Method of producing l-amino acids

FIELD: biotechnology.

SUBSTANCE: invention relates to biotechnology. Method of producing L-lysine using recombinant coryneform microorganism able to produce L-lysine is disclosed, where recombinant coryneform microorganism is transformed by means of insertion of acetate-inducible promoter below stop codon of target gene on chromosome for attenuation of target gene expression and enhancing of ability of recombinant coryneform microorganism to produce L-lysine, where target gene is gene located in nodal point of L-lysine biosynthesis path.

EFFECT: invention increases production of L-lysine in comparison with parent strain of microorganism.

4 cl, 2 dwg, 12 tbl, 13 ex

 



 

Same patents:

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and microbiology and provides a method of producing Corynebacterium glutamicum or Brevibacterium flavum bacteria with a high level of synthesis of L-lysine, which includes seeding a culture of Corynebacterium glutamicum or Brevibacterium flavum bacteria, capable of producing L-lysine, on a medium containing fusidic acid, and collecting from the grown colonies, those colonies with a high level of synthesis of L-lysine. The invention also relates to a method for microbiological synthesis of L-lysine by culturing bacteria obtained using said method.

EFFECT: invention enables to obtain L-lysine with high efficiency.

2 cl, 1 tbl, 8 ex

FIELD: chemistry.

SUBSTANCE: invention relates to field of biochemistry and represents method of obtaining L-amino acid - L-lysine, L-threonine, L-asparagine, L-aspartic acid, L-methionine or L-isoleucine, which includes cultivation of bacteria Escherichia coli in medium for obtaining and accumulation of L-amino acid and collection of L-amino acid. Bacterium is modified in such a way as to increase expression of its gene gltP or gene gltS.

EFFECT: invention makes it possible to increase output of target L-amino acid.

12 cl, 5 tbl, 5 ex

FIELD: biotechnologies.

SUBSTANCE: invention represents a method of microbiological synthesis of L-threonine with usage of a bacteria that belongs to the Escherichia kind, in which the gene fumA is inactivated.

EFFECT: invention makes it possible to produce L-threonine with high extent of efficiency.

2 cl, 1 tbl, 3 ex

FIELD: biotechnology.

SUBSTANCE: basic fermentation medium is prepared on the basis of fermentative lysate of starch in an amount of 8-15% for glucose, and additional fermentation medium containing the components of basic fermentation medium, 2-3.5 times concentrated. They are sterilised. Biosynthesis of L-lysine is carried out using strain-producer Corynebacterium glutamicum of All-Russia classification of microorganisms Ac-2577D (BIGOR 55). The fermentor is loaded with the basic nutrient medium in amount of 1/3 of its volume. Then inoculation of the basic fermentation nutrient medium is carried out with 10-20% inoculum grown in two stages. Biosynthesis process is carried out with continuous feeding starting from 8-16 hours of cultivation. At that the inhibitory concentration of reducing substances in the culture fluid of 4-8% is maintained. After filling the device to the maximum volume after 60-66 hours of cultivation and then every 6-12 hours for the rest part of biosynthesis process a part of the culture fluid in amount of 10-15% of the maximum volume is pumped into the device for final fermentation. In this device, the biosynthesis process is continued for 6-12 hours under the same conditions as in the main device but without feeding the additional nutrient medium. Then L-lysine is isolated.

EFFECT: invention enables to carry out the biosynthesis process for a long time without reducing the rate of synthesis of L-lysine, and provides obtaining of the culture fluid with high concentration of L-lysine prior to the isolation.

4 ex

FIELD: biotechnology.

SUBSTANCE: biomass is isolated by microfiltration. The native solution is clarified. The clarified solution is desalted by passing through the ion-exchange system of 10 identical columns with a height to diameter ratio of 0.8, which are connected in the sequence: anion exchanger in OH-form - cation exchanger in H+-form, at a rate of 2-2.5 of solution volume per volume of the system. The desalted solution is passed through the column with the anion exchanger in OH-form. The resulting solution of lysine-base is passed through the column with the cation exchanger. Elution of lysine with cation exchanger 3-5N is carried out, preferably 4N, with alkali liquor. The gaseous hydrogen chloride is bubbled to the resulting concentrated lysine eluate, causing simultaneously neutralisation and crystallisation of lysine.

EFFECT: method enables to eliminate the need of evaporation in the technological, which results in power consumption economy.

2 cl, 1 ex

FIELD: chemistry.

SUBSTANCE: disclosed is a method of producing crystals of a basic amino acid hydrochloride from a basic amino acid sulphate fermentation broth or an fermentation reaction solution. The fermentation reaction is catalysed by viable microbial cells which produce a basic amino acid selected from a group consisting of arginine, lysine, ornithine, and histidine. The broth or solution is characterised by equivalent ratio of the sulphate ion/basic amino acid from 50 to 150%. A metal chloride is added to the basic amino acid sulphate fermentation broth or fermentation reaction solution, said metal being selected from: calcium, potassium, magnesium and barium, in equivalent ratio from 80 to 120% with respect to the sulphate ion. The pH is kept in the range from 3 to 8.5 and temperature from 20 to 90°C. Metal sulphate crystals are then removed. The obtained broth or fermentation solution is then cooled, while keeping concentration of the metal sulphate below its saturated concentration value. Crystals of the basic amino acid hydrochloride are then separated and accumulated.

EFFECT: method enables to obtain crystals of a basic amino acid hydrochloride with high purity and high output.

2 cl, 3 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: what is presented is a protein able to make the bacterium of Enterobacteriaceae family stable to L-cysteine induced growth inhibition and specified in a group consisting of: (a) protein presented in SEQ ID NO: 2 or its version, and (b) protein presented in SEQ ID NO: 4 or its version, what is also presented is a DNA fragment coding said protein. What is described is a L-amino acid producer bacterium of Enterobacteriaceae family containing said DNA fragment. What is offered is a method for producing L-amino acid involving cultivation of said bacterium in the nutrient medium and recovery of said L-amino acid from a culture fluid.

EFFECT: invention provides higher yield of produced L-amino acid.

12 cl, 12 tbl, 1 dwg, 8 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. The invention relates to a method of obtaining L-lysine using Escherichia coli bacteria containing versions of the dapA gene of B. subtilis bacteria.

EFFECT: invention enables to obtain L-lysine with high efficiency.

6 cl, 4 ex

FIELD: food industry.

SUBSTANCE: starch-containing raw materials (cereals) c are milled to produce a milled product including solid starch-free components in an amount of no less than 20 wt % One prepares a water-based suspension of the milling product to ultimately obtain flour pulp with dry weight content equal to at least 45 wt %. The pulp is heated in a jet boiler by way of water steam delivery to a temperature exceeding that of starch gelatination. One performs flour pulp hydrolysis by way of dilution and subsequent saccharification in the presence of α-amylase enzyme in a quantity of 0.002 - 3.0 wt % of the total quantity of the starch-containing raw material used to produce water medium M. Water medium M is added to the fermentative medium wherewith one cultivates a microorganism capable of the organic compound hyperexpression for fermentative broth production.

EFFECT: method enables production of an organic compound represented by a solid or partly solid non-volatile product of microbial metabolism such as monocarboxylic, dicarboxylic and triocarboxylic acids acid with 3 - 10 carbon atoms carrying, in case of necessity, hydroxyl groups, proteogenic and non-proteogenic amino acids, vitamins and biopolymers.

13 tbl, 5 ex

FIELD: food industry.

SUBSTANCE: method for production of at least one organic compound having at least 3 carbon atoms or at least 2 carbon atoms and at least one nitrogen atom by way of fermentation involves the following stages: a1) milling cereal crop grains representing a starch source. The produced milled material contains at least 20 wt % of starch-free solid components of the starch source. At a2) stage one performs suspending the milled material in a water liquid and partial fermentative hydrolysis of starch in the milled material and in case of necessity - subsequent saccharification. One produces a liquid (1) containing monosaccharides or oligosaccharides; at b) stage one performs addition of the liquid (1) at a concentration of at least 50 wt % to a fermentative medium containing a microorganism producing the organic compound under fermentative conditions.

EFFECT: target product yield enhancement.

17 cl, 7 tbl

FIELD: biotechnologies.

SUBSTANCE: A description is given of extracted molecules of the Corynebacterium glutamicum nucleic acids that encode polypeptides having activity of the II ABC saccharose-specific component. The invention relates as well to recombinant expression vectors comprising the described nucleic acids molecules. A method for producing a host cell containing the described expression vectors is exposed therein. The present invention relates as well to a method for producing the described polypeptide by means of cultivating said host cell. A method of testing patients for Corynebacterium glutamicum comprising the detection of the described nucleic acids molecules is exposed therein.

EFFECT: diversification of the nucleic acids molecules encoding proteins of the phosphoenolpyruvate- sugar-phosphotransferase system.

27 cl, 4 dwg, 13 tbl

The invention relates to biotechnology, in particular genetic engineering, and is cosmicly vector pСLF3 for cloning DNA fragments in corynebacteria

FIELD: chemistry.

SUBSTANCE: invention relates to field of biochemistry, in particular to isolated version of serine protease, containing, at least, from five to eight amino acid substitutions in positions, selected from the group, consisting of positions12, 14, 15, 16, 24, 35, 36, 39, 49, 54, 61, 63, 64, 65, 67, 69, 75, 76, 78, 79, 81, 86, 92, 93, 99, 109, 112, 121, 123, 125, 127, 143, 159, 179, 181, 184, 189, where substituting amino acid is selected from the group, consisting of F, G, L, V, I, S, A, Y, K, W, M, P, N, Q, T, E, H, R, C, N and D, where said substitutions are made in positions, equivalent to positions in protease Cellulomonas 69 B4, as well as to molecule of nucleic acid, which codes it. Described are: expression vector, which contains said molecule of nucleic acid, as well as host-cell, containing it. Also disclosed are cleaning composition, animal food, composition for fabric of leather processing, which contain said version of serine protease, as well as cleaning method with application of said cleaning composition.

EFFECT: claimed invention has improved caseinolytic activity and/or thermal stability, and/or stability in LAS, and/or improved casein hydrolysis in comparison with protease, which does not have said number of substitutions.

63 cl, 7 dwg, 21 tbl, 21 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and concerns the strain Escherichia coli BL21(DE3)Gold/pETmin-CypA producing human recombinant cyclophilin A. The characterised strain is produced by cell transformation of the strain BL21(DE3)Gold by pETmin-CypA plasmid. The plasmid has a size of 5865 base pairs and contains XhoI-NdeI fragment of pET-22b(+) vector carrying ampR ampicillin resistance gene, a promoter and RNA-polymerase T7 phage terminator and a polylinker. A fragment produced by PCR with using the oligonucleotide primers 5'-TTATACATATGGTCAACCCGACCGTGTTCTTC and 5'-TTTCTCGAGTTATTCGAGTTGTCCACAGTCAGC of pCyPAwt/pGEX-2TK plasmid with the closed fragment of hrCpA (human recombinant cyclophilin A) gene having a size of 498 base pairs is cloned at XhoI-NdeI sites.

EFFECT: presented strain is high-producing; it requires no complicated clean-up system and can be used in cancer treatment.

2 dwg

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. A disclosed polypeptide having the amino acid sequence which has a sequence identity of not less than 80% to the amino acid sequence shown in SEQ ID NO: 1 or 2, revealed in description, which polypeptide has a capable of expressing the polynucleotide activity. Also a polynucleotide encoding D-lactate dehydrogenase originated from DNA construct in which the polynucleotide and a promoter capable of expressing the polynucleotide are linked is introduced. Also described a transformant for production of lactic acid, or transformed yeast, in which the polynucleotide or the DNA construct is introduced. A method of producing D-lactic acid, which comprises the step of culturing the said transformant.

EFFECT: transformant capable of highly producing D-lactic acid compared to the D-lactic acid produced with host cell.

15 cl, 2 dwg, 4 tbl, 13 ex

FIELD: chemistry.

SUBSTANCE: invention relates to the field of biotechnology. Claimed is a transformed microorganism - yeasts Saccharomyces for obtaining ethanol, where the said microorganism is transformed with a nucleotide sequence, coding xylose isomerise, and the said microorganism is transformed by a nucleotide sequence, coding xylulokinase, or the said microorganism is transformed with a promoter, capable of increasing the expression of endogenic xylulokinase. The said microorganism is capable of a higher xylose isomerise activity; higher growth rate in a growth medium or on a growth medium, which contains xylose; faster xylose metabolism; and/or faster ethanol production when grown in anaerobic conditions on xylose as a carbon source than an equivalent microorganism before transformation. An inoculant and culture medium, containing the said transformed yeasts and xylose or a source of xylose, are described. Claimed is a method of obtaining the said transformed microorganism, including a stage of the microorganism transformation with the xylose isomerise-coding nucleotide sequence, or the xylulokinase-coding nucleotide sequence, or the promoter, capable of increasing the expression of endogenic xylulokinasse. Described is a method of fermentation, including the cultivation of the said microorganism in the culture medium, which contains xylose or xylose source. Claimed is a method of obtaining ethanol-containing biofuel, where the said method includes a stage cultivation of the microorganism in accordance with the claimed invention in the culture medium, which contains xylose or source of xylose. Application of the yeasts in accordance with the claimed invention for obtaining ethanol is described.

EFFECT: invention makes it possible to obtain ethanol by means of the said transformant in a larger amount in comparison with the equivalent microorganism before transformation, on the xylose-containing medium.

11 cl, 7 dwg, 1 tbl, 7 ex

FIELD: chemistry.

SUBSTANCE: invention refers to biotechnology. What is presented is nucleic acid coding protein possessing acetyl-CoA-carboxylase activity making up the deficiency of acetyl-CoA-carboxylase in yeast, wherein a nucleotide sequence is specified in nucleic acid, which contains a nucleotide sequence: (a) coding protein consisting of the amino acid sequence SEQ ID NO:2; (b) hybridised in the hard conditions with nucleic acid complementary to SEQ ID NO:1; (c) SEQ ID NO:1; and (d) hybridised in the hard conditions with nucleic acid consisting of the complementary nucleic sequence coding protein SEQ ID NO:2; wherein SEQ ID NO:1 and 2 are disclosed in the description. There are also described: acetyl-CoA-carboxylase (SEQ ID NO:2) increasing the host-specific arachidonic acid content; a recombinant vector containing the above nucleic acid; and a cell transformed by the above vector for producing the fatty acid composition rich in arachidonic acid. What is presented is a method for producing the fatty acid composition involving culturing the above cell and collecting the fatty acid composition from the transformed cell culture.

EFFECT: invention enables producing the fatty acid composition rich in arachidonic acid in the host cell.

11 cl, 8 dwg, 5 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used to determine a human genotype by polymorphism in matrix metalloproteinase MMP9-1562 C>T (rs3918242) gene. The method is based on the establishment of a melting profile with fluorescence-labelled specific oligonucleotide samples. The method uses an allele-shared pair of primers, fluorescence-labelled allele-specific oligonucleotide samples different for each allele and a general oligonucleotide labelled with a fluorescence extinguisher of the following nucleotide composition: MMP9-1562s CGAAACCAGCCTGGTCAACG; MMP9-1562a TCTGCCTCCCGGGTTCAAGC; MMP9-1562p1 GGCGCACGCCTATAA-FAM; MMP9-1562p2 GGCGCATGCCTATAA-HEX; MMP9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), wherein FAM means the fluorescence extinguisher FAM, HEX means the fluorescence extinguisher HEX, BHQ1 means the dark fluorescence extinguisher attached to 5'-terminal nucleotide. Referring the sample to a homozygote or a heterozygote by the allele is determined by a DNA melting profile shape that is a maximum of the first fluorescence curve derivative.

EFFECT: invention enables providing more reliable and accessible genotyping.

1 dwg

FIELD: biotechnology.

SUBSTANCE: invention is the mutant variants of recombinant L-asparaginase characterised by amino acid sequence corresponding to the amino acid sequences of L-asparaginase of bacteria Wolinella succinogenes, in which the lysine amino acid residue in the position 24 is replaced by the serine residue or the valine amino acid residue in the position 23 is replaced by the glutamine residue, and the lysine amino acid residue in the position 24 is replaced by the threonine residue.

EFFECT: invention enables to obtain variants of L-asparaginase with improved resistance to proteolysis under the action of trypsin when compared to the unmodified recombinant protein and different levels of glutaminase activity while complete maintaining asparaginase activity, which makes them attractive objects for development on their basis of new antitumor therapeutics preparations.

2 cl, 1 dwg, 1 tbl, 11 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and immunology. What is presented is a host cell of Bordetella pertussis, Bordetella bronchiseptica or Bordetella parapertussis, which is used as an adjuvant or for preventing or treating whooping cough, having the low activity of endogenous glycosyltransferase at least 98% identical to the amino acid sequence SEQ ID NO: 2 as compared to the activity of glycosyltransferase of a relative parent strain, wherein the low activity is ensured by using an inactivating vector, which causes the inactivation of expression of a sequence of endogenous nucleic acid coding glycosyltransferase, or reduces to a low level of expression of the sequence of endogenous nucleic acid coding glycosyltransferase by the fusion of nucleic acid coding glycosyltransferase with a low-level or inducible promotor. What is disclosed is a preparation consisting of LPS of the above host cell with an increased replacement of hexosamine 1' or 4' phosphate groups of LPS referred to a lipid A, as compared to a LPS preparation from the related parent strain; thereby LPS is characterised by producing at least 8 ions in the ESI-MS spectrum, wherein the preparation is used as an adjuvant or for preventing or treating whooping cough. What is presented is using the above host cells or the LPS preparation for producing the preparation for preventing and/or treating whooping cough, or producing the drug preparation for immunising a mammal, wherein the host cells or LPS is used as an adjuvant. What is described is a pharmaceutical composition used as the adjuvant or for preventing or treating Bordetella infection containing the above host cell or above LPS preparation in an effective amount and a pharmaceutically acceptable carrier.

EFFECT: invention enables producing the pharmaceutical preparation of Bordetella cells or LPS, possessing the high immunogenicity as compared to the preparation of the related parent strain Bordetella.

12 cl, 7 dwg, 3 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, in particular to tumour-specific promoters, and can be used in the anti-cancer therapy. There are constructed the broad-spectrum tumour-specific promoters providing the therapeutic gene expression inside a cancer cell. The invention also involves expression cassettes, expression vectors, pharmaceutical compositions, methods of treating cancer and using the expression cassettes and vectors.

EFFECT: promoters of the present invention provide a high expression level of the operatively linked therapeutic gene in the cancer cells of different origin, wherein the normal cell expression is absent or low.

29 cl, 19 dwg, 4 tbl, 20 ex

Up!