Method for determining toxicity of chemicals generating active oxygen forms

FIELD: chemistry.

SUBSTANCE: method provides adding riboflavin to the final concentration of 1⋅10-5 mg/ml - 1⋅10-3 mg/ml into the Escherichia coli K12 MG1655 culture with the pColD-lux plasmid, in which the bioluminescence lux operon of marine photobacteria Photobacterium leiognathi, Vibrio fischeri or Photorabdus luminescens is placed under the control of the pColD promoter. Adding the test substance and determining the luminescence intensity of the resulting suspension and the control are carried out. The damaging effect of the test substance is estimated by the suspension luminescence intensity deviation from the control.

EFFECT: increasing the induction factor.

4 cl, 1 dwg, 2 ex

 



 

Same patents:

FIELD: medicine.

SUBSTANCE: agent contains mutant luciferase of glowworms Luciola mingrelica (SEQ ID No:2), recovered from recombinant cells E.coli transformed by plasmid pETL7, luciferin, magnesium sulphate, tris-(oxymethyl)-aminomethane, acetic acid, sodium ethylene aminotetraacetate, dithiotreitol, bovine serum albumin, sucrose and water.

EFFECT: higher sensitivity of ATP test, lower enzyme consumption.

2 cl, 3 dwg, 1 tbl, 4 ex

FIELD: chemistry.

SUBSTANCE: biomodule contains the following, immobilised into gel: nicotinamide adenine dinucleotide (NADN): flavine mononucleotide (FMN)-oxidoreductase, myristic aldehyde, NADN, enzyme stabiliser - dithiothreitol in concentration of 1·10-4 M, a FMN solution and a substrate. The method of preparing the biomodule involves preparation of 3-5% gel by boiling a starch suspension in a phosphate buffer or heating a gelatin suspension in a phosphate buffer to 60-80°C, cooling the gel to 24°-30°C, mixing the buffer solution of a bienzymatic system of luminescent bacteria NADN:FMN-oxidoreductase - luciferase, solutions of myristic aldehyde, reduced nicotinamide adenine dinucleotide, enzyme stabiliser - dithiothreitol in concentration of 1·10-4 M with gel, depositing onto the substrate and drying at 4-10°C. The biomodule is activated with a solution of flavin mononucleotide.

EFFECT: invention increases activity output and maximum luminous intensity of the biomodule by 1,3-3 times, increases the time for constant illumination level of the biomodule to 2-20 minutes, increases the storage time of the biomodule without loss of activity by 2 times, increases thermal stability and resistance of the biomodule to chemical factors of the environment.

2 cl, 12 dwg, 12 ex

FIELD: chemistry.

SUBSTANCE: luminescent biocatalyst contains immobilised cells of luminescent bacteria which are included in a polyvinyl alcohol based cryogenic gel at given ratio of components.

EFFECT: prolonged possible use of the biocatalyst, simplification of its composition and production technology.

1 dwg, 2 tbl, 6 ex

FIELD: medicine; pharmacology.

SUBSTANCE: it is obtained a chimerous photo protein (photin), presented by amino-acid sequence of obeline protein, which part (from the rest in position 50 to the rest in position 94) is replaced by a homologous site of amino-acid sequence of clitine protein (the rests 53-97). The method of obtaining new chimerous photo protein by the method of recombinant DNA and vectors applied to it and cells is described. It is offered to use photo protein under the invention as the calcium indicator in various test systems in vitro and in vivo.

EFFECT: increased level of bioluminescence in comparison with natural protein.

11 cl, 6 dwg, 2 tbl, 3 ex

FIELD: biochemistry, analytical biochemistry.

SUBSTANCE: reagent for quantitative determination of adenosine 5'-triphosphate (ATP) by bioluminescent method comprises luciferase isolated from recombinant E. coli cells comprising plasmid pLR with native firefly luciferase gene, or luciferase isolated from recombinant E. coli cells comprising plasmid with m-pLR with the Luciola migrelica mutant luciferase gene wherein histidine residue at the position 433 is replaced for tyrosine residue. Also, the reagent comprises magnesium sulfate, mixture of tris-(hydroxymethyl)-aminomethane and acetic acid as a buffer, mixture of ethylenediaminetetraacetate sodium, dithiothreitol, bovine serum albumin and trehalose as stabilizing agents and water. In the assay method of adenosine 5'-triphosphate the reagent provides enhancing sensitivity and reproducibility in determination of ATP and reducing consumption of enzyme due to increase of specific activity of the reagent. The reagent provides carrying out determination of adenosine 5'-triphosphate by bioluminescence intensity at 560-570 nm in using firefly Luceola migrelica native luciferase, and by bioluminescence intensity at 606-610 nm in using luciferase wherein histidine residue at the position 433 is replaced for tyrosine residue.

EFFECT: improved assay method, valuable properties of reagent.

1 dwg, 1 tbl, 4 ex

FIELD: biochemistry, analytical biochemistry.

SUBSTANCE: reagent for determination of adenosine 5'-triphosphate (ATP) represents an aqueous solution of firefly luciferase containing luciferin, magnesium sulfate, tris-(hydroxymethylaminomethane), acetic acid, ethylenediaminetetraacetate sodium, dithiothreitol, bovine serum albumin and a stabilizing agent taken among the group including polybrene, polyvinylpyrrolidone, N-phthalylchitosan and sucrose. Using the invention provides enhancing precision and reproducibility of ATP assay. Invention can be used medicine, ecology, pharmacy and food industry.

EFFECT: improved assay method.

5 cl, 2 tbl, 3 ex

FIELD: biotechnology, microbiology.

SUBSTANCE: method involves sowing out samples of mixed cultures in liquid selective media, determination of cells number accumulating in media during microorganisms growth by bioluminescent method and mathematical treatment of kinetic data of the growth of individual bacterial cultures, determination of the parent concentration of microorganisms relating to different taxonomic groups. Invention allows carrying out the simultaneous identification of bacterial cells relating to different taxonomic groups and presenting in mixed cultures simultaneously, and to enhance precision in determination of cells number in the broad concentration range and to reduce the total analysis time significantly. In industry mixed cultures are used widely in different branches of food industry (dairy, meat, brewing and others) and in other biotechnological processes (biological treatment of sewage waters, bioremediation of soils, producing methane from waste in different manufactures and others). Invention can be used for differentiated determination of microorganisms number in mixed cultures that are widely distributed in nature: in air, soil, ponds, as components of natural microflora in higher organisms and among contaminants causing injury of different objects.

EFFECT: improved method for determination.

1 tbl, 3 dwg, 5 ex

FIELD: biochemistry, in particular production of immobilized enzymes useful on chemistry, biochemistry, medicine, histology, microbiology, ecology and agriculture for bioluminescence analysis.

SUBSTANCE: target reagent is obtained by production of 3-5 % gel by boiling of starch suspension in phosphate buffer, gel cooling to 24-30°C, mixing of buffer solution of luminescent bacterium bienzyme system NADH:FMH-oxydoreductase-lucirerase with starch gel, dosage on lavsan film and drying at 4-10°C. According the invention components are introduced in the next order: trimyristin aldehyde, nicotinamidadeninedinucleotide, bienzyme system NADH:FMH-oxydoreductase-lucirerase, and flavin mononucleotide. Substrate solution of nicotinamidadenine dinucleotide, flavin mononucleotide, and trimyristin aldehyde are prepared in phosphate buffer with pH 6.8-7.0.

EFFECT: reagent of improved quality due to decreased quantity of reaction mixture components (from four to one), reduced analysis period by two times and increased measurement accuracy.

2 cl, 1 dwg, 4 ex

FIELD: gene and protein engineering for various luminescent assays.

SUBSTANCE: new luciferase mutant forms have been obtained. Said mutant forms have increased thermostability and optionally different emission wave length in contrast with respective wild type enzymes. In all disclosed muteins natural amino acid residue in position equivalent to 357-position in Photinus pyralis luciferase sequence is replaced with other residue, preferably with uncharged polar amino acid (in particular tyrosine) residue. Mutant luciferases of present invention are useful in various analytical systems as reporter agent.

EFFECT: Mutant luciferases with new properties.

22 cl, 15 dwg, 6 tbl, 12 ex

The invention relates to methods of analysis of toxic compounds and can be used in environmental monitoring

FIELD: chemistry.

SUBSTANCE: invention relates to field of biochemistry, in particular to isolated version of serine protease, containing, at least, from five to eight amino acid substitutions in positions, selected from the group, consisting of positions12, 14, 15, 16, 24, 35, 36, 39, 49, 54, 61, 63, 64, 65, 67, 69, 75, 76, 78, 79, 81, 86, 92, 93, 99, 109, 112, 121, 123, 125, 127, 143, 159, 179, 181, 184, 189, where substituting amino acid is selected from the group, consisting of F, G, L, V, I, S, A, Y, K, W, M, P, N, Q, T, E, H, R, C, N and D, where said substitutions are made in positions, equivalent to positions in protease Cellulomonas 69 B4, as well as to molecule of nucleic acid, which codes it. Described are: expression vector, which contains said molecule of nucleic acid, as well as host-cell, containing it. Also disclosed are cleaning composition, animal food, composition for fabric of leather processing, which contain said version of serine protease, as well as cleaning method with application of said cleaning composition.

EFFECT: claimed invention has improved caseinolytic activity and/or thermal stability, and/or stability in LAS, and/or improved casein hydrolysis in comparison with protease, which does not have said number of substitutions.

63 cl, 7 dwg, 21 tbl, 21 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and concerns the strain Escherichia coli BL21(DE3)Gold/pETmin-CypA producing human recombinant cyclophilin A. The characterised strain is produced by cell transformation of the strain BL21(DE3)Gold by pETmin-CypA plasmid. The plasmid has a size of 5865 base pairs and contains XhoI-NdeI fragment of pET-22b(+) vector carrying ampR ampicillin resistance gene, a promoter and RNA-polymerase T7 phage terminator and a polylinker. A fragment produced by PCR with using the oligonucleotide primers 5'-TTATACATATGGTCAACCCGACCGTGTTCTTC and 5'-TTTCTCGAGTTATTCGAGTTGTCCACAGTCAGC of pCyPAwt/pGEX-2TK plasmid with the closed fragment of hrCpA (human recombinant cyclophilin A) gene having a size of 498 base pairs is cloned at XhoI-NdeI sites.

EFFECT: presented strain is high-producing; it requires no complicated clean-up system and can be used in cancer treatment.

2 dwg

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. A disclosed polypeptide having the amino acid sequence which has a sequence identity of not less than 80% to the amino acid sequence shown in SEQ ID NO: 1 or 2, revealed in description, which polypeptide has a capable of expressing the polynucleotide activity. Also a polynucleotide encoding D-lactate dehydrogenase originated from DNA construct in which the polynucleotide and a promoter capable of expressing the polynucleotide are linked is introduced. Also described a transformant for production of lactic acid, or transformed yeast, in which the polynucleotide or the DNA construct is introduced. A method of producing D-lactic acid, which comprises the step of culturing the said transformant.

EFFECT: transformant capable of highly producing D-lactic acid compared to the D-lactic acid produced with host cell.

15 cl, 2 dwg, 4 tbl, 13 ex

FIELD: chemistry.

SUBSTANCE: invention relates to the field of biotechnology. Claimed is a transformed microorganism - yeasts Saccharomyces for obtaining ethanol, where the said microorganism is transformed with a nucleotide sequence, coding xylose isomerise, and the said microorganism is transformed by a nucleotide sequence, coding xylulokinase, or the said microorganism is transformed with a promoter, capable of increasing the expression of endogenic xylulokinase. The said microorganism is capable of a higher xylose isomerise activity; higher growth rate in a growth medium or on a growth medium, which contains xylose; faster xylose metabolism; and/or faster ethanol production when grown in anaerobic conditions on xylose as a carbon source than an equivalent microorganism before transformation. An inoculant and culture medium, containing the said transformed yeasts and xylose or a source of xylose, are described. Claimed is a method of obtaining the said transformed microorganism, including a stage of the microorganism transformation with the xylose isomerise-coding nucleotide sequence, or the xylulokinase-coding nucleotide sequence, or the promoter, capable of increasing the expression of endogenic xylulokinasse. Described is a method of fermentation, including the cultivation of the said microorganism in the culture medium, which contains xylose or xylose source. Claimed is a method of obtaining ethanol-containing biofuel, where the said method includes a stage cultivation of the microorganism in accordance with the claimed invention in the culture medium, which contains xylose or source of xylose. Application of the yeasts in accordance with the claimed invention for obtaining ethanol is described.

EFFECT: invention makes it possible to obtain ethanol by means of the said transformant in a larger amount in comparison with the equivalent microorganism before transformation, on the xylose-containing medium.

11 cl, 7 dwg, 1 tbl, 7 ex

FIELD: chemistry.

SUBSTANCE: invention refers to biotechnology. What is presented is nucleic acid coding protein possessing acetyl-CoA-carboxylase activity making up the deficiency of acetyl-CoA-carboxylase in yeast, wherein a nucleotide sequence is specified in nucleic acid, which contains a nucleotide sequence: (a) coding protein consisting of the amino acid sequence SEQ ID NO:2; (b) hybridised in the hard conditions with nucleic acid complementary to SEQ ID NO:1; (c) SEQ ID NO:1; and (d) hybridised in the hard conditions with nucleic acid consisting of the complementary nucleic sequence coding protein SEQ ID NO:2; wherein SEQ ID NO:1 and 2 are disclosed in the description. There are also described: acetyl-CoA-carboxylase (SEQ ID NO:2) increasing the host-specific arachidonic acid content; a recombinant vector containing the above nucleic acid; and a cell transformed by the above vector for producing the fatty acid composition rich in arachidonic acid. What is presented is a method for producing the fatty acid composition involving culturing the above cell and collecting the fatty acid composition from the transformed cell culture.

EFFECT: invention enables producing the fatty acid composition rich in arachidonic acid in the host cell.

11 cl, 8 dwg, 5 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used to determine a human genotype by polymorphism in matrix metalloproteinase MMP9-1562 C>T (rs3918242) gene. The method is based on the establishment of a melting profile with fluorescence-labelled specific oligonucleotide samples. The method uses an allele-shared pair of primers, fluorescence-labelled allele-specific oligonucleotide samples different for each allele and a general oligonucleotide labelled with a fluorescence extinguisher of the following nucleotide composition: MMP9-1562s CGAAACCAGCCTGGTCAACG; MMP9-1562a TCTGCCTCCCGGGTTCAAGC; MMP9-1562p1 GGCGCACGCCTATAA-FAM; MMP9-1562p2 GGCGCATGCCTATAA-HEX; MMP9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), wherein FAM means the fluorescence extinguisher FAM, HEX means the fluorescence extinguisher HEX, BHQ1 means the dark fluorescence extinguisher attached to 5'-terminal nucleotide. Referring the sample to a homozygote or a heterozygote by the allele is determined by a DNA melting profile shape that is a maximum of the first fluorescence curve derivative.

EFFECT: invention enables providing more reliable and accessible genotyping.

1 dwg

FIELD: biotechnology.

SUBSTANCE: invention is the mutant variants of recombinant L-asparaginase characterised by amino acid sequence corresponding to the amino acid sequences of L-asparaginase of bacteria Wolinella succinogenes, in which the lysine amino acid residue in the position 24 is replaced by the serine residue or the valine amino acid residue in the position 23 is replaced by the glutamine residue, and the lysine amino acid residue in the position 24 is replaced by the threonine residue.

EFFECT: invention enables to obtain variants of L-asparaginase with improved resistance to proteolysis under the action of trypsin when compared to the unmodified recombinant protein and different levels of glutaminase activity while complete maintaining asparaginase activity, which makes them attractive objects for development on their basis of new antitumor therapeutics preparations.

2 cl, 1 dwg, 1 tbl, 11 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and immunology. What is presented is a host cell of Bordetella pertussis, Bordetella bronchiseptica or Bordetella parapertussis, which is used as an adjuvant or for preventing or treating whooping cough, having the low activity of endogenous glycosyltransferase at least 98% identical to the amino acid sequence SEQ ID NO: 2 as compared to the activity of glycosyltransferase of a relative parent strain, wherein the low activity is ensured by using an inactivating vector, which causes the inactivation of expression of a sequence of endogenous nucleic acid coding glycosyltransferase, or reduces to a low level of expression of the sequence of endogenous nucleic acid coding glycosyltransferase by the fusion of nucleic acid coding glycosyltransferase with a low-level or inducible promotor. What is disclosed is a preparation consisting of LPS of the above host cell with an increased replacement of hexosamine 1' or 4' phosphate groups of LPS referred to a lipid A, as compared to a LPS preparation from the related parent strain; thereby LPS is characterised by producing at least 8 ions in the ESI-MS spectrum, wherein the preparation is used as an adjuvant or for preventing or treating whooping cough. What is presented is using the above host cells or the LPS preparation for producing the preparation for preventing and/or treating whooping cough, or producing the drug preparation for immunising a mammal, wherein the host cells or LPS is used as an adjuvant. What is described is a pharmaceutical composition used as the adjuvant or for preventing or treating Bordetella infection containing the above host cell or above LPS preparation in an effective amount and a pharmaceutically acceptable carrier.

EFFECT: invention enables producing the pharmaceutical preparation of Bordetella cells or LPS, possessing the high immunogenicity as compared to the preparation of the related parent strain Bordetella.

12 cl, 7 dwg, 3 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, in particular to tumour-specific promoters, and can be used in the anti-cancer therapy. There are constructed the broad-spectrum tumour-specific promoters providing the therapeutic gene expression inside a cancer cell. The invention also involves expression cassettes, expression vectors, pharmaceutical compositions, methods of treating cancer and using the expression cassettes and vectors.

EFFECT: promoters of the present invention provide a high expression level of the operatively linked therapeutic gene in the cancer cells of different origin, wherein the normal cell expression is absent or low.

29 cl, 19 dwg, 4 tbl, 20 ex

FIELD: chemistry.

SUBSTANCE: group of inventions relates to succinic acid-producing mutant microorganism, which is able to apply simultaneously saccharose and glycerine as carbon sources. Mutant microorganism is obtained by weakening of mechanism of saccharose-mediated catabolite repression of glycerol by removal of gene, which codes fructosephosphotransferase, or by introduction of gene, which codes glycerolkinase. Mutant microorganism is selected from the group, which consists of Mannheimia sp., Actinobacillus sp. and Anaerobiospirillum sp. Also claimed is method of obtaining mutant microorganism and versions of method of obtaining succinic acid with application of claimed microorganism.

EFFECT: group of inventions provides obtaining succinic acid with high output 1,54 mol/mol.

11 cl, 4 dwg, 2 tbl, 5 ex

FIELD: biotechnology.

SUBSTANCE: invention is a recombinant plasmid pET40CmAP/CGL determining the synthesis of hybrid bifunctional polypeptide CmAP/CGL with the properties of highly active alkaline phosphatase of marine bacterium Cobetia marina (CmAP) and galactose specific lectin of mussels Crenomytilus grayanus (CGL). The plasmid comprises NcoI/SalI - fragment of plasmid pET-40b(+) (Novagen) and the DNA fragment of 2028 base pairs, which is a chimeric gene encoding structural genes of the alkaline phosphatase CmAP and galactose specific lectin CGL, interconnected by polynucleotide encoding the amino acid sequence of the linker (G4S)3EL and enterokinase site D4K. Also a recombinant strain of E. coli Rosetta(DE3)/pET40CmAP/CGL is provided, transformed by the indicated plasmid, - producer of the hybrid bifunctional protein CmAP/CGL, comprising the amino acid sequences of recombinant alkaline phosphatase CmAP and galactose specific lectin CGL. The method of obtaining the hybrid bifunctional protein CmAP/CGL is proposed.

EFFECT: invention enables to obtain highly purified preparation of the hybrid protein with the properties of recombinant highly active alkaline phosphatase CmAP and galactose specific lectin CGL, and can be used to detect differences in glycosylation of oncofetal antigens.

3 cl, 2 dwg, 3 ex

Up!