Polypeptide e 206, designed for the detection of antibodies to human immunodeficiency virus type ii, the dna fragment is not 206 encoding the polypeptide e 206, recombinant plasmid dna rnu 206 encoding a polypeptide e 206, the bacterial strain escherichia coli producing polypeptide e 206

 

(57) Abstract:

Usage: in biotechnology, genetic engineering and immunology. The invention consists in that the hybrid polypeptide E consisting of a polypeptide product of the env gene of HIV-2 and a-galactosidase of E. coli. The hybrid polypeptide is synthesized by the bacterial strain Escherichia coli VKPM N-5872. The strain obtained by transformation of plasmid DNA pHE206, bearing a fragment of the env gene of HIV-2. 4 S. p. f-crystals.

The invention relates to biotechnology, genetic engineering and immunology and is a hybrid polypeptide consisting of a polypeptide product of the env gene of human immunodeficiency virus 2nd type (HIV-2) and-galactosidase of E. coli synthesized by a bacterial strain of E. coli carrying the recombinant plasmid, having in its composition a cloned fragment of the env gene of HIV-2 (env2) and communicating with antibodies to the gene products env2, which allows serodiagnostic of acquired immunodeficiency syndrome (AIDS).

AIDS is caused by infection with human immunodeficiency virus (HIV). HIV when ingested, affects cells of the immune system (T-lymphocytes, monocytes and macrophages) and cells of the Central nervous system. Zabol the parks are defined only antibodies to viral proteins, followed by progressive degradation of the immune and Central nervous system. Therefore, to make an emergency anti-epidemic, preventive measures and early treatment of HIV infection is extremely urgent to develop diagnostic products, allowing to detect HIV in the early stages of infection.

Numerous studies of HIV has allowed to define its structure, genome organization, clarify the mechanism of the expression and function of individual viral proteins. Currently, there are two types of human immunodeficiency virus (HIV-1 and HIV-2), with similar genome organization and different antigenic structure of viral proteins.

HIV is the most complex of all known retroviruses structure of the genome. In addition to the genes gag, pol and env, directing the synthesis of the main virionyx proteins common to all retroviruses, the genome of HIV-1 contains six genes: vif, tat, rev (or art, or trs), 3'-nef, vpr and vpu. The genome of HIV-2, in contrast to HIV-1 does not contain a vpu gene, but contains a gene vpx.

The env gene of HIV-2 encodes two glycoproteins (mol.m. 110 and 32 KD, gp110 and gp32, respectively. It is known that nearly 100% of people infected with HIV-2, it is possible to detect antibodies to glycoprotein gp32. CLASS="ptx2">

Most of the methods of diagnosis of HIV infection based on the detection of antibodies to HIV proteins in serum and other biological fluids (serodiagnosis). For these purposes, different approaches are used, which applies the principle of enzyme-linked immunosorbent assay (ELISA), agglutination reaction (latex, erythrocytes), immunofluorescence, immunoblotting and radioimmunoprecipitation. One of the most promising ways to improve all of these diagnostic test-systems is used as the antibody-binding entity recombinant HIV protein, synthesized in expressing different systems. The use of such recombinant proteins, preserving the antigenic determinants of HIV, instead of viral antigens not only increases the specificity and sensitivity of the test systems, but also makes them safe at work. There are a significant number of developments aimed at creating recombinant proteins, gene products of HIV, in particular the env gene.

Currently in search of polypeptides that are most promising for diagnosis, treatment and prevention of AIDS. Research is conducted both in direction selection cell producers, and in the direction LASS="ptx2">

The essence of this technical solution is that proposed the original hybrid polypeptide E consisting of a polypeptide product of a fragment of the genome of HIV-2, combined with a-galactosidase of E. coli, binding of antibodies to the product of the env gene of HIV-2; the DNA fragment encoding the polypeptide E included in the recombinant plasmids RNA; E. coli strain VKPM N-5872 containing recombinant plasmid RNA and expressing the protein E.

Producing strains characterized by the following characteristics: the cells straight, rod-shaped, motile with peritrichous flagella, gram-negative, risperadone. Cells grow on the LB medium and other nutrient media used for culturing Escherichia coli and simple nutrient media containing 10 μg/ml tetracycline and 50 μg/ml ampicillin. When grown on nutrient agar medium at 37aboutWith a colony of cells smooth, round, shiny, pale yellow, transparent, smooth edge. When growing on the same media, but when 30-32aboutWith colonies of cells are "slimy" phenotype, characteristic colonies of cells with lon mutations, growing at low temperature. With the growth in liquid media the cells form a smooth intense haze. Cells are well resinae salt in ammonium and nitrate form, and organic matter in the form of peptone and amino acids. Reducing nitrates to nitrites. Gelatino not thin. Maltose is not fermented. Urease activity is not formed. Transformation of cells with plasmids with the promoters of bacteriophage performed by standard methods. The obtained cell clones with plasmids grown in LB medium at a temperature of 30-32aboutC. Preparative fermentation for the recombinant protein is carried out at a temperature 39-42aboutC. the Productivity of the strain when using plasmid expression vectors with promoters of bacteriophage is about 500 µg of recombinant protein per 1 ml of cell suspension in culture density of 5 x 108cells/ml Protein is stable at a temperature of 4aboutWith in the next 3-4 months.

Recombinant polypeptide E, isolated and purified from the producer strain immobilized on a solid medium (PVC or polystyrene tablets, nitrocellulose, nylon, latex, erythrocytes, and others), binds antibodies to the products of the env gene of HIV-2 in serum and other biological fluids. The strain is deposited in the collection of industrial microorganisms Institute of genetics of industrial microorganisms, Moscow under N-5872.

P R Anisimovna blood, to which is added 30 ml of lyse solution (155 mm NH4Cl, 10 mm KHCO3; 0.1 mm EDTA). The mixture is incubated for 15 min on ice. Centrifuged at 2000 G for 10 min at 4aboutC. White cells resuspended in 10 ml of SE (75 mm NaCl, 2 mm EDTA) add proteinase K To a final concentration of 100 μg/ml and 1 ml of 20% SDS. The mixture is incubated for 4 h at 37aboutWith add 1/2 volume (5 ml) of water-saturated phenol and the same number with chloroform isoamyl alcohol (24: 1). The resulting mixture was shaken on a shaker for 15 min and centrifuged at 2000 rpm for 10 minutes To selected aqueous phase add 1/30 volume of NaOAc (pH 5.5) and equal volume of isopropyl alcohol. DNA is then precipitated by centrifugation and washed with 70% ethanol solution. The precipitated DNA was dissolved in buffer TE (10 mm Tris-HCl, 1 mm EDTA, pH 8.0) to a final concentration of 1 µg/ml.

In eppendorff tube 0.5 ml incorporate the following components: deionized water to 43.5 ál reaction buffer 10 ál x 10 (final concentration 25 mm Tris-HCl, pH 8.3 (at 25aboutC), 50 mm KCl, 2 mm MgCl2, 1 mm-mercaptoethanol, gelatin, 200 μg/ml), a mixture of dNTP 16 μl (final concentration 200 μm), primer N1 5-CTGCACTAAAGGATCCGTCC-3' 10 μl (final concentration of 1.0 μm), primer N2 5'-CTGCAGGCTTCAGTAGTGT-3' 10 μl (final concentration of 1.0 μm), DNA (matricariae tubes are mixed on the vortex 3-4 with and precipitate on microcentrifuge for 5-10 sec.

In a test tube add 50 ál of mineral oil and placed in the apparatus for amplifying DNA N 801-0177 DNA Thermal Cycler Perkin-Elmer Corporation.

The reaction mixture was incubated at 94aboutWith 7 minutes, and then spend the cycle of amplification with the following parameters: 2 min at 37about(Hybridization of the primers), 5 min at 72about(Completion of the primers), 2 min at 94aboutC (denaturation of DNA). The loop amplification is repeated 25 times. After the last cycle of amplification, the reaction mixture was incubated at 72aboutWith 10 minutes

In test tube add 50 μl of chloroform, the material is shaken with chloroform with 5 on the vortex and then centrifuged at microcentrifuge 10 C. Select the aqueous (upper) phase (about 100 µl), which is formed in the form of spherical droplets, and transferred to a clean tube.

10 µl of the aqueous phase used for the analysis of amplification products in 2% agarose gel with methyl-ethidium (visible piece 430 p. N.).

Method Sanger determined the nucleotide sequence of the DNA fragment NE.

ACGGATCCTTTAGTGCAGAGGTGGCAGAACTATACCGATTGGAATTGGGGGATTATAAAT

TAGTAGAAGTAACACCAATTGGCTTCGCACCTACAGCAGAAAAAAGATACTCCTCTGCTC

CAGGGAGACATAAGAGAGGTGTGCCTGTGCTAGGGTTCCTAGGTTTTCTCACGACAGCAG

GTGCTGCAATGGGCGCGGCGTCTCTGACGCTATCGGCTCAGTCTCGGACTTTATTGGCTG

GGATAGTGCAGCAACAGCAACAGCTGTTGGACGTGGTCAAGAGACAACAAGAAATGTTGC

Synthesized on a DNA array DNA fragment hydrolyzing restrictase > PST and BamHI in the Bromphenol blue buffer (10 mm Tris-HCl, 10 mm MgCl2, 50 mm NaCl and 1 mm dithiothreitol pH 7.5) for 14 h at a temperature of 37aboutC. the Enzymes are inactivated by heating at 70aboutWith 15 minutes DNA precipitated with ethanol and dissolved in 50 μl of H2O. 10 μl of treated restrictable DNA fragment is placed in eppendorff tube containing 3 μl of ligase buffer (50 mm Tris-HCl, 10 mm MgCl2, 20 mm dithiothreitol, 1.0 mm ATP, 50 μg/ml bovine serum albumin), 2 μl (0.2 ág/ml) DNA vector plasmid pEL5 treated restrictase > PST and BamHI, 4 μl of H2O. To this mixture 1 μl (100 units) of T4 DNA ligase and the mixture is incubated for 3 h at 16aboutC.

Received ligase mixture transform cells of E. coli strain PLT90 in the usual manner. Transformed cells are plated on plates with 1% LB-agar containing 25 μg/ml of ampicillin. Grown colonies screened for recombinant plasmids. For this purpose, the bacterial cells are lysed and release of plasmid DNA. The selected plasmid DNA treated with restrictase > PST and BamHI and the hydrolysate examined by electrophoresis in 1% agarose.

The hydrolysate of plasmid DNA from reko the em size of the vector and the synthesized DNA fragment. When determining the nucleotide sequence of the plasmid DNA established that we synthesized DNA fragment in the plasmid RNA via BamHI site attached to the C-terminal site-galactosidase of E. coli.

P R I m e R 3. The strain of E. coli NE containing plasmid RNA, grown in 100 ml LB medium at 30aboutWith up to a density of 8 x 108cells/ml then the temperature was raised to 37aboutWith and grow the cells for 2 hours, the Cells are harvested by centrifugation at 4000 rpm for 15 minutes, the Cells are lysed by ultrasound and secrete proteins according to the described method.

Selected proteins analyzed in 10% SDS page according to the standard method of laemmli's method. As markers of molecular masses of proteins using a set of company "Pharmacia", containing markers molecular mass 20-160 KD. As a control using the obtained similarly the cell lysate of E. coli strain PL90 containing the vector plasmid pEL5 and not containing the obtained plasmid pHE206. Comparative analysis of protein composition shows that the strain of E. coli NE containing plasmid RNA, expresses a hybrid polypeptide mol. m 130-135 KD. This polypeptide is named E. Amino acid sequence of the hybrid polypeptide (sequence-galactosidase DNA HIV-2 is shown below:

G S F A E V A E L R Y L E L G D Y K L V E V T P I

G F A P T A K E R Y S S G R A P H K R G V P V L G F

L G F L T T A G A A M G A A S L T L S A Q S R T L L

A G I V Q Q Q Q Q L L D V V K R Q E M L R L T V W

G T K N L Q A R V T A I E K L Y A D Q A R L N S W G

C A F R Q V C H T T

P R I m e R 4. Control of antigenic activity.

Control antigenic activity of preparations carried out by the method of immunoblotting. To do this, hold the procedure of electrophoresis (as described in example 3), then carry out the electrophoretic transfer of separated proteins to nitrocellulose membrane BH85 using the apparatus for electroplating 24 V, 400 mA for 1 h the quality of the transfer is checked by staining the membrane with a solution of 0.2% S Ponso 3% THU for 5 min at room temperature. The paint washed twice for 30 min with TBS buffer (0.15 M NaCl, 20 mm Tris-HCl, pH 7.4) with 0.05% Tween-20 at room temperature. In the next step, conduct blocking nitrocellulose membranes with immobilized protein a solution of 5% nonfat dry milk prepared in 0.1 M Na-phosphate buffer, pH 7.4, for 30 min at room temperature. After blocking temperature for 1 h at 37aboutWith treated with serum containing antibodies to HIV-2, in a dilution of 1:100. Then spend trekker is Titel carried out by incubation of the filter with antivitamin peroxidase conjugate at 37aboutWith in an hour. Next, repeat the procedure three times of washing. The reaction is checked by adding 100 ál of 30% hydrogen peroxide and 50 ml of a solution of 4-chloro-1-naphthol (20 mg in 0.1 M Tris-HCl, pH 8.0). The analysis shows that the polypeptide E associated with antibodies to human immunodeficiency virus type II.

Thus, this invention allows to identify antibodies to the products of the env gene of HIV-2 with high efficiency and specificity, and the process definition does not require working with a highly infectious viral material.

1. Polypeptide E 206, designed for the detection of antibodies to human immunodeficiency virus type II, obtained in the bacterial strain Escherichia coli VKPM NB-5872, transformed with recombinant plasmid pHE 206 that encodes a polypeptide with the following amino acid sequence shown in the description, merged with galatosidase E. coli and possessing the ability to bind with antibodies to the product of the env gene of HIV-2, mol.m. 130 135 kilodaltons when determining the method of polyacrylamide gel electrophoresis.

2. The DNA fragment is NOT 206 encoding the polypeptide E 206 obtained by chain polymerization reactions, nucleotide sequence, provided the peptide E 206, designed for the detection of antibodies to human immunodeficiency virus type II, size 6830 p. O. containing Bam HI- > PST fragment DNA vector P EL 5A, including gene-galactosidase of E. coli, size 6400 p. O. Bam HI-Pst I fragment DNA is NOT 206 encoding the polypeptide E 206, size 430 p. O. one plot splitting restrictase Bam HI, Sma I, SalGI, Pst I; the promoter of bacteriophage lambda croLac Z; genetic markers: gene Amp2the gene for resistance to ampicillin.

4. The bacterial strain Escherichia coli VKPM NB-5872 producer polypeptide E 206 intended for the detection of antibodies to human immunodeficiency virus type II.

 

Same patents:

The invention relates to biotechnology and immunology
The invention relates to biotechnology, genetic engineering and immunology, and can be used for serodiagnosis of hepatitis C

FIELD: biotechnology, microbiology.

SUBSTANCE: invention relates to a method for preparing inosine and 5'-inosinic acid that are prepared by using microorganism Escherichia coli. Production of inosine by indicated microorganisms is elevated due to the enhanced activity of protein encoded by gene yijE. Invention provides increasing yield of inosine and 5'-inosinic acid.

EFFECT: improved preparing method, valuable properties of strain.

8 cl, 3 dwg, 2 tbl, 3 ex

FIELD: biotechnology, microbiology.

SUBSTANCE: inosine and 5'-inosinic acid are obtained by using microorganism Escherichia coli. Production of inosine by indicated microorganism is elevated due to enhancing activity of protein encoding by gene ydeD. Invention provides elevating yield of inosine and 5'-inosinic acid.

EFFECT: improved preparing method.

8 cl, 3 dwg, 2 tbl, 4 ex

FIELD: biotechnology, microbiology.

SUBSTANCE: avirulent strain as a producer of capsule antigen is obtained on the base of the natural strain V. cholerae of serogroup O139 by method of step-by-step selection of cells with enhanced production of capsule. Prepared strain forms antigen by 3-4-fold more as compared with other strains of this serogroup. The strain shows high and stable level of capsule antigen production that is one of components of chemical choleraic vaccine against cholera pathogen of serogroup O139.

EFFECT: improved preparing method, enhanced yield of antigen.

7 ex

FIELD: biotechnology, microbiology, amino acids.

SUBSTANCE: invention relates to a method for producing L-amino acids using microorganism belonging to genus Escherichia wherein gene mlc encoding the global regulator of carbohydrates metabolism is inactivated. For producing such amino acid as L-threonine the strain Escherichia coli TDH7Δmlc::cat/pPRT614 is used wherein gene mlc is inactivated. Invention provides producing L-amino acids with the high degree of effectiveness.

EFFECT: improved producing method.

5 cl, 2 dwg, 1 tbl, 2 ex

FIELD: genetic engineering, biotechnology, molecular biology, medical-biological and pharmaceutical industry.

SUBSTANCE: invention relates to isolating gene from cells of the strain P. altcromonas producing enzyme that cleaves polysaccharide comprising sulfated fucose and this gene encodes above indicated enzyme, Invention proved the presence of two opened reading frames (ORF-1 and ORF-2) and their nucleotide sequences are determined. Active recombinant forms of enzyme able to hydrolyze sulfated fucose-comprising polysaccharide are obtained by expression of these sequences in E. coli being this polysaccharide is not cleaved by fucoidanase produced by Flavobacterium sp. SA-0082 (FERM BP-5402). Applying the invention provides the possibility for preparing large amounts of qualitative raw for pharmaceutical preparations.

EFFECT: improved preparing method, valuable properties of polypeptide.

5 cl, 5 dwg, 2 tbl, 7 ex

FIELD: genetic and protein engineering, medicine, molecular biology, pharmacy.

SUBSTANCE: invention proposes a modified form of plasminogen urokinase type activator (activator) wherein amino acid sequence differs from that in the natural activator as result of replacing the sequence Arg-Arg-His-Arg-Gly-Gly-Ser in the composition of inhibitory loop for the sequence Arg-His-His-Ala-Gly-Gly-Ser and by replacing 24 N-terminal amino acids for the foreign sequence consisting of 16 amino acid residues. Invention proposes the constructed recombinant plasmid (pUABC 34) comprising DNA fragment that encodes a new activator. As result of transformation of E. coli K-12 JM109 cells with plasmid pUABC 34 the recombinant strain E. coli VKPM-8145 as a producer of a modified form of activator is obtained. This polypeptide is characterized by reduced sensitivity to effect of inhibitor PAI-1 and absence of some by-side effects in the complete retention of biological activity of the natural activator produced by the recombinant. This provides effective applying a new activator as a component of pharmaceutical compositions eliciting thrombolytic effect.

EFFECT: valuable medicinal properties of activator and pharmaceutical composition.

6 cl, 6 dwg, 8 ex

FIELD: genetic and tissue engineering, biotechnology, medicine, agriculture.

SUBSTANCE: invention relates to the development of simple with constructive relation peptide vector (PGE-κ) consisting of polypeptide sequence of epidermal growth factor (EGF) and modified sequence of signal peptide T-antigen SV-40. New vector PGE-κ is able to provide the selective delivery of genetic material in target-cell cytoplasm carrying external receptors to EGF and the following its transport across nuclear membrane. Also, invention proposes a method for preparing peptide vector PGE-κ involving its expression as a fused protein "mutant thioredoxine-linker-vector" and cleavage of product expressed in E. coli in the linker region with specific protease. Invention provides preparing the recombinant strain E. coli B-8389 VKPM as a producer of the fused protein comprising PGE-κ. Proposed vector shows simple structure, absence of toxicity and immunogenicity and these properties provide its usefulness for the directed genetic modification of epithelial, embryonic and tumor cells in vivo.

EFFECT: improved preparing method, valuable medicinal properties of vector, improved genetic modification.

7 cl, 12 dwg, 4 tbl, 16 ex

FIELD: biotechnology, in particular prephenate dehydrotase-chorismatmutase and DNA fragment encoding the same.

SUBSTANCE: prephenate dehydrotase-chorismatmutase is isolated from Methylophilus methylotropus and may contain replacements, deletions, inserts, or incorporations of one or more amino acids. Said enzyme plays an important role in L-phenylalanine biosynthesis. Method of present invention makes it possible to improve L-phenylalanine production due to increased activity of enzymes involving in L-phenylalanine biosynthesis pathway.

EFFECT: improved L-phenylalanine production.

2 cl, 2 dwg, 1 tbl

FIELD: biotechnology, in particular method for production of L-amino acid except L-glutamic acid.

SUBSTANCE: claimed method includes cultivation of bacteria Methylophilus, which is capable to grow utilizing methanol as a main carbon source and to produce L-amino acid; and collection L-amino acid from culture. For example, bacteria Methylophilus with increased activity of dihydrodipicolinate synthase and aspartokinase is used. Said activity is increased by introducing DNA encoding dihydrodipicolinate synthase which is not inhibited with L-lysine by negative back coupling, and DNA encoding aspartokinase which is not inhibited with L-lysine by negative back coupling, into cells.

EFFECT: increased yield of L-amino acids.

10 cl, 7 dwg, 6 tbl, 7 ex

FIELD: biotechnology, in particular provision storage.

SUBSTANCE: bacteriocin represents polypeptide isolated from lactobacillus sakei 2512 and is capable to suppress lysteria growth and reproducing. Bactericin has specific amino acid sequence represented in claims. Nuclear acid sequence encoding said polypeptide is disclosed. Also disclosed is a vector including nuclear acid sequence for cloning and/or expression of polypeptide, for example in transformed cells, selected from Lactococcus, Lactobacillus, etc. Method for production of recombinant polypeptide is developed. Claimed bactericin or strain 2512 are used as component of bactericide composition, being capable to suppress growth of gram positive pathogenic bacteria, in particular Listeria monocytogenes.

EFFECT: large scale application of bacteriocin against pathogenic or undesired flora in food industry.

13 cl, 2 dwg, 1 tbl, 3 ex

FIELD: biotechnology, genetic engineering, molecular biology.

SUBSTANCE: invention proposes recombinant DNA pcDNA-TCI that has molecular mass 4.3 x 103 kDa and size 6 657 nucleotide pairs. The proposed recombinant plasmid DNA provides expression of artificial gene TCI comprising cytotoxic T-cellular epitopes of HIV-1 in eucaryotic cells. Also, invention proposes recombinant attenuated strain of bacterium Salmonella enteritidis E-23 pcDNA-TCI. The proposed strain is obtained by genetic transformation of the strain Salmonella enteritidis E-23 with plasmid pcDNA-TCI. The strain provides delivery DNA-vaccine in eucaryotic cells as the recombinant plasmid DNA pcDNA-TCI. Proposed groups of inventions provide inducing the expressed specific humoral and cellular immune response to HIV-1 in body. Proposed group of inventions can be used in medicine and virology for construction of live DNA-vaccine against HIV-1.

EFFECT: valuable biological and medicinal properties of strain and vaccine.

2 cl, 3 dwg, 3 tbl, 5 ex

FIELD: genetic engineering and medicine genetic.

SUBSTANCE: method for detection of gene resistance of subjects to infection by HIV1 is disclosed. Method includes DNA isolation, CCR5 gene PCR-amplification by using two primers complementary to two gene CCR5 sites. Further amplification products are restricted with endonuclease HincII (HindII), sizes of formed amplified fragments are determined, and on the base of obtained data deletion and single-nucleotide mutations are detected. Method of present invention makes it possible to simultaneously diagnose the presence of two mutation in human CCR5 gene, and (if individual has both mutation in heterozygote state) to distinguish cys- and trans-configurations.

EFFECT: method for diagnosis of congenital gene resistance to infection by HIV1.

2 dwg, 1 tbl, 2 ex

FIELD: virology.

SUBSTANCE: invention proposes different compositions able to induce production of antibodies against Tat HIV-1 that can inhibit multiplication of HIV-1. Also, invention proposes a method for induction of antibodies raised against Tat HIV-1, in vitro method for assay of the presence of antibodies and their titer values, a method for reducing HIV-1 virus levels, sequence of synthetic nucleic acid and synthetic molecule. Proposed group of inventions can be used for inhibition of multiplication of HIV-1 in infected patients and for attenuation of HIV-1 multiplication after the primary infection in early infected persons.

EFFECT: valuable methods and compositions.

39 cl, 7 dwg, 9 tbl, 5 ex

FIELD: biotechnology, medicine.

SUBSTANCE: the suggested immunoenzymatic test system for identifying the spectrum of antibodies to HIV types 1 and 2, type 1 group O and detecting antigen to HIV type 1 p24 deals with applying immunosorbent based upon HIV antigens being gp41 (env HIV-1 and HIV-2 group O), gp120 (env), p24 (gag), p31 (pol), gp36 (env HIV-2), antibodies to HIV 1 antigen p24, and detecting reagents, moreover, the above-mentioned HIV antigens and HIV antibodies should be sorbed in different cells of plotting boards for immunoenzymatic assay (IEA) and for sorbing it is necessary to apply 96-cell polystyrene dismountable or nonseparable plotting boards. The innovation provides higher sensitivity, simplification and avoiding the subjectivity in evaluating the results obtained.

EFFECT: higher efficiency of identification.

1 cl, 1 dwg, 1 ex, 8 tbl

Up!