Single-chemical nucleic acid molecules for gene expression control

FIELD: biotechnology.

SUBSTANCE: invention relates to biochemistry, in particular to a single-stranded nucleic acid molecule that inhibits target gene expression. The said molecule in the order from the 5'-end to the 3'-end contains the 5'-end portion Xc, the linker portion Lx, the inner portion Z, the linker portion Ly and the 3'-end portion Yc. At that, the inner region Z consists of the inner 5'-end portion X that is complementary to the 5'-end portion Xc and the inner 3'-end portion Y that is complementary to the 3'-end portion Yc. At that, Z consists of 19-30 bases and contains a sequence that suppresses the target gene expression. Z-(Xc+Yc) from 0 to 4 bases, Xc from 1 to 11 bases and Yc from 1 to 11 bases. This invention also discloses a method, application and composition for target gene expression inhibition, method, use and pharmaceutical composition for treatment of a disease caused by an increase in target gene expression using the above-mentioned nucleic acid molecule and the use of such molecule to induce RNA interference.

EFFECT: invention allows application of a single-stranded nucleic acid molecule for patients treatment, since it does not cause a side effect in the form of interferon induction.

32 cl, 32 dwg, 7 tbl, 25 ex

 



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention describes a gene therapeutic structure coding vascular endothelial growth factor (VEGF) and (FGF-2). Codon-optimised recombinant plasmid lies in the basis of gene therapeutic structure coding both factors. Introduction of gene therapeutic structure may be made directly to a damaged nerve and paraneural tissues both in intraoperative and postpoperative period. The invention may be used for stimulation of nerves regeneration.

EFFECT: invention improves significantly results of reparative treatment for damaged peripheral nerves.

3 cl, 15 dwg

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry, particularly to methods of producing a plant with higher drought and salt tolerance compared to the wild-type plant by reducing expression/function of the protein transcription factor in the plant. The invention also relates to a plant with high drought and salt tolerance obtained using said method.

EFFECT: invention enables to efficiently obtain a plant with high drought and salt tolerance compared to the wild-type plant.

6 cl, 6 dwg, 1 tbl, 6 ex

FIELD: biotechnology.

SUBSTANCE: codon-optimised cDNA are declared, encoding the stromal cell factor 1 alpha and the vascular endothelial growth factor of isoform 165, and also a recombinant plasmid containing them. The recombinant plasmid can be used as part of a pharmaceutical composition for the recovery of blood vessels and improvement of blood supply in the damaged tissues or organs.

EFFECT: invention enables to increase the efficiency of use of gene products.

4 cl, 5 dwg

FIELD: medicine.

SUBSTANCE: invention refers to molecular biology and can be used in diagnosing cardiomyopathies of various origin Presented is a set of synthetic oligonucleotides for identifying mutations of a coding part of desmin (DES) gene associated with cardiomyopathies. The mutations are identified by detecting a full sequence of the coding part of DES gene. The coding part of DES gene is amplified by means of 7 pairs of synthetic oligonucleotides at the same temperature and annealing time, and the prepared amplification products are sequenced by means of one pair of universal primers.

EFFECT: presented invention enables the sensitive and specific detection of DES gene mutations, with reducing the amplification reaction time, the number of manipulations, the time of agent application for the sequencing reaction, and reducing a probability of a reaction error.

3 cl, 1 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biochemistry. There are presented pharmaceutical compositions having a concatemer molecule and a kit, as well as using for preparing an agent for immune system modulation or for human's or animal's immune system activity modulation, and a composition according to the invention. The given invention can find further application as an immunomodulatory agent in therapy of various diseases.

EFFECT: what is presented is a concatemer molecule of non-coding nucleic acid containing at least four single-strand sites with non-methylated CG motives for human's or animal's immune system activity modulation.

20 cl, 4 dwg

FIELD: biotechnologies.

SUBSTANCE: invention refers to a method of detection of Mycobacterium tuberculosis isolates resistant to pyrazinamide by detection of mutations in pncA gene, associated with evolving resistance to pyrazinamide, by PCR in real time mode using HRM analysis. It involves amplification in a mixture of equal amounts of tested DNA and wild type DNA using primers: Pnc18U: 5'-TACGCTCCGGTGTAGGCAC-3' and Pnc15R: 5'-GAAGCGGCGGACTACCATC-3', formation of heteroduplexes due to simultaneous co-amplification of wild type DNA and test DNA, where the first PCR stage includes concentration equalisation by quantitative PCR using the same pair of primers (Pnc18U/Pnc15R) with calibration curve generation and use of regression equation.

EFFECT: reliable and fast detection of mutations in pncA gene associated with evolving resistance to pyrazinamide, due to high specificity and sensitivity.

1 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to oligopeptides, containing the sequence NLSSAEVVV (SEQ ID NO:6), in which one or two amino acids can be substituted, possessing the inducibility of cytotoxic T-cells, their pharmaceutical compositions and application for the production of anti-cancer vaccines.

EFFECT: obtaining pharmaceutical compositions for the production of anti-cancer vaccines.

20 cl, 6 dwg, 1 tbl, 1 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and represents a method of obtaining useful metabolites with the application of bacteria of the Enterobacteriaceae family, in particular bacteria, belonging to the genus Escherichia, which is modified in such a way that it contains a genetic expression system, including a transcription apparatus, regulated by a protein of the LysR type, and modified in such a way that the self-induced positive regulation of the feedback type in the said system is mediated by a coinducer.

EFFECT: method is suitable for the production of L-amino acids with a branched chain, in particular L-valine, L-isoleucine and L-leucine, higher alcohols and D-pantothenic acid; invention makes it possible to obtain L-amino acids with the high degree of efficiency.

23 cl, 2 dwg, 5 tbl, 6 ex

FIELD: biotechnology.

SUBSTANCE: proposed RNA-aptamer is a 57-unit mixed-type oligonucleotide having the nucleotide sequence GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, where A, G are ribonucleotides, U, C are 2'-desoxy-2'-fluoro-ribonucleotides, has the ability to recognise autoantibodies specific to disseminated sclerosis.

EFFECT: characterised invention binds specifically and highly affine with autoantibodies specific to disseminated sclerosis, and can be used for the diagnostics of disseminated sclerosis.

3 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used to determine a human genotype by polymorphism in matrix metalloproteinase MMP9-1562 C>T (rs3918242) gene. The method is based on the establishment of a melting profile with fluorescence-labelled specific oligonucleotide samples. The method uses an allele-shared pair of primers, fluorescence-labelled allele-specific oligonucleotide samples different for each allele and a general oligonucleotide labelled with a fluorescence extinguisher of the following nucleotide composition: MMP9-1562s CGAAACCAGCCTGGTCAACG; MMP9-1562a TCTGCCTCCCGGGTTCAAGC; MMP9-1562p1 GGCGCACGCCTATAA-FAM; MMP9-1562p2 GGCGCATGCCTATAA-HEX; MMP9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), wherein FAM means the fluorescence extinguisher FAM, HEX means the fluorescence extinguisher HEX, BHQ1 means the dark fluorescence extinguisher attached to 5'-terminal nucleotide. Referring the sample to a homozygote or a heterozygote by the allele is determined by a DNA melting profile shape that is a maximum of the first fluorescence curve derivative.

EFFECT: invention enables providing more reliable and accessible genotyping.

1 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to the field of biotechnology, namely, to obtaining inhibitors of adhesion and/or aggregation of platelets, and can be used in medicine. A polypeptide, used as a component of a pharmaceutical composition and in sets for screening of the inhibitors of platelet adhesion or aggregation, is obtained in a recombinant way with the application of a matrix of the salivary gland cDNA of Anopheles stephensi.

EFFECT: invention makes it possible to obtain the polypeptide, possessing inhibiting activity with respect to platelet aggregation and/or inhibiting activity with respect to platelet adhesion.

10 cl, 4 dwg, 5 ex

FIELD: biotechnology.

SUBSTANCE: expression vector is also provided, comprising the polynucleotide and a transformant obtained from S. cerevisiae, for production of the said protein, comprising the polynucleotide or vector.

EFFECT: efficient production of fatty acids with long-chain, having 18 carbon atoms.

9 cl, 3 dwg, 3 tbl

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and genetic engineering. Claimed is expression plasmid vector for monocistronic heterologous expression of recombinant proteins in cells of Chinese hamster ovary (CHO), possessing property of high-frequency integration of expression cassette in said cells, in the following sequence containing region of initiation of plasmid pUC replication with functional gene of ampicilline resistance; site of Epstein-Barr virus terminal repetition (EBVTR), functional promoter of elongation factor 1 alpha gene of Chinese hamster, flanked with 5' untranslated region of said gene; site for cloning open reading frame of recombinant protein (polylinker); functional terminator of elongation factor 1 alpha gene of Chinese hamster, flanked with 3' untranslated region of said gene, promoter, functioning in mammalian cells; gene of antibiotic resistance; and functional terminator of antibiotic resistance gene. Also claimed is line of cells - recombinant protein producers and method of obtaining recombinant protein with application of said cells.

EFFECT: invention makes it possible to increase stability and productivity of expression systems of recombinant proteins.

13 cl, 7 dwg, 6 tbl, 8 ex

FIELD: chemistry.

SUBSTANCE: invention refers to biotechnology. What is presented is nucleic acid coding protein possessing acetyl-CoA-carboxylase activity making up the deficiency of acetyl-CoA-carboxylase in yeast, wherein a nucleotide sequence is specified in nucleic acid, which contains a nucleotide sequence: (a) coding protein consisting of the amino acid sequence SEQ ID NO:2; (b) hybridised in the hard conditions with nucleic acid complementary to SEQ ID NO:1; (c) SEQ ID NO:1; and (d) hybridised in the hard conditions with nucleic acid consisting of the complementary nucleic sequence coding protein SEQ ID NO:2; wherein SEQ ID NO:1 and 2 are disclosed in the description. There are also described: acetyl-CoA-carboxylase (SEQ ID NO:2) increasing the host-specific arachidonic acid content; a recombinant vector containing the above nucleic acid; and a cell transformed by the above vector for producing the fatty acid composition rich in arachidonic acid. What is presented is a method for producing the fatty acid composition involving culturing the above cell and collecting the fatty acid composition from the transformed cell culture.

EFFECT: invention enables producing the fatty acid composition rich in arachidonic acid in the host cell.

11 cl, 8 dwg, 5 tbl, 8 ex

FIELD: chemistry.

SUBSTANCE: claimed inventions deal with a modified protein, nucleic acid, coding such protein, a vector, containing nucleic acid, and a carrier for biotin binding, which such protein is immobilised on. The characterised modified biotin-binding protein is obtained by the introduction of a mutation from one to several amino acid residues into a sequence, represented in SEQ ID NO:2, or an amino acid sequence, identical to the said sequence by 98% or more, and the presence of the biotin-binding activity, where at least one residue, selected from the group, consisting of residues from 1) to 4), presented below, is substituted with the residue of acidic amino acid or residue of neutral amino acid; 1) residue of arginine in position 104 SEQ ID NO: 2; 2) residue of lysine in position 141 SEQ ID NO: 2; 3) residue of lysine in position 26 SEQ ID NO: 2 and 4) residue of lysine in position 73 SEQ ID NO: 2.

EFFECT: claimed inventions make it possible to obtain the biotin-binding protein and can be applied for biotin binding.

14 cl, 6 dwg, 11 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and gene engineering. A method for selecting at least one transfected eukaryotic host cell expressing a target product, the eukaryotic host cells comprise at least an introduced polynucleotide encoding the target product, an introduced polynucleotide encoding a DHFR enzyme using at least one expression vector, providing a plurality of eukaryotic host cells, whose viability is dependent upon folate uptake, wherein the said host cells comprise at least a foreign polynucleotide encoding the target product, a foreign polynucleotide encoding a DHFR enzyme, culturing the said plurality of the eukaryotic host cells in a selective culture medium comprising folic acid in a concentration of 12.5-50 nM combined with a concentration of MTX of 2.3-500 nM, selecting at least one eukaryotic host cell expressing the target product.

EFFECT: described is a method of the target product and culture medium preparation.

11 cl, 2 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention relates to field of medicine, genetic engineering and biotechnology. Claimed is method of providing tumour-free tissue-substituting therapy on the basis of obtained from adult somatic cells induced pluripotent stem cells (iPSC), where the latter are genetically modified by means of artificial chromosome (AC), carrying bicistronic cassette with suicide-gene and gene of sensitivity to antibiotic under control of regulatory element, specific for pluripotent stem cells, with modified iPSC being selected in presence of respective antibiotic, absence of AC integration into iPSC genome is confirmed, are introduced into recipient organism directly, without preliminarily differentiation in vitro, after 1-14 days patients are given a 5-10-day course of therapy with inductor of toxicity of suicide-gene product.

EFFECT: invention makes it possible to reduce to zero risk of cancer transformation of transplanted cells and development of teratomas, increase clinical efficiency of recovery of cell mass of injured organ or tissue, reduce waiting time for potential recipients.

6 cl, 1 tbl, 1 dwg

FIELD: biotechnology.

SUBSTANCE: synthetic DNA is proposed, encoding human erythropoietin, having the sequence Seq ID No. 1, comprising its expression vector, the method of production of erythropoietin producer strain, and a strain of a Chinese hamster ovary cells - producer of recombinant human erythropoietin, deposited under the number RKKK(P) 761 D.

EFFECT: invention enables to increase the expression level of recombinant human erythropoietin.

5 cl, 1 tbl, 8 dwg, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to molecular biology and medicine. There are presented ribonucleic acids of general formula (NuGlXmGnNv)a and derivatives thereof as an immunostimulating agent, compositions containing them.

EFFECT: treating cancer diseases, infectious diseases, allergic and autoimmune diseases.

21 cl, 2 dwg, 5 tbl

FIELD: chemistry.

SUBSTANCE: group of inventions relates to field of biotechnology. Method of selecting food diet includes determination of food diet or substance, which increase amount of microRNA, present in mammalian milk, applying correlation of miroRNA profiles in milk and food diet, obtained by mammal, or substance, contained in food diet, as index. Profiles of microRNA in milk, identified before and after dietary intake, are compared, and if amount of at least one type of microRNA, identified after intake, is higher than that identified before intake, it is supposed that diet increased amount of microRNA in milk. Method additionally includes measurement of microRNA in milk and microRNA profiles in serum of plasma, and if amount of microRNA, contained both in milk and serum or plasma, after dietary intake increases in milk by 1.47 times or higher in comparison with that identified in serum or plasma, it is supposed that diet increases amount of microRNA in milk.

EFFECT: application of invention group makes it possible to obtain breast milk, possessing immunostimulating action.

6 cl, 7 dwg, 11 tbl, 5 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to biotechnology and represents a conjugate used for siRNA intracellular delivery and containing siRNA, which is conjugated by a covalent bond with a hydrophilic compound on one side, e.g. PEG, and with a hydrophobic compound, e.g. cholesterol, on the other side. By self-assembly, the conjugates are able to form homogenous nanoparticles, micellas, wherein the hydrophobic compounds are packed inside the micella; siRNA - between the hydrophobic and hydrophilic compounds, and the hydrophilic compounds - outside. The present invention also discloses methods for producing the above conjugate, pharmaceutical compositions containing the above nanoparticles for the gene therapy of various diseases depending on specific siRNA delivered. What is also disclosed is a pharmaceutical composition for treating cancer, which contains the nanoparticles containing survivin-specific siRNA.

EFFECT: invention enables increasing the siRNA stability in a living body, providing thereby the effective delivery of therapeutic siRNA into cells and the shown activity of siRNA even in a low dose of a relatively low concentration.

25 cl, 19 dwg, 1 tbl, 6 ex

Up!