Method for prediction of risk of hyperplastic processes of endometrium

FIELD: medicine.

SUBSTANCE: DNA is recovered from peripheral venous blood. Genetic polymorphisms of tumour necrosis factor α (-308 G/A TNFα), tumour necrosis factor 1 receptor (+36 A/G TNFR1), interferon-inducible T-cell chemoattractant (A/G I-TAC), interleukin 1A (-889 C/T IL-1A), lymphotoxin α (+250 A/G Ltα) are typed by polymerase chain reaction. A high risk of developing hyperplastic processes of endometrium is predicted if detecting a combination of alleles -308 G TNFα, +36 A TNFR1, A I-TAC, -889 T IL-1A and/or a combination of alleles +36 A TNFR1, A I-TAC, -889 T IL-1A and/or a combination of alleles -308 G TNFα,+250 G Ltα, -889 T IL-1A.

EFFECT: higher accuracy.

2 dwg, 1 tbl, 1 ex

 

The invention relates to the field of medical diagnostics, namely to gynecology, and can be used to predict the risk of development of endometrial hyperplasia (GGE).

The endometrium is the mucous membrane lining the uterine cavity. When this shell begins to grow excessively in violation of the hormonal processes in the body women, talk about endometrial hyperplasia. There are three types of endometrial hyperplastic processes:

- cystic glandular endometrial hyperplasia (an overgrowth of glandular tissue and the appearance of cysts);

- glandular and glandular-cystic polyps (endometrial polyps - benign tumor formation, increasing from the uterine wall into its lumen);

-atypical hyperplasia - a perverted, abnormal growth of endometrial tissue (adenomatosis, adenomatous hyperplasia) [Sun N. In. The importance of molecular genetic and immune factors in the pathogenesis and treatment tactics of patients with hyperplastic processes of the endometrium. //Author. Diss.to.m.N. - SPb., 2011. - 20 P.].

Endometrial hyperplastic processes possible at any age, are found almost one in four women with infertility and have varying degrees of manifestations, but their frequency increases significantly to perimenopausal. The prevalence of hyperplasia ending�Tria is 10-30%, endometrial polyps - 0.5 to 35.7 percent [Lysenko O. V. endometrial Hyperplastic processes in different age periods the study of cytokine status and SFAS ligand//Obstetrics and gynecology. - 2011. - №4.- S. 12-15].

Endometrial hyperplasia as a possible basis for the formation of malignant tumors for many decades represent an important medico-social problem. The frequency of malignancy of endometrial hyperplastic processes varies within a wide range (0.25 to 50%) and is determined by the morphological features of the disease, duration of recurrence, and patient's age. Simple endometrial hyperplasia without atypia proceeds to cancer in 1% of cases, polypoid form without atypia - 3 times more often.

For clinical endometrial hyperplasia characterized by anovulatory uterine bleeding that occurs typically after a delay of menstruation. Bleeding is usually prolonged, with moderate blood loss, or abundant, profuse. In hyperplastic processes of the endometrium (often with endometrial polyps) sometimes appear intermenstrual spotting [Maksimov S. Y. risk Factors for malignant neoplasms of reproductive system women//Problems of Oncology.-2003. - Vol. 49, No. 3, Pp. 496 - 501].

About�Anchalee confirmation of the diagnosis of the GGE is only possible after hysteroscopy with subsequent histological examination of the endometrium. Unfortunately, we have to admit that ultrasound diagnosis is not always effective. In some cases, the patients with unexplained even after the diagnostic laparoscopy infertility GGE revealed during hysteroscopic examination may be the only likely cause.

Pathological transformation of the endometrium is a complex biological process involving all links neurohumoral regulation of a woman's body. It is known that the reason for the development of the GGE could be defects in ovulation, giperestrogeniya, progesterone deficiency, disturbance of proliferation and suppression of apoptosis, and changes of the receptor phenotype of the endometrium. GGE often occurs with endometriosis, fibroids and chronic inflammatory processes in the endometrium. In recent years revealed a complex system of factors that are involved in cell regulation, and expanded notions of intercellular interaction and intracellular processes in hormone-dependent tissues. So, it is established that in the regulation of proliferative activity of cells of the endometrium along with the estrogen involved a number of biologically active compounds (interleukins, factors tumor necrosis, chemokines). In the regulation of tissue homeostasis and the pathogenesis of proliferative diseases an important role belonging to�IIT not only increased cell proliferation, but the dysregulation of cell death (apoptosis). The resistance of the endometrial cells to programmed cell death (apoptosis) leads to the accumulation of modified and excessively proliferous cells, which is characteristic of neoplastic changes in the endometrium [Lysenko O. V. Hyperplastic processes in the endometrium at different ages, the study of cytokine status and SFAS ligand//Obstetrics and gynecology. - 2011. - №4.- S. 12-15].

The known method according to the patent of Russian Federation №2466390 published on 10.11.2012 the application for invention No. 2011105301/15 from 15.02.2011 G. "a method for predicting the development of cancer in pathological processes of the endometrium in women of reproductive age" (Sidorova I. S. Unanyan A. L. (RU), Vlasov R. S. (RU), etc.), proposed a method for predicting the development of endometrial cancer, including the identification of clinical signs, scraping of the uterus, histological examination, determination of the methylation of genes-suppressors MLH1, RASSF1, GSTP1, P16, RAR-b, CDX1 tumor growth by the method of methyl-sensitive PCR (MCH-PCR), the calculation of the probability of development of cancer of the uterine body. When the value of R greater than 0.6 predict a high likelihood of developing cancer of the uterine body, p, equal to 0.3 and 0.59, - moderate probability of cancer, at p below 0,29 - low probability of cancer.

Untill�the horizon is he improves the accuracy of forecasting of development of cancer of the uterine body while existing pathological processes of the endometrium in women of reproductive age, and gives the opportunity to predict the propensity of patients to the formation of isolated endometrial hyperplastic processes.

The known method of quantitative morphological assessment of the severity of chronic endometritis on the patent of Russian Federation №2475742, published on 20.02.2013. The inventive method consists in the fact that examine the scrapings of the endometrium. On the histological specimen score the presence of morphological signs of chronic inflammation in most areas, and at selected sites, depending on their availability and homogeneity. The total score, which ranges from 1 to 10 points, is the quantitative assessment of the severity of chronic endometritis. The sum from 1 up to 4 points allows you to install a light degree of severity of chronic endometritis. From 5 to 7 points - medium, 8 to 10 - heavy. The disadvantage is that the method can be used only by the research histomorphological examination of scrapings from the uterus.

A method of predicting the development of endometriosis, leading to disruption of reproductive function in girls with oligomenorrhea RF patent №2161311, �published 27.12. 2000. The method is based on the study of a number of indicators of the immune system and includes determining the number of T-lymphocytes by flow cytometry (using a cytometric system FACS Calibur company Beckton Dickinson), determining the concentration of immunoglobulin M (IgM) using the test radial immunodiffusion according to Mancini, the determination of the level of circulating immune complexes (CIC) in serum - method of separation in polyethylene glycol with an assessment on the spectrograph Multiscan company Labsystems (wavelength 450 nm). Determination of the diagnostic factor F by the formula F=- K10,00793+K20,013 - K30,043+3,09, where K1- indicator IgM, K2- the value of the CEC, K3- figure T-cells (-CD3). If F>0, then predict a patient's risk of developing endometriosis. If F<0, then the occurrence of endometriosis is unlikely. The proposed method gives the probability of correct prediction in 76% of cases.

The method allows taking into account the main links of the pathogenesis of endometriosis to predict the development of this disease in adolescent girls with oligomenorrhea and chronic pelvic pain, in a timely manner to diagnose the disease and recommend pathogenetically based treatment that may affect the frequency of heavy running FD�m of endometriosis and associated infertility.

The disadvantage is that it can only be used to predict the development of endometriosis in adolescent girls with oligomenorrhea and chronic pelvic pain, but does not allow to predict the formation of isolated endometrial hyperplastic processes.

The objective of this study is to expand the Arsenal of methods of diagnosis, namely the creation of a prediction method of forming isolated hyperplastic processes of the endometrium in women of Russian nationality, urozhenko of the Central Chernozem region of Russia, on combinations of genetic polymorphisms: -308 TNFα G, +36 A TNFR1, A I-TAC, -889 T IL-1A and/or +36 A TNFR1, A I-TAC, -889 T IL-1A and/or -308 TNFα G, +250 G Ltα, -889 T IL-1A.

The technical result of the invention - to provide criteria for the assessment of the risk of isolated endometrial hyperplastic processes.

In accordance with the assigned task has been developed a method of predicting the formation of isolated endometrial hyperplastic processes, including blood sampling, DNA extraction from peripheral venous blood typing of genetic polymorphisms by polymerase chain reaction, carried out the typing of genetic polymorphisms of the tumor necrosis factor α (-308 G/A TNFα), receptor of tumor necrosis factor 1 (+36 A/G TNFR1), interferon inducement�tion chemoattractant T cells (A/G I-TAC), interleukin-1A (-889 C/T IL-1A), lymphotoxin α (+250 A/G Ltα) and the analysis of the combination of gene polymorphisms of tumor necrosis factor α (-308 TNFα G), the receptor of tumor necrosis factor 1 (+36 A TNFR1), interferon inducible of chemoattractant T cells (I-TAC), interleukin

1A(-889 T IL-1A), lymphotoxin α (+250 G Ltα), prediction of an increased risk of isolated forms of hyperplastic processes of endometrium in patients in case of detection of a combination of alleles -308 TNFα G 36 A TNFR1, A I-TAC, -889 T IL-1A and/or combinations of alleles+36 A TNFR1, A I-TAC, -889 T IL-1A and/or combinations of alleles -308 TNFα G,+250 G Ltα, -889 T IL-1A.

Novelty and inventive step lies in the fact that the prior art not known to the ability to forecast the evolution of isolated endometrial hyperplasia by the presence of allele combinations -308 G gene of tumor necrosis factor α (-308 polymorphism TNFα G), allele+36 A receptor of the tumor necrosis factor (polymorphism+36 A TNFR1), allele And interferon inducible of chemoattractant T cells (polymorphism And I-TAC), -889 allele T of interleukin-1A (-889 polymorphism T IL-1A, allele+250 G lymphotoxin α (polymorphism+250 G Ltα).

The invention is characterized by the following graphic image:

Fig.1. Discrimination of alleles at locus G/A I-TAC (rs4512021) (wherehomozygotes GG,homozygotes AA,heterozygotes AG - negative control).

Fig.2. Electrophoretic separation of the products of restriction gene -889 C/T IL-1A, 2,3,4 where homozygotes -889 CT; 5,6,10 homozygotes -889 MOP; 1,7-9,11-14 -heterozygote -889 CT.

The method is as follows:

DNA extracted from samples of peripheral venous blood of patients with isolated hyperplastic processes of the endometrium by the method of phenol-chloroform extraction in 2 stages. In the first stage to 4 ml of blood add 25 ml of lyse buffer containing 320 mm sucrose, 1% Triton X-100, 5 mm MgCl2, 10 mm Tris-HCl (pH=7,6). The resulting mixture was stirred and centrifuged at 4 º C, 4000 rpm for 20 minutes. After centrifugation the supernatant decanted, to the residue add 4 ml of a solution containing 25 mm EDTA (pH=8.0) and 75 mm NaCl, resuspension. Then add 0.4 ml 10% SDS, 35 ál proteinase K (10 mg/ml) and incubated the sample at 37º for 16 hours.

In the second phase from the resulting lysate sequentially perform the extraction of DNA equal volumes of phenol, phenol-chloroform (1:1) and chloroform by centrifugation at 4000 rpm for 10 minutes. After each centrifugation produce a selection of the aqueous phase. DNA is precipitated from the solution with two volumes of chilled 96% ethanol. Formed DNA is dissolved in twice-distilled, deionized water and stored at -200°C.

The selected DNA is then subjected�Ute polymerase chain reaction using standard oligonucleotide primers (table 1).

The structure of the primers and probes used for genotyping of the studied DNA markers

Table 1

The gene and its polymorphismThe PCR conditionsThe structure of the primers and probesThe restriction enzymeLiterature
-308 G/A
TNFα
(rs 1800629)
95.0°C: 4.00 m
54.0°C: 1.00 m
95.0°C: 0.15 m
F: 5'-GAAATGGAGGCAATAGGTTTTGAG-3'
R: 5'-GGCCACTGACTGATTTGTGTGTAG-3'
5'-FAM-CCGTCCTCATGCC - RTQ1-3'
5'-ROX-CCGTCCCCATGCC - RTQ1-3'
____[J. Hulkkonen, 2002]
+36 A/G TNFR1
(rs 767455)
95.0°C: 4.00 m
59.0°C: 1.00 m
95.0°C: 0.15 m
F: 5'- AGCCCACTCTTCCCTTTGTC-3'
R: 5'-CCACCGTGCCTGACCTG-3'
5'- FAM: CTGCTGCCACTGGT-RTQ1-3'
5'- ROX: CTGCTGCCGCTGGT-BHQ2-3'
____[S. J. Chae
et al., 2008]
A/G
I-TAC
(rs 4512021)
95.0°C: 4.00 m
52.5°C: 1.00 m
95.0°C: 0.15 m
F: 5' - CAAAGACCTAAGGGAACTAGGTGATAG - 3'
R: 5' - GTGTCTTCCCAATGTGTGTTCCT - 3'
5' - FAM - ATGACTCTGGCTAGTC - RTQ1-3'
5' - ROX - AGCATGACTCCGGCTA-BHQ2-3'
____[C. Derichs, 2001]
-889 C/T
IL-1A
(r 1800587)
95.0°C: 4.00 m
94.0°C: 0.40 m
60.0°C: 0.40 m
72.0°C: 1.00 m
5'-aagcttgttctaccacctgaactaggc-3'
5'-ttacatatgagccttccatg-3'
Bsp 19I[Trevilatto
et al., 2003]
+250 A/G
Lt α
(rs 909253)
95.0°C: 5.00 m
56.3°C: 1.00 m
95.0°C: 0.15 m
F: 5'-CAG TCTCATTGTCTCTGTCACACATT-3'
R: 5'-ACAGAGAGAGACAGG AAGGGAACA-3'
5'-FAM:CCATGGTTCCTCTC-RTQ1-3'
5'-ROX:CTGCCATGATTCC-RTQ1-3'
____[S. Sugiura, 2002]

Molecular genetic analysis is carried out by polymerase chain reaction of DNA synthesis. PCR is performed on the amplifiers IQ5 (BioRad) and TP-PCR-01-TERZIC".

On the amplifier IQ5 (Bio-Rad) analyze nucleotide polymorphism (-308 G/A TNFα,+36 A/G TNFR1 AND/G I-TAC,+250 A/G Ltα by polymerase chain reaction of DNA synthesis using standard oligonucleotide primers and specific probes with subsequent analysis of the polymorphism method for the discrimination of alleles. The reaction mixture volume of 25 μl includes: 6.7 mm Tris-HCl (pH 8,8), 2.5 mm MgCl2, 0.1 μg of genomic DNA, 10 PM of each primer, 5 pcmall each probe, 200 μm dATP, dGTP, dCTP, dTTP, and 1 unit of active Taq polymerase. After denaturation perform 40 cycles of amplification under the scheme: a primer annealing and denaturation.

On the amplifier TP-PCR-01-TERZIC" analyze polyester�of hizma gene -889 C/T IL-1A by polymerase chain reaction of DNA synthesis using standard oligonucleotide primers according to the method specified in [Hulkkonen, J. Inflammotory cytokines and cytokine gene polymorphisms in chronic lymphocytic leukaemia, in primary Sjögren''s Syndrome and Haelthy Subjects: [acad. diss.] /J. Hulkkonen; University of Tampere, Medical School Tampere University Hospital. - Tampere, 2002. - R. 81].

The reaction is carried out in a 12.5 µl total volume of the mixture containing 33.5 mm Tris-HCl (pH 8,8), 1.25 mm MgCl2, 0.5 μg of genomic DNA, 5 PM of each primer, 100 µm dATP, dGTP, dCTP, dTTP, and 1 unit of active Taq polymerase. After denaturation perform a 32 cycle amplification scheme: denaturation, primer annealing and elongation. Then, the samples incubated for 5 min at 72°C and cooled. The amplification products analyzed in 2% agarose gel, stained with ethidium bromide for 30 minutes at 160V. As the electrophoretic buffer used htae (Tris-acetate buffer). Then, the samples identified in transmitted UV light.

Genotyping is carried out by the method of discrimination of alleles using the Tag Man probes. When conducting PCR amplifier with fluorescence detection (amplifier IQ5) genotyping is performed by method Man Tag probes according to the values of OEF (relative fluorescence unit) of each probe.

Two lanes, vertical and horizontal, divide the graph into four sections: one for each homozygous state, one for the heterozygous state and the section without reaction. The assignment of genotypes of unknown samples is determined by tracing OEP for about�tion of the fluorophore on the x-axis relative to OEF for another fluorophore on the y-axis on the chart discrimination of alleles.

• If the values of OEF of the unknown sample are above the horizontal stripes and the right vertical stripes, genotype heterozygote (GA).

• If the values of OEF of the unknown sample are above the horizontal stripes and vertical bars to the left, genotype homozygote for an allele 2 (OEF allele 2 pending on the y-axis).

• If the values of OEF an unknown sample are below the horizontal bars and to the right of vertical, genotype homozygote for an allele of 1 (RFU allele 1 pending on the x-axis).

• If the values of OEF an unknown sample are below the horizontal bars and to the left of vertical, the definition of the genotype is not possible, in this case an undefined sample - negative control.

Genotyping of DNA markers (locus -889 C/T IL-1A) produced by the method of analysis of the polymorphism of the lengths of restriction fragments (RFLP) of PCR products amplification of specific genomic regions using appropriate enzymes produced by "Simanim" (Novosibirsk).

After incubation, the restriction mixture for 16 hours at 37°C is carried out the separation of DNA fragments by horizontal electrophoresis in an electrophoretic cell production company "Helikon" (Russia). Depending on the size of the partial DNA fragments using agarose gel 2-3% concentration, PR�prepared on the basis of TVE-buffer stained with ethidium bromide solution (0,01%). Visualization of trigram performed in a dark box with a transilluminator company UVP (Sweden).

Creation of database and statistical calculations carried out using the program "STATISTICA 6.0" [Borovikov, V. Statistica: the art of computer data analysis /V. Borovikov. - 2nd ed. - SPb.: Peter, 2003. - 688 p.: ill. - (For professionals)].

Study of the role of combinations of genetic variants of polymorphic markers of genes of interleukins in the formation of isolated uterine fibroids was performed using the software APSampler [http:sources.redhat.com/cygwin/] using Monte-Carlo Markov chains and Bayesian nonparametric statistics [A. V. Favorov A Gibbs sampler for identification of symmetrically structured, spaced DNA motifs with improved estimation of the signal length /A. V. Favorov, M. S. Gelfand, A. V. Gerasimova [et al.] //ioinformatics. - 2005. - Vol.21, No. 10. - R. 2240-2245].

Assessment of the level of statistical significance of the obtained results is carried out using the Bonferroni (pcor), i.e., amendments that minimizes the probability of false positive results [Rebrova O. Yu., Statistical analysis of medical data. https://sites.google.com/site/oyurebrova/book" t "_blank /O. Y. Rebrova//M media. - 2006 - 312 p.].

The possibility of using the proposed method to assess the risk of development of isolated endometrial hyperplasia confirmation�em analysis of the results of observations of 713 patients with different proliferative processes of the reproductive system, including uterine fibroids, endometriosis, endometrial hyperplastic processes and population control group of 500 people. Among 713 surveyed in 150 women were observed hyperplastic processes in the endometrium. Patients were included in the relevant group of patients only after diagnosis of the disease, confirmed by clinical, laboratory and instrumental methods of examination and confirmed by histology data.

In the studied group included individuals of Russian nationality who are nationals of the Central Chernozem region of Russia and have no relationship among themselves.

Found that the combination of molecular genetic markers -308 TNFα G,+36 A TNFR1, A I-TAC, -889 T IL-1A occurs in 41,86% of patients in 2 times more often than in the control group (20,92%, p=0,000005, pcor=0,01, OR=2,72 95%CI 1,76 - 4,18). Also in patients with isolated endometrial hyperplasia common in the combination of genetic variants +36 A TNFR1, A I-TAC, -889 T IL-1A (42,64%) 1.9 times more often in comparison with the control (22,25%, p=0,0000008, pcor=0,02, OR=TO 2.59, 95%CI 1,70 - 3,95). The combination of the three genetic markers -308 TNFα G,+250 G Ltα, -889 T IL-1A (14,81%) in this group significantly more often (in 4.5 times) occurs than in the control group (or 3.28%, p=0,000001, pcor=0,02, OR=5,12, 95%CI 2,47 - 10,61).

A concrete example.

The patient H. the Russian national�spine, a native of the Central Chernozem region of Russia, was held the fence peripheral venous blood, extraction of DNA from peripheral venous blood; polymerase chain reaction typing of genetic polymorphisms of the tumor necrosis factor α (-308 G/A TNFα), receptor of tumor necrosis factor 1 (+36 A/G TNFR1), interferon inducible of chemoattractant T cells (A/G I-TAC), interleukin-1A (-889 C/T IL-1A), lymphotoxin α (+250 A/G Ltα) and analysis of combinations of gene polymorphisms of tumor necrosis factor α (-308 TNFα G), the receptor of tumor necrosis factor 1 (+36 A TNFR1), interferon inducible of chemoattractant T cells (I-TAC), interleukin-1A (-889 T IL-1A), lymphotoxin α (+250 G Ltα). The results are shown in figures 1 and 2.

It is revealed that due to the presence of a combination of alleles -308 TNFα G, +36 A TNFR1, A I-TAC, -889 T IL-1A and combinations of alleles+36 A TNFR1, A I-TAC, -889 T IL-1A, a woman can be attributed to the risk group of the probability of occurrence of isolated endometrial hyperplastic processes with the aim of preventing the development of clinical manifestations, and with the aim of early diagnosis to reduce the frequency of surgical intervention and improve the quality of life of women.

Thus, the obtained data indicate that combinations of alleles -308 TNFα G,+36 A TNFR1, A I-TAC, -889 T IL-1A, allele+36 A TNFR1, A I-TAC, -889 T IL-1A and allele -308 TNFα G,+250 G Ltα, -889 T IL-1A are risk factors R�Suite endometrial hyperplasia (OR=2,72, OR=2,59 and OR=5,12, respectively) in women of Russian nationality, urozhenko of the Central Chernozem region of Russia.

The use of this method will allow to form among women of Russian nationality, urozhenko of the Central Chernozem region of Russia, a group of patients with increased risk of development of endometrial hyperplastic processes for mandatory dynamic ultrasound to monitor the condition of the endometrium, histomorphological examination of the contents of the uterine cavity, with subsequent selection of measures of prevention, supervision or medical treatment from a specialist doctor. With early diagnosis and proper differentiated approach to the management of patients with endometrial hyperplasia will have the opportunity to prevent slamonline of endometrial hyperplastic processes.

A method of predicting risk of development of endometrial hyperplasia in women of Russian nationality, urozhenko of the Central Chernozem region of Russia, including extraction of DNA from peripheral venous blood typing by polymerase chain reaction genetic polymorphisms of the tumor necrosis factor α (-308 G/A TNFα), receptor of tumor necrosis factor 1 (+36 A/G TNFR1), interferon inducible of chemoattractant T cells (A/G I-TAC), interleukin-1A (-889 CT IL-1A), lymphotoxin α (+250 A/G Ltα), and the prediction of an increased risk of endometrial hyperplastic processes in identifying combinations of alleles -308 TNFα G, +36 A TNFR1, A I-TAC, -889 T IL-1A and/or combinations of alleles+36 A TNFR1, A I-TAC, -889 T IL-1A and/or combinations of alleles -308 TNFα G,+250 G Ltα, -889 T IL-1A.



 

Same patents:

FIELD: medicine.

SUBSTANCE: chronic infectious-inflammatory diseases (CIIDs) are diagnosed. Clinical blood analysis and bacteriological tests are conducted. A sensibilisation index (SI) and an immune responsiveness index (IRI) are calculated; total microbial count per 1 m3 of the working space air is measured, and the total microbial number (TMN) is derived. If the TMN is less than 500 CFU/m3 with no CIIDs diagnosed accompanied by the SI of less than 1.08 standard units and the IRI of less than 13 standard units, the immunoassay is considered to be inadvisable. If the TMN falls within the range of 500-2,500 CFU/m3 with one CIID diagnosed accompanied by the SI from 1.08 to 1.3 standard units and the IRI from 13.1 to 15.7 standard units, the immunoassay with the first-level tests seems advisable. Whereas the TMN exceeding 2,500 CFU/m3 with at least two CIIDs accompanied by the SI of 1.4-1.5 standard units and the IRI of 15.8-18.3 standard units, the immunoassay with the second-level tests is thought expedient.

EFFECT: invention enables detecting the workers in need of further examination for the purpose of timely immune correction in the setting of mass routine examinations.

1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: DNA from peripheral venous blood is extracted. An analysis of a combination of genetic versions of polymorphous markers of genes of cytokines of the gene regulator of the activity of normal expression and secretion of T-cells (-403 G/A RANTES), macrophage protein -1β (+1931 A/T MIP 1β), factor of stromal cells (-801 G/A SDF1), interleukin -1 (-511 C/T IL-1B), monocyte chemoattractant protein -1 (C/G MCP-1), interleukin -4 (-590 C/T IL-4) is performed. An increased risk of development of a combination of uterine myoma with endometriosis and hyperplastic processes of the endometrium is predicted if the combination of alleles 403 A RANTES, G MCP-1,+1931 A MIP 1β, -590 C IL-4 or the combination of alleles -403 A RANTES,+1931 A MIP 1β, -801 G SDF1, -511 C IL-1B is identified.

EFFECT: application of the claimed method makes it possible to detect a group of patients with a risk of developing a combination of proliferative reproductive system diseases, which makes it possible to prescribe an adequate therapy to prevent further progressing of the diseases.

3 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: invention deals with method of predicting level of arterial pressure in women of Russian nationality, born in Central Black Earth region of Russia. Method includes separation of DNA from lymphocytes of peripheral venous blood and analysis of genetic polymorphisms. +46G/A ADRB2 and 4a/4b eNOS by method of polymerase chain reaction Level of systolic arterial pressure in women in late pregnancy is predicted by results of multiple regression equation of the following type: Y1=15,455+2,544x1+9,946x2+0,736x3+4,716x4+0,185x5, where x1 is genetic variant in locus - 4a/4b eNOS, namely 4b4b=1; 4a4b=2; 4a4a=3; x2 is presence of preeclampsia in relatives: yes=0, no=1; x3 is level of systolic arterial pressure before pregnancy, mm Hg; x4 is presence of cardiovascular system pathology: yes=0, no=1; x5 is woman's weight before pregnancy, kg Level of diastolic arterial pressure in women in late pregnancy is predicted, for which purpose multiple regression equation of the following type is used: Y2=14,200+7,768x1-2,877x2+7,500x3+0,414x4+3,668x5, where x1 is genetic variant in locus - 4a4b eNOS, namely 4b4b+4a4b=1, 4a4a=0; x2 is genetic variant in locus +46G/A ADRB2, namely GG+GA=1, AA=0; x3 is presence of preeclapsia in relatives:yes=0, no=1; x4 is systolic arterial pressure before pregnancy, mm Hg; x5 is presence of cardiovascular system pathology: yes=0, no=1.

EFFECT: invention makes it possible to realise early prediction of increase of arterial pressure level in women in late pregnancy, will make it possible to form of women at the stage of pregravidal preparation and at early terms of pregnancy groups of high risk of developing hypertension in late pregnancy, as well as realise required therapeutic-preventive measures aimed at prevention of development of said pregnancy complication in due time.

2 dwg, 2 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: method is based on contacting a membrane test strip with an analysed fluid sample and initiating thereby a motion along the test strip membranes of reagents being parts of the sample or coating the membrane, and forming the immune complexes to be detected in the course of reactions in the membrane pores or on the surface thereof. A distinguishing feature of the presented method for antigen detection is that the test strip is coated additionally within the test sample contact area with a certain amount of specific antibodies, which react to the detected antigen expected to be found in the sample, when a fluid front moves and block a certain number of binding sites. The number of the coating free antibodies is specified so that the low content thereof in the analysed sample being of no diagnostic importance ensures blocking the binding sites completely that prevents the antigen from binding in the analysed area of the test strip and from developing a destructive staining in the analysed area.

EFFECT: presented approach enables reliable diagnosing based on the detection results of the antigens of gastrointestinal disorders, avoiding the achievement of positive test results for the low-antigen samples, which testifies to no development of the disease in an individual.

1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention relates to field of medicine, in particular hepatology and infectious diseases, and can be used for determination of stage of fibrous process in monitoring of patients with chronic hepatitis C. To realise method levels of blood serum cytokins are determined in patients with chronic hepatitis C with diagnosed by means of biopsy or other non-invasive method stage of fibrous process 2 times a year, with further calculation of cytokine profile integral index (CPII) on their basis, at initial stage F0 growth of CPII higher than -8 testifies to debut of fibrous changes in liver (transition to stage F1), at initial stage F1, drop of CPII below -10 testifies to transition to stage F2, at initial stage F2 growth of CPII higher than -3 testifies to transition of fibrosis to stage F3, at initial stage F3 drop of CPII below -3 testifies to development of cirrhosis.

EFFECT: determination of stage of fibrous process in monitoring of patients with chronic hepatitis C.

3 ex, 1 tbl, 5 dwg

FIELD: medicine.

SUBSTANCE: invention relates to medicine, namely to a method of predicting spontaneous onset of pregnancy in women with I and II stage of external genital endometriosis. The essence of the invention consists in the fact that before treatment in peripheral blood of women with infertility, associated with I and II stage of external genital endometriosis determined is a relative quantity of IL- IL-1β + monocytes, and if the value of the said index is 50.0% and higher in the monocytic gate the spontaneous onset of pregnancy within a year after carrying out the surgical treatment of endometriosis is predicted.

EFFECT: application of the claimed method makes it possible to predict with high accuracy the spontaneous onset of pregnancy in the women with infertility in case of I and II stage of external genital endometriosis within a year after therapeutic laparoscopy, which makes it possible to select optimal tactics of the patients' management and estimate the necessity of administering them methods of assisted reproductive technologies.

1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: peripheral blood serum interleukin-6 is measured by an immunoassay; if the measured level is more than 5 pg/ml, a biocontrol session of the heart rate variability is predicted to be effective and is expected to represent the total spectrum power gain of the heart rate variability combined with a drop in a regulatory system strain index in relation to references.

EFFECT: method enables the more accurate prediction of the length of the biocontrol course in order to intensify the vagal effect on the heart rate.

1 tbl

FIELD: medicine.

SUBSTANCE: invention relates to field of biotechnology and immunology. Described is antibody, which specifically binds denatured CD70. Claimed group of inventions can be used in medicine.

EFFECT: disclosed is method of diagnostics, prediction, prevention and treatment of malignant tumours of ovaries, pancreas and other malignant tumours with application of antibodies.

5 cl, 10 dwg, 2 tbl, 9 ex

FIELD: medicine.

SUBSTANCE: group of inventions relates to medicine, namely to immunology, and can be used for the ex-vivo determination of the cancer treatment efficiency. For this purpose, a level of activated T-lymphocytes (CD3+ CD69+) in an organism is measured after the introduction to a subject of one or more doses of an immunogenic composition. The level of the activated T-lymphocytes (CD3+ CD69+) higher than approximately 10.4% testifies to the fact that the subject is such that demonstrates successful clinical outcome for treatment; that is an increase of the survival rate.

EFFECT: application of the level of the activated T-lymphocytes (CD3+ CD69+) makes it possible to apply them as a biomarker for the monitoring, modification or correction of cancer treatment.

7 cl, 1 ex, 2 dwg

FIELD: medicine.

SUBSTANCE: invention refers to immunology and represents a method for anti-immunoglobulin E antibody neutralisation activity test, which consists in binding the test antibodies with human IgE in a solution, incubating the above solution with human peripheral blood, inducing cell degranulation and determining a cell portion having a high expression level of CD63 (CD63high) surface marker in a basophile population with phenotype CD123+HLA-DR-.

EFFECT: invention enables considerably reducing the length of analysis and its labour intensity.

2 dwg, 2 ex

FIELD: medicine, ophthalmology.

SUBSTANCE: in lacrimal liquid one should detect the content of interleukin 8 (IL-8) and that of interleukin 1 beta (IL-1β) to calculate prognostic coefficient (PC) due to dividing the first value by the second one by the following formula: At PC value being below 10.0 one should predict favorable disease flow, and at PC value being above 10.0 - unfavorable flow.

EFFECT: higher accuracy of prediction.

2 ex

FIELD: medicine, medicinal microbiology.

SUBSTANCE: method involves growing microorganism culture to be studied in solid nutrient medium followed by preparing microbial suspension and its incubation in the presence of lactoferrin. Control sample is prepared in parallel series. Control and experimental samples are incubated, supernatant is removed from bacterial cells and lactoferrin concentration is determined in supernatant of experimental and control sample by immunoenzyme analysis. Then anti-lactoferrin activity is calculated by difference of concentrations of residual lactoferrin in experimental and control samples. This method provides enhancing the sensitivity and precision in carrying out the quantitative evaluation of anti-lactoferrin activity in broad spectrum of microorganisms that is urgent in diagnosis and prognosis of diseases with bacterial etiology. Invention can be used in determination of persistent indices of microorganisms for assay of their etiological significance in pathological processes.

EFFECT: improved assay method.

3 tbl, 3 ex

FIELD: medicine, biology.

SUBSTANCE: invention relates to nutrient medium used for accumulation of cells for the following cytological and/or immunocytochemical analysis carrying out. Invention relates to medium containing salts NaCl, KCl, anhydrous CaCl2, MgSO4 x 6 H2O, MgCl2 x 6 H2O, Na2HPO4 x 2 H2O, KHPO4, NaHCO3, and also glucose and Henx's solution, 10% albumin solution and polyglucin taken in the ratio 1:1:1. Invention provides enhancing the preservation of cells.

EFFECT: improved an valuable properties of nutrient medium.

3 ex

FIELD: medicine, cardiology.

SUBSTANCE: in peripheral blood one should detect the level of CD95(+) and CD16(+) neutrophilic granulocytes and at combination of increased level of CD95(+) neutrophilic granulocytes by 4 times and more and CD16(+) neutrophilic granulocytes by 0.6 times against the norm with ECG signs of myocardial infarction one should predict lethal result of large-focal myocardial infarction.

EFFECT: higher accuracy of prediction.

FIELD: medicine, parasitology.

SUBSTANCE: one should carry out immunoenzymatic assay to detect diagnostic optic density and that of labeled immune complex in a plot's hole with tested serum measured in conventional units at wave length being 492 nm. One should calculate coefficient of antibodies concentration measured in conventional units by the following formula: CAC = (Odtsh - Odd) x 100, where CAC - coefficient of antibodies concentration, Odtsh - optic density of the hole with tested serum, Odd - diagnostic value of optic density, 100 - coefficient of serumal dilution. By CAC value one should detect the titer of antibodies to Lamblia intestinalis antigens to interpret results of the trial. The method enables to study the dynamics of disease flow.

EFFECT: higher efficiency and accuracy of diagnostics.

1 ex, 1 tbl

FIELD: medicine.

SUBSTANCE: the present innovation deals with studying and treating diseases of inflammatory, autoimmune and degenerative genesis. One should perform sampling of heparinized blood followed by its sedimentation to obtain blood plasma with leukocytes and centrifuging to isolate the latter which are washed against erythrocytic and serumal admixtures, and, also, it deals with calculating the number of cells in samples out of leukocytic suspension after incubation (B) for 1.5 h at 37 C in holes of plastic microplotting board, out of leukocytic suspension one should additionally prepare two samples, one should be applied to calculate total number of leukocytes before incubation (A), the second sample undergoes incubation at the same mode at addition of autoserum to calculate the number of cells remained after incubation (C). One should state upon adhesive properties of leukocytes by the index of spontaneous adhesion (D), where D=(A-B)/B.100%, and effect for enhanced cellular adhesion under the impact of autoserum should be detected by the value of K=(B-C)/C.100% at K ≥ 30%, where B - C - the number of cells undergone additional adhesion after addition of autoserum. The present innovation widens functional possibilities of the suggested method due to obtaining additional values depicting adhesive properties of blood leukocytes.

EFFECT: higher accuracy of detection.

FIELD: medicine, immunology.

SUBSTANCE: one should carry out reaction of blast-transformation, detect proliferation of T-lymphocytes activated with antibodies to CD3 in the presence of interleukin-7 (ACT IL-7) and in the presence of interleukin-7 and dexametazone (ACT IL-7 D), calculate the index for dexametazone action as the ratio of ACT IL-7 to ACT IL-7 D, moreover, the value of dexametazone action index being above 1.2 indicates increased production of cytokins that suppress T-lymphocytes in neonatals. The method enables to detect functional defect of immune system that characterizes neonatal period.

EFFECT: higher efficiency of detection.

2 ex

FIELD: medicine.

SUBSTANCE: method involves measuring forced exhalation volume per 1 s (FEV1) in l, full right ventricle evacuation time (RVE) in ms and angiotensin II value (AII) in ng/l. Discriminant relationship is built as D=0.504·RVE+3.038·FEV1 - 2.0·AII. D being less than 83.88, pulmonary hypertension occurrence is predicted within 1 year. D being equal to or greater than 83.88, no pulmonary hypertension is predicted to occur.

EFFECT: enhanced accuracy of prediction.

FIELD: medicine, medicinal immunology.

SUBSTANCE: method involves determination of heterophilic antibodies in human serum blood by the Paul-Bunnel's method relatively the level of circulating immune complexes, complement-activating properties of heterophilic antibodies by incubation of standardized ram erythrocytes with 0.8% serum for 30 ± 5 min and the following measurement of the erythrocytes lysis degree. The measurement of the effector function coefficient of heterophilic antibodies is carried out by the complement system Keff.f.h.a.-c.s. by the formula: Keff.f.h.a.-c.s. = Y/Tg.a. wherein Y means a lysis degree, %; Tg.a. means a reverse titer of heterophilic antibodies to ram erythrocytes. The damage assay is carried out by comparison of the immune status with the relative level of circulating immune complexes in serum. Method provides detection of preclinic from of immunodeficiency and autoimmune diseases that opens the possibility for their prophylaxis at most early stages of development. Invention can be used for assay of damage in the immune status in human serum blood.

EFFECT: improved method for assay.

5 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: method involves concurrently examining anti-inflammatory IL-4 level in blood serum and lacrimal fluid. The value being within the limits of 60-70 pg/l in blood serum and 5-15 pg/l in lacrimal fluid, disease prognosis is considered to be unfavorable. The IL-4 concentration being within the limits of 90-100 pg/l in blood serum and 20-30 pg/l in lacrimal fluid, disease prognosis is considered to be favorable.

EFFECT: high accuracy of diagnosis.

Up!