Recombinant plasmid dna r 280 gm encoding a polypeptide with properties granulocyte-macrophage colony-stimulating factor human. the strain escherichia coli sg20050/p 280 gm - producer of the polypeptide with properties granulocyte-macrophage colony-stimulating factor human

 

(57) Abstract:

The use of biotechnology, in particular genetic engineering. The essence of the invention: a new recombinant plasmid p280 GM containing a synthetic gene for granulocyte-macrophage colony-stimulating factor (GM-CSF), determining the constitutive synthesis of the polypeptide with properties of GM-CSF human and E. coli SG 20050/p280GM providing the level of expression of GM-CSF, about 15% of the total cellular protein at a density of 109cells/ml, which is about 20-30 mg per one liter of this cell suspension. 2 C. p. F.-ly, 3 ill.

The invention relates to biotechnology, in particular genetic engineering, and is designed in vitro recombinant plasmid DNA containing the synthetic gene for granulocyte-macrophage colony-stimulating factor, human (GM-CSF), tandem promoters (ptrpx2) tryptophan operon of E. coli and synthetic sites of translation initiation, contributing to the efficient biosynthesis of the polypeptide with the biological activity of GM-CSF, and Escherichia coli strain producer of this polypeptide.

GM-CSF lipoprotein, Mature form of which is formed by useplease are T-lymphocytes, endothelial cells and fibroblasts. GM-CSF stimulates in vitro proliferation and differentiation of stem cells to form colonies neutrophilic and eosinophilic leukocytes and macrophages. He is also involved in many other biological and immunological functions of the body, such as a change in morphology of effector cells, their mobility, the cytotoxic activity and phagocytosis [1]

The ability of GM-CSF to stimulate the growth of granulocytes and macrophages makes possible its clinical use to reduce the side effects of the beam - and chemotherapy, in the treatment of side effects in bone marrow transplantation.

Known methods for producing GM-CSF person, based on the use of placenta extract or the culture fluid cell lines - superproducers of GM-CSF [2, 3] as well as gene expression of GM-CSF in COS-cells [4] the Disadvantage of these approaches is the very low yield of the target product and, as a consequence, the high cost of medications GM-CSF. So much more promising is the method of receiving GM-CSF microbiological synthesis, which provides the ability to obtain the target product with a significantly higher yield of crane for bacterial expression of variants of the structural gene, as well as regulatory elements that control its expression.

Known recombinant plasmid pGMtrp [5] contains a synthetic gene that encodes a polypeptide with properties of GM-CSF of human rights and expressed under the control of the promoter of tryptophan operon of E. coli. E. coli cells SG20050 containing this plasmid provides the level of synthesis of the target product, does not exceed 5-7% of the total protein of the cell, which is not enough to obtain industrial producer strain.

Known recombinant plasmid in which the DNA copy of the gene GM-CSF is under the control of inducible temperature of phage promoter [6] the Level of expression of GM-CSF up to 7-10% of the total protein of the cells, and the presence of additional amino acid residue methionine at the 5'end of the recombinant polypeptide does not affect its biological properties. According to the principle of design, technical essence and the achieved result of this plasmid is closest to the proposed and selected as a prototype. A significant disadvantage of the prototype is the use of inducible promoter, which reduces the adaptability of the process of obtaining recombinant product.

The task of developing the framework of E. coli.

The task was solved by designing a new recombinant plasmids p280GM that encodes a constitutive synthesis of GM-CSF, and E. coli strain SG20050/p280GM providing the level of expression of GM-CSF, about 15% of the total cellular protein.

Recombinant plasmid DNA p280GM characterized by the following features:

encodes the amino acid sequence of the Mature GM-CSF person;

has a molecular weight of 2.7 MD (3966, etc., O.);

consists of:

> PST /BamHI DNA fragment of the plasmid pDS280 (1083 p. O.), which contains part of the gene of b-lactamase and tandem promoters tryptophan operon of E. coli;

NcoI/ > PST fragment of plasmid pGMtrp containing part of the synthetic gene GM-CSF encoding the polypeptide (13-127) Mature GM-CSF person (2834, etc., O.), part of the gene of b-lactamase and the transcription terminator of phage l;

synthetic deoxyoligonucleotide duplex, 5'-GATCAATTCTATGGCACCAGCACGATCTCCCTCTCCTTCTACTCAAC - 3' 3'- TTAAGATACCGTGGTCGTGCTAGAGGGAGAGGAAGATGAGTTGGTAC - 5', which contains the ATG codon and encodes a polypeptide (1-12) the Mature GM-CSF person.

contains:

synthetic gene GM-CSF person;

as a genetic marker gene b-lactamase determining the stability of the transformed plasmid p280GM of E. coli cells to panic the following distances to the right of the EcoRI site (279 p. O.)- BamHI 454 nucleotide; > PST 2938 nucleotides.

A significant difference plasmid constructions is that using deoxyoligonucleotide adaptor replaced 12 5'-end of gene triplets GM-CSF. This substitution does not violate the encoded them amino acid sequence, but optimizes the secondary structure of mRNA, which leads to a considerable increase in the level of synthesis of the target product.

To obtain a bacterial strain-producer of the polypeptide with the biological activity of GM-CSF person competent E. coli cells SG20050 transform skonstruiruem the plasmid p280GM.

Thus obtained E. coli strain SG20050/p280GM characterized by the following features:

Morphological features. Cells small? thickened rod-shaped, gram-negative, risperadone.

Cultural characteristics. Cells grow well on simple nutrient media. During growth on agar "Difco" colonies are round, smooth, adpressed, muddy, shiny grey, smooth edge. With the growth in liquid medium (minimal medium with glucose or LB-broth) intensive form a smooth suspension.

Physical and biological characteristics. Cells grow at temperatures from 4 to 40oC at the optimum pH from 6.8 inania in the form of peptone, tryptone, yeast extract, amino acids, etc. as a source of carbon use amino acids, glycerol, carbohydrates.

Resistance to antibiotics. Cells are resistant to ampicillin (300 mg/ml), due to the presence of plasmids and to tetracycline (50 µg/ml), due to the presence of the transposon.

Significant differences in the strain of E. coli SG20050/280GM is that it causes constitutive synthesis of the polypeptide with properties of GM-CSF person with the expression level of about 15% of the total cellular protein, which is more than 2 times that of the prototype.

The resulting strain deposited at the all-Union collection of industrial microorganisms at the Institute of genetics at number VKPM B-6613.

In Fig. 1 shows a diagram and the physical map of the recombinant plasmid P280GM.1-allocation of fragments and ligation of DNA ligase of phage T4 in the presence of deoxyoligonucleotide duplex. 2 transformation of competent E. coli cells; Fig. 2 primary structure EcoRI BamHI DNA fragment p280GM containing the synthetic gene GM-CSF, and encoded them with the amino acid sequence. Underlined with a dotted underscore nucleotide substitutions in the structural part of the gene GM-CSF, about the; is a of Fig. 3 electrophoregram lysates of E. coli cells SG20050/pGMtrp (lane 1), E. coli SG20050/p280GM (lane 2), E. coli SG20050 (lane 3) 12% SDS page.

Example 1. Chemical synthesis of oligonucleotides.

The synthesis of oligonucleotides perform solid-phase phosphoramidite method on a DNA synthesizer System 1 (Beckman) with increasing oligonucleotide chain in the direction from the 3'end to the 5'-end using secure phosphamidon - 5-dimethoxytrityl-N-acyl-2-deoxynucleoside-3-O-(methoxybenzophenone)-tactivemovie tetrazolo. The synthesis is carried out in the scale of 0.5-0.7 µm. Use synthetic cycle, described in [8] After synthesis of the protective group was removed by consecutive treatment with thiophenolate of triethylamine and concentrated ammonia. When this occurs the separation of the oligonucleotide from the media. 5'-Dimethoxytrityl group is removed by acid treatment and oligonucleotide purified by electrophoresis in 20% SDS page containing 7M urea. Output 1-5 O. E.

Example 2. Construction of recombinant plasmid DNA p280GM.

Cells of E. coli bacteria G600 containing plasmid DNA pDS280 [7] grown at 37oC in LB-broth containing 100 μg/ml ampicillin, until the stationary phase. Then plasmid DNA videla is containing a series of synthetic gene GM-CSF [5] Obtained the preparations of plasmid DNA used to construct the plasmids p280GM. To this end, 10 μg of plasmid DNA pDS280 and pGMtrp incubated with a mixture of restriction endonucleases BamHI and > PST and NcoI and > PST (10 units each), respectively, in 30 μl of buffer R containing 20 mm Tris-HCl, pH 7.5, 50 mm NaCl,10 mm MgCl2, 7 mm mercaptoethanol, for 1 h at 37oC. After incubation the reaction is stopped twice by extraction with a mixture of fenfluramine (1:1) and the DNA precipitated by 70% ethanol. Analysis of the completeness of hydrolysis and isolation of BamHI/ > PST fragment of the plasmid DNA pDS280 (1028 p. O.) (fragment 1) and NcoI/ > PST fragment of the plasmid DNA pGMtrp (2834 p. O.) (fragment 2) is administered by electrophoresis in 1% gel low-melting agarose. Next, fragment 1 (1 µg) were combined in the presence of duplex: 5'-GATCAATTCTATGGCACCAGCACGATCTCCCTCTCCTTCTACTCAAC - 3' 3'- TTAAGATACCGTGGTCGTGCTAGAGGGAGAGGAAGATGAGTTGGTAC - 5' fragment 2 (0.4 µ g) using 30 units of T4 DNA ligase in 50 μl of buffer L for 6 h at 15oC and the reaction mixture was used to transform competent cells of E. coli C600. Transformants are plated on agar medium containing ampicillin (100 μg/ml) and the thus obtained single colonies grown at 37oC in LB-broth containing 100 μg/ml ampicillin, until the stationary phase. Then plasmid DNA isolated in accordance with the procedure described in [9] and analyzed by indanol is confirm a direct determination of the nucleotide sequence of the DNA in the area of building using a modified method of Maxima-Gilbert [10]

Example 3. Obtaining strain-producer of the polypeptide with properties of GM-CSF person.

The plasmid p280GM transform competent cells of E. coli SG20050 and get producing strains polypeptide with properties of GM-CSF person.

Example 4. Immunoblot analysis.

E. coli cells SG20050 and E. coli SG20050/p280GM grown at 37oC in 20 ml of LB-broth for 20 h on a rocking chair when the rotation speed of 120 rpm, select a sample volume of 2 ml and the cells centrifuged 10 min at 10,000 rpm Cells suspended in 100 μl of buffer containing 125 mm Tris-NCl, pH of 6.8, 20% glycerol, 3% SDS, 3% mercaptoethanol, of 0.005% bromophenol blue, heated for 10 min in a boiling water bath and cooled in ice. 10 ál of the samples subjected to electrophoresis in a 12.5% SDS-PAG. After electrophoresis, the proteins transferred to nitrocellulose filters (Schleicher @ Schuel HAWP 293 23 HA of 0.45 m) using a device for electro-blot analysis. After transfer, the filter is incubated overnight in PBS buffer (10 mm califofnia buffer, pH of 7.2, 150 mm NaCl) containing 3% (weight concentration) BSA at 4oC. After incubation in BSA solution, the filters are incubated for 2-3 h with specific antibodies, diluted with PBS to a concentration of 5 μg/ml After incubation, the filters carefully probivautsa VECTOR-BIOPRODUCT, Koltsovo, Novosibirsk region), incubated for at least 1 h at room temperature. For the color filter 50 mg 4-chloro-1-naphthol, dissolved in 1 ml of ethanol, diluted 1:100 PBS and add 30% hydrogen peroxide to a concentration of 0,006% After the appearance of staining the filter was washed with PBS, dried and stored in the dark. According to the Western blot analysis of a single polypeptide that reacts with antibodies to human GM-CSF (SIGMA, USA), is a polypeptide with a molecular weight of about 16 KD, which is determined by plasmid p280GM.

Example 5. Determination of biological activity.

E. coli cells SG20050/p280GM grown as in example 4. Cells are suspended in 20 ml buffer containing 10% sucrose; 0.1 M Tris-HCl, pH 7.5; 5 mm Na2EDTA, and destroy the ultrasound on installing Soniprep 150 (MSE). The resulting lysate is sterilized by ultrafiltration through a filter of 0.45 mm CA/CN (SIGMA, USA) and the activity of GM-CSF was determined using the method of cloning gemopoeticheskoi predecessors in semi-solid agar cultures [6] mononuclear cells obtained from blood gematologichesky healthy donors separation in gradient density ficol - urografin (SIGMA, USA). Cells at a concentration of 5105well cultivated in medium Mac-Koya 5A (NGOs "VECTOR", Russia) in the tablet is t the number of colonies is performed on the 7th day.

According to determine the biological activity of the lysate of E. coli cells SG20050/p280GM stimulates the formation of colonies of cells - the precursors of macrophages and granulocytes; spontaneous colony (adding lysates of E. coli cells SG20050) does not occur.

Example 6. Determination of productivity of E. coli strain producer of the polypeptide with properties of GM-CSF person.

E. coli cells SG20050/p280GM grown as in example 4. The content of recombinant GM-CSF defined relative to total cellular protein.

Cells suspended 200 μl of a buffer containing 125 mm Tris-HCl, pH to 6.8; 20% glycerol; 3% SDS; 3% mercaptoethanol; of 0.005% bromophenol blue, heated for 10 min in a boiling water bath and cooled in ice. Samples 2, 5 and 10 ál subjected to electrophoresis in 12% SDS-PAG. After electrophoresis the gel was washed with 10% solution of trichloroacetic acid and stain using Kumasi R-250. After washing the excess dye gel is scanned at 550 nm using a laser scanner UltroScan XL (LKB, Sweden).

According to the scanning of recombinant GM-CSF is 15-20% of the total protein of E. coli.

Example 7. Isolation and characterization of the protein synthesized in the cells of E. coli strain producer of polypeptide-broth as described above in example 4, biomass is harvested by centrifugation for 15 min at 6000 rpm, the cell sediment was washed with 200 ml of buffer containing 10% sucrose; 0.1 M Tris-HCl, pH 7.5; 5 mM Na2EDTA and 0.5 mM DTT, resuspended in 20 ml of the same buffer and destroy ultrasound using an ultrasonic installation Soniprep 150 (MSE). The resulting lysate clarify by centrifugation for 30 min at 10000 rpm and the precipitate washed twice with 30 ml of a solution of 2 M urea in PBS buffer containing 150 mM NaCl, 20 mM potassium phosphate, pH 7.5, 5 mM Na2EDTA, dissolved in 10 ml of 4 M urea in PBS buffer. Any insoluble particles are removed by centrifugation for 30 min at 20000 rpm According to electrophoresis in 12% SDS page the purity of the drug GM-CSF is 60%

A solution of GM-CSF chromatographic on a column with broad porous reversed-phase media Policy ODS-300 [11] in the gradient mixture of acetonitrile, isopropanol and water (3:1:1) at a rate of 1 ml/min with detection of the elution profile at 220 nm. The protein peak containing data electrophoresis homogeneous GM-CSF, collected and used for analysis of amino acid composition, N-terminal analysis by the method described in [11] the Drug GM-CSF stored at -70oC. This method of selection can be obtained from 0.5 l culture of E. coli cells SG20050/p280GM at a density of 109

Thus, the claimed technical solution allows to obtain a polypeptide with protein structure identical to the structure and properties of natural GM-CSF person; the level of biosynthesis of GM-CSF is about 15% of the total cellular protein of E. coli due to the improvement of the secondary structure of a polycistronic mRNA containing the synthetic gene GM-CSF.

Sources of information

1. Clark S. K. and R. Kamen// Sceince, 1987, v.236, N. 4806, pp.1229-1237.

2. Burgess A. V. Wilson, E. M. A. and D. Metcalf// Blood, 1979, v.54, p.614.

3. J. C. Gasson Weishard R. H. Kaufman, S. E. Clark, S. G. Wong, G. C. Gold D. W. // Science, 1984, v.226, p.1339.

4. Wong G. G. J. Witek S. Temple, P. A. Wilkens K. M. Leary A. C. Luxenberg, D. P. Jones, S. S. Brown E. L. Kay R. M. Orr E. C. Shoemarker C. Kaufman R. J. Hewick, R. M. Wang, E. A. Clark, S. G.// Science, 1985, v.228, p.819.

5. Gileva I. P. Bondar T. S. Blinova N. N. Khaldoyanidi S. K. Kravchenko centuries Officers Century. And. Hawks S. I. Korobko Century,// Reports of the Russian Academy of Sciences, 1994, T. 336, No. 2, S. 254-256.

6. Burgess A. W. Begly C. G. Jonson G. R. Lopez, A. F. Williamson D. J. Mermoid J. J. Simpson, R. J. A. Schmitz DeLammarter J. F.// Blood, 1987, v.69, No. 1, p. 43-51.

7. Kravchenko Centuries Gileva I. P. The Shamin Centuries Likhoshvai Century A. Dobrynin Century. N. Filippov S. A. Korobko Century, Bioorganic chemistry, 1988, I. 14. N 10, S. 1372-1386.

8. Kolosov, M. N. Korobko Century, Dobrynin Century. N. Severtsov I. C. Chuvpilo S. A. Bystrov, N. With. Berlin, Y. A. Cousin A. L. Butkus Centuries Polyakov, I. A. BOV A. N. Republic of Belarus, F. authorship, N 1092176, publ.in. B. I. 1984, N 18.

9. Birnboim H. C.// in: Methods in Enzymology. Recombinant DNA. Part B. 1983, v. 100. Eds. Wu R. Grossman L., Moldave R. p.243-254. Academic Press, Inc.

10. Chuvpilo, S. A. Kravchenko and V. V.//FEBS. 1984, v.179, N 1, p.34-36.

11. Akimenko H. A. Zykov, S. A. Officers Century. And. Gileva I. P. Kravchenko Century. Century. Sandakhchiev HP//Dokl. An SSSR, 1991, T. 40, N 4, S. 878-M

1. Recombinant plasmid DNA p 280GM encoding a polypeptide with properties granulocyte-macrophage colony-stimulating factor, human mol. m 2,7 Md containing > PST /BamHI DNA fragment from the plasmid pDS 280 (1083 p. O.), comprising part of the gene-lactamase and tandem promoters tryptophan operon of E. coli; NcoI/ > PST fragment pGMtrp, comprising part of the synthetic gene granulocyte-macrophage colony-stimulating factor encoding the polypeptide (13 127 of the Mature GM-CSF person (2834, etc., O.), part of the gene - lactamase and the transcription terminator of phage , synthetic deoxyoligonucleotide duplex,

5'-GATCAATTCTATGGACCAGCATCTCCCTCTCCTTCTACTCAAC-3'

3'-TTAAGATACCGTGGTCGTAGAGGGAGAGG-AAGATGAGTTGGTAC-5',

including the ATG codon and encodes a polypeptide (1 12) Mature granulocyte-macrophage colony-stimulating factor, human; synthetic gene for granulocyte-macrophage colonystimulating the plasmid p 280GM of E. coli cells to penicillin antibiotics; unique recognition sites of restriction endonucleases that are located at the following distances to the right of the EcoRI site (279 p. O.) - BamHI-454 nucleotide; > PST -2938 nucleotides.

2. The strain Escherichia coli SG20050/p280GM VKPM B-6613 producer polypeptide with properties granulocyte-macrophage colony-stimulating factor human.

 

Same patents:
The invention relates to the field of biotechnology, in particular genetic engineering, and can be used to create the plasmid and the corresponding strains-producers of recombinant proteins, as well as for purification of protein products

The invention relates to the construction of the expression vector recombinant DNA encoding immune interferon person
The invention relates to biotechnology, in particular genetic engineering, and can be used to create the plasmid and the corresponding strains-producers of recombinant proteins, as well as for purification of protein products

The invention relates to biotechnology, in particular genetic engineering, and is a fragment of DNA encoding the synthesis of glycoprotein G of rabies virus, the recombinant plasmid DNA and the strain containing the recombinant plasmid, producing structural protein glycoprotein G

The invention relates to the field of prokaryotic cells with stable gene amplification by multiple nyandeng integration into the chromosome at least two copies of a particular DNA sequence
The invention relates to biotechnology

The invention relates to genetic engineering and biotechnology and is a recombinant strain of E. coli HB 101 RMK 16 and recombinant plasmid RMK 16 that defines the degradation of the herbicide 2,4-dichlorophenoxyacetic acid of this strain

FIELD: biotechnology, microbiology.

SUBSTANCE: invention relates to a method for preparing inosine and 5'-inosinic acid that are prepared by using microorganism Escherichia coli. Production of inosine by indicated microorganisms is elevated due to the enhanced activity of protein encoded by gene yijE. Invention provides increasing yield of inosine and 5'-inosinic acid.

EFFECT: improved preparing method, valuable properties of strain.

8 cl, 3 dwg, 2 tbl, 3 ex

FIELD: biotechnology, microbiology.

SUBSTANCE: inosine and 5'-inosinic acid are obtained by using microorganism Escherichia coli. Production of inosine by indicated microorganism is elevated due to enhancing activity of protein encoding by gene ydeD. Invention provides elevating yield of inosine and 5'-inosinic acid.

EFFECT: improved preparing method.

8 cl, 3 dwg, 2 tbl, 4 ex

FIELD: biotechnology, microbiology.

SUBSTANCE: avirulent strain as a producer of capsule antigen is obtained on the base of the natural strain V. cholerae of serogroup O139 by method of step-by-step selection of cells with enhanced production of capsule. Prepared strain forms antigen by 3-4-fold more as compared with other strains of this serogroup. The strain shows high and stable level of capsule antigen production that is one of components of chemical choleraic vaccine against cholera pathogen of serogroup O139.

EFFECT: improved preparing method, enhanced yield of antigen.

7 ex

FIELD: biotechnology, microbiology, amino acids.

SUBSTANCE: invention relates to a method for producing L-amino acids using microorganism belonging to genus Escherichia wherein gene mlc encoding the global regulator of carbohydrates metabolism is inactivated. For producing such amino acid as L-threonine the strain Escherichia coli TDH7Δmlc::cat/pPRT614 is used wherein gene mlc is inactivated. Invention provides producing L-amino acids with the high degree of effectiveness.

EFFECT: improved producing method.

5 cl, 2 dwg, 1 tbl, 2 ex

Up!