Disposable system for sterile obtaining of lipids and nucleic acids particles

FIELD: pharmacology.

SUBSTANCE: group of inventions discloses a system for sterile obtaining of lipids and nucleic acids nanoparticles and method for sterile obtaining of lipids and nucleic acids nanoparticles.

EFFECT: group of inventions allows to obtain uniform lipid and nucleic acid particles by simple steps, reproducible and under aseptic conditions, and can be used to deliver this class of therapeutic molecules to target cells.

23 cl, 13 tbl, 7 ex, 1 dwg

 



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention describes a gene therapeutic structure coding vascular endothelial growth factor (VEGF) and (FGF-2). Codon-optimised recombinant plasmid lies in the basis of gene therapeutic structure coding both factors. Introduction of gene therapeutic structure may be made directly to a damaged nerve and paraneural tissues both in intraoperative and postpoperative period. The invention may be used for stimulation of nerves regeneration.

EFFECT: invention improves significantly results of reparative treatment for damaged peripheral nerves.

3 cl, 15 dwg

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry, particularly to methods of producing a plant with higher drought and salt tolerance compared to the wild-type plant by reducing expression/function of the protein transcription factor in the plant. The invention also relates to a plant with high drought and salt tolerance obtained using said method.

EFFECT: invention enables to efficiently obtain a plant with high drought and salt tolerance compared to the wild-type plant.

6 cl, 6 dwg, 1 tbl, 6 ex

FIELD: biotechnology.

SUBSTANCE: codon-optimised cDNA are declared, encoding the stromal cell factor 1 alpha and the vascular endothelial growth factor of isoform 165, and also a recombinant plasmid containing them. The recombinant plasmid can be used as part of a pharmaceutical composition for the recovery of blood vessels and improvement of blood supply in the damaged tissues or organs.

EFFECT: invention enables to increase the efficiency of use of gene products.

4 cl, 5 dwg

FIELD: medicine.

SUBSTANCE: invention refers to molecular biology and can be used in diagnosing cardiomyopathies of various origin Presented is a set of synthetic oligonucleotides for identifying mutations of a coding part of desmin (DES) gene associated with cardiomyopathies. The mutations are identified by detecting a full sequence of the coding part of DES gene. The coding part of DES gene is amplified by means of 7 pairs of synthetic oligonucleotides at the same temperature and annealing time, and the prepared amplification products are sequenced by means of one pair of universal primers.

EFFECT: presented invention enables the sensitive and specific detection of DES gene mutations, with reducing the amplification reaction time, the number of manipulations, the time of agent application for the sequencing reaction, and reducing a probability of a reaction error.

3 cl, 1 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biochemistry. There are presented pharmaceutical compositions having a concatemer molecule and a kit, as well as using for preparing an agent for immune system modulation or for human's or animal's immune system activity modulation, and a composition according to the invention. The given invention can find further application as an immunomodulatory agent in therapy of various diseases.

EFFECT: what is presented is a concatemer molecule of non-coding nucleic acid containing at least four single-strand sites with non-methylated CG motives for human's or animal's immune system activity modulation.

20 cl, 4 dwg

FIELD: biotechnologies.

SUBSTANCE: invention refers to a method of detection of Mycobacterium tuberculosis isolates resistant to pyrazinamide by detection of mutations in pncA gene, associated with evolving resistance to pyrazinamide, by PCR in real time mode using HRM analysis. It involves amplification in a mixture of equal amounts of tested DNA and wild type DNA using primers: Pnc18U: 5'-TACGCTCCGGTGTAGGCAC-3' and Pnc15R: 5'-GAAGCGGCGGACTACCATC-3', formation of heteroduplexes due to simultaneous co-amplification of wild type DNA and test DNA, where the first PCR stage includes concentration equalisation by quantitative PCR using the same pair of primers (Pnc18U/Pnc15R) with calibration curve generation and use of regression equation.

EFFECT: reliable and fast detection of mutations in pncA gene associated with evolving resistance to pyrazinamide, due to high specificity and sensitivity.

1 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to oligopeptides, containing the sequence NLSSAEVVV (SEQ ID NO:6), in which one or two amino acids can be substituted, possessing the inducibility of cytotoxic T-cells, their pharmaceutical compositions and application for the production of anti-cancer vaccines.

EFFECT: obtaining pharmaceutical compositions for the production of anti-cancer vaccines.

20 cl, 6 dwg, 1 tbl, 1 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and represents a method of obtaining useful metabolites with the application of bacteria of the Enterobacteriaceae family, in particular bacteria, belonging to the genus Escherichia, which is modified in such a way that it contains a genetic expression system, including a transcription apparatus, regulated by a protein of the LysR type, and modified in such a way that the self-induced positive regulation of the feedback type in the said system is mediated by a coinducer.

EFFECT: method is suitable for the production of L-amino acids with a branched chain, in particular L-valine, L-isoleucine and L-leucine, higher alcohols and D-pantothenic acid; invention makes it possible to obtain L-amino acids with the high degree of efficiency.

23 cl, 2 dwg, 5 tbl, 6 ex

FIELD: biotechnology.

SUBSTANCE: proposed RNA-aptamer is a 57-unit mixed-type oligonucleotide having the nucleotide sequence GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, where A, G are ribonucleotides, U, C are 2'-desoxy-2'-fluoro-ribonucleotides, has the ability to recognise autoantibodies specific to disseminated sclerosis.

EFFECT: characterised invention binds specifically and highly affine with autoantibodies specific to disseminated sclerosis, and can be used for the diagnostics of disseminated sclerosis.

3 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used to determine a human genotype by polymorphism in matrix metalloproteinase MMP9-1562 C>T (rs3918242) gene. The method is based on the establishment of a melting profile with fluorescence-labelled specific oligonucleotide samples. The method uses an allele-shared pair of primers, fluorescence-labelled allele-specific oligonucleotide samples different for each allele and a general oligonucleotide labelled with a fluorescence extinguisher of the following nucleotide composition: MMP9-1562s CGAAACCAGCCTGGTCAACG; MMP9-1562a TCTGCCTCCCGGGTTCAAGC; MMP9-1562p1 GGCGCACGCCTATAA-FAM; MMP9-1562p2 GGCGCATGCCTATAA-HEX; MMP9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), wherein FAM means the fluorescence extinguisher FAM, HEX means the fluorescence extinguisher HEX, BHQ1 means the dark fluorescence extinguisher attached to 5'-terminal nucleotide. Referring the sample to a homozygote or a heterozygote by the allele is determined by a DNA melting profile shape that is a maximum of the first fluorescence curve derivative.

EFFECT: invention enables providing more reliable and accessible genotyping.

1 dwg

FIELD: food industry.

SUBSTANCE: organoleptical properties improvement is achieved by the fish oil microcapsules production method characterised by obtainment of an oil-in-water emulsion by way of mixing fish oil and an encapsulation ingredient in water; the components are taken at a ratio 30-35 and 25-30 wt %, water - balance; the method additionally involves homogenisation and dispersion of the obtained emulsion in an ultrasonic field and microemulsion subsequent spray drying; ultrasonic dispersion is carried out with insonification frequency equal to 28 kHz and intensity equal to 40 W/cm2; spray drying is carried out with a parallel hot air flow with the temperature at the inlet and outlet equal to 160-180C respectively.

EFFECT: simplification and enhancement of microencapsulation processes efficiency during production of deodorised and encapsulated fat-soluble food products, in particular, improvement of organoleptic properties of fish oils used for food products enrichment.

4 cl, 6 ex, 1 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to microencapsulation of water-soluble preparations, particularly to encapsulation of common jujube possessing the therapeutic properties. The method for common jujube encapsulation involves dispersing common jujube powder suspension in isopropanol in the presence of the preparation E472 and precipitating with carbon tetrachloride as a non-solvent. There are produced microcapsules containing common jujube as a core in xanthane gum as a shell in core:shell ratio 1:3, 1:1 and 3:1 with 100% yield.

EFFECT: invention provides simplifying and accelerating the microencapsulation process and higher weight yield.

3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to the field of medicine and describes a method of obtaining ferrocene microcapsules, where xanthan gum is used as an envelope for the microcapsules, characterised by the fact that a suspension of 100 mg of ferrocene in 2 ml of benzene is dispersed into a suspension of xanthan gum in the presence of 0.01 g of E472 c preparation with mixing, with the addition of 5 ml of acetone and 0.5 ml of water; the obtained suspension is filtered and dried at room temperature.

EFFECT: invention provides the simplification and acceleration of the process of obtaining the microcapsules and increase of output by weight.

1 dwg, 2 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to medicine, particularly to a method for ferrocene encapsulation characterised by the fact that a microcapsule coating is carrageenan, whereas a non-solvent is ethanol when producing microcapsules by physical-chemical non-solvent addition.

EFFECT: implementing the invention enables simplifying and accelerating the process of encapsulation and increasing weight yield.

7 dwg

FIELD: chemistry.

SUBSTANCE: calcium carbonate or magnesium carbonate is dissolved in isopropanol and the obtained solution is added to a solution of sodium alginate in isopropanol in the presence of E472c while stirring at a rate of 1000 rps. The calcium carbonate or magnesium carbonate and sodium alginate are taken in weight ratio of 1:1 or 1:3. Chloroform is then added. The obtained suspension of microcapsules is filtered and dried. The process is carried out at 25C for 20 minutes.

EFFECT: simple and faster process of producing microcapsules, reducing losses when producing microcapsules, and high mass output.

4 ex

FIELD: food industry.

SUBSTANCE: method is as follows: 100 mg of "green apple" flavouring agent is dissolved in 1 ml of dimethylsulphoxide; the produced mixture is dispersed into sodium alginate suspension in butanol, the suspension containing 300 mg of sodium alginate in the presence of 0.01 g of E472c preparation, under stirring conditions. Then one performs additional pouring of 3 ml of toluene and 1 ml of water; the produced suspension is filtered out and dried at room temperature.

EFFECT: microcapsules manufacture process simplification and weight yield increase.

3 ex

FIELD: chemistry.

SUBSTANCE: suspension of 100 mg of fullerene C60 in 2 ml of ethanol is dispersed into a suspension of cappa-carrageenan in butanol, which contains 100 mg or 300 mg of cappa-carrageenan in the presence of 0.01 g of the preparation E472c with mixing. Then 5 ml of toluene and 0.5 ml of water are added, the obtained suspension is filtered and dried at room temperature.

EFFECT: simplification and acceleration of the process of obtaining microcapsules and an increase of the output by weight.

1 dwg, 2 ex

FIELD: chemistry.

SUBSTANCE: invention relates to field of microcapsulation of heterocyclic compounds of triazine series. Method of obtaining microcapsules of triazine series pesticides is characterised by the fact that 0.1 g of triazine series pesticide and 0.02 g of E472c preparation as emulsifying agent are added to 10 g of 5% water solution of polyvinyl alcohol (PVA) and obtained mixture is subjected to mixing. Reaction mixture components are dissolved until transparent solution is formed after which 5 ml of carbinol as the first precipitating agent and then 10 ml of isopropanol as the second precipitating agent are added slowly drop-by-drop. After that, obtained suspension of microcapsules is kept for 1 minute, filtered on filter, washed with propanol several times, dried, with method being realised at 25C without special equipment.

EFFECT: simplification of the process of obtaining microcapsules and increase output by weight.

3 ex

FIELD: chemistry.

SUBSTANCE: method of obtaining microcapsules of triazine series pesticides is characterised by the following: 0.1 g of triazine series pesticide and 0.02 g of E472c preparation as emulsifier are added to 10 g of 5% water solution of polyvinyl alcohol (PVA), and obtained mixture is subjected to mixing. After dissolution of reaction mixture components and formation of transparent solution 15 ml of isopropanol are very slowly drop-by-drop poured in, and obtained suspension of microcapsules is stayed for 1 minute, filtered on filter, washed several times with isopropanol and dried. Method is realised at 25C without special equipment.

EFFECT: simplification of the process of obtaining microcapsules and increased output by mass.

3 ex

FIELD: chemistry.

SUBSTANCE: method is characterised by the fact that 100 mg of iron sulphate or zinc sulphate are dissolved in 1 ml of water and obtained mixture is dispersed into carrageenan solution in acetone, which contains 300 mg of carrageenan, in presence of 0.01 g of E472c preparation with mixing. After that, 2 ml of ethanol are added, obtained suspension is filtered and dried at room temperature, with realisation of the method without special equipment.

EFFECT: simplification and acceleration of the process of obtaining microcapsules and increase of output by mass.

2 ex

FIELD: chemistry.

SUBSTANCE: invention relates to nanotechnology, particularly a method of producing aspirin nanocapsules in a carrageenan envelope. The disclosed method includes preparing an aspirin suspension in benzene; dispersing the obtained mixture into a carrageenan suspension in butanol in the presence of an E472c preparation while mixing at 1000 rps; adding tetrachloromethane; filtering the obtained nanocapsule suspension and drying at room temperature.

EFFECT: method provides a simpler and faster process of producing nanocapsules and increases mass output.

1 dwg, 4 ex

Up!