The method of detection of human immunodeficiency virus

 

(57) Abstract:

Usage: in molecular biology in the diagnosis of AIDS. The inventive method for detecting human immunodeficiency virus lies in the fact that they are carrying out the amplification of deoxyribonucleic acid (DNA) virus using primers of 26 links with the following nucleotide sequence: GATGGCCCAAAAGTTAAACAATGGCC and primer of the 31-th link with the following nucleotide sequence: TTCTCTTATTAAGTT CTCTGAAATCTACTA, find duplicated fragment by hybridization with a labeled probe of 36 links CTCCATTTAGTACTGTCTTTT TTCTTTATGGCAAAT and probe on the media of 32 links ATTTCTACTAATGCTTTT ATTTTTTCTTCTG. At the same time the amplification of the DNA of the virus is carried out using as primers CH 26 CH 27. In this case, the gel bromide stain with ethidium. The virus is detected only if the dyed gel is a fragment of the marker gene. 1 C.p. f-crystals, 4 Il. table 1.

The invention relates to molecular biology, in particular to a method of diagnosis of AIDS is based on the detection of genetic material of the pathogen and adapted for mass analysis with the possible automation of the process.

It should be noted that hybridization detection provirus AIDS using PCR-OG which involves performing PCR with subsequent detection of duplicated fragment by hybridization with a labeled probe.

The resulting complex is separated from the excess probe by electrophoresis and detected by autoradiography.

The proposed method includes two main stages. The first is a reproduction of a given fragment of the genome of the pathogen by polymerase chain reaction (PCR) multiple hybridization with two oriented towards each other oligonucleotide probes, which are further supplemented by a polymerase or its analog, or combination with polymerase reactions of other types. This will solve the problem of sensitivity (since it results in the reproduction of not less than 107and to use the most simple methods for the preparation of samples for analysis. In the second stage amplificatory product is detected by hybridization with oligonucleotide probes. In this case it is used as an additional means of control fragment of the genome of the pathogen, already "recognized" two probes in the first stage, "recognized" again probes. One of them must contain a label that allows you to find duplicated product: high sensitivity is better in the presence of two pairs of primers: one to the fragment of the pathogen (HIV), another to the marker gene. The gel after hybridization and autoradiography bromide stain with ethidium. A negative result in the determination of the agent is unambiguous only for those samples that significantly a sufficient amount of product amplification of marker segment.

In the method of detection of the causative agent of AIDS in the blood or lymphocyte culture method was applied PCR amplification with subsequent oligomer-hybridization (PCR-OG). Developed a new variant of this method, which allows to detect the causative agent of AIDS at the earliest stages of infection: sensitivity compared with the prototype increased appreciably simplified analysis techniques. On the other hand, unambiguously prove the absence of the pathogen, which is very important especially in the case of AIDS. This is achieved by the fact that in parallel with the detection provirus HIV in the same sample is an estimate of the number of gene DNA and efficiency analysis by amplification of the marker gene with the second pair of primers. PCR-OG is supposed to be used as a control in the development of new methods of diagnosis of AIDS and just for analyses of blood samples for the presence of HIV. Such analyses already provozieren 1 and 2 restrict the fragment of the pathogen (S) or in the presence of two pairs of primers (added a couple of 1m and 2m, limiting marker gene m is introduced into the hybridization with probes (one or two) that has a binding site within a fragment of the pathogen A. Marker fragment M is detected in the same mix in a similar way or another, since the latter is always present in large numbers. For example, in the proposed new version of the PCR-OG fragment of the pathogen is detected by hybridization with a labeled probe and marker gene by bromide staining by ethidium.

This approach allows you to apply other options hybridization detection used both for agents and for the marker. So, to automate the process fragment A (or M) can be introduced into the hybridization with probe 3, immobilized on the polymer carrier, and with a probe containing the label radioactive or non-radioactive.

In Fig. 1 shows radioautogram gel analysis of drugs linfocitos DNA PCR-OG. All samples contain DNA from 1 million cells, among which 500(1), 50(2), 10(3) or 0(4) contain a provirus AIDS. Indicates the position labeled probe 4 and the complex probe-amplificatory fragment ( * ), Fig. 2 is an example of determination by the method of PCR-OG provirus AIDS in blood products from 7 patients. It is seen that p is and the definition provirus AIDS PCR-OG with amplification in the presence of a pair of primers P1 and P2 (1-5) and two pairs of P1 P2 and GH26 GH27 (6-9). All samples for analysis were taken DNA from 0.5 million lymphocytes, among which 18000(1), 500(2, 6), 50(3, 7), 10(4, 8) and 0(5, 9) contain the provirus AIDS: * the location of the complex probe-amplificatory fragment; Fig. 4 the same gel after the bromide staining by ethidium: M marker fragment; ** the fragment provirus.

P R I m e R 1. The choice of the sequence of primers and probes. Given the high propensity of HIV mutations, when it is detected, you must use the primers and probes corresponding to the most conservative parts of the viral genome. As such sites are targets encouraged to use those same nucleotide sequence in HIV-1 and HIV-2. This coincidence or similarity observed for these two evolutionary distant species, Though, can serve as a guarantee for the sustainability of selected targets for possible new mutations.

In connection with the above, the basis for the search target was the comparison of the nucleotide sequences over the entire length of the genome for hivmn, EMBL accession M17449 (HIV-1) and hiv2rod, EMBL accession M15390 (HIV-2) on the computer using the program "Microgenie". In these viruses coincides 55.2% of the sequence, the most coincide, as expected, genes gog (position 788-2308 in hivmn, 546-2114 in hiv2rod), which are further screened for homology with all available data EMBL GenBank (September 1991) nucleotide sequence of HIV by using the same program "Microgenie". As criteria for determining the suitability of the primer or probe, use the following: length of target not less than 25 units, no more than 3 mismatches (mismatches) for family viruses HIV-1 and not less than 75% of matches for HIV-2 (hiv2rod); do not allow mismatch closer than 3 links from 3' end, having more than 1 pair of mismatches located near and vyvetrivanii more than 1 link. Meet these criteria all selected primers and probes to gene pol (denoted by p, see table). Thus P1 P4 are used as probes 1-4 in Fig. 1. For P5 (also potential probe) compliance with the criteria is observed only for family viruses HIV-1.

P R I m m e R 2. Synthesis of probes and primers. The probes P1, P2 and P4 synthesize fostamatinib method on the automatic synthesizer according to the usual scheme [4] To select probes from the reaction mixture using reverse-phase chromatography before removing methoxytrityl 5'-terminal protective group. The resulting probes are practically homogeneous according to gel electrophoresis.

System media-probe P3 is obtained by phospholidine originalidad Assembly probe P3 for the same phospholidine scheme. The load carrier phosphate groups is 20 ╬╝mol/g of these groups of approximately 25% engage in subsequent oligonucleotide synthesis. The resulting system was characterized by low level of nonspecific adsorption of labeled probe (about 0.01%), which shows the viability of its use in hybridization as shown in Fig. 1 scheme.

P R I m e R 3. Detection provirus AIDS modified PCR-OG in the culture of lymphocytes in the blood. DNA preparations from cultures of lymphocytes containing a known amount of provirus AIDS, is used as the object in the development of diagnostic methods. Also, the drugs are prepared by mixing DNA from infected and uninfected cultures of lymphocytes. Detection and quantification of contamination of the cultures of lymphocytes with the AIDS virus important when testing new antiviral drugs that are first carried out on cell cultures.

When conducting blood tests for AIDS carry out the separation of the lymphocytes from other blood components by centrifugation or hypotonic shock. Next, lymphocytes isolated from the blood or from the culture, are lysed by proteinase K or proposal, which then inactivate by heating at 95aboutthe same. Next, the lysate is introduced into PCR directly or after additional deproteinization and concentration of DNA. It should be noted that when the blood tests may be necessary not only detection provirus in linfocitos DNA, but also RNA-containing viral particles in the serum or received from her drugs. It is also possible, since PCR runs for both DNA and RNA.

After PCR 1/5 of the mixture add a solution of labeled probe containing all the necessary components for both hybridization and gel electrophoresis. The latter is conducted immediately after hybridization in solution. Radioautography gel after electrophoresis (Fig. 1, 2) allows to identify the band corresponding to the product of hybridization. If DNA from a culture of lymphocytes was observed according to the intensity of this band and the number of provirus (Fig. 1, 3 and 4). In the analysis of the detection provirus AIDS using P1 and P2 as primers for PCR and P4 as a probe for hybridization, we have achieved a detection limit corresponding to 1 infected lymphocytes per 100,000 clean that above described in the literature.

P R I m e R 4. Comparison of the effectiveness of detection provirus AIDS method is, as it was discovered, is not reduced, if PCR to introduce another pair of primers, limiting the area of genomic DNA that is present in all cells in this case a fragment of the gene HLA-DO between primers GH26 and GH27. This 242-tier slice when the amplification is always formed in significant quantities, visible without hybridization with the colouring of bromide gel by ethidium (Fig. 4) regardless of the presence of DNA provirus HIV or any other. Therefore, when analyzing for the presence of HIV PCR amplification of DNA from the original sample is carried out in the presence of two pairs of primers: one to the fragment of the pathogen (HIV), the other to a marker gene (not necessarily HLA-DO , which may be quite convenient due to their variability. Definition provirus goes hand in hand with quality control samples. The gel after hybridization and autoradiography bromide stain with ethidium. A negative result in the determination of the agent is unambiguous only for those samples that significantly a sufficient amount of product amplification marker fragment. A negative result in the diagnosis of AIDS is no less important than positive, especially in the case of erroneous analysis results by other methods, or when Anaya of HUMAN IMMUNODEFICIENCY VIRUS, providing for amplification reaction virus DNA using primers, detection of duplicated fragment by hybridization with a labeled probe complementary to an internal portion of that fragment, and separation of the resulting complex from excess probe by gel-electrophoresis, radioautography gel and detection of virus by results of the analysis radiography gel, characterized in that as primers in amplification using primer of 26 links with the nucleotide sequence GATGGCCCAAAAGTTAAACAATGGCC and primer of 31 link with the nucleotide sequence TTCTCTTATTAAGTTCTCTGAAATCTACTA, detection of duplicated fragment is carried out by hybridization with labeled probe, and with the probe on the media as a labeled probe using oligonucleotide of 36 links nucleotide sequence CTCCATTTAGTACTGTCTTTTTTCTTTATGGCAAAT, and as a probe on the media use of the oligonucleotide of 32 links with nucleotide sequence ATTTCTACTAATGCTTTTATTTTTTCTTCTG.

2. The method according to p. 1, characterized in that simultaneously carry out the amplification of the marker gene HLA-DQ using as primers CH26 and CH27, gel after autoradiography bromide stain with ethidium while the virus detection

 

Same patents:

The invention relates to medical Microbiology and biotechnology, in particular genetic engineering, and can be used for the identification of toxigenic strains of anthrax by molecular hybridization

The invention relates to biotechnology, in particular to methods for detection of viral infections in clinical samples using bioinorganic DNA probes, and can be used in epidemiology, Virology, clinical medicine for the detection and identification of hepatitis a virus (HA)

The invention relates to biochemistry, in particular the amplification of deoxyribonucleic acid (DNA)

FIELD: biotechnology, genetic engineering, molecular biology.

SUBSTANCE: invention proposes recombinant DNA pcDNA-TCI that has molecular mass 4.3 x 103 kDa and size 6 657 nucleotide pairs. The proposed recombinant plasmid DNA provides expression of artificial gene TCI comprising cytotoxic T-cellular epitopes of HIV-1 in eucaryotic cells. Also, invention proposes recombinant attenuated strain of bacterium Salmonella enteritidis E-23 pcDNA-TCI. The proposed strain is obtained by genetic transformation of the strain Salmonella enteritidis E-23 with plasmid pcDNA-TCI. The strain provides delivery DNA-vaccine in eucaryotic cells as the recombinant plasmid DNA pcDNA-TCI. Proposed groups of inventions provide inducing the expressed specific humoral and cellular immune response to HIV-1 in body. Proposed group of inventions can be used in medicine and virology for construction of live DNA-vaccine against HIV-1.

EFFECT: valuable biological and medicinal properties of strain and vaccine.

2 cl, 3 dwg, 3 tbl, 5 ex

FIELD: genetic engineering and medicine genetic.

SUBSTANCE: method for detection of gene resistance of subjects to infection by HIV1 is disclosed. Method includes DNA isolation, CCR5 gene PCR-amplification by using two primers complementary to two gene CCR5 sites. Further amplification products are restricted with endonuclease HincII (HindII), sizes of formed amplified fragments are determined, and on the base of obtained data deletion and single-nucleotide mutations are detected. Method of present invention makes it possible to simultaneously diagnose the presence of two mutation in human CCR5 gene, and (if individual has both mutation in heterozygote state) to distinguish cys- and trans-configurations.

EFFECT: method for diagnosis of congenital gene resistance to infection by HIV1.

2 dwg, 1 tbl, 2 ex

FIELD: virology.

SUBSTANCE: invention proposes different compositions able to induce production of antibodies against Tat HIV-1 that can inhibit multiplication of HIV-1. Also, invention proposes a method for induction of antibodies raised against Tat HIV-1, in vitro method for assay of the presence of antibodies and their titer values, a method for reducing HIV-1 virus levels, sequence of synthetic nucleic acid and synthetic molecule. Proposed group of inventions can be used for inhibition of multiplication of HIV-1 in infected patients and for attenuation of HIV-1 multiplication after the primary infection in early infected persons.

EFFECT: valuable methods and compositions.

39 cl, 7 dwg, 9 tbl, 5 ex

FIELD: biotechnology, medicine.

SUBSTANCE: the suggested immunoenzymatic test system for identifying the spectrum of antibodies to HIV types 1 and 2, type 1 group O and detecting antigen to HIV type 1 p24 deals with applying immunosorbent based upon HIV antigens being gp41 (env HIV-1 and HIV-2 group O), gp120 (env), p24 (gag), p31 (pol), gp36 (env HIV-2), antibodies to HIV 1 antigen p24, and detecting reagents, moreover, the above-mentioned HIV antigens and HIV antibodies should be sorbed in different cells of plotting boards for immunoenzymatic assay (IEA) and for sorbing it is necessary to apply 96-cell polystyrene dismountable or nonseparable plotting boards. The innovation provides higher sensitivity, simplification and avoiding the subjectivity in evaluating the results obtained.

EFFECT: higher efficiency of identification.

1 cl, 1 dwg, 1 ex, 8 tbl

FIELD: genetic engineering.

SUBSTANCE: invention relates to vectors used in genetic engineering. Invention proposes a lentiviral vector with condition-dependent replication that comprises two nucleotide sequences. The first nucleotide sequence reduces probability for formation of lentiviral vector able for replication. The second nucleotide sequence inhibits replication of lentivirus of wild type, helper virus or helper vector but it doesn't inhibit replication of dependent vectors, or it encodes proteins showing the same properties. Also, invention discloses these nucleotide sequences, method for preparing such vectors and their using. Invention can be used in medicine in prophylaxis and therapeutic treatment of viral diseases, in particular, HIV infection.

EFFECT: valuable biological properties of vectors.

45 cl, 53 dwg, 12 ex

FIELD: biotechnology, immunology, virology.

SUBSTANCE: invention relates to CR3 chimera gene having sequence of SEQ ID NO:1 encoding chimera polyprotein. Said gene contains fragments, encoding fragments enriched with cyrotoxic T-cell epitope (CTL). Such fragments are selected from internal conserved and regulatory proteins, HIV epitopes of T-helper cells (Th), and B-cell epitope. Chimera polyprotein contains fragments of various HIV proteins inducing anti-HIV-1 immune response.

EFFECT: invention useful in HIV treatment and prevention.

7 cl, 10 dwg, 2 tbl, 11 ex

FIELD: gene engineering, virology, veterinary science.

SUBSTANCE: the suggested feline vaccine contains a plasmid that includes gene env, gag/pro or both genes env and gag/pro of feline immunodeficiency virus. This vaccine provides feline immunization against feline immunodeficiency.

EFFECT: higher efficiency.

5 cl, 16 dwg, 22 ex

FIELD: medicine, virology, molecular biology, genetic engineering.

SUBSTANCE: invention relates to nucleic acid constructions and to vaccine preparations containing such construction and to using such preparations in medicine. Nucleotide sequence that encodes HIV-1 gag protein or its fragment containing gag epitope and HIV-1 Nef protein or its fragment containing nef epitope, and RT protein or its fragment containing RT epitope is coupled operatively with heterologous promoter wherein gag sequence is optimized by cordons. This sequence is a component of pharmaceutical composition and used in treatment and/or prophylaxis of HIV-infection and AIDS.

EFFECT: valuable medicinal properties of constructions, protein and pharmaceutical composition.

15 cl, 50 dwg, 22 ex

FIELD: chemistry, organic, viruses.

SUBSTANCE: invention relates to medical and molecular genetics. Three geometric constructions are proposed on the basis of vector plasmid pEGFP-N1, the constructions producing siPHK: inhibitors of reproduction of the human immune deficiency virus of the 1 type. The invention may be used in development of more efficient anti-HIV preparations on the basis of interfering RNAs (siPHK) produced in cells with the aid of administered vector expressing constructions.

EFFECT: obtaining of genetic construction for development of anti-HIV preparations.

3 cl, 1 dwg, 5 tbl, 3 ex

FIELD: chemistry, biochemistry.

SUBSTANCE: invention relates to biotechnology and to methods of producing vaccine preparations with the help of gene engineering and immunology. The invention proposes the expressive plasmid DNA p-BMC-gag (A)-hum, containing an artificial gene gag (A)-hum, for expression of p55 protein in eukaryote cell. The invention can be used in medicine and allied industries ensure a 10-12-fold increase in expression of p55 protein of the human immunodeficiency virus of the 1st type in eukaryote cells.

EFFECT: high-efficiency method of producing vaccine preparations gene engineering and immunology.

1 cl, 2 dwg, 2 tbl, 4 ex

FIELD: medicine, psychiatry.

SUBSTANCE: one should isolate DNA out of lymphocytes of peripheral venous blood, then due to the method of polymerase chain reaction of DNA synthesis one should amplify the fragments of hSERT locus of serotonin carrier gene and at detecting genotype 12/10 one should predict the risk for the development of hallucino-delirious forms of psychoses of cerebro-atherosclerotic genesis.

EFFECT: more objective prediction of disease development.

3 ex

FIELD: biotechnology, medicine, proteins.

SUBSTANCE: invention describes new polypeptide in isolated form relating to subfamily of superfamily human immunoglobulins (Ig-Sf). This polypeptide shows at least 70% of homology level with amino acid sequence of murine molecules CRAM-1 or CRAM-2 regulated by the confluence of adhesive (figures 3, 6 are represented in the claim). Also, invention relates to antibodies showing specificity with respect to the polypeptide. Antibodies and soluble polypeptide can be used for treatment of inflammation and tumors. Invention describes polynucleotide or oligonucleotide encoding the full-size polypeptide or its moiety and represents primer, probe, anti-sense RNA and shows the nucleotide sequence that is identical conceptually with human CRAM-1. Invention provides preparing new adhesive proteins from superfamily Ig-Sf that are regulated at the transcription level in endothelium by effect of tumors. Invention can be used for treatment of different diseases, in particular, inflammatory responses.

EFFECT: valuable medicinal properties of polypeptide.

19 cl, 33 dwg, 1 ex

FIELD: biotechnology, genetics.

SUBSTANCE: invention relates to methods used for detecting low frequency mutations occurrence in gene encoding cytochrome b. Method involves isolation of DNA from known fungi for constructing oligonucleotide probe or primer. Then polymerase chain reaction (PCR) is carried out for assay of binding the nucleotide probe with amplicon generated by this reaction, or the presence of amplicon is detected that is generated as result of PCR using indicated primers. Invention provides rapid and precise detection of mutations conferring resistance of fungus against fungicide.

EFFECT: improved diagnostic methods for detecting mutations.

24 cl, 18 dwg, 14 tbl, 18 ex

FIELD: genetic engineering, molecular biology, pharmacy.

SUBSTANCE: invention relates to methods of genome screening and can be used for identification of pharmacological agent in vegetable extract. Method is realized by treatment of cells with a vegetable extract, isolation of protein or RNA from these cells, identification of isolated protein or RNA wherein their concentration differs from that in untreated cells and detection of compound(s) in indicated vegetable extracts. Then cells are treated with the found compound(s), protein or RNA are isolated from cells treated with this compound(s) and compound(s) are identified that cause the stimulation or inhibition of expression of protein or RNA wherein their concentration differs from that in untreated cells. Invention provides carrying out the characterization of biological properties of vegetable extract and to detect the individual compound(s) that elicit unknown or disclosed biological property of this extract.

EFFECT: improved identifying method.

6 cl

Thrombopoietin // 2245365

FIELD: medicine, molecular biology, polypeptides.

SUBSTANCE: invention describes homogenous polypeptide ligand mpI representing polypeptide fragment of the formula: X-hTPO-Y wherein hTPO has amino acid sequence of human fragments TPO (hML); X means a amino-terminal amino-group or amino acid(s) residue(s); Y means carboxy-terminal carboxy-group or amino acid(s) residue(s), or chimeric polypeptide, or polypeptide fragment comprising N-terminal residues of amino acid sequence hML. Also, invention relates to nucleic acid encoding polypeptide and expressing vector comprising nucleic acid. Invention describes methods for preparing the polypeptide using cell-host transformed with vector, and antibodies raised against to polypeptide. Invention describes methods and agents using active agents of this invention. The polypeptide ligand mpI effects on replication, differentiation or maturation of blood cells being especially on megacaryocytes and progenitor megacaryocyte cells that allows using polypeptides for treatment of thrombocytopenia.

EFFECT: valuable medicinal properties of polypeptide.

21 cl, 92 dwg, 14 tbl, 24 ex

Up!