Recombinant granulocyte-colony stimulating factor (g - csf) without additional methionine residue at the n-end

 

(57) Abstract:

The invention relates to biotechnology, and in particular to methods specific cleavage obtained by biotechnology proteins using IgA-protease and especially the methods of production in prokaryotes recombinant proteins or polypeptides with the potential for subsequent removal of the N-terminal sequence. Recombinant granulocyte-colony stimulating factor (G - CSF) without additional methionine residue at the N-end is produced by cleavage of IgA-protease fused protein expressed in E. coli cells containing between N-terminal methionine and amino acid sequence of G - CSF site recognition IgA-protease.

The invention relates to methods specific cleavage obtained by biotechnology proteins using IgA-protease (also known as Hasami) and particularly to methods for in prokaryotes recombinant proteins or polypeptides with the potential for subsequent removal of the N-terminal sequence.

Getting protein biotechnology is performed with the use of microorganisms that are easily cultivated and allow a simple way to obtain protein. Suitable micro is reptococcus carnosus and Baker's yeast Saccharomyces cerevisiae. However, the authentic expression of foreign genes in these organisms often has drawbacks. For example, in E. coli conditions broadcast result aminoanisole residue of methionine, which have homologous proteins in most cases efficiently cleaved. However, when receiving foreign proteins that cleavage of the first methionine residue is in most cases optional. A suitable method is to obtain such proteins, first in the form of a fused protein and then splitting using a specific series-specific protease.

In addition, in contrast to the authentic proteins such fused proteins have the advantage that they escalated in the cell of the microorganism and form a dense body include ("Inclusion Bodies"), which can be easily separated from other parts of the cell and thereby to facilitate the isolation and purification of the desired protein. On the other hand, the protein carrier using methods of genetic engineering primarily merge with the actually desired protein, give merged with partner special resistance to nonspecific proteolytic cleavage; cleavage of polypeptides, which chaitali allow you to distribute desirable proteins in certain parts of the cells, from which they can be particularly easy to clean and where they are particularly stable and/or where they are accessible for test purposes. Finally, the protein carrier may also have special properties that allow effective cleaning, for example, by affinity chromatography. For many purposes of use prefer-fused proteins, which are protein-media aminocore and the desired protein at the carboxyl end. But in certain cases it may be desirable return variant or binding of the desired protein with two partners merger. It may be beneficial to also reverse the repetition of the desired protein within the merge.

To obtain the desired protein in a free form from mergers must cleavage covalently associated partners from each other. In principle, this can be achieved by chemical or biochemical (enzymatic) methods. However, in most cases, there are limitations associated with the fact that to obtain the desired protein is important that such a breakdown occurred in the sequence between the partners of a merger, i.e. in the transition region, but in no case additionally inside with the/P> Still used chemical methods for specific against a particular sequence of separation of the fused proteins are, for example, splitting a bromine cyan for the amino acid methionine inside the protein and the cleavage between amino acids Asp ! Pro in an acidic environment with the use of formic acid. But these methods are suitable only if the specific location of the cleavage of the desired protein is found only in the transition region and is not repeated a second time. However, in General, biochemical methods of splitting should be preferred to chemical methods, as the first in most cases can be performed under physiological or at least when chemically mild reaction conditions which do not harm the desired protein.

Biochemical methods of splitting slit proteins are based on the use of possible specific proteases. For example, trypsin digested following the amino acids arginine or lysine peptide bonds within proteins. Increase specificity can be achieved prior chemical modification of the amino acids Lys, resulting in specific recognition you can limit aminokislotnye connection between the amino acid arginine and any following amino acid. Overview about used still enzymatic methods for the cleavage of the fused protein was composed of F. A. O. Marston ([D. M. Glover, E.]: DNA cloning III, IRL PRESS, Oxford and Washington DC, 1987). Enzymatic methods of splitting is limited by the fact that specific point of cleavage amino acid (amino acids) can occur simultaneously in the desired protein. So for biochemical cleavage of the m protein is suitable in particular enzymes, that the splitting recognize not only amino acids, but the amino acid sequence; however, the probability that a certain sequence of amino acids in addition to finding the point of cleavage between partners merge occurs again in the very desirable protein so small, the greater the number of amino acids required for recognition and cleavage.

The list sequentially-specific proteases that are currently in use for splitting slit proteins, currently contains a factor XA. This protease cleaves specifically the sequence Ile-Glu-Gly-Arg ! X, where ! shows the point of splitting, and X denotes any amino acid. However, it appears that this protease cannot be applied univera transition region;often these substrates (so that is, fused proteins, which contain the desired protein, covalently linked to a protein carrier) or not at all broken down or hydrolyzed only in a very small degree, or only in a soluble form.

Especially important is the effective splitting of the fused protein in obtaining recombinant proteins in prokaryotes, because it requires the introduction of a DNA sequence which contains AUG as the start codon prior to starting their own DNA sequence. As a result, in prokaryotes, such as E. coli expressed recombinant protein, which contains an additional methionine residue at the N-end.

However, in many cases you receive does not contain methionine 1 recombinant protein. The receipt of such proteins from prokaryotes can be done for example through the methionine-specific peptidase that it N-terminal methionine. However, this method is associated with very high costs, because the removal can only be checked by sequence analysis of proteins. In addition, the division containing and not containing methionine of the protein because of almost identical molecular weight ausesaurine N-terminal amino acids from the fused protein. When this amino acid protein from the N - Terminus, due to the gradual elimination of ectopeptidases, preferably by laciniate may be removed until the sequence X-Pro. The sequence X-Pro otscheplaut of this product or in two stages, or in stage 1 using postprison - dipeptidyl-amino peptidases (EC 3.4.14.). This method has the disadvantage that, due to the gradual removal of amino acids from the N - Terminus of the protein should be produced not a single product, but always a mixture of products, which, along with the desired product, and contains not fully exempted final products.

Another method for enzymatic cleavage of the fused protein is known from European patent N 0020290. In this method for removal of the desired protein is used enzyme Collagenase with a specific sequence recognition.

However, it was found that Collagenase, as well as other endopeptidase, has only a small specificity (see Biochim. Biophys. Acta 271 (1972), 133-144). In addition Collagenase active only against proteins that have a specific spatial structure.

The use of the aforementioned factor Ha for removal of N-terminal chosenia has other disadvantages, namely that, in all probability, are recognized and split internal sequence of the target protein. In addition, factor XA separated from the blood serum of cattle, resulting in the need associated with high costs purification and Analytics to detect possible available pathogenicity factors or viruses.

Different types of pathogenic bacteria (for example of the genus Neisseria, particularly Neisseria gonorrhoea and Neisseria meningititis, or genus Haemophilus, particularly Haemophilus influenzae and Haemophilus aegyptious) that develop on the mucous membrane of humans, secrete proteases, split sequence close family proteases that are specific for IgAI person, and therefore, are referred to as IgA-protease or hazy. Immunoglobulin IgAI is an important component of the secretory immune response, which should protect against infections such pathogenic organisms (Review: Korfeld and Plaut, Rev, Infect. Dis. 3 (1981), 521-534). Along with this lgA-protease cleaves well as your own protein precursor in autoproteolysis. Getting IgA protease from Neisseria gonorrhoea MSll in the authentic strain of bacteria and gram-negative host cells has already been described in detail previously (patent Germany N 3622221.6).


1. Pro-Ala-Pro ! Ser-Pro

2. Pro-Pro ! Ser-Pro

3. Pro-Pro ! Ala-Pro

4. Pro-Pro ! Thr-Pro

The symbol ! denotes the point of rupture of the IgA-protease. Cloning of the sequence encoding the IgA-protease described in Pohlner and others, 1987.

The present invention was to develop an improved method for biochemical (enzymatic) cleavage of the fused proteins that obtained by the method of gene fused proteins comprising any of the partners mergers and specific sequence cleavage in the transition region, can be used as a substrate to produce useful proteins such as G - CSF, with high yield and optimal for subsequent use form, in particular without additional Met.

This task is solved by the method of gene technology by introducing the point of recognition or sequence cleavage Pro ! X-Pro in the transition region fused protein by specific cleavage of this sequence of the IgA-protease as indicated by the symbol ! the point of splitting, X denotes mainly the amino acids Ser, Thr and Ala, and particularly preferably Ser and Thr, but can refer to other amino acids.

Under the concept of "IgA-about the example, in Rev. Infekt. Dis 3 (1981) 521-534. But is also suitable recombinant IgA-protease, which are described, for example, in the patent application Germany N 3622221 Proc. Natl. Acad. Sci. USA 79 (1982) 7881-7885, Proc. Natl. Acad. Sci. USA 80 (1983) 2681-2685, Nature 325 (1987) 458-462 and EMBO Jour. 3 (1984) 1595-1601.

After cleavage of the IgA-protease aminocore protein contains the sequence X-Pro. This sequence as part of the desired protein can be advantageous, disadvantageous or minor. Best this sequence is, in General, when obtained by the method of gene technology desired protein in its natural form contains at its aminocore both the corresponding amino acids of the X-Pro. Characterized aminobenzamide X-Pro proteins that are important in biotechnology, occur in nature.

The method according to the invention, in contrast to all other known methods for cleavage of the m protein has the advantage that it was possible to apply the universal fused to proteins, which in its transition region are specified sequence cleavage and that it can be applied to the insoluble, soluble, connected to the membrane and associated with the merged cell proteins. In addition, as persons who are in microorganisms. Another advantage of the method lies in the fact that the applied splitting enzyme, the strip, you can get low cost of nutrient media non-pathogenic bacteria.

Embedding sequence cleavage for IgA in the transitional region of the fusion proteins carry out by means of gene technology. Thus, a nucleotide sequence that encodes the sequence of splitting or part of it, can be synthesized by chemical means and embed using known means of gene technology between DNA segments for protein carrier and the desired protein. Accordingly, it is possible to embed the natural sequence of nucleotides that encodes a suitable sequence cleavage or a part of it. Encoding the fusion protein gene is predominantly under the control of appropriate (mainly induced signals in the expression so that it becomes possible producing cell is fused proteins. As host cells for the production of m protein can be applied prokaryotic and eukaryotic organisms (both plant and animal) cells. Applied to the protein carrier can be any function, matter, cgchat purification of fusion proteins or their stability and much more. Preferred protein carrier explained below.

Particularly preferred application of the method according to the invention is the preparation of recombinant proteins or peptides without N - terminal methionine residue of the fused proteins or peptides with the amino acid sequence Met-Y-Pro ! X-Pro-A, where X denotes any amino acid, mainly Thr, Ala or Ser, and Y denotes one or more of any of the amino acids, which mostly, if X represents Thr or Ala, ends Pro or, if X represents Ser, ends with the sequence Pro-Ala or Pro-Pro, and A stands for any sequence of amino acids. This split-fused protein or peptide using IgA-protease and get the product of decomposition with the amino acid sequence X-Pro-A. for Example, this method for obtaining recombinant proteins from prokaryotic cells without N - terminal methionine residue includes the following stages:

(1) transformation of prokaryotic cells a gene that encodes a protein or peptide with the amino acid sequence Met-Y-Pro ! X-Pro-A, where X, Y and A have the above values,

(2) culturing the transformed cell in a suitable medium and the expression of the transformed gene,

(4) isolation of the resulting product decomposition with the amino acid sequence X-Pro-A without N-terminal methionine residue.

Thanks to the method according to the invention unexpectedly can be obtained with high yield and good specificity in one phase proteins without N-terminal methionine residue, which have N-terminal sequence X-Pro and X denotes mainly Thr, Ala or Ser.

Part of the carrier Y-fused protein refers to the amino acid sequence of at least l, predominantly to 100, especially predominantly from 1 to 50 amino acids, which ends recognizable IgA-protease sequence cleavage. If X denotes the amino acid serine,Y ends mainly the sequence Pro-Ala or Pro. If X represents Thr or Ala, Y ends with predominantly Pro, especially predominantly Arg-Pro, Pro-Arg-Pro or Ala-Pro-Arg-Pro.

In a particularly preferred embodiment, Y represents at least 5 amino acids, which ends with the sequence Pro-Ala-Pro-Arg-Pro. However, for the method according to the invention are applied all recognized IgA-protease point of cleavage.

Part of the carrier Y may contain more druganaut mainly such amino acid sequence, which at the DNA level to improve the expression of the protein Met-Y - Pro ! X-Pro-A and/or at the level of amino acids facilitate its purification from the cell.

The expression of the protein Met-Y-Pro ! X-Pro-A at the DNA level can be improved, for example, merge with fragments of the gene-galactosidase, then Y is part of the protein-galactosidase. Well-known specialist and other opportunities to increase the expression of the protein Met-Y-Pro ! X-Pro-A. Merge with other polypeptides, particularly with vysokopatogennyj (for example, poly-Lys, Arg), or connecting with certain substances with high affinity (such as streptavidin), can facilitate the purification and separation of the product of the expression (see for example European patent And 0089626, European patent 0 306 610).

Recombinant DNA encoding a fused protein, you can get well-known specialist in the field of molecular biology method. Usually the media that contains the coding sequence of the amino acid And DNA sequence, split restrictive endonucleases in the region of 51-end of this gene and re-connect with oligonucleotides that contain the desired sequence. When this oligonucleotide should contain a sequence that encodes a point is the basic mechanisms known media specialist. Suitable carrier is a carrier that provides a high expression of the recombinant DNA according to the invention. Recombinant DNA is predominantly under the control of the induced signal expression (for example , tac, lac or trp view).

The media according to the invention may be extrachromosomal (such as plasmids), and integrated (for example, the bacteriophage lambda) in the genome of the host body. Mostly the media according to the invention is a plasma. Examples of carriers suitable for expressions DNA according to the invention in prokaryotes, are commercially available pUC - and pUR - carriers.

Examples of proteins that have an N-terminal sequence X-Pro and X is Thr, Ala or Ser, and which can be obtained according to the method of the invention in one stage are human erythropoietin - chain T-cell receptor of human rights and particularly granulocyte stimulating factor human (G-CSF).

G-CSF is synthesized as lymphokine-activated monocytes, macrophages, and other cell lines. Lymphokines involved in the maturation of cells of the immune system or blood cells. They stimulate the maturation of basic cells of the bone marrow to redifferentiate the t significantly increase the population of polymorphonuclear cells within a short period of time, for G-CSF obtained wide application in the field of therapy. So G-CSF could be used, for example, after chemotherapy in cancer, which destroyed cells of the immune system. Furthermore, G-CSF could be used in transplants of bone marrow, severe burn injuries, due to weak immunity, congenital infections and leukemia.

G-CSF is a molecule secretory protein. Therefore, the primary product of translation contains N-terminal signal sequence, which when secretion is cleaved, so that the sequence of the Mature G-CSF begins with the amino acids Thr(+l)- Pro(+2) (provisions of amino acids +1 and +2). When the production of G-CSF in prokaryotes, this signal peptide is cleaved or bad, or not cleaved, so to receive G-CSF without the signal sequences from prokaryotes need to clone AUC(Met) as the initiating codon before the coding of the Mature G-CSF DNA sequence that begins at the level of protein Thr(+1)- Pro(+2). As a result, in the prokaryotes, such as E. coli, Express G-CSF, which contains methionine in the first position of the amino acid sequence.

According to the method of the invention can prog(+l)-Pro(+2).

This is due to the fact that they derived G-CSF from prokaryotes, which in position +1 and +2 amino acid sequence contains the amino acids Thr(+l)-Pro(+2) and before that, starting from position-l amino acid sequence, has the following sequence of amino acids that is recognized by the IgA-protease, which begins with Thr(+l)-Pro(+2).

In a preferred embodiment, a derivative contains the position of the-l and-2 Pro in position from -3 to-l amino acid sequence Arg-Pro-Pro in position -4 to-l amino acid sequence Pro-Arg-Pro-Pro or in position -5 to-l amino acid sequence Ala-Pro-Arg-Pro-Pro.

In a particularly preferred embodiment, a derivative contains at position -6 to-l the sequence of amino acids

< / BR>
Under G-CSF in the sense of the subject invention understand recombinant G-CSF, from prokaryotic hosts, the sequence of which is disclosed, for example, Science 232 (1986) 61, and educated him derivatives with stimulating granulocyte activity that have amino acid sequence starting with X(+1)-Pro(+2). X is Thr, Ser or Ala, particularly preferably Thr.

G-CSF-derived according to the invention n is 1)). Thus the result of a single stage hydrolysis get not containing methionine at position -1 of G-CSF, the amino acid sequence of which the N-end begins with the amino acids Thr(+1)-Pro(+2) naturally occurring G-CSF.

When the expression of G-CSF in prokaryotes are formed insoluble aggregates (refractile bodies) that are inactive. Before applying the protein, for example, for therapeutic purposes, it should be converted to its active form. When well-known specialist methods (cf. for example European patent And 0219874; European patent And 0114506; WO 84/03711) first, carry out the dissolution of the addition of denaturing means that you connect then denaturirovannaya and, if necessary, further purification stages. Processing of the protein according to the invention IgA - protease can be carried out before dissolution after dissolution, or only after denaturirovannyj. If the processing of the IgA-protease should be carried out immediately after the dissolution, before the addition of IgA-protease to separate the solvent (such as guanidine hydrochloride or urea) dialysis. However, the processing of the IgA-protease is carried out mainly after denaturirovannyj, as in this case, the outputs of the G-CSF is particularly high.

After dissolution, denaturirovannyj and splitting of the IgA-protease thus obtained product of splitting clear of mainly using ion-exchange and fractionation. Pollution thus obtained and containing no methionine in position-l G - CSF other proteins is less than 0.1%, mostly less than 10-3%.

Therefore, not containing methionine at position-l G-CSF splitting IgA-protease can be separated or clear almost quantitatively from the containing methionine fused protein.

According to the method of the invention of prokaryotes can be obtained recombinant G-CSF, which is less than 0.1%, mostly less than 10-3% contaminated with other proteins and quantitatively contains no G-CSF from prokaryotes, in which position -1 contains methionine.

The subject invention is also pharmaceutical sredstv.html together with conventional pharmaceutical agents, carriers, fillers and excipients. This drug is particularly suitable for the treatment of diseases, which should stimulate the formation of granulocytes, particularly neutrophils.

The pharmaceutical preparations according to the invention are mainly used as solutions for injection and infusion. This can be done as a result of what is available, ready for injection solution, which contains the composition according to the invention. However, you can also use pharmaceutical preparations in the form of liofilizatow. The latter are formed by means of known, suitable for the purposes of injection tools or solutions. As a medium for injection is used primarily water, which contains common in solutions for injection additives as stabilizers, agents, dissolution, buffer solutions and isotonic supplements, such as physiological sodium chloride solution. Such additives are, for example, mannitol, buffer solution tartrate or citrate, ethanol, complexing agents such as ethylenediaminetetraacetic acid and its non-toxic salts and high molecular weight polymers such as liquid polyethylene oxide for reguliruyushchee in capsules.

Finally, the present invention also includes the use of not containing methionine at position -1 of G-CSF from prokaryotes to obtain pharmaceutical preparations according to the invention.

The method according to the invention includes biotechnological produce the desired protein. Under the biotechnology mean that the desired protein or its intermediate product is produced using gentechnologie funds and other biotechnological methods (for example, fermentation of microorganisms).

The desired protein is an intermediate product or a final product, which can find application for example in medicine, research, environmental or industrial processes or products.

The method according to the invention implies that the desired protein is formed from the fused protein (denoted also as a fusion protein), and the fused protein or fusion protein is composed of several covalently linked with each other partners merger. At least, one of the partners of a merger is desirable protein. The sequence of the partners of the merger and the extent of their occurrence in the fused protein any; ar is Aina.

The protein carrier or the part of the carrier is used to give the desired protein in the form of a fused protein of special features. Such properties can be expressed, for example, increased resistance fused proteins, which is based on structural features and thus significantly higher resistance in contrast to cellular proteases or on the transfer of the fused protein into the environment with little proteolytic activity. In addition, the protein carrier may contain properties that provide effective cleaning of fused proteins. This includes for example the binding of certain ligands to the method of affinity chromatography, the deposition of fused proteins in the discharge with low cost besieged bodies and transfer the proteins in an easily accessible place.

The area inside the fused protein in which the components (proteins - native and desirable protein) fused protein are connected to each other, referred to as transitional areas.

Each transition region may be defined by one or more amino acid sequence. Amino acid sequence (like all other follower

Within the method of the invention all of the amino acid sequence in the transition areas, which should be split IgA - protease, contain a sequence of splitting or sequence recognition by the method of the invention.

The place between the two amino acids amino acid sequence, which is the splitting slit protein or m protein, called the point of cleavage.

The method according to the invention includes the enzymatic cleavage of the fused protein in transitional areas IgA-protease. Under the IgA-protease or igati within the method of the invention understand IgA-protease strain of Neisseria gonorrhoeae MS 11 and all other enzymes related with this protease at the level of nucleotide and the process of its formation. Included also especially IgA proteases of the genus Neisseria and Haemophilus.

The microorganism E. coli ED 8654 was deposited under the number DSM 2102 in the German Center of microorganisms, Grisebachstrasse 8,3400 göttingen.

Example 1. Construction of plasmids for expression not containing methionine G-CSF.

The design is produced when changing media expression pPZ07-mgllac (WO. 88/09373). For this medium of expression pPZ07 - mgllac digested with Nco I and what I IgA at the level of DNA obtained through the following oligonucleotides.

Oligonucleotide A:

5' AAT TCG GAG GAA AAA TTA ATG ACA CCA CTG CGA CCT CCT ACA

CCA CTG GGC CCT G 31< / BR>
Oligonucleotide B:

5' GAT AGG CC GCC CAG TGG TGT AGG AGG TCG CAG TGG TGT CAT

TAA TTT TTC CTC CGA ATT 3'

Both of the oligonucleotide is added in equimolar quantities and injected approximately 100-fold excess in split, as described above, the media pPZ07-mgllac. After re-cross-linking transform in the usual way competent cells of E. coli K12. Known methods distinguish DNA from the cells and break down ApaI and Bam HI. Fragment G-CSF length of approximately 520 p. O. distinguish in the application of restrictive endonucleases ApaI and BamHI from G-CSF - sequence (Science 232 (1986), 61-65). This fragment is injected in split as well ApaI and BamHI media.

Example 2. In addition to sequence recognition IgAI fused protein may contain additional peptides, providing easier cleaning, for example, streptavidin. For this purpose, the streptavidin gene (WO 89/03422) clone in the correct translational lattice sequence before detection of IgA-protease.

Example 3. Using a described in example 1 plasmids transform E. coli K12 cells (ED 8654, DSM 2102), transformants are selected on medium containing ampicillin and characterize the plasma will tivirus in the full environment. This medium contains per 1 liter of 16 g of bacteriophora (Difco), 10 g of yeast extract (Difco) and 5 r sodium chloride. Cells are left to grow to OD 546=2.0 and then induce 10-3mol/l IPTG. After another 4 h, the cells collected by centrifugation, dissolved using lysozyme/EDTA (ethylenediaminetetraacetic acid) and secrete G-CSF as an incorporated body (IB s, cf. the European patent A 0219874).

Denaturirovannaya or denaturirovannaya allocated insoluble particles merge G-CSF is carried out, as described in European patent A-0 219 874. Denaturirovannaya produce dialysis about 6 mol/l guanidine hydrochloride. Here you can select the already divisible part and after dialysis about 5 mmol/l buffer solution of potassium phosphate pH 7 to apply for cleavage with IgA-protease (example 4).

Alternatively, after denaturirovannyj in guanidine hydrochloride perform dialysis about 5 mmol/l buffer solution of potassium phosphate pH 7, containing 1 mmol/l GSH and 3 mmol/l GSSG. After denaturirovannyj it also happens dialysis compared to 3 mmol/l buffer solution of potassium phosphate with a pH of 7.

Example 4. The cleavage of the fused protein IgA1-protease to obtain native G-CSF without metio is whether denatured in example 3, G-CSF add 2-5 g IgA-protease and incubated for 30 min at room temperature. Through various ion-exchange column, such as Mono-Q or Mono-S, you can select do not contain methionine G-CSF. The protein sequence of aminocore shows that the purified G-CSF begins with the correct amino acid sequence Thr(+l)-Pro(+2).

Example 9. Purification of active hazy from the supernatant fluid of the culture of recombinant E. coli cells.

Recombinant E. coli SOO cells that contain plasmid pEX1070 patent Germany 36 22 221.6) with a modified genome of the IgA-protease, isolated the active strip in the supernatant of the culture. Filtration through the membrane, it was possible to accumulate the enzyme in the supernatant of culture and then precipitated from solution by ammonium sulfate (0,42 g/ml). After centrifugation the precipitate was dissolved in Biorex-buffer solution (50 mmol potassium phosphate, pH 7.0, 8.6% of glycerol) (l ml of buffer solution to 1 liter of supernatant of culture), balanced dialysis relative to 2 l of buffer solution and then subjected to cation exchange chromatography (Biorex 70). Related IgA-protease at one stage was suirable laundering buffer solution (500 mmol potassium phosphate, pH 7.0 to 8.6% glycerol) with speakers and fractionally. Then containing IgA-protease fractions were analyzed for elektrochemie hazy in pure form has been gelfiltration with Sephacryl HR300 in Biorex-buffer solution, followed by subsequent cation exchange chromatography (see above). Activity higazy was examined by incubation with 1 IgA - antibodies and separation of the resulting cleavage products in SDS - polyacrylamide gel.

Example 10. Construction of plasmids for expression not containing methionine interleukin 3.

The design is performed with the use of media expression pPZ07-mglac (WO. 88/09373). For this medium of expression pPZ07-mgllac digested using NCOI and protruding ends are removed with Mung bean - nuclease. Then further decompose the carrier Bam H1. Optimized aminobenzene region fused protein on the DNA level through the following oligonucletide.

Primary 1A:

5' AATTCGGAGGAAAAATTAATGAAAGCCAAACGTTTTAAAAAACATGT

CGACCATGGAG 3'

Primary 1B:

5' GGATCCTCCATGGTCGACATGTTTTTTAAAACGTTTGGCTTTCATTAA

TTTTTCCTCCGAATT 3'

Both of the oligonucleotide add together in equimolar quantities and injected approximately 100-fold excess in split, as described above, the media pPZ07-mgllac. After ligation done by competent cells of E. coli K12 transform. Known methods are separated from the cells DNA, disintegrated with Sa1I/Bam H1 and tie with a DNA fragment that contains coderay region of interleukin-3 with the recognition area for IgA-protease at the DNA level are carried out through known techniques PCR, and conduct PCR reaction with the DNA of interleukin 3 and with the following primary oligonucleotides.

Primary 2A:

5'AAGCTTGTCGACCCACGTCCACCAGCTCCCATGACCCAGACAACGCCC 3'

Primary 2B:

5'TTCGTTGGATCCCTAAAAGATCGCGAGGCTCAAAGT 3'

The resulting PCR fragment is additionally cut by enzymes Sal 1 and Bam H1, after which it can be inserted directly in the above-described carrier DNA and bind covalently with ligase.

After transformation of the recombinant DNA of the appropriate host, such as E. coli K12 C600, it is possible to synthesize Il 3 in E. coli in the form of the RB ' s and then to select. As described for G-CSF, perform denaturing and denaturirovannaya protein and break down denaturirovannyj protein using IgA-protease. Thus obtained do not contain methionine Il 3 after further stages of purification can be used for therapy.

Example 11. Construction of plasmids for expression not containing methionine interleukin 2.

Designing can be done with the use of media expression pPZ07-mgllac (W088/09373), which after switching on the primary 1A and 1B oligonucleotides as described in example 10, were digested with Sal1/Bam H1. Getting the coding region of the interleukin 2 with the recognition area lgA-protease on olnoshemi FOR and 3B, which encode the recognition area for IgA-protease.

Primary 3A:

5'AAGCTTGTCGACCCACGTCCACCAGCACCTACTTCAAGTTCTACAAAG 3'

Primary POLLUTANTS:

5'TTCGTTGGATCCTCAAGTTAGTGTTGAGATGATGCTTT 3'

Thus obtained PCR fragment additionally cut by enzymes Sal1 and Bam H1, then it can directly be inserted into the above-described carrier DNA. Further occurs as described for IL 3. In the previous example, was described as an appropriate use of point of recognition IgA-protease and the subsequent way you can get not containing methionine therapeutic proteins that begin with the series of acids Ala-Pro. Other proteins that are similar to the above examples can be obtained without methionine, namely in the application of oligonucleotides that contain a recognition area for IgA - protease and the region, which similarly corresponds to the 5' or 3' end of the published sequence and can be obtained via PCR amplification. Here are some other relevant therapeutic proteins in Mature naturally occurring form begin with AIa-Pro and therefore can be obtained similarly by the method of the invention:

Cathepsin L (EC 3.4.22.15), Mason, R. W. et al. Biochem. J. 240,373-377,68, 1988.

Osteonectin Fisher, L. W. et al. J. Biol. Chem. 262, 9702-9708, 1987.

Type IV collagenase, Collier, I. E., et al., J. Biol. Chem. 263, 6579-6587, 1988.

Next way to obtain proteins, which in the Mature form begin a sequence of amino acids Ser, Pro. As an example, it should be called:

Alpha-1 antitripsin, Hill, R. E. et al., Nature 311, 175-177, 1984.

Atrial natriuretic factor, Kambayashi, Y. et al., FEBS Lett. 259, 341-345, 1990.

Other examples for proteins, which in its Mature form begin with Thr-Pro and can be therapeutic, are for example:

Complement factor B, Campell.R.D. et al., Proc.Nat.Acad.Sci. 80, 4464-4468, 1983.

Apolipoprotein A, Eaton, D. L. et al., Proc. Nat. Acad. Sci. 84, 3224-3228. 1987.

Recombinant granulocyte-colony stimulating factor (G-CSF), having N-terminal sequence Thr - Pro and essentially free of form G-CSF with methionine at N-end, obtained by splitting IgA-protease fused protein expressed in E. coli cells containing between N-terminal methionine and amino acid sequence of G-CSF site recognition IgA-protease.

 

Same patents:

The invention relates to biotechnology, in particular genetic engineering, and is designed in vitro recombinant plasmid DNA containing the synthetic gene for granulocyte-macrophage colony-stimulating factor, human (GM-CSF), tandem promoters (ptrpx2) tryptophan operon of E. coli and synthetic sites of translation initiation, contributing to the efficient biosynthesis of the polypeptide with the biological activity of GM-CSF, and Escherichia coli strain producer of this polypeptide

FIELD: genetic engineering, in particular production of human granulocyte colony-stimulating factor.

SUBSTANCE: Recombinant plasmid DNA pES3-7 with molecular weight of 3.63 MDa (5907 b.p.) is constructed. Said DNA consists DNA Ndel/Notl-fragment containing sequence of recombinant G-CSF artificial gene, β-lactamase gene; and plasmid pET22b(+) DNA Ndel/Notl-fragment containing promoter and terminator of T-RNA-polymerase transcription, amplifier of 17 phage 10 gene translation. Plasmid pES3-7 contains as genetic marker β-lactamase gene which determines resistance of E.coli cells transformed with plasmid pES3-7 to ampicillin, and unique restriction endonuclease recognition sites existing on the next distance to the right from Ndel-site: Xbal - 38 b.p.; Hpal - 1332 b.p.; Pstl - 4065 b.p.; Pvul - 4190 b.p.; Xhol - 5363 b.p. Obtained plasmid is used in transformation of Escherichia coli cells to produce strain E.coli BL21(DE3)/pES3-7 as subproducer of recombinant G-CSF. Method of present invention makes in possible to produce recombinant G-CSF with high yield (20-30 % based on total cell protein content).

EFFECT: simplified method for production of recombinant G-CSF with high yield.

2 cl, 2 dwg, 2 ex

FIELD: biotechnology, microbiology, genetic engineering.

SUBSTANCE: invention describes construction of recombinant plasmid DNA pFGM17 encoding constitutive synthesis of polypeptide of human granulocytic-macrophagal colony-stimulating factor (GM-CSF) and consisting of Kpn I/Eco RI-fragment of plasmid pSPF1 DNA and artificial DNA sequence encoding signal peptide of the protein Caf1 from Yersinia pestis, and also Kpn I/Eco RI-fragment of intermediate plasmid pSK-GM comprising the synthetic human gene GM-CSF. Escherichia coli cells are transformed with plasmid DNA pFGM17 and strain E. coli BL21(DE3)/pFGM17 is prepared that is a producer of human polypeptide GM-CSF. Invention provides enhancing technological effectiveness and economy of process for preparing recombinant FM-CSF due to excluding the induction stage in biosynthesis process and in simultaneous increasing the yield of the end product by 2 times. Invention can be used for preparing human granulocytic-macrophagal colony-stimulating factor.

EFFECT: valuable properties of plasmid DNA and microorganism strain.

2 cl, 4 dwg, 4 ex

FIELD: molecular biology.

SUBSTANCE: invention relates to isolated DNA fragment encoding horse GM-CSF, and isolated horse GM-CSF protein. Also disclosed are vectors and various compositions containing thereof. GM-CSF is useful as adjuvant for horse vaccination as well as non-specific immunity stimulator in veterinary.

EFFECT: new compositions for gorse vaccination.

18 cl, 2 dwg, 1 tbl, 7 ex

FIELD: medicine, endocrinology, pharmacy.

SUBSTANCE: invention proposes an agent eliciting antidiabetic activity. Agent represents nonglycosylated recombinant human granulocyte colony-stimulating factor. It differs from native preparation by absence of glycosyl group and the presence of additional methionine residue by its N-end. Effect of agent is associated with mobilization and migration of bone marrow mesenchymal stem cells, homing into pancreas. This results to reparation of insulin-producing activity of organ and normalization of the peripheral blood glucose level after monotherapy with recombinant human granulocyte colony-stimulating factor.

EFFECT: valuable medicinal property of agent.

3 tbl, 2 dwg, 1 ex

FIELD: gene engineering.

SUBSTANCE: invention can be used for production of recombinant polypeptide of human granulocyte colony-stimulating factor. Recombinant plasmid DNA is constructed in vitro. It includes synthetic gene of human granulocyte colony-stimulating factor, strong constitutive promoter A3 from the early stage of bacteriophage T7 and synthetic section - translation enhancer (TREN) of gene 10 in bacteriophage T7. This DNA in combination with high copy number of plasmid and optimisation of cultivation conditions ensures constitutive biosynthesis of target protein in transformed by this DNA race of Escherichia coli SGK25/pA3GF with high yield.

EFFECT: constitutive biosynthesis of target protein in cells; high yield.

2 cl, 4 dwg, 7 ex

FIELD: biotechnologies.

SUBSTANCE: invention relates to field of biotechnology, namely, to obtaining genetically modified cell lines and can be applied in medicine for immunotherapy and immuno-prophylaxis in patients with malignant neoplasms. By means of recombinant method line of cells of human melanoma KG is obtained, which secretes recombinant granulocytic-macrofagal colony-stimulating human factor. Obtained line is deposited with Specialised cell culture collection of vertebrates of Russian cell culture collection under number RCCC ("П") 699"Д".

EFFECT: line of human melanoma cells KG possesses stable cultural, morphological and immunological characteristics and possesses ability to secrete recombinant human GM-CSF, remaining after cell inactivation with ionising irradiation.

FIELD: medicine.

SUBSTANCE: imiquimod or resiquimod is injected locally to a mammal over 12-26 hours after injection of nucleotide sequences encoding granulocyte-macrophage colony-stimulating factor and antigen peptide or protein.

EFFECT: significant amplification of immune response of mammal to antigen.

18 cl, 23 dwg, 1 tbl, 1 ex

FIELD: chemistry.

SUBSTANCE: disclosed is a method of producing, separating and purifying the human granulocyte colony stimulating factor (hG-CSF). Cells of a recombinant producer strain are obtained and the culture fluid is then concentrated. Bacterial cells are broken down while separating inclusion bodies via double treatment with high pressure. Protein impurities are removed. The inclusion bodies are dissolved and protein is recovered. Protein renaturation is carried out for 70-90 hours while diluting the protein solution to 400 ml. The obtained solution is deposited on an anion-exchange chromatographic column with diameter of 300 mm with linear rate of deposition of 600-1000 ml/min. The hG-CSF is then concentrated successively on chromatographic columns with anion-exchange or cation-exchange sorbents. The hG-CSF is then purified on a cation exchanger in fraction recycling conditions and stabilised by dialysis.

EFFECT: method enables to obtain, in one cycle, a stable preparation of hG-CSF in amount of 15-20 g with high homogeneity on HPLC and high hemostimulating activity.

5 cl, 1 dwg, 2 ex

FIELD: chemistry.

SUBSTANCE: invention relates to genetic engineering, specifically to creation of fibroblast growth factor receptor (FGFR) muteins, and can be used in medicine. The polypeptide of the FGFR4 receptor extracellular domain (ECD) acidic region mutein is an FGFR4 ECD chimera or a FGFR4 long acid box version and has more acid residues in the D1-D2 linker region than the wild-type FGFR4 ECD. The muteins may include a point mutation that inhibits glycosylation. The mutein is used to treat a disease associated with one or more FGFR ligands, e.g., proliferative diseases, including various types of cancer, angiogenic disorders and macular degeneration.

EFFECT: invention enables to obtain an FGFR4 ECD acidic region mutein, having low capacity to bind with tissue, by increasing the number of amino acid residues within the D1-D2 linker region.

32 cl, 22 dwg, 11 tbl, 18 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, particularly to genetically engineered production of human proteins, and may be used for preparing human epidermal growth factor (hEGF) in bacterial cells in the form of glutathione-3-transferase fusion protein. What is constructed is the recombinant DNA coding GST-hEGF fusion protein which consists of an amino acid sequence of glutathione-S-transferase and an amino acid sequence of human epidermal growth factor divided by a cleavage site by enterokinase, and characterised by the nucleotide sequence SEQ ID NO:1. The KpnI/XhoI fragment of the vector pET41 and the above recombinant DNA are used to create the recombinant plasmid pAS007 for expression of GST-hEGF fusion protein in E.coli cells.

EFFECT: invention enables reaching high GST-hEGF expression levels in Ecoli cells.

2 cl, 3 dwg, 1 tbl, 5 ex

Up!