|
Nutrient medium for detection of necrobacillosis pathogen Nutrient medium for detection of the necrobacillosis pathogen comprises medium 199, blood serum of cattle, and 40% glucose solution at a predetermined ratio of components. |
|
Bacterial strain komagataeibacter xylinus - bacterial cellulose producer Invention refers to biotechnology. The strain Komagataeibacter xylinus is deposited in Russian National Collection of Industrial Microorganisms (VKPM) under VKPM registration No. B-12068. Bacterial cellulose is applicable in plastic surgery, tissue regeneration and skin repair. |
|
Strain of legume bacteria bradyrhizobium japonicum for production of bacterial fertiliser for soy Strain of legume bacteria Bradyrhizobium japonicum VKM B-2629D for production of bacterial fertiliser for soy is offered. |
|
Biological preparation for decontamination of soil and slimes from oil and oil products Biological preparation contains the hydrolyzate containing a product of anaerobic fermentation of mix of leaves of plants, beet or reed molasses and water taken in the pre-set ratios, and the cultural liquid formed during of obtaining of microbic mass of native carbon-oxidising microorganisms at the pre-set ratio of components. |
|
Lyophilised nutrient medium for visual identification of ureaplasma urealyticum Invention offers the nutrient medium for visual identification of Ureaplasma urealyticum containing a nutritious base, growth stimulators, carbamide, selective components, horse serum, pH indicator and distilled water. The nutritious base is fermentative peptone, placental broth, PPLO broth and sodium chloride, the growth stimulator is barmy extract, as selective additives are antibiotics and antifungal preparation and pH indicator is phenol red indicator. |
|
Strain of staphylococcus aureus bacteria used as test-culture to select antibacterial agent Strain of Staphylococcus aureus 113 bacteria having anti-lysozyme activity is deposited in state collection of microorganism and normal flora of FBIS MNIIEM named after G.N. Gabrichevsky of Rospotrebnadzor under registration No. 1253, and can be used to select the antibacterial agents suitable for effective struggle with long-lasting pathogen staphylococcus. |
|
Streptococcus salivarius strain vkpm v-11174, obtained on available medium Strain Streptococcus salivarius M-11 with high antagonistic activity is deposited in the All-Russian Collection of Industrial Microorganisms under the registration number VKPM V-11174 and can be used for production of fermented milk products. |
|
|
Method of production of bacterial concentrate Method provides for preparation of the culture medium based on clarified caseous serum, sterilisation and cooling. After cooling to the culture medium 3-5% of buckthorn oil and activated culture of propionate bacterium Propionibacterium freudenreichii "Ш85" are added. Cells growth, bacterial mass separation from culture fluid are performed with suspension production. The produced suspension is developed, sealed and cooled. |
|
Invention relates to biotechnology and the Francisella tularensis 15/23-1ΔrecA strain, as well as a method of producing same. The described strain is genetically labelled: has only one copy of the iglC gene and a deleted recA gene. The strain is obtained from the Francisella tularensis 15 NIIEG vaccine strain through successive allelic exchange of one of the two copies of the iglC gene then the recA gene on their deleted versions using a suicide vector plasmid, which is inserted into the cell of the strain by transformation followed by collection of F. tularensis strain cells based on a chloramphenicol resistance attribute and further selection of modified strains on a medium with saccharose. |
|
Bifidobacterium longum atcc baa-999 (bl999) and weight control Invention relates to application of composition, containing Bifidobacterium longum ATCC BAA-999, for supporting weight reduction or weight preservation in sexually mature people and animals. |
|
Authentication method of dairy products Group of inventions relates to biotechnology. A method for identifying the presence or absence of a lactic acid bacterial strain comprising an IS element in a dairy product. The method comprises obtaining a nucleic sample from a dairy product, providing a primer pair specific for a region of said uniquely located IS element and a region of a nucleic acid sequence adjacent to said uniquely located IS element, performing a PCR amplification reaction with said primer pair, identifying the presence or absence of a lactic acid bacterial strain by detecting the presence or absence of said amplification product. The lactic acid bacterial strain is the Pediococcus acidilactii under accession DSM 22981 and a primer pair comprising a first primer of SEQ ID NO: 1 and a second primer of SEQ ID NO: 2 and/or a lactic acid bacterial strain Lactobacillus delbrueckii subsp.lactis under accession No DSM 24025, and a primer pair comprising a sixth primer of SEQ ID NO: 6 and a seventh primer of SEQ ID NO: 7. The said lactic acid bacterial strains may be used for the marking of dairy products. Proposed are new bacterial strains, their use in the production of dairy products as well as the dairy products containing these bacterial strains. Proposed is a kit for the specific detection of a lactic acid bacterial strain, comprising a said primer pair. |
|
Streptococcus thermophilus strain used for production of fermented milk products Strain Streptococcus salivarius Bo4-I with high antagonistic activity is deposited in the All-Russian Collection of Industrial Microorganisms under the registration number VKPM V-10893 and can be used for production of fermented milk products and pro-biotic preparations. |
|
|
Strain Lactobacillus plantarum B2-II with high antagonistic activity is deposited in the All-Russian Collection of Industrial Microorganisms under the registration number VKPM V-10816 and can be used for production of fermented milk products and pro-biotic preparations. |
|
|
Strain Streptococcus salivarius M-9 with high antagonistic activity is deposited in the All-Russian Collection of Industrial Microorganisms under the registration number VKPM V-11177 and can be used for production of fermented milk products and pro-biotic preparations. |
|
|
Enterococcus strain hirae vkpm v-11173 used for obtaining of fermented milk products Strain Enterococcus hirae O-45 with high antagonistic activity is deposited in the All-Russian Collection of Industrial Microorganisms under the registration number VKPM V-11173 and can be used for production of fermented milk products. |
|
|
Strain enterococcus durans used to produce sour-milk products and probiotic specimens Strain Enterococcus durans C-45 having high antagonist activity is deposited in All-Russia Collection of Industrial Microorganisms under registration No. VKPM B-11171, and can be used during production of sour-milk products and probiotic specimens. |
|
|
Invention relates to field of biotechnology. Claimed is strain Micrococcus sp. VKM Ac-2632D, intended for reduction of content of total nitrogen, ammonium-ion, iron and aluminium in sewage water of treatment facilities of industrial enterprises. |
|
Lactococcus lactis strain for treatment or prevention of digestion disorder and thereof application Group of inventions relates to strain Lactococcus lactis CNCM I-2807, intended for treatment or prevention of digestion disorder, and its application. Strain Lactococcus lactis CNCM I-1631 can also be applied for treatment or prevention of digestion disorder. Diameters of zones of inhibiting pathogenic organisms E. coli, L. monocytogenes and S. enteritidis in incubation with strain Lactococcus lactis CNCM I-1631 constitute more than 6 mm. After 4 hours of incubation with apical part of monolayer of T84 cells value of transepithelial electric resistance constitutes 108.54% for strain Lactococcus lactis CNCM I-2807 and 110.90% for strain Lactococcus lactis CNCM I-1631. |
|
Method of production of biomass containing plantaricyne and its use for medical purposes Strain of lactobacillus Lactobacillus plantarum DSM 23213 and strain of lactobacillus Lactobacillus rossiae DSM 23214 are suggested, their joint cultivation activates synthesis of plantaricyne A, K and N and production of the product containing plantaricyne A, K and N. Product is produced by cultivation of the said strains, co-inoculation by water suspension of substrate lactobacillus, incubation at 30-37°C, preferably 30°C for 18-24 h, preferable 18 h. Said suspension has cell density about 9.0 log CFU/ml for each type of lactobacillus, and is added to the substrate in percentage ratio to volume of substrate from 1 to 4%. The produced product is used as part of pharmaceutical and cosmetic compositions, and during manufacturing of the medicament to increase barrier function of the epidermis or intestine, or for wound repair. |
|
Method of detecting lipase-producing microorganisms in confectionary products Invention relates to microbiology and can be applied for detection of lipase-producing microorganisms in confectionery products. Method of detecting lipase-producing microorganisms in confectionary products includes sampling, preparation of initial dilution of sample from sample and a series of tenfold dilutions with the following inoculation in two parallel Petri dishes. Inoculations are poured with nutrient medium, which contains peptone, sodium chloride, calcium chloride, agar, fatty emulsion and alcohol blue dye in specified ratio of components and are incubated at temperature 30±1°C for 48±3 h in aerobic conditions. After incubation of inoculations performed is calculation of colonies of typical microorganisms, which produce lipolytic enzymes, to which colonies, which have blue coloration around and/or under them, and/or white dimness of medium, are referred to. |
|
Method of differentiation of plague and pseudotuberculosis pathogens as per N-acetyl-beta-D-glucosaminidase activity provides for production of the suspension of agarinic culture of studied bacteria in concentration (1-5)×109 microcolonies, preparation of synthetic substrate, for this 4-methylumbelliferil-N-acetyl-β-D-glucosaminide is used in amount of 50 mcM. The substrate is dissolved in 2 ml of dimethylformamide. From the produced solution 0.6 ml are taken, and 9.4 ml of 0.1 M phosphate buffer pH 7.4 is added. 20 mcl of prepared solution are mixed with droplet 0.05 ml of suspension of agarinic culture of bacteria in the physical solution in Petri dish. The obtained mixture is incubated for 10-20 minutes at 37°C, then reaction is terminated by addition of 5 mcl of 10 n. alkali solution. Differentiation in UV rays of transilluminator is performed at 366 nm. Bright fluorescence of blue colour is evidence of positive result of the reaction, and confirms that studied strain hydrolyses the prepared substrate and belongs to Yersinia pseudotuberculosis. Absence of incandescence confirms the strain belonging to Yersinia pestis. |
|
Burkholderia cepacia V-7518 strain with typical and stable cultural, tinctorial, biochemical properties is described. |
|
Stenotrophomonas maltophilia strain is deposited in the State collection of pathogenic microorganisms and cell cultures "GKPM-Obolensk" under the registration number V-7520. |
|
Method of obtaining of copolymer of 3-hydroxybutyrate and 3-hydroxyhexanoate Method of obtaining of copolymer of 3-hydroxybutyrate and 3-hydroxyhexanoate is offered. The method includes the cultivation of the strain producer Cupriavidus eutrophus VKPM V-10646 in conditions of aeration and stirring in liquid salt water with glucose. At the beginning of the process of fermentation the limiting concentration of sulphur compounds are used , also the substratum-predecessor is added - potassium hexanoate, at the concentration 1 g/l and inhibitor of reactions of beta oxidation cycle - acrylate, at the concentration 0.5-1.0 g/l partially 2-3 times within 1.5-2.5 h. Total duration of the process is 45 hours minimum. |
|
Consortium of microorganisms Exiguobacterium mexicanum VKPM V-11011 and Bacillus vallismortis VKPM V-11017 taken in the ratio 1:1 for cleaning of various types of cryosolic soils from oily wastes is offered. |
|
Method of obtaining of copolymer of 3-hydroxybutyrate, 3-hydroxyvalerate and 4-hydroxybutyrate Method of obtaining of copolymer of 3-hydroxybutyrate, 3-hydroxyvalerate and 4-hydroxybutyrate is offered. The method includes the cultivation of the strain producer Cupriavidus eutrophus VKPM V-10646 in conditions of aeration and stirring in liquid salt medium. The main carbon substratum is glucose or oleic acid. The liquid salt medium contains yeast extract in the concentration 2 g/l. The additional source of carbon are substrata-predecessors in the form of potassium valerate in the concentration 1.0-2.0 g/l and gamma-butyrolacton in the concentration 1.5-2.5 g/l, and the additional source of carbon is added at the first stage of fermentation process gradually within 1.5-2 h at total duration of the process 32 hours minimum. |
|
Method of obtaining of biomass of activated autochthonic microorganisms-biodestructors of N-phosphon methyl glycine (glyphosate) is offered. Before cultivation the composition of the liquid medium is added by 0.05-0.4 mcg·cm-3 of glyphosate and perfluordecalin emulsion stabilized by the emulsifier monostearate sorbitan. The final content of perfluordecalin in the liquid nutrient medium is 1.0% by weight, a monostearate sorbitan - 0.0005% by weight. Throughout all the cycle of cultivation fractionally, with the interval 2-4 hours, glyphosate is added with the increment 1.25-2.5 after each addition, starting from the amounts of glyphosate equal to its initial contents in the cultural medium. |
|
Biopreparation for bioremediation of oil-contaminated soils for climatic conditions of far north Biopreparation is proposed for the bioremediation of oil-contaminated soils for the climatic conditions of the Far North. The biopreparation comprises a solid substrate-carrier and a consortium of hydrocarbon-oxidizing microorganisms immobilized on its surface, comprising strains of Bacillus vallismoris RNCIM B-11017, Exguobacterium mexicanum RNCIM B-11011, Serratia plymuthica VKM B-2819D, Rhodococcus sp. VKM Ac-2626D, and the mineral nutrient substrate for bacteria. |
|
Claimed are strain Lactobacillus plantarum DSM 23755, strain Lactobacillus plantarum DSM 23756,strain Lactobacillus fermentum DSM 23757 and strain Lactobacillus fermentum DSM 23758, used for preparation of product, based on fermented soya, which includes isoflavone-aglycones, equol and lunasin. Mixture of said four strains can also be used for preparation of said product. To obtain it said mixture of four strains of lactic bacteria are cultivated, inoculation of obtained after cultivation water suspension of lactic bacteria into soya-based substrates with further incubation at 30-37°C, preferably 30°C, for 48-96 h, preferably 96 h, is realised. Product, obtained by claimed method is intended for treatment of hair loss. |
|
Method of production of biocomposite Method comprises culturing a strain of bacteria Gluconacetobacter sucrofermentans RNCIM B-11267 under static conditions on the after-alcohol distillery grain followed by obtaining a gel film of bacterial cellulose. The obtained gel film of bacterial cellulose is placed in the solution of antibiotic sodium fusidine in the concentration of 2-200 mg/ml for 5 h and dried at room temperature to obtain the biocomposite. |
|
|
K5 heparosan fermentation and purification Method of producing substantially pure heparosan from E.coli K5, comprises culturing E.coli K5 in a medium with glucose as the primary carbon source, binding heparosan to a solid-phase carrier with subsequent elution and precipitating heparosan from the eluate. Said culturing includes batch culturing phase and a batch fed culturing phase. The medium used at the batch culturing step contains (per litre) about 20 g glucose, 10-300 mg thiamine, about 13.5 g KH2PO4, about 4.0 g (NH4)2HPO4, about 1.4 g MgSO4·7H2O, about 1.7 g citric acid, and about 10.0 ml solution of trace elements, the solution of trace elements substantially consists of (per 1 l 5M HCl) 10.0 g FeSO4·7H2O, 2.0 g CaCl2, 2.2 g ZnSO·7H2O, 0.5 g MnSO4·4H2O, 1.0 g CuSO4·5H2O, 0.1 g (NH4)6Mo7O24·4H2O and 0.02 g Na2B4O7·10H2O. The feed medium used at the batch fed culturing step contains (per litre): 250-1000 g glucose, 20 g MgSO4, 0.15-0.5 g thiamine and, optionally, 47 g KH2PO4. Oxygen is supplied by bubbling air with or without additional supply of oxygen. |
|
Bile resistant bacillus composition secreting high levels of essential amino acids Group of inventions relates to a method of screening and isolating Bacillus subtilis cells, an animal feed supplement composition containing said cells and an animal feeding method. The method includes collecting and isolating Bacillus subtilis spore cells, characterised by rapid germination and growth in the presence of a medium with 4 mM or 6 mM bile salts, obtaining vegetative cells from the spore cells, UV mutation of said vegetative cells, collecting and isolating vegetative Bacillus subtilis cells, characterised by a high level of producing at least one essential amino acid, analysing the obtained vegetative Bacillus subtilis cells to confirm maintenance of germination and growth in the presence of a medium with bile salts and isolating the collected Bacillus subtilis cells. The obtained cells are added in amount of 105 to 1012 CFU/g to the feed supplement composition. The method of feeding an animal includes administering said feed supplement composition to an animal along with other feed ingredients. |
|
Strain of bacteria exiguobacterium sp. - decomposer of crude oil and petroleum products Bacterial strain Exiguobacterium sp. ELA-6, having the ability to dispose of crude oil and petroleum products, is deposited in Federal State Institution of Science the Institute of Biochemistry and Physiology of Microorganisms of RAS under the registration number RNCM B-2813D and can be used to purify soil and water reservoirs contaminated with crude oil and petroleum products, in a wide temperature range from +4 to +30°C. |
|
Probiotic composition for application in treatment of intestinal inflammation Group of inventions relates to biotechnology. Claimed are strains of Lactobacillus plantarum CECT 7484, Lactobacillus plantarum CECT 7485 and Pediococcus acidilactici CECT 7483, demonstrating anti-inflammatory activity, immunomodulating activity, activity with respect to IBS or activity with respect to abdominal distension. Also claimed is pharmaceutical composition, containing effective amount of at least one strain, selected from the ones mentioned above, as well as pharmaceutically acceptable excipients. Effective amount of said composition can be used in prevention or treatment of intestinal inflammation, inflammatory bowel disease (IBD), irritable bowel syndrome (IBS), distension and bloating of abdomen in animals, including humans. |
|
Present invention relates to biotechnology and provides methods of producing isoprene by culturing recombinant cells of fungi or microorganisms. Said cells optionally contain a heterologous isoprene synthase polypeptide and at least one nucleic acid which encodes at least one mevalonate (MVA) pathway polypeptide, such as an acetyl-CoA acetyltransferase polypeptide, 3-hydroxy-3-methylglutaryl-CoA-synthase polypeptide, 3-hydroxy-3-methylglutaryl-CoA-reductase polypeptide, mevalonate kinase polypeptide, phosphomevalonate kinase polypeptide and diphosphomevalonate decarboxylase polypeptide. Said cells produce more than 400 nmol/gwcm/hr of isoprene. |
|
Radioactive raw materials containing radioactive chemical elements or their isotopes, are treated with an aqueous suspension of bacteria of Thiobacillus in the presence of elements with variable valence. The radioactive raw materials are used as ores or radioactive wastes of nuclear cycles. The method is implemented to obtain polonium, radon, francium, radium, actinium, thorium, protactinium, uranium, neptunium, americium, nickel, manganese, bromine, hafnium, ytterbium, mercury, gold, platinum, and their isotopes. |
|
Bacteriorhodopsin obtaining method Bacteriorhodopsin obtaining method provides for growth in a fermenter of Halobacterium salinarum VKPM V-11953 strain during six days with further separation of biomass by centrifugation and its destruction at incubation in distilled water during one night at constant stirring. The deposit is separated by centrifugation so that a supernatant is obtained. The obtained supernatant is centrifuged and rejected. Distilled water is added to the obtained deposit in the same volume; the deposit is suspended in water for 3-4 times. After that, the deposit is applied onto a chromatographic column with silica gel based on 200 optic units in an application specimen at wave length of 280 nm per 100 ml of silica gel. After elution is completed, specimens are taken with the ratio of optic density of the solution at wave length of 280 nm to optic density of the solution at wave length of 570 nm (D280\D570) of less than 2.5. |
|
Method of culturing listerious microbe comprises preparing the nutrient medium containing the mother solution of leaf lettuce juice, agar and phosphate buffer in a predetermined ratio. On the prepared nutrient medium Listeria monocytogenes is applied and cultured at a temperature of 20-22°C for least 24 hours. At that the mother solution of leaf lettuce juice is prepared by sequential washing it with tap water and sterile water, followed by drying at room temperature, grinding and squeezing of juice from the resulting mass. |
|
Method of preparation of cultures of sulphide-bearing bacteria for dna extraction Method of preparation of cultures of sulphide-bearing bacteria for DNA extraction is offered. In the method 15 ml of cultural liquid are used. The cultural liquid is centrifuged at 1000 rpm. The triple washing of cells with phosphatic and salt buffer in the ratio 10:1 is performed. Mixing is performed within 10 seconds and centrifugation is conducted at 1000 rpm within 10 minutes. |
|
Inventions refers to veterinary microbiology and concern oligonucleotide primers for identifying serogroup D Pasteurella multocida bacterial strains and isolates, as well as a method using them. The presented method involves recovering microbial culture from a pathologic material on artificial nutrient media. That is followed by carrying out a polymerase chain reaction with synthetic oligonucleotide primers having the sequences SEQ ID NO:1 - 5' catcgcatccagaatagcaaact 3', SEQ ID NO:2 - 5' ctccgatgctttggttgtg 3' per dcbF gene region responsible for heparosan synthetase synthesis. The amplification product is gel transferred, and the reaction process is assessed. If the reaction appears to be positive, a fragment having a size of 355 base pairs is synthesised. |
|
Invention relates to biochemistry. disclosed is an agent in the form of a Rhodococcus wratislaviensis VKM Ac-2623D strain for cleaning soils contaminated with hexachlorobenzene, lindane, dichlorodiphenyltrichloroethane, dichlorodiphenyldichloroethane, trillate and phthalates (dibutyl phthalate, dioctyl phthalate). |
|
Claimed is strain of Streptomyces flavogriseus, capable of producing antibiotic complex, containing hexaenoic antibiotic of mediocidin subgroup and non-polyene antibiotic of heterocyclic structure. Strain is deposited in ARCIM under number AC-1947. |
|
Nutrient medium for growing microorganisms deinococcus radiodurans Nutrient medium comprises soybean milk, glucose, MgSO4×7H2O, MnCl2, FeSO4×7H2O and distilled water in a predetermined ratio of components. |
|
|
Strain of bacteria bacillus stratosphericus intended to produce ethanol from lignocellulosic biomass Strain of bacteria Bacillus stratosphericus Sol. NK 2, having the ability to produce ethanol, is deposited in RNCM under the registration number RNCM B-11678. The strain can be used for industrial production of ethanol, as well as in food industry, medicine, agriculture for feed production. |
|
|
Strain of bacteria bacillus stratosphericus capable to produce ethanol from lignocellulosic biomass Strain of bacteria Bacillus stratosphericus RNCIM B-11677, producing ethanol from lignocellulosic biomass, is proposed. |
|
|
Invention relates to biotechnology and concerns strain Rickettsia sibirica subsp. sibirica. Described use of strain R. sibirica subsp. sibirica "Primorye-32/84" of genotype BJ-90, deposited in the All-Russian museum of rickettsial cultures of FGBU NIIEM named after N.F. Gamalei with the accession number of 160, for the development of the preparations for diagnostics of rickettsioses caused by Rickettsia sibirica subsp. sibirica BJ-90. The strain was isolated in the RF from imago ixodic ticks D. silvarum, collected in Primorsky Krai in 1984. The strain is a pathogen for guinea pigs, successfully cultivated on cell culture Vero E6. |
|
Lactobacillus plantarum strain as hypocholesterolemic agents (versions) and application thereof Group of inventions relates to composition, comprising Lactobacillus plantarum strains, and application of strains and composition. Composition with cholesterol-lowering activity contains effective quantity of, at least, strains, selected from the group strain of Lactobacillus plantarum CECT 7527, strain of Lactobacillus plantarum CECT 7528 and strain of Lactobacillus plantarum CECT 7529. Said strains possess probiotic properties, and cholesterol-lowering activity. Pharmaceutical, veterinary or food product is obtained on the basis of claimed composition. Composition is also suitable for prevention or treatment of cardio-vascular disorders, as well as for lowering cholesterol in animals, including humans. |
|
Stabiliser of colour in bacterial composition Invention relates to field of biotechnology. Claimed is application of carbonic acid salt as stabiliser of colour in bacterial composition, containing bacterial cells, belonging to genus Bifidobacterium, and ascorbate. |
|
Means of obtaining preparations for diagnosing rickettsiosis caused by rickettsia slovaca Invention relates to biotechnology and use of a Rickettsia slovaca strain. Disclosed is use of the Rickettsia slovaca "Karpunino-19/69" strain, which is deposited in the Russian Museum of Rickettsiaceae Cultures of the Gamalei Research Institute for Epidemiology and Microbiology under number 155, for obtaining preparations for diagnosing rickettsiosis caused by Rickettsia Slovaca. The "Karpunino-19/69" strain is isolated in Russia and is an aetiologic agent for tick-borne lymphadenopathy (TIBOLA) syndrome. |
|
Strain of bacteria kocuria sp. - destructor of crude oil and petroleum products Strain of bacteria Kocuria sp., having the ability to dispose quickly crude oil and petroleum products (diesel fuel oil, motor oil, hydraulic oil, gas condensate), deposited in the RNCM under the registration number Kocuria sp. RNCM Ac-2624D and can be used to clean soil and water reservoirs contaminated with crude oil and petroleum products, under the wide temperature range from +4 to +30°C. |
Another patent 2551023.