pH=4.8 and dried with lyophilization.

EFFECT: low cost collagen production; high purity cosmetic preparation production.

2 dwg

FIELD: medicine, endocrinology, pharmacy.

SUBSTANCE: invention relates to a pharmaceutical composition comprising epidermal growth factor (EGF) used in treatment of wounds on skin and soft tissues of lower limb in diabetic patient. Method of treatment involves topical infiltration of EGF-containing solution into different points and by contours of tissue damaged zone to provide administration of the solution into wound in the total volume 4-20 ml and irrigation of all deep surface of wound base and edges with the indicated composition. Invention provides prevention of diabetic limb amputation, stimulation of cellular proliferation in patients with foot ulcer being especially in geriatrics.

EFFECT: valuable medicinal properties of pharmaceutical composition.

19 cl, 1 tbl, 9 ex

FIELD: medicine.

SUBSTANCE: method involves carrying out mechanical treatment of biological connective tissue and following treatment with solutions. Animal or human connective tissue is hold in solution of collagen and/or its derivatives and/or collagen processing products at 25-65°C and exposed to ionizing radiation treatment.

EFFECT: improved biocompatibility and physicochemical properties; prolonged drug action.

6 cl

FIELD: peptides, pharmacy.

SUBSTANCE: invention relates to low-molecular derivatives of peptides that are able to act as inhibitors in interaction between laminine and nidogen (interactions laminine/nidogen). Also, invention relates to a method for their preparing, pharmaceutical composition prepared on thereof and their using for preparing pharmaceutical agents, and for identification of inhibitors in interaction laminine/nidogen.

EFFECT: valuable properties of peptides.

5 cl, 12 dwg

FIELD: biotechnology, medicine.

SUBSTANCE: cells are contacted with protein containing fibronectin EDb-domen in presence of one or more chemical substances. As check experiment reaction between the same cells and abovementioned protein in absence of said substances. Expression of certain protein or presence of nucleic acid encoding the same makes it possible to select compounds bonding to fibronectin EDb-domen.

EFFECT: new biotechnological method.

1 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to low-molecular derivatives of peptides which are used for preparing a pharmaceutical agent which inhibits laminin/nidogen reaction.

EFFECT: increased effectiveness of compounds.

2 cl, 12 dwg, 2 tbl, 30 ex

FIELD: textile, paper.

SUBSTANCE: when boiling collagen, linear dimensions of leather tissue are measured before and after collagen boiling. The structure-to-structure distance is determined using difference of the sample thickness after boiling and the rated thickness of the sample before boiling, which is produced as a product of the sample thickness before boiling and a coefficient of layers number defined as a quotient from division of a lengthy sample length into the length of the sample after boiling. Invention makes it possible to realise the specified method objective.

EFFECT: method improvement.

4 ex, 3 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to medicine and concerns agents and methods based on using fibronectin domain EDA. Substance of the inventions involves using a polypeptide comprising an amino acid sequence of the fibronectin domain EDA, or its TLR4-binding fragment, or a version of specified domain; for preparing a pharmaceutical composition stimulating an antigen- specific immune response.

EFFECT: improved stimulant property.

36 cl, 3 ex, 11 dwg

FIELD: biotechnologies.

SUBSTANCE: invention refers to the area of biotechnology, namely to production of short peptides - stimulators of production of extracellular matrix protein in the skin, and can be used in the medicine. The peptides produced consist of four amino-acid residues that can be used separately or in combination in the method of stimulation of collagen production using fibroblast.

EFFECT: invention provides for effective collagenesis stimulation in fibroblast cells.

25 cl, 3 dwg, 7 tbl, 6 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: group of inventions refers to medicine. The invention aims at creating biodegraded implants of the regenerated silk fibroin Bombyx mori. A method for preparing the biodegraded composite matrix of the regenerated silk fibroin Bombyx mori involves the stages: - dissolving the regenerated fibroin in a buffer containing CaCl2, C2H5OH, H2O in molar ratio 1:2:8. That is followed by dialysis of the prepared solution to the fibroin concentration min. 20 mg/ml. The fibroin solution of the concentration min. 20 mg/ml is mixed with dimethyl sulphoxide (DMSO). Gelatin or polylysine is added to the prepared mixture. The prepared mixture is frozen and thawed with an organic solvent added; what is also presented is the use of the specified biodegraded composite matrix as a base for the biodegraded implant.

EFFECT: group of inventions enables improving the biocompatibility, increasing the adhesive properties of matrix and cell proliferation in a mammalian body.

2 cl, 3 dwg, 3 ex, 1 tbl

Up!