|
RussianPatents.com
|
|
Invention is recombinant plasmid DNA encoding hybrid polypeptides with the properties of red fluorescent protein mCherry. The recombinant plasmid DNA pChFN3 encodes the hybrid protein ChFN3 which has the properties of red fluorescent protein mCherry and 10 domain of human fibronectin of type III, and the recombinant plasmid DNA pChTNF encodes the hybrid protein ChTNF which has the properties of red fluorescent protein mCherry and TNF. The present invention provides efficient production of hybrid proteins pChFN3 and ChTNF with the properties of red fluorescent protein mCherry in the strain E.coli BL21 (DE3). |
|
|
Invention refers to molecular biology and medicine. What is presented is a genetic construct on a basis of the vector plasmid pEGFP-N1 with a neomycin resistance gene, containing human glial cell-derived neurotrophic factor (GDNF) gene with heat shock elements (HSE) 4-8 and green fluorescent protein (GFP) gene controlled by a thermally regulated promoter of heat shock protein hsp70 gene of Drosophila melanogaster. The invention can be used in therapy of neurodegenerative disorders, traumatic adromia, as well as in cerebral ischemic stroke in mammals (including in humans), as a decrease of temperature activation threshold (39 to 42 degrees Celsius) of GDNF therapeutic gene expression enables reducing a negative effect of high temperatures on human body when using the construct containing the GDNF therapeutic gene for treating the neurodegenerative disorders that is ensured by using hsp 70 of Drosophila melanogaster. |
|
|
Nutrient medium for growing filamentous fungi-dermatophytes from clinical material Nutrient medium for growing filamentous fungi-dermatophytes from clinical material comprises glucose, bacteriological agar, meat peptone, casein hydrolyzate, yeast extract, sodium chloride, sodium carbonate, L-cysteine, thioglycolic acid and distilled water in a predetermined ratio of components. |
|
|
Invention refers to biotechnology and concerns cDNA coding human dysferlin, a genetically engineered construct wherein such cDNA is cloned, a recombinant adenovirus and a pharmaceutical composition. The described genetically engineered construct comprises an expression plasmid adenovirus vector pAd/CMV/V5-DEST, wherein the codon-optimised cDNA having a sequence presented in SEQ ID NO: 1 and coding human dysferlin is cloned according to recombination sites attB1 and attB2. The recombinant replication defect adenovirus serotype 5 is prepared with using such genetically engineered construct and included into the pharmaceutical composition in an effective amount. |
|
|
Method of species and strain identification of bifidobacteria of phylotype bifidobacterium longum Invention relates to field of biotechnology and deals with species and strain identification of bifidobacteria of phylotype Bifidobacterium longum. Claimed method is based on combination and polymorphism of genes of toxin-antitoxin of RelBE superfamily and is characterised by the fact that for identification amplification with genome DNA is performed with application of set of species- and strain-specific oligonucleotides, PCR products are analysed in agarose gel, and size of obtained fragment is determined by means of DNA-marker. Analysed strains are related to certain species and/or strain in case of accumulation of fragments with application of certain oligonucleotides. |
|
|
Bacterial strain lactobacillus acidophilus having high resistance to t-2 toxin Invention can be used for development of antitoxic preparations and feed additives for prevention of mycotoxicosis in farm animals and poultry. The bacterial strain Lactobacillus acidophilus is deposited in the Russian Collection of Microorganisms under the registration number RCM B-2794D. The strain has resistance to T-2 toxin and capacity to destroy it metabolically in the habitat of bacteria. The resistance to the strain T-2 toxin is up to 77%, and the ability to destroy T-2 toxin is 1.8Ч10-12 nmol/CFU. |
|
|
Method for identifying lactic acid bacilli Invention refers to biotechnology and concerns a method for identifying lactic acid bacilli. The presented method is based on a combination and a polymorphism of toxin-antitoxin RelBE and MazEF gene superfamilies and characterised by the fact that identifying is ensured by genome DNA amplification with using a set of oligonucleotides of certain structure; PCR products are analysed in agarose gel, while a size of the produced fragment is determined by means of a DNA marker. The analysed strain is referred to a specific group, species or strain in case of producing fragments when using certain oligonucleotides. |
|
|
Respiratory syncytial virus (rsv) anti-g protein antibodies Invention refers to biotechnology and immunology. What is presented is an isolated monoclonal antibody or its immunoreactive fragment binding to the respiratory syncytial virus (RSV) G protein epitope of the strain A2. There are also described a nucleic acid molecule coding it, a host cell containing this nucleic acid molecule, a method for producing the antibody and a pharmaceutical composition containing this antibody. |
|
|
Method of producing nanomaterial based on recombinant archaeal halobacterium salinarum flagella Invention concerns biotechnology and nanotechnology. The method includes transforming archaeal cells with a recombinant plasmid, growing cells, selecting flagella and modifying the surface of the flagella. The plasmid structure contains recombinant genes for synthesis of flagellins A1 and A2 which form flagella, wherein the sequence of flagellin A1 or flagellin A2 or sequences of flagellin A and flagellin A2 contain at least one peptide insert for selective binding of metal ions or nanoparticles. The point of the peptide insert in flagellin A1 is defined in the region between first and second glycosylation sites located between position 86 and position 96 of SEQ ID NO:2, and the point of the peptide insert in flagellin A2 is defined in the region between first and second glycosylation sites located between position 82 and position 92 of SEQ ID NO:3, where the length of the peptide insert is 5 to 60 amino acids. The method includes selecting archaeal flagella containing peptide inserts for non-covalent bonding with metal ions, performing fragmentation of flagella into fragments and modifying the surface of flagella by binding peptide inserts with metal ions and oxidising metals, washing, drying and packing the obtained nano-structured material. |
|
|
Cell-penetrating peptides and polypeptides for microorganism cells Invention refers to genetic engineering and can be used for methane-producing cell permeability control. What is prepared is a polypeptide able to permeate into a methane-producing cell and to increase its permeability, characterised by an amino acid sequence SEQ ID NO:117, 118 or 119 or being at least 90% identical to the above sequence, or at least 15 sequential amino acids of the above sequence. What is also prepared is a polynucleotide coding the above polypeptide cloning and expressing vectors used for producing host cells producing the polypeptide or used for the vector replication. The polypeptide can contain a fluorescent tag on an N-terminal amino acid residue. |
|
|
Invention is a set of synthetic oligonucleotides for species identification of roseroot (Rhodiola quadrifida (Pall.) Fisch. et Mey). The set comprises species-specific areas to create a forward, reverse primers and a destructible probe, namely forward primer - CGGCAACGGATATCTCGGCT-3', the reverse primer - 5'-GGCCTCGCAACCACCACTTGTC-3', the destructible probe - (fluorescent label)-5'-CCGTGAACCATCGAGTTTTT-3'-(quencher). |
|
|
Method for staphylococcus aureus genotyping Invention concerns a method for Staphylococcus aureus genotyping. The presented method involves preparing a pure culture on a solid nutrient medium with DNA purification and amplification by multiplex polymerase chain reaction (PCR) and result detection by agarose gel electrophoresis. The multiplex PCR involves using four pairs of primers complementary to extracellular thermonuclease (nuc) gene, Panton-Valentine leukocidin (pvl) gene, toxic shock protein (tst) gene and methicillin resistance (mecA) gene sites. Staphylococcus aureus is genotyped by the presence or absence of pvl and tst virulence genes and mecA methicillin resistance genes or combinations thereof. |
|
|
Strain Rhodotorula sp. 51-18-2P is deposited in the Russian National Collection of Microorganisms of the Institute of Biochemistry and Physiology of Microorganisms n.a. GK Scriabin of RAS under the registration number RNCM Y-2993D. The strain is capable to destroy crude oil and petroleum products in contaminated water or soil. |
|
|
Strain of yeast saccharomyces cerevisiae for production of champagne Strain of yeast Saccharomyces cerevisiae DZIV-12 has high biochemical and technological properties. It is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number of Saccharomyces cerevisiae RNCIM Y-3980 and can be used in production of champagne. |
|
|
Invention relates to recombinant plasmid DNA pEst877 determining expression of the polypeptide with the activity of esterase P. cryohalolentis K5T on the cell surface with the molar weight of 3.64 Md (5.519 kb) consisting of NcoI/XhoI - DNA fragment of plasmid pET20b(+) with length of 3.654 kb, comprising a promoter T7lac, the bacteriophage T7 transcription terminator, the gene of bla β-lactamase which determines the stability of the cells transformed with the plasmid pEst877 to ampicillin, the site ori of replication initiation, signal sequence pelB of pectate lyase B Erwinia carotovora; and NcoI/XhoI-fragment of DNA with the size of 1.865 kb containing fusion gene Est877 encoding the amino acid sequences of esterase P. cryohalolentis K5T with an additional amino acid residue of aspartic acid after the site of cleavage of signal peptide and auto-transporter P. cryohalolentis K5T in a single reading frame. The invention also relates to the bacterial strain E. coli BL21(DE3)pLysS/pEst877 - producer of polypeptide with the activity of esterase P. cryohalolentis K5T on the cell surface. |
|
|
Method for preparing cartridge genetic constructs expressing several rna hairpins Invention refers to molecular biology and gene therapy. The method provides carrying out the following procedures: cartridge construct designing, synthesis of oligonucleotides; pair-wise annealing and setting of partially complementary oligonucleotides; precipitation and restriction of the cartridge fragments with applicable restriction nucleases; simultaneous ligation of separate cartridge fragments into one linear molecule; two PCR amplifications, electrophoresis in agarose miniature gel and electroelution; ligation into pGemT-easy vector; transformation and selection of positive clones by means of colony-hybridisation; sequence analysis of a DNA of plasmid clones; re-cloning of the cartridges into an expression vector. |
|
|
Novel mutation involved in increased tolerance to imidazolinone herbicides in plants Invention relates to biochemistry, particularly to a plant, having high resistance to an AHAS-inhibiting herbicide, which includes at least one Shiloh-8 IMI nucleic acid, parts thereof, a plant cell and seeds. Described is a nucleic acid which encodes a polypeptide which increases herbicide resistance of a plant. Disclosed are an expression cassette and a plant transformation vector which include said nucleic acid. Described are methods of controlling weeds growing near a plant having high resistance to an AHAS-inhibiting herbicide. Disclosed is a method of producing a plant having high resistance to an AHAS-inhibiting herbicide, as well as a method of increasing AHAS activity in a plant. Described is a method of selecting a cell transformed by a vector containing IMI nucleic acid. Also disclosed is a method of increasing resistance to an AHAS-inhibiting herbicide and a weed control method which includes treatment with an AHAS-inhibiting herbicide. |
|
|
Bacterial strain Bacillus vallismortis RNCIM B-11017 is grown and a suspension is made of it, which is applied in cryogenic soil and the water environment. It is exposed under the specified parameters from 7 to 60 days and the quantitative content of crude oil and petroleum products in the cryogenic soil and water environment is determined. |
|
|
Method for creating transgenic animals with stable and high target protein expression in milk Invention refers to biotechnology, particularly to methods for preparing next generation drug preparations and biologically active additives in bioreactors on the basis of transgenic producing mammals. The method for creating transgenic animals producing a protein with stable and high expression in milk, involves producing transgenic mammals with using a vector containing a reporter gene coding a target protein that is a goat beta-casein gene promoter, a bovine growth factor terminator and effective two-fold transcription terminators. The terminators surround an expression cartridge and possess an ability to break genome transcripts effectively in a mammalian genome by the effective protection of transgene expression in the mammalian genome against further repression. The effective two-fold terminators represent any mammalian genome site fulfilling the following conditions: 3'-sites of the two simultaneously expressing and opposite genes containing a site of the second-to-last exon, the last intervening sequence, the last exon and a polyadenylation signal, a space of two polyadenylation signals at different DNA strands is no more than 100 base pairs. |
|
|
Method of identifying nosocomial strains of microorganisms Invention relates to biotechnology. The method is intended for the identification of nosocomial strains of microorganisms in carrying out epidemiological monitoring. Water-alcohol solutions of 3-4 aniline dyes are prepared. A standardised suspension of the studied microbial culture is added, incubated; the obtained results are estimated and the identity of strains is determined. In case of the identity of sensitivity indices of the separated and studied microbial cultures to each corresponding aniline dye the identification of nosocomial strain is stated. |
|
|
Invention represents the plasmid 40NaGal, which determines synthesis of α-acetylhalactosaminidase α-AlNaGal, which includes a NcoI/SalI-fragment of the plasmid pET-40b(+) (Novagen) and a fragment of DNA with a size of 1299 base pairs, which contains a chimeric gene, consisting of a structural part of the gene α-AlNaGal, adapted by the N-end for the expression in cells of E.coli, and nucleotides, coding a specific sequence for the protease TEV. The invention also relates to strain of E.coli Rosetta(DE3), transformed by the claimed plasmid, - producent of a chimeric protein, which includes an aminoacid sequence of recombinant α-N-acetylhalactosaminidase α-AlNaGal. Also claimed is a method of obtaining recombinant α-N-acetylhalactosaminidase α-AlNaGal with the application of strain according to the invention. |
|
|
New strain of hybrid cultured animal cells Mus musculus 2F9 - producer of monoclonal antibodies specific for lysostaphin inhibiting its lytic activity and suitable for its quantitation is proposed. High-affinity monoclonal antibodies (mAb) of hybridoma 2F9 enables to determine lysostaphin in the samples to the concentrations of 0.8 ng/ml. The mAb of hybridoma 2F9 can be used to study the structural and functional properties of lysostaphin and quality control of preparations based on lysostaphin. |
|
|
Nanoscale enzyme biocatalyst for in vivo detoxification of organophosphorous compounds Invention refers to biotechnology. What is presented is an enzyme biocatalyst in the form of nanoscale particles for in vivo detoxification of organophosphorous compounds. The biocatalyst represents non-covalent polyelectrolyte complexes. The given complexes consist of a polyhistidine-containing polypeptide with the properties of organophosphosphorous hydrolase and polyethylene glycol-polyglutamic acid block copolymer in a charge relation of enzyme:block copolymer falling within the range of 2:1 to 1:5. |
|
|
Nutrient medium for cultivation of listeriosis causative agent Invention relates to biotechnology, in particular to obtaining nutrient media for cultivation of a listeriosis causative agent. A nutrient medium contains fermentative hydrolysate of soya beans, fermentative hydrolysate from an activated embryo-egg mass of quails, sodium chloride, potassium phosphate 2-substituted 3-aqueous, sodium phosphate 2-substituted 12-aqueous, microbiological agar and distilled water in a specified component ratio. |
|
|
Vaccine composition for animal immunisation against coccidiosis and method for using it Present invention refers to a vaccine composition for an animal immunisation against coccidiosis and a method for the animal immunisation. The characterised vaccine contains from approximately 10 to approximately 1,000 oocysts of the first strain Eimeria and from approximately 100 to approximately 10,000 oocysts of the second strain of the above species; the first and second strains have asynchronous endogenous period, and the first strain represents the nonattenuated strain Eimeria, and the second strain represents the early strain Eimeria. |
|
|
Constructions and methods for production and secretion of cell wall-cleaving enzymes Invention relates to field of molecular biology and biochemistry. Claimed is polynucleic acid, coding cross-linked protein to provide secretion of cell wall-cleaving enzyme, in microorganism of class Clostridia, as well as respective recombinant microorganism and method of production and secretion of said protein. |
|
|
Method of producing preparative quantities of phloem-restricted viral antigens Invention relates to biochemistry, particularly a method of producing preparative quantities of a viral antigen - potato leaf roll virus (PLRV) protein, in chimeric viral particles imitating PLRV virions, the method comprising producing recombinant DNA containing cDNA of turnip vein-clearing virus (TVCV) which belongs to tobamoviruses, where the TVCV cDNA is under the control of a plant promoter and there is a transcription terminator at its end, and the TVCV coat protein gene is substituted with a PLRV major coat protein gene, which includes producing agrobacterial vector (plasmid) pCambia 1300, which is capable of being embedded into the host-plant gene and cause system infection, transferring the formed recombinant DNA into the agrobacterial vector pCambia, transforming a Nicotiana benthamian host-plant with the agrobacterial vector pCambia, reproduction of the chimeric virus, consisting of viral DNA, in the Nicotiana benthamian host-plant, separating the chimeric virus containing TVCV cDNA, the coat gene of which is substituted with the a PLRV major coat protein gene, from infected leaves of the Nicotiana benthamian host-plant. Disclosed is a method of producing antiserum against PLRV capsid protein, which includes immunising animals with viral particles obtained using said method. |
|
|
Invention relates to field of immunology, medicine and biotechnology. Claimed are versions of anti-EPHA2 antibodies. Claimed antibodies are bound with polypeptide, consisting of amino acids 426-534 in SEQ ID NO:8. Also described are hybridomes, which produce such antibodies, and pharmaceutical compositions and methods of application of said antibodies and compositions. |
|
|
Invention refers to biotechnology and concerns a kit for detecting Q fever by RT PCR. The characterised kit contains synthetic oligonucleotides limiting a fragment of groEL gene: GroEL F 5' CTTCTACTGTTATGACGCCTTCTTTGC 3'; GroEL R 5' CGCAAGTAGGCACCATTTCTGC 3', and a fluorescent probe: GroEL Probe 5' FAM-CACTTTCTCCATCGCTTCCGCAATAATA-TAMRA 3'. |
|
|
Method of restoring sensitive layer of biosensor Invention relates to biotechnology. The method involves treating the sensitive layer of a biosensor with solution of a common fraction of protease of hepatopancreas of king crab in a buffer comprising tris-HCl 50 mM, CaCl2 3 mM, NaCl 100 mM, pH 8.0 at solution temperature of 35-40°C. The process is carried out in multiple successive steps with a solution of a solution of a common fraction of protease of hepatopancreas of king crab in said solvent at temperature of 35-40°C followed by exposure. The sensitive layer of the biosensor is successively washed with dodecyl sulphate dissolved in the same buffer in concentration of 0.1% and then with water at each step. The treatment process is carried out three times. |
|
|
Immobilised biocatalyst for microbial biotransformation of steroid compounds Immobilised biocatalyst for microbial biotransformation of steroid compounds comprises cells of a microorganism having 1,2-dehydrogenase activity, included in the polyvinyl alcohol cryogel matrix. As cell having 1,2-dehydrogenase activity the immobilised biocatalyst comprises biomass of actinobacteria Pimelobacter simplex. The ratio of components in the biocatalyst is (wt %): actinobacteria cells Pimelobacter simplex - 1-5 (in dry substance), polyvinyl alcohol - 7-20, the aqueous phase - up to 100. |
|
|
Invention relates to molecular biology and oncology and may be used for diagnostics of terminal mutations in gene RET, associated with genetic predisposition to cancer of thyroid (CT). The set of sequences of oligonucleotides has the following nucleotide composition: 5'-CATGGCCACTCCCAGTGC-3', 5'-CACAGGGACTCCTCAGCAC-3', 5'-CACCCCCACCCACAG-3',5'-GAGATGGGTGGCTTGTG-3', 5'-GGCTAGTGCTGTCAGGCC-3', 5'-CTAAGCACCCTAGACGCG-3', 5'-CAGGGATAGGGCCTGG-3', 5'-CCCCAAGAGAGCAACACC-3', TACGAGCCGTGCCT, GATGGGCTGCGCAG, CACGTGCTGGGCCT, TAGAAGCTGTACAT, CACGAGAAGTGGAG, TACGAGCTGAGCTG, GGAAATGGATGGGATTTG, CCATATGGACGGCAATTC. |
|
|
Method of production of frozen bacterial concentrate on basis of symbiosis of probiotic bacteria Method comprises preparing a culture medium, its sterilisation and cooling. In the cooled culture medium the combined inoculum is added, containing separately activated by β-galactosidase bifidobacteria of strain Bifidobacterium longum B 379 M, propionic acid bacteria of strain Propionibakterium Freudenreichii Shermanii subsp. AC-2503, and the activated bacterial inoculum Lactobacillus acidophilus of viscous race taken in a ratio of 9:0.7:0.3, respectively, in an amount of 5% by volume of the culture medium. It is cultured for 14-16 hours at given process parameters, and the cells are separated from the culture liquid to obtain a bacterial mass. The resulting bacterial mass is mixed with the protective medium at a ratio of 1:1. It is bottled, sealed and frozen. |
|
|
Group of inventions relates to the field of biotechnology. Synthetic 5'UTR regions are applied to enhance the transgene expression, with the 5'UTR regions being located between a promoter and a sequence, presenting an interest in an expression vector. The claimed invention also claims vectors, which contain the 5'UTR regions, and a method of enhancing the transgene expression in their application. |
|
|
Clostridial neurotoxins with modified persistence Invention relates to the field of biochemistry, in particular to clostridial neurotoxins with a modified persistence. Claimed is a polypeptide, containing HC-domain, the first and, at least, one additional LC-domain with amino acid sequences, at least, 90% identical to the respective sequences of a neurotoxic component of botulotoxin of a serotype A, B, C1, D, E, F or G. Also claimed are nucleic acid, an expression vector and a host cell, intended for the expression of the said polypeptide. Also claimed are a method of obtaining and application of the said polypeptide, including as a component of a pharmaceutical composition, for treatment of a condition, associated with hyperactive cholinergic innervations of a muscle or a exocrine gland, and for cosmetic procedures, associated with wrinkles. |
|
|
Cattle diarrhea virus with modified erns protein Claimed invention relates to the field of biotechnology and virology. Described is a chimeric pestivirus, where the said chimeric pestivirus includes the cattle diarrhea virus, which does not express its homologous Erns protein. The said chimeric pestivirus expresses a heterologous Erns protein, originating from the other pestivirus, or a natural, synthetic or genetic version of the said heterologous Erns protein. Also described are methods and sets for treatment or prevention of propagation of the infection, caused by the cattle diarrhea virus, as well as methods for a differentiation between the vaccinated animals and the animals, infected with the virus of a wild type. |
|
|
Protease-resistant insulin analogues Invention relates to the field of biotechnology, namely to novel analogues of insulin and can be used in medicine. An insulin analogue, in which at least two hydrophobic amino acids are replaced with hydrophilic amino acids in comparison with a parent insulin, and where A-chain of the insulin analogue contains at least one mutation and B-chain contains at least one mutation in comparison with the parent insulin, and at least one mutation in A-chain is in one or more cleavage sites, selected from the group, consisting of A13-14, A14-15 and A19-20, and at least one mutation in B-chain is in one or more cleavage sites, selected from the group, consisting of B2-3, B6-7, B9-10, B10-11, B13-14, B14-15, B16-17, B22-23, B24-25, B25-26, and where amino acid in B30 position is deleted. The insulin analogue is used as a component of a pharmaceutical composition for treatment or prevention of hyperglycemia, type 1 or type 2 diabetes mellitus. |
|
|
Recombinant plasmid dna pmind-vapb, containing vapb msmeg_1283 gene coding nucleotide sequence Invention relates to microbiology and genetic engineering and discloses a recombinant plasmid DNA pMind-vapB, which is plasmid pMind into which a sequence shown on fig 2 is cloned. |
|
|
Recombinant plasmid dna pmind-vapc, containing vapc msmeg_1284 gene coding nucleotide sequence Invention relates to microbiology and genetic engineering and discloses a recombinant plasmid DNA pMind-vapC, which is plasmid pMind into which a sequence shown on fig 2 is cloned. |
|
|
Monoclonal antibodies against protein rgm a and application thereof Invention relates to the field of biotechnology and immunology. Described are versions of antibodies, binding the GRM molecule, as well as their antigen-binding fragments, amino acid sequences of variable parts of which are presented in the claim materials. Nucleic acid, coding the said antibodies, is presented. Claimed is a method of obtaining the RGM-binding protein, which includes cultivation of a host cell in a culture medium under conditions suitable for obtaining the binding protein, capable of binding with RGM, where the host cell contains an expression vector, containing the separated nucleic acid, coding the said antibody. Described is a pharmaceutical composition for treating a disease, in which the SGM A activity produces a negative impact, which contains a therapeutically efficient quantity of the said antibody and a pharmaceutically acceptable carrier. Claimed is an application of the said antibody for obtaining a medication, used for a) reduction of hRGM A binding with a patient's Neogenin receptor; or b) for reduction of hRGM A binding with BMP-2 and BMP-4 in the patient. |
|
|
Escherichia coli bacteria strain - producer of recombinant flagellin Invention relates to biotechnology and a recombinant strain of Escherichia coli bacteria - a producer of biologically active flagellin. The described strain is obtained by transformation of an E. coli BL21[DE3] cell culture with recombinant plasmid DNA pET151FliC, which is obtained based on a pET151FliC vector in which was embedded a fliC gene which codes biologically active flagellin, having a nucleotide sequence represented in Seq ID No 3. The strain is deposited in the Russian National Collection of Industrial Microorganisms (RCIM) of the Research Institute for Genetics and Selection of Industrial Microorganisms under No B-11369. |
|
|
Claimed invention relates to biotechnology and represents a polypeptide construction for treatment, prevention and relief of disorders, associated with an adhesion of platelets and platelet-mediated aggregation or its dysfunction, which includes one or more single-domain antibodies, aimed against the von Willebrand factor (vWF), and one or more single-domain antibodies aimed against serum albumen (SA). The invention also relates to nucleic acid, coding such polypeptide construction, to compositions, containing the said construction, and to its application for obtaining medications for prevention, treatment and relief of the said disorders. |
|
|
Bacterial strain lactobacillus acidophilus used to prepare fermented milk product Strain Lactobacillus acidophilus No. 9-PS has biochemical activity and high acidity. The strain is deposited in the Departmental collection of beneficial microorganisms for agricultural purposes of Russian Agricultural Academy (RCAM) under the registration number of RCAM01850. The strain may find application in prevention and correction of disorders of microbiocenosis of the gastrointestinal tract. |
|
|
Expression vectors are claimed designed to express human darbepoetin. The host cells are proposed, containing the claimed vectors. The method of production of human darbepoetin-α from the culture medium of the proposed cell is claimed. The optimised gene of darbepoetin is proposed. |
|
|
Method for preparing mechano-dependent growth factor Invention refers to biotechnology. A method for preparing a mechano-dependent growth factor provides an in-growth ultrasound exposure on the cells Saccharomyces cerevisiae YBS618/pKX-MGF at a frequency of 880 kHz and power density within the range of 0.1-1.0 W/cm3 with pumping under pressure into a fermenter. The concentration of the mechano-dependent growth factor after 48 hours of growth makes 30.5-34 mcg/ml. |
|
|
Strain gluconacetobacter sucrofermentans - producer of bacterial cellulose Strain Gluconacetobacter sucrofermentans H - 110 is a producer of bacterial cellulose. The strain is deposited in the Russian National Collection of Industrial Microorganisms under the registration number of strain Gluconacetobacter sucrofermentans RNCIM B-11267 and can be used in medicine, food and pharmaceutical industries. |
|
|
Recombinant pseudo-adenovirus particle based on the genome of human adenovirus of serotype 5 and the method of its use are characterised. The presented particle comprises an expressing cassette with the insert of the hemagglutinin gene of influenza virus, at that the hemagglutinin gene of influenza virus was used as hemagglutinin of strain A/Brisbane/59/2007(H1N1) with the nucleotide sequence preliminary optimised for expression in human cells, presented in SEQ ID N0:2. The said haemagglutinin gene of influenza virus is cloned into an expression cassette comprising the signal of polyadenylation SV40 under control of the cytomegalovirus promoter. The presented invention can be used to induce specific immunity against influenza virus of A subtype H1 and H5 when administered to a subject in an effective amount, by providing enhanced expression of the recombinant hemagglutinin of influenza virus A/Brisbane/59/2007 (H1N1). |
|
|
Inventions group relates to the field of microbiology and may be used in food industry. One proposes Lactobacillus sanfranciscensis DSM 22063 strain and Lactobacillus plantarum DSM 22064 strain; the both strains are able to perform complete gluten decomposition in flour. The strains may be used for production of a mixture for complete gluten decomposition in flour. Additionally, one proposes a method for preparation of dough of flour with completely decomposed gluten. The produced gluten- detoxified flour dough may be used for production of a baking mixture with completely decomposed gluten. The said dough may be used for yeast bakery goods production. Additionally, the baking mixture and gluten- detoxified dough may be used for manufacture of food products suitable for recovery of nutritional imbalance being the consequence of gluten-free food ration. |
|
|
Single-stranded circular rna and method for producing it Invention refers to biochemistry, particularly to a method for producing a single-stranded circular RNA. The method involves a synthesis of a sense chain and an anti-sense chain containing a nucleotide sequence with unpaired nucleotides on 5'-terminal and 3'-terminal, in a combination with a ligation of the nucleotide on 5'-terminal of the nucleotide sequence with the unpaired nucleotides in the sense chain with the nucleotide on 3'-terminal of the nucleotide sequence with the unpaired nucleotides in the anti-sense chain and vice versa with using lygase. The nucleotide sequence with the unpaired nucleotides on 5'-terminal of the sense chain and the nucleotide sequence with the unpaired nucleotides on 3'-terminal of the anti-sense chain are looped together. The nucleotide sequence with the unpaired nucleotides on 3'-terminal of the sense chain and the nucleotide sequence with the unpaired nucleotides on 5'-terminal of the anti-sense chain are also looped together. The sense and anti-sense chains are stemmed together. The loop length makes 9 nucleotides, while the stem length makes 19 to 31 nucleotides. |
|
|
Claimed invention relates to the field of biotechnology and deals with a method of amplification and detection of nucleotide sequences in a reaction mixture and a set, used in the said method. The claimed method includes providing an analysed sample, reagents for realisation of amplification by a polymerase chain reaction (PCR) and, at least, four double-labelled probes. Each of the probes is specific to its nucleotide sequence to be detected, bears a fluorescent label and a respective fluorescence quencher, with both probes bearing similar labels, and probes, bearing similar labels, differ by a temperature of melting (Tm). After that, amplification of the nucleotide sequences and an analysis of a melting curve are performed by means of the double-labelled probes in the reaction mixture. |
Another patent 2513078.
| © 2013-2014 Russian business network RussianPatents.com - Special Russian commercial information project for world wide. Foreign filing in English. |