The way of increasing the productivity of agricultural animals and the preparation for its implementation

 

(57) Abstract:

The use of genetic engineering, the use of chimeric somatostatin-containing protein to increase meat and/or milk productivity of farm animals. The inventive as immunostimulant used water-insoluble polypeptide containing a fragment chloramphenicolchloramphenicol without the 10 C-terminal amino acids, amino acid spacer (Sp)n type (where n = 1, 2, 4 or 8) and amino acid sequence of somatostatin - 14. Immunization of animals with the composition consisting of the indicated chimeric protein and incomplete adjuvant-blockers, caused them persistent increase in milk yield and/or gain, and increase productivity consisted of specific impacts antisomatostatin immunization and nonspecific effect of the stimulation caused by the immunization procedure. The latter effect, despite its smaller size, can also be used to increase the productivity of farm animals. 2 C. p. F.-ly, 3 tables.

The invention relates to genetic engineering, specifically to the use of chimeric somatostatinergic protein to increase the productivity of CE is practical cost per 1 kg of weight gain is one of the main objectives of the livestock. Know that you can increase the productivity of farm animals by introducing them somatotropin [1,2] However, the high cost of somatotropin makes this option is not always cost-effective, and the use of hormonal drugs to obtain food causes wariness in society. The totality of these reasons somatotropinoma drugs have not yet found wide application in practice of animal husbandry. It is possible, however, to increase the concentration of endogenous anabolic factors impacting their inhibitor somatostatin [1,2]

Somatostatin biologically active tetradecapeptide having the following amino acid sequence, A G C K N F F W K T F T S C, produced in the hypothalamus and the gastrointestinal tract. The sequence of somatostatin -14 highly conservative among vertebrates, and mammals has no species specificity. Somatostatin exerts a strong inhibitory effect on a wide range of hormones and related functions of the body: growth hormone, thyroid stimulating hormone, insulin, glucagon, secretin, gastrin, pepsin, Maletin and a number of regulatory peptides. A broad spectrum of action of somatostatin on the factors necessary for growth and uti the possible economic cost of fodder, etc. In this regard, much interest is an autoimmune response to somatostatin, leading to a decrease in the concentration of peptide in the blood, and, consequently, induction of anabolic factors and accelerate the growth of animals. For lowering the concentration of endogenous somatostatin are active or passive immunization of animals, resulting in the blood appear antisomatostatin antibodies [2]

Somatostatin is a low molecular weight protein-hapten, the half-life in blood is a few minutes. Therefore, immunization with somatostatin use it conjugates with different proteins. It should be emphasized that this approach allows to obtain organic food, because it is not associated with the use of any drugs direct hormonal action and antibiotics, and is based on small changes in the concentrations of endogenous protein anabolic factors in elite, high-yielding instances of animals [2]

Numerous studies showed that immunized with somatostatin animals showed increase in average daily gain of 10-20% decrease appetite by 9% and increase in the efficiency of utiliz what about the gastro-intestinal tract when more sluggish peristalsis. Immunized with somatostatin animals and their offspring, have the right proportions and weight distribution of animals between muscles, bones and fat is the same as in the control [1, 2] Immunization of pregnant goats leads to an increase of 10% weight newborns and increase milk yield.

However, the practical distribution of livestock antisomatostatin immunotherapy is not received, due to the high cost of medications chemically synthesized somatostatin ($48 for 1 mg catalog company Sigma 1992. ) Because the small size of the somatostatin-14 does not allow its direct microbial synthesis using recombinant DNA technology described several attempts to carry out the synthesis in the form of a chimeric protein with the specific visiblename target product, not given, however, satisfactory results [3, 4] the Main disadvantage of the above-described chimeric proteins was very low immunogenicity against somatostatin, due, most likely, his mask in the molecule chimeric protein, therefore, these proteins did not find application in agricultural or medical practice.

Us razrabotena (Sp), contains arginine and Proline (RF) and determining the localization of somatostatin (S) on the surface of carrier protein and the high immunogenicity. The design consists of a water-insoluble protein carrier (fragment of bacterial chloramphenicolchloramphenicol without the 10 C-terminal amino acids (PC), tetramer spacer (RF)4and C-terminal somatostatin-14 with the General formula RS(Sp)4S. Molecular weight of such a chimeric protein according to electrophoresis in SDS page is 28 kDa.

Plasmid construction, programming such a chimeric protein size 4912 p. N. containing ScaI-BamHI fragment of plasmid vector pBR 325 size 4828 p. N. comprising part of the gene of resistance to tetracycline with site restrictase BamHI at the 5'end of the gene of resistance to ampicillin; part of the gene chloramphenicolchloramphenicol with polyatom ScaI restriction on the 3'-end and eliminated the site restrictase EcoRI;

SmaI EcoRI fragment linker containing the restriction site EcoRI and flanked with 5'-end nucleotide sequence GGG poluchit SmaI for articulation with the 3' end of the gene chloramphenicolchloramphenicol site ScaI;

EcoRI* -BglI fragment adapter for connection with the sequence of the spacer (Sp) size 9 p. N.


ACCCGGGGCCGGGGCCGGGGCCGGGGCCGGCCTTAA

EcoRI-BamHI fragment of the synthetic gene, the somatostatin-14 with a "stop"codon, size 54 N. p.

AATTCATGGCTGGTTGCAAAAACTTCTTCTGGAAAACCTTCACGTCTTGCTAGG

GTACCGACCAACGTTTTTGAAGAAGACCTTTTGGAAGTGCAGAACGATCCCTAG

genetic marker: a gene of resistance to ampicillin;

one area of cleft restrictase BamHI, which was taken as 0 point;

one area of cleft restrictase SalGI, located at a distance of 276 p. N. clockwise from the BamHI site;

one area of cleft restrictase > PST, located at a distance 3236 p. N. clockwise from the BamHI site;

one area of cleft restrictase NcoI, located at a distance 4712 p. N. clockwise from the BamHI site;

one area of cleft restrictase BglII, located at a distance 4840 p. N. clockwise from the BamHI site;

one area of cleft restrictase Bsp1201, located at a distance 4846 p. N. clockwise from the BamHI site;

one area of cleft restrictase EcoRI, located at a distance 4876 p. N. clockwise from the BamHI site. (4)

Above the spacer, the media adapter and a gene for somatostatin-14 was synthesized, were cloned in the plasmid by standard methods.

This chimeric ban collection PMBC number In-6519.

Chimeric block with the exposed somatostatin is a water-insoluble enzyme inactive chloramphenicolchloramphenicol without 10 terminal amino acid residues, which through spacer elements sequence (RF)4the attached sequence of somatostatin-14.

Analysis of expression of genes coding for somatostatin in the composition of the hybrid proteins is carried out in the E. coli cells D 3207. Hybrid genes comprising expressing vectors pC(Sp)nS in E. coli cells MKD 3207 determine the constitutive synthesis under the control of its own promoter CAT. E. coli cells MKD 3207 transformed by the plasmid pC(Sp)4S, grown in LB medium containing ampicillin (50 μg/ml), to the density OD5502.0 to 2.5 at 37aboutC for 18 h In the quality control use the original plasmid pCCS encoding a chimeric protein CAT-somatostatin under the control of own Pcat. From 1.5 ml of the cell culture by centrifugation receive sediment cells, which are suspended in 200 μl of buffer solution containing 50 mm Tris-Hcl, pH 6.8, 10% glycerol, 2% SDS and 2% mercaptoethanol. The suspension is boiled for 5 min and analyzed by electrophoresis in 15% SDS-PAG. The results show the presence of dominant bands mo the proteins.

To highlight a hybrid protein with the sequence of somatostatin, E. coli cells, MKD 3207 transformed by the plasmid pC(Sp)4S, cultivated in the medium of LD as described above in the fermenter to the density OD5504,0-5,0. Cells precipitated by centrifugation at 5 thousand g 10 minutes the Precipitate of cells suspended in 50 mm Tris-Hcl, pH 8.0, containing 50 mm NaCl, 10 mm EDTA based 38 ml of buffer biomass from one liter of cell culture. After suspension add lysozyme to a final concentration of 100 μg/ml Triton-X100 to a concentration of 0.1% and incubated suspension in ice. Cells destroy ultrasound. Sediment Taurus-inclusions containing water-insoluble hybrid protein is obtained by centrifugation at 12 thousand g 10 min at 4aboutC. washed twice with buffer containing Triton, centrifuged and resuspended in the original buffer without Triton. Selected aliquots and analyzed in 15% SDS-PAG electrophoresis. As a result of this cleanup procedure receive the preparation of the hybrid protein having a purity of 90% of the total protein precipitate.

This method of isolation and purification of the hybrid protein adapted for use at a later secreted protein as drug-promoter in animal husbandry.

The purpose of the infusion of the material mode of immunization, elucidation of possible side effects and to determine the maximum stimulating effect on meat and milk production and its possible mechanism.

P R I m e R 1. Preparation of chimeric somatostatinergic protein for immunization.

The purified preparation of the protein derived from water-insoluble Taurus inclusions, as described above, is dissolved in buffer 0.2 M Tris-HCl pH 8.0, containing 6 M guanidinium and 2 mm EDTA, add 50-fold molar excess of mercaptoethanol in the calculation of the number of S-S groups chimeric protein, and the solution is quickly diluted 10-fold volume of buffer without handinhand. The resulting hybrid protein precipitate is separated by centrifugation for 15 min at 12000 g at 4aboutC and freeze-dried for storage. Directly before use, the lyophilized drug resuspended in a minimum volume of 10 mm phosphate buffer pH 7.0, and then click finish oil-water suspension with incomplete adjuvant's adjuvant at the ratio of protein-adjuvant 1:1, homogenize short sound. Immunization is carried out by intramuscular injection of a suspension in the neck or shoulder at a dose of 50 μg of the chimeric protein per 1 kg of live weight. Carried the th period, a further 1-2 booster immunization with the to increase the productivity of animals to the desired level in the later stages of the content.

P R I m m e R 2. The drug chimeric somatostatin - containing protein to increase productivity.

2A. Milk production of cattle.

The drug is administered to pregnant heifers black-motley breed at the age of 24-25 months approximately 50 days before calving, determining the period of pregnancy rectal examination. Dose of 50 mg/1 kg of live weight, injections are repeated three times with two week intervals in the neck or shoulder. In these conditions appears in the blood antisomatostatin Antilla, and the immunized animals did not show any signs of toxicity, including no violations of reproductive functions (abortion, dead birth, malformations, etc).

As can be seen from the data table. 1, the immunized animals after calving until the 60-day observation noted a significant increase in milk yield in cows immunized with chimeric protein with somatostatin: on day 14, this difference reached 21% and was maintained at the level of 9-13% and the scatter of the data does not exceed 1,5-3,0% Booster injection of chimeric proteins in this case did not.

Techenie the first 30 days after calving, exceed such animals immunized with a synthetic somatostatin, conjugated with bovine serum albumin (p. 3 of table.1).

2B. Application for pigs.

The drug is administered to pregnant sows of large white breed approximately 50 days before farrowing. The drug is administered in a dose of 50 μg per 1 kg of weight of animal intramuscularly in the neck region. The immunization is carried out three times in two weeks.

The immunized animals not observed manifestations, indicating the toxicity of the drug, including no violations of reproductive functions (abortion, dead birth, malformations, etc).

The body weight of piglets in the experimental group 1.5 times higher than in the control (see table.2).

In the experiment were used drugs protein C(Sp)4S and C(Sp)8S. the results of the experiments for both medications were approximately the same.

P R I m e R 3. Factors stimulating the productivity of agricultural animals subjected to antisomatostatin immune.

As can be seen from the data table.3, along with a significant increase in meat and milk productivity of animals in their immunization chimeric protein with somatostatin, has Malcom carrier. This stimulatory effect may be associated with repeatedly observed in the scientific literature stimulation of life and productivity of animals under the influence of the immunization, regardless of the nature of the immunogen. However, in the vast majority of these works were used not individual preparations of purified proteins, and various Polyethene complexes of unidentified composition from cell extracts and biological fluids to the mixture of organic substances like river silt, which eliminates the possibility of an unambiguous interpretation of the results. Thus, the ultimate effect of increasing the productivity of farm animals by immunization somatostatinomas chimeric protein consists of specific actions antisomatostatin response and nonspecific effect of immunization with a carrier, and immunization with a protein carrier, despite less stimulating effect, can also be used independently in economic practice.

1. The way of increasing the productivity of farm animals, involving the injection of an animal drug that contains a carrier protein, somatostatin and adjuvant, otlichnoi chloramphenicolchloramphenicol without 10C-terminal amino acids, amino acid spacer (Sp)nwhere n is 1, 2, 4 or 8, and somatostatin-14 amino acid sequence AGCFWKTFTSC, and it is injected intramuscularly at least three times with two week intervals.

2. The drug is to increase the productivity of farm animals, containing a carrier protein, somatostatin and adjuvant, characterized in that it contains a chimeric protein with a water-insoluble enzyme inactive chloramphenicolchloramphenicol without 10C-terminal amino acids, amino acid spacer (Sp)nwhere n is 1, 2, 4 or 8, and somatostatin-14 amino acid sequence AGCFFWKTFTSC in an effective amount.

 

Same patents:

The invention relates to medicine, namely to in vitro methods of extraction of specific antibodies from the blood and can be used in rheumatology and biotechnology

The invention relates to medicine, namely to sanitation, and can be used to control pollution by products of microbiological production

The invention relates to the field of livestock and can be used for the transportation of slaughter cattle for meat production animals from farms suppliers of industrial complexes and feedlots, and other technological stresses arising during the period of breeding, rearing and fattening of young cattle

The invention relates to veterinary medicine, in particular to the prevention of slow virus diseases in animals

The invention relates to animal husbandry and veterinary medicine and is intended for use in the formation of herds of cattle resistant leukemia

The invention relates to animal husbandry, in particular to the breeding of animals, and can be used on pig farms and complexes

The invention relates to proceratiinae, in particular to methods of incubation and can be used in forestry and agriculture for the conclusion of viable juveniles of different species of birds

The invention relates to animal husbandry and aimed at improving the fertilizing ability of cows and reducing the duration of the period from calving to fruitful insemination

The invention relates to agriculture, particularly dairy cattle breeding

FIELD: animal science.

SUBSTANCE: the present innovation deals with dynamic loading onto cardio-vascular system in animals. Selection should be carried out by the following parameters: , ΔT3 and Δn, where ΔT1 - the time for pulse increase at running, ΔT2 - the time for pulse stabilization after running, ΔT3 - the time for pulse increase after running, Δn - the increase of pulse frequency after running. One should select animals into milking herd at the following values; ΔT3 ≤ 10 sec, Δn ≤ 10 beats/min. The method enables to present perspective evaluation of lactation capacity in animals.

EFFECT: higher efficiency of selection.

1 dwg, 1 ex, 1 tbl

FIELD: veterinary.

SUBSTANCE: method comprises introducing glauconite into diet of milk cows in ecologically unfriendly zone in amount corresponding to 0.15-0.20 g per 1 kg cow's weight once a day over a 25-30 day period.

EFFECT: reduced level of lead both in body and in blood of cows.

3 tbl

FIELD: veterinary medicine.

SUBSTANCE: method involves interpreting dynamic omega potential behavior pattern relative to its initial level during 6-7 min after applying artificial pain irritation. The method is applied beginning from animal age of 1 month. Omega potential is measured before and after pain irritation test. Omega potential level growing down, the animal is considered to be of low stress stability. Omega potential level growing high, the animal is considered to be of high stress stability.

EFFECT: enhanced effectiveness of method.

2 dwg, 2 tbl

FIELD: veterinary medicine.

SUBSTANCE: poultry's diet during the first and second phases of egg yield should be supplemented with roxazym enzymatic complex at the ratio towards husk-bearing components being 0.007 - 0.009 : 20. The present innovation prevents inflammation of oviducal vagina in laying hens.

EFFECT: higher efficiency of prophylaxis.

3 ex

FIELD: poultry science, poultry selection.

SUBSTANCE: the method deals with evaluating egg shell pigmentation in 30-wk-aged hens of maternal stock followed by selecting the youngsters obtained from these hens. Two weeks before finishing the process hens should undergo stress impact to re-evaluate their egg shell pigmentation. Poultry offspring that changed the values of chromaticity by 2 points and higher should be rejected. The innovation enables to increase efficiency of selecting hens for higher safety and egg yield.

EFFECT: higher efficiency of selection.

1 ex

FIELD: veterinary science.

SUBSTANCE: the suggested preparation contains condensate obtained after distillation with urinary vapor of sows being in heat, acetic acid, butyric acid, caproic acid at the following ratio of components, weight%: acetic acid 0.5-2.0, butyric acid 5.0-20.0, caproic acid 0.5-5.0, condensate - the rest up to 100. The preparation is of high biological activity.

EFFECT: higher efficiency.

1 ex, 1 tbl

FIELD: poultry science.

SUBSTANCE: the present innovation deals with visual evaluation in chicken followed by testing them by the value of bioelectric potential. Chickens with bioelectric potential being significantly higher against average values are considered to be stress-resistant ones and those with bioelectric potential being significantly lower against average values in concrete population are concluded to be stress-sensitive ones. The method is very simple in its implementation and efficient for large-scale selection in poultry on stress-resistance.

EFFECT: higher efficiency.

1 cl, 2 dwg, 2 ex, 4 tbl

FIELD: animal science.

SUBSTANCE: the suggested biopreparation named "Lactobifadol" should be applied 1 mo before the impact of the mentioned stress factor at the dosage of 100-200 mg/kg body weight, daily. Application of "Lactobifadol" enables to normalize physiological body state and decrease the losses of meat production.

EFFECT: higher efficiency of prophylaxis.

1 ex, 2 tbl

FIELD: animals science.

SUBSTANCE: the present innovation deals with intramuscular injection of sodium salt preparation cloprostenol 30-45 min before placing at the dosage of 750 mcg/animal. The method provides increased reproductive function, enhances sexual reflex, increases the volume of ejaculate, concentration, activity and quality of spermatozoa.

EFFECT: higher efficiency of breeding.

2 ex, 3 tbl

Up!