Strain escherichia coli bl21(de3)gold/petmin-cypa producing human recombinant cyclophilin a

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and concerns the strain Escherichia coli BL21(DE3)Gold/pETmin-CypA producing human recombinant cyclophilin A. The characterised strain is produced by cell transformation of the strain BL21(DE3)Gold by pETmin-CypA plasmid. The plasmid has a size of 5865 base pairs and contains XhoI-NdeI fragment of pET-22b(+) vector carrying ampR ampicillin resistance gene, a promoter and RNA-polymerase T7 phage terminator and a polylinker. A fragment produced by PCR with using the oligonucleotide primers 5'-TTATACATATGGTCAACCCGACCGTGTTCTTC and 5'-TTTCTCGAGTTATTCGAGTTGTCCACAGTCAGC of pCyPAwt/pGEX-2TK plasmid with the closed fragment of hrCpA (human recombinant cyclophilin A) gene having a size of 498 base pairs is cloned at XhoI-NdeI sites.

EFFECT: presented strain is high-producing; it requires no complicated clean-up system and can be used in cancer treatment.

2 dwg

 

The invention relates to the field of molecular biotechnology and genetic engineering, and relates to a new strain-producer of recombinant cyclophilin And (rctpa).

The use of anticancer chemotherapy leads to suppression of hematopoiesis and creates the risk of infectious complications, which hampers timely treatment. There is therefore the need to use tools that support the hematopoietic function of bone marrow.

Cyclophilin A (CFA) is a protein with a molecular weight of 18 KD, is found in all tissues of mammals, involved in intracellular protein transport, regulation of cell proliferation and holding the signal from the receptor in T-lymphocytes [Fischer G, Bang H, Mech S. Determination of enzymatic catalysis for the cis-trans-isomerization of peptide binding in proline-containing peptides. Biomed. Biochim. Acta. 1984; 43(10): 1101-1111; Colgan J, Asmal M, Yu B, Luban J. Cyclophilin A-deficient mice are resistant to immunosuppression by cyclosporine. Journal of immunology. 2005; 174(10): 6030-6038]. Secretory forms the CFA inflammation, attracting Mature macrophages, neutrophils and activated T-lymphocytes [Sherry B, Yarlett N, Strupp A, Cerami A. Identification of cyclophilin as a proinflammatory secretory product of lipopolysaccharide-activated macrophages. Proceedings of the National Academy of Sciences of the United States of America. 1992; 89(8): 3511-3515].

CFA enhances the migration of stem cells and precursors from the bone marrow to the periphery, which allows to consider this blockack factor regeneration [Khromykh LM, Kulikova NL, Anfalova TV, et al. Cyclophilin A is produced by thymocytes regulates the migration of murine bone marrow cells. Cell Immunol. 2007; 249 (1): 46-53].

CFA is a factor of differentiation of stem cells of the myeloid series and promotes the maturation of dendritic cells, that allows to consider it as a hematopoietic factor, able to participate in the recovery of the immune system.

For a comprehensive study of the biological properties of the CFA, particularly in systems in vivo, requires a significant amount of this protein.

Known strain of Escherichia coli (E. coli) producing RCCF in the form of protein with polyhistidine sequence [V. Sherry, G. Zybarth, M. Alfano, L. Dubrovsky JG, R. Mitchell, D. Rich, P. Ulrich, R. Bucala, A. Cerami, M. Bukrinsky. Role of cyclophilin A in the uptake of HTV-1 by macrophages and T lymphocytes. Proc. Natl. Acad. Sci. 1998, 95, pp.1758-1763].

Disadvantages: RCCF is produced in the form of a protein that is different from native, containing in its composition polyhistidine sequence; low content of the final product (protein); the need for additional purification steps.

A known strain of E. coli that produce RCCF without additional polypeptide sequences [Liu J, Albers MW, Chen CM, Schreiber SL, Walsh CT. Cloning, expression andpurification of human cyclophilin in Escherichia coli and assessment of the catalytic role of cysteines by site-directed mutagenesis. ProcNatlAcadSciUSA, 1990 Mar; 87(6): 2304-2308].

Disadvantages: low content of the final product and complex purification scheme.

Task Appl�already listed of the invention is the creation of a strain of E. coli - the producer of RCCF high protein, structurally as close as possible to native and does not require complicated purification systems.

The problem is solved by transforming competent cells of E. coli BL21(DE3)Gold plasmid pETmin-CypA

The technical result of the invention: the resulting strain E. coli BL21(DE3)Gold/pETmin-CypA - producer of recombinant cyclophilin And structurally as close as possible to native and does not require complicated purification systems.

To obtain plasmids pETmin-CypA was performed polymerase chain reaction (PCR) with oligonucleotide primers (5'-TTATACATATGGTCAACCCGACCGTGTTCTTC and 5'-TTTCTCGAGTTATTCGAGTTGTCCACAGTCAGC), using as template the plasmid pCyPAwt/pGEX-2TK. The resulting reaction fragment length of 515 BP and the vector pet-22b(+) were digested with restriction endonucleases BamHI and NdeI. After that, the enzymes are inactivated at t=65°C for 20 min and the reaction was carried out ligation. The strain E. coli TOP10 transformed ligase mixture (water, transforming the vector buffer for ligase, ligase, polyethylene glycol). Selected resistant to ampicillin clones, plasmids were isolated and conducted PCR-RFLP analysis.

Physical map of the resulting plasmid is shown in Fig.1.

The structure of the cloned gene in the selected clones was confirmed by determining the nucleotide sequence using the kit Big Dye Terminator Cycle Squencing Kit (v. 3.1). In the obtained expression plasmid pETmin-CypA (Fig.1). Plasmid pETmin-CypA contains a unique recognition sites of restriction by endonucleases, with the following coordinates: PstI - 4726, EcoRV - 1937, BgIII - 765.

Plasmid pETmin-CypA has a size 5865 base-pair (BP) and contains: a fragment XhoI-NdeI vector pet-22b (+) carrying the gene for resistance to ampicillin ampR, promoter and terminator of RNA polymerase of phage T7 and polylinker in which the sites XhoI-NdeI cloned fragment obtained by PCR using oligonucleotide primers 5'-TTATACATATGGTCAACCCGACCGTGTTCTTC and 5'-TTTCTCGAGTTATTCGAGTTGTCCACAGTCAGC plasmid pCyPAwt/pGEX-2TK with a cloned fragment of the gene for RCCF size 498 BP (M. Bukrinsky Albert Einstein College of Medicine of Yeshiva University, USA):

A method of producing strain E. coli BL21(DE3)Gold/pETmin-CypA.

Competent cells of E. coli BL21(DE3)Gold transformed with plasmid pETmin-CypA and after cultivation of recombinant clones on apparitional LB medium containing 150 mg/l ampicillin at t=37°C, were obtained producing strains of the polypeptide RCCF.

The cultivation of the proposed strain in the fermenter.

A single colony of the inventive strain was inoculable in 5 ml of broth TV containing 150 mg/l ampicillin, and were grown for 18 h with stirring at a speed of 180 Rev/min and t=37°C. the Inoculum for fermentation was prepared, Parasiva adapted culture in 500 ml again when�otoplenie environment cultivated in the conditions of aeration for 18 h and was introduced into the fermenter.

The fermentation culture was performed once in the fermenter inoculum at a ratio of 1:10 to the volume of the medium with pH 7.0 to 7.4; t=37°C and aeration of 150 Rev/min. the Culture was grown for 2 h, then added the inducer isopropyl-β-D-1-thiogalactopyranoside (IPTG) to a final concentration of 0.5 mm, incubated for 4 h. Cells were collected by centrifugation 4000 rpm for 10 min and kept at t=-20°C. the Content of RCCF in biomass of recombinant producer strain was up to 20% the total protein content of producer strain or 100 mg/liter of bacterial culture.

The resulting strain E. coli BL21(DE3)Gold/ pETmin-CypA characterized by the following features.

Morphological features: the cells are rod-shaped, gram-negative, Nisporeni.

Cultural characteristics: the cells grow well on standard nutrient media. The generation time is up to 30 min in liquid LB-medium. The growth agresiones LB medium, colonies are round, smooth, translucent, shiny, grey, edge smooth; the diameter of the colonies 2-3 mm; pasty consistency. Growth in LB liquid medium is characterized by the clouding. Culture fluid after cooling was subjected to centrifugation.

Physiological and biochemical characteristics: the cells were grown in �the range of temperatures of 20 to 42°C, when the pH value of 6.8 to 7.2.

The resistance of the strain to antibiotics: cells resistant to ampicillin due to the presence of plasmid pETmin-CypA gene ampR.

Storage conditions strain: LB medium with 15% glycerol, t=-70°C in the store vials.

The strain E. coli BL21(DE3)Gold/pETmin-CypA deposited in all-Russian Collection of Industrial Microorganisms FSUE Geniii Genetics, registration number VKPM b-11722.

A method of producing RCCF performed as follows. Cultivation of E. coli strain BL21(DE3)Gold/pETmin-CypA was carried out at t=37°C in a nutrient medium based broth TV (Terrific Broth) at pH of 7.2; the culture liquid after cooling, centrifuged. The obtained biomass was destroyed by an ultrasonic disintegrator. Soluble fraction was subjected to ion exchange chromatography on a column of Fractogel TSKDEAE-650(S); the unbound fraction was passed through ion-exchange column (CM Sepharose Fast Flow. Purification of the final product from endotoxins was performed on a column with Detoxi-Gel Endotoxin Removing Gel.

The destruction of the biomass was performed using an ultrasonic disintegrator Branson Sonifier 250 in lysing buffer (20 mm TrisCl, pH 8.0 for 5 min. the Temperature of the slurry was maintained in the range from 2 to 8°C if the oscillation frequency of the tip, a component of 22 KHz, the amplitude of 14-16 μm and the disintegration capacity of 100 watts. The resulting lysate was centrifuged at 50000 g for 15 min.

The solution�needful fraction of cells were applied to a column containing Fractogel TSKDEAE-650(S) and the balanced buffer (20 mm TrisCl pH of 8.0 at a speed of 3 ml/min. under these conditions, RCCF not been contacted with the sorbent. The fraction containing RCCF, adjusted to a pH of 6.2 by adding 10% acetic acid. The separation of the fractions was performed on a column filled with a cation-exchange sorbent CM Sepharose Fast Flow and equilibrated in 20 mm sodium phosphate buffer, pH 6.2 (buffer C) at a speed flow 5 ml/min After application fraction the column was washed with buffer C to exit the optical density of the flowing solution at 280 nm to a value close to zero. The elution was conducted with a linear gradient from buffer C to buffer 20 mm Na2CO3, 250 mm NaCl, pH>10, a volume of 150 ml.

To remove lipopolysaccharides used sorbent Detoxi-Gel Endotoxin Removing Gel (Thermo Scientific), which was placed in a chromatographic column HK/20 and was equilibrated by passing 50 ml of phosphate-buffered saline. Further passed through a column of the solution of purified RCCF in phosphate-buffered saline at a flow rate of 2 ml/min Maximum total amount of protein applied at one time was 200 mg, and the solution volume is 50 ml. the Control process performed by the flow measurement of the optical density of the solution at a wavelength of 280 nm. The product fully meets the requirements of immunobiological recombinant drugs �about the content of impurity bacterial proteins of E. coli and endotoxins.

The method allows to obtain 70-100 mg protein per 1 l of bacterial culture.

A chromatographic separation of RCCF by electrophoresis is shown in Fig.2.

Legend:

M - markers.

But - soluble fraction of the lysate of E. coli strain BL21(DE3)Gold/pETmin-CypA.

In - fraction, obtained after flash chromatography.

With the fraction not bound to a cation exchange column.

1, 2, 3 - fractions obtained by gradient elution cation exchange column.

The Escherichia coli strain BL21(DE3)Gold/pETmin-CypA - producer of recombinant cyclophilin A person obtained by transformation of cells of strain BL21(DE3)Gold plasmid pETmin-CypA with size 5865 pairs of nucleotides and containing a fragment XhoI-NdeI vector pet-22b (+) carrying the gene for resistance to ampicillin ampR, promoter and terminator of RNA polymerase of phage T7 and polylinker in which the sites XhoI-NdeI cloned fragment, obtained by PCR using oligonucleotide primers 5'-TTATACATATGGTCAACCCGACCGTGTTCTTC and 5'-TTTCTCGAGTTATTCGAGTTGTCCACAGTCAGC plasmids pCyPAwt/pGEX-2TK with a cloned fragment of the gene for RCCF size 498 BP:
1 atggtcaacc ccaccgtgtt cttcgacatt gccgtcgacg gcgagccctt
51 gggccgcgtc tcctttgagc tgtttgcaga caaggtccca aagacagcag
101 aaaattttcg tgctctgagc actggagaga aaggatttgg ttataagggt
151 tcctgctttc acagaattat tccagggttt atgtgtcagg gtggtgactt
201 cacacgccat aatggcactg gtggcaagtc catctatggg gagaaatttg
251 aagatgagaa cttcatccta aagcatacgg gtcctggcat cttatcgatg
301 gcaaatgctg gacccaacac aaatggttcc cagtttttca tctgcactgc
351 caagactgag tggttggatg gcaagcatgt ggtgtttggc aaagtgaaag
40 aaggcatgaa tattgtggag gccatggagc gctttgggtc caggaatggc
451 aagaccagca agaagatcac cattgctgac tgtggacaac tcgaataa



 

Same patents:

FIELD: biotechnology.

SUBSTANCE: strain Aspergillus oryzae 12-84, having a high level of synthesis of the complex of proteases and peptidases, nucleases, chitinase, β-glucanase, mannanase and α-amylase, is deposited in State Scientific Institution of All-Russian Scientific Research Institute of Agricultural Microbiology of the Russian Agricultural Academy under the registration number Aspergillus oryzae RCAM01134. The strain may be used to produce complex enzyme preparations with their subsequent application for hydrolysis of raw materials in the preparation of biocorrectors of food and feed, amino acid additives and biologically active additives with functional properties.

EFFECT: invention enables to increase the yield of proteolytic, nuclease, chitinase, β-glucanase, mannanase and α-amylase activities.

2 tbl, 2 ex

FIELD: biotechnologies.

SUBSTANCE: strain of green microalga Acutodesmus obliquus Syko-A Ch-055-12 with the ability to reduce the content of polluting substances in sewage is deposited in the Collection of Microseaweed of IPPAS under the registration number IPPAS S-2016. The strain of green microalga Acutodesmus obliquus IPPAS S-2016 can be used for cleaning of waste treatment facilities of municipal services and the pulp-and-paper enterprise from polluting substances (ammonium nitrogen, suspended substances, iron) at high temperatures.

EFFECT: improvement of strain properties.

1 dwg, 2 ex

FIELD: biotechnology.

SUBSTANCE: characterised method comprises carrying out of PCR with use of specific primers to genes vc0497, vc0502 and vc0514 from the island of pandemicity VSP-II. The characterised test system comprises the components for isolation of DNA, the components for carrying out PCR, including, in particular, a primer mix VSPIIreg-F - 5'-TGGAAAGAAGAGCGTTACTGC-3', VSPIIreg-R - 5'-CCCTGTTGATGATGTGATTTG-3' to the gene vc0497, VSPIIpilin-F - 5'-CTGTGATTCGGGCTTTATCGG-3', VSPIIpilin-R - 5'-GCGTAAACTGAGCCAATAAGC-3' to the gene vc0502, VSPIIchem-F - 5'-CTTGATGGAGCGGAGAAAAC-3', VSPIIchem-R - 5'-CGATGAATAGCCTGTTGAAC-3' to the gene vc0514, taken in the ratio 1:1:1:1:1:1, respectively.

EFFECT: inventions enable to differentiate quickly and reliably the toxigenic genetically modified strains to genovariants with low and high epidemic potential.

2 cl, 1 dwg, 2 tbl

FIELD: biotechnology.

SUBSTANCE: strain of bacterium Bacillus subtilis RNCIM B-11964 is proposed, which is a highly active producer of pectolytic enzymes macerating plant tissue.

EFFECT: strain exhibits high pectate-lyase and pectin-lyase activity with respect to pectins from different sources.

2 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: group of inventions refers to biotechnology and microbiology. There are presented strain Bacillus sp. KCCM11143P possessing antifungal activity on Saprolegnia sp., culture fluid produced by culturing the strain, probiotic composition, feed additive, antifungal agent and agent for improving quality of water containing the strain Bacillus sp. KCCM11143P or its culture fluid. There are also presented method for culturing fish or shell fish, method for preventing saprolegniosis in animals and method for improving quality of water with using the strain Bacillus sp. KCCM11143P or its culture fluid.

EFFECT: strain Bacillus sp KCCM11143P has a high production level of siderophores inhibiting a high ability of iron uptake and thereby inhibits the growth of other pathogens and Saprolegnia sp, promotes a higher rate of food consumption and weight gain by fish, as well as reducing an excretion level that promotes higher quality of water.

10 cl, 4 dwg, 11 tbl, 15 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. Disclosed is a Microbacterium species VKM Ac-2614D strain for cleaning contaminated and chronically contaminated fresh water bodies in the temperature range of +2°C to +25°C.

EFFECT: invention enables to remove petroleum hydrocarbons from water and bottom deposits with low oxygen concentration in the water and in high latitude conditions.

3 tbl, 2 ex

FIELD: biotechnology.

SUBSTANCE: strain of microalgae Desmodesmus sp. 3Dp86E-1 has high rate of CO2 fixation and tolerance to high concentrations of CO2 in the cultivation medium, and the high ability to accumulate lipids enriched with polyunsaturated fatty acids. The strain is deposited in the Collection of microalgae cultures of the Institute of Plant Physiology n.a. K.A. Timiryazev RAS (IPPAS) under the registration number Desmodesmus sp. IPPAS S-2014 and can be used for conversion of carbon dioxide from industrial waste gases in the raw material for production of biofuel and feed additives.

EFFECT: invention enables to improve the rate of fixation of CO2 in air-gas mixture.

4 dwg, 1 tbl

FIELD: biotechnology.

SUBSTANCE: strain of microalgae Chlorella vulgaris 711-54 has high properties of wastewater treatment degree of agricultural and alcohol production, significant productivity and high content of valuable compounds in biomass. The strain is deposited in the Russian Collections of Microalgae in the institution of the Russian Academy of Sciences of Institute of Plant Physiology n.a. KA Timiryazev (IPPAS) with the assigned identifier Chlorella vulgaris IPPAS C-2015 and can be used for treatment of wastewater of agricultural and alcohol production.

EFFECT: invention enables to improve the quality of treatment of the said wastewater.

1 tbl, 4 dwg

FIELD: biotechnology.

SUBSTANCE: characterised oligonucleotide primers are complementary to a specific region of the mig-gene of Mycobacterium avium and have the following base composition: 5'-CGT CAA AAG CGA ACT GCA-3' and 5'-TAA TTC GTT GCC CGA CTC-3'. The method of detecting DNA of Mycobacterium avium comprises DNA isolation, DNA amplification using oligonucleotide primers, transfer of amplification product on the gel followed by detection of the analysis results on the transilluminator. In case of positive reaction a fragment is synthesised, corresponding to the size of 157 bps.

EFFECT: inventions can be used in veterinary diagnostic, scientific and practical laboratories for detection of genetic material of Mycobacterium avium in samples.

2 cl, 1 dwg, 4 ex

FIELD: chemistry.

SUBSTANCE: present invention relates to biotechnology and is a genetically modified strain of Streptomyces thermotolarences WSJ-IA, which produces isovaleryl spiramycin I. The present invention also discloses a method of producing said strain. The method includes steps of constructing a recombinant plasmid comprising a double gene ist-acyB2 and transforming the plasmid into the isovaleryl spiramycin I - producing strain WSJ-IA. The invention also discloses a method of producing isovaleryl spiramycin I by culturing the Streptomyces thermotolarences WSJ-IA strain in a culture medium.

EFFECT: present invention increases the output of the obtained isovaleryl spiramycin I.

3 cl, 3 dwg, 5 tbl, 4 ex

FIELD: chemistry.

SUBSTANCE: invention relates to the field of biotechnology. Claimed is a transformed microorganism - yeasts Saccharomyces for obtaining ethanol, where the said microorganism is transformed with a nucleotide sequence, coding xylose isomerise, and the said microorganism is transformed by a nucleotide sequence, coding xylulokinase, or the said microorganism is transformed with a promoter, capable of increasing the expression of endogenic xylulokinase. The said microorganism is capable of a higher xylose isomerise activity; higher growth rate in a growth medium or on a growth medium, which contains xylose; faster xylose metabolism; and/or faster ethanol production when grown in anaerobic conditions on xylose as a carbon source than an equivalent microorganism before transformation. An inoculant and culture medium, containing the said transformed yeasts and xylose or a source of xylose, are described. Claimed is a method of obtaining the said transformed microorganism, including a stage of the microorganism transformation with the xylose isomerise-coding nucleotide sequence, or the xylulokinase-coding nucleotide sequence, or the promoter, capable of increasing the expression of endogenic xylulokinasse. Described is a method of fermentation, including the cultivation of the said microorganism in the culture medium, which contains xylose or xylose source. Claimed is a method of obtaining ethanol-containing biofuel, where the said method includes a stage cultivation of the microorganism in accordance with the claimed invention in the culture medium, which contains xylose or source of xylose. Application of the yeasts in accordance with the claimed invention for obtaining ethanol is described.

EFFECT: invention makes it possible to obtain ethanol by means of the said transformant in a larger amount in comparison with the equivalent microorganism before transformation, on the xylose-containing medium.

11 cl, 7 dwg, 1 tbl, 7 ex

FIELD: chemistry.

SUBSTANCE: invention relates to a method for the enzymatic production of 2-hydroxy-2-methyl carboxylic acids from 3-hydroxy carboxylic acids. The disclosed method involves synthesis of 3-hydroxy carboxylic acid in an aqueous reaction solution which contains a unit, having 3-hydroxy carboxylic acid CoA-mutase activity and having both 3-hydroxy-carbonyl-CoA ester-producing and 3-hydroxy-carbonyl-CoA ester-isomerising activity. That unit is selected from a group comprising an isolated cobalamin-dependent mutase, an enzyme or a system of enzymes exhibiting 3-hydroxy-carbonyl-CoA ester, a microorganism or crude extract thereof, adding to said reaction solution, incubation, and then obtaining, appropriately, converted 2-hydroxy-2-methyl carboxylic acid in form of an acid or in form of salts thereof.

EFFECT: method is safe for the environment and has low power consumption.

24 cl, 2 dwg, 2 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: invention concerns biochemistry and biotechnology and can be applied in crop production. New albumen (MF3) capable of improving plant resistance to infection diseases and plant parasites is extracted from cells of Pseudomonas fluorescence microbe. Gene mf3 is cloned, complete sequence encoding the albumen is determined, and expression vectors are constructed, which activate the said sequence or its part coding MF3 fragment retaining protection properties of the whole albumen. Introduction of obtained vector constructions into host plant cells produces plant cell cultures expressing MF3, transgenic plants resistant to infection diseases and/or plant parasites, and microbe strains producing recombinant albumens. The invention suggests application of purified MF3 albumen or its active fragment in compositions for plant protection against pathogens and vermin.

EFFECT: obtaining a substance applicable in compositions for plant protection against pathogens and vermin.

9 cl, 1 dwg, 24 tbl, 24 ex

FIELD: biotechnology.

SUBSTANCE: invention relates to isolated molecules of Corinebacterium glutamicum nucleic acid encoding polypeptide having diaminopimelat epimerase activity. Disclosed are recombinent expressing vectors containing such nucleic acid molecules and host cells with introduced abovementioned expressing vectors. Also disclosed is method for production of amino acids by cultivation of said cells.

EFFECT: enhanced enzyme assortment; high effective method for amino acid production.

36 cl, 4 tbl, 13 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. A disclosed polypeptide having the amino acid sequence which has a sequence identity of not less than 80% to the amino acid sequence shown in SEQ ID NO: 1 or 2, revealed in description, which polypeptide has a capable of expressing the polynucleotide activity. Also a polynucleotide encoding D-lactate dehydrogenase originated from DNA construct in which the polynucleotide and a promoter capable of expressing the polynucleotide are linked is introduced. Also described a transformant for production of lactic acid, or transformed yeast, in which the polynucleotide or the DNA construct is introduced. A method of producing D-lactic acid, which comprises the step of culturing the said transformant.

EFFECT: transformant capable of highly producing D-lactic acid compared to the D-lactic acid produced with host cell.

15 cl, 2 dwg, 4 tbl, 13 ex

FIELD: chemistry.

SUBSTANCE: invention relates to the field of biotechnology. Claimed is a transformed microorganism - yeasts Saccharomyces for obtaining ethanol, where the said microorganism is transformed with a nucleotide sequence, coding xylose isomerise, and the said microorganism is transformed by a nucleotide sequence, coding xylulokinase, or the said microorganism is transformed with a promoter, capable of increasing the expression of endogenic xylulokinase. The said microorganism is capable of a higher xylose isomerise activity; higher growth rate in a growth medium or on a growth medium, which contains xylose; faster xylose metabolism; and/or faster ethanol production when grown in anaerobic conditions on xylose as a carbon source than an equivalent microorganism before transformation. An inoculant and culture medium, containing the said transformed yeasts and xylose or a source of xylose, are described. Claimed is a method of obtaining the said transformed microorganism, including a stage of the microorganism transformation with the xylose isomerise-coding nucleotide sequence, or the xylulokinase-coding nucleotide sequence, or the promoter, capable of increasing the expression of endogenic xylulokinasse. Described is a method of fermentation, including the cultivation of the said microorganism in the culture medium, which contains xylose or xylose source. Claimed is a method of obtaining ethanol-containing biofuel, where the said method includes a stage cultivation of the microorganism in accordance with the claimed invention in the culture medium, which contains xylose or source of xylose. Application of the yeasts in accordance with the claimed invention for obtaining ethanol is described.

EFFECT: invention makes it possible to obtain ethanol by means of the said transformant in a larger amount in comparison with the equivalent microorganism before transformation, on the xylose-containing medium.

11 cl, 7 dwg, 1 tbl, 7 ex

FIELD: chemistry.

SUBSTANCE: invention refers to biotechnology. What is presented is nucleic acid coding protein possessing acetyl-CoA-carboxylase activity making up the deficiency of acetyl-CoA-carboxylase in yeast, wherein a nucleotide sequence is specified in nucleic acid, which contains a nucleotide sequence: (a) coding protein consisting of the amino acid sequence SEQ ID NO:2; (b) hybridised in the hard conditions with nucleic acid complementary to SEQ ID NO:1; (c) SEQ ID NO:1; and (d) hybridised in the hard conditions with nucleic acid consisting of the complementary nucleic sequence coding protein SEQ ID NO:2; wherein SEQ ID NO:1 and 2 are disclosed in the description. There are also described: acetyl-CoA-carboxylase (SEQ ID NO:2) increasing the host-specific arachidonic acid content; a recombinant vector containing the above nucleic acid; and a cell transformed by the above vector for producing the fatty acid composition rich in arachidonic acid. What is presented is a method for producing the fatty acid composition involving culturing the above cell and collecting the fatty acid composition from the transformed cell culture.

EFFECT: invention enables producing the fatty acid composition rich in arachidonic acid in the host cell.

11 cl, 8 dwg, 5 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used to determine a human genotype by polymorphism in matrix metalloproteinase MMP9-1562 C>T (rs3918242) gene. The method is based on the establishment of a melting profile with fluorescence-labelled specific oligonucleotide samples. The method uses an allele-shared pair of primers, fluorescence-labelled allele-specific oligonucleotide samples different for each allele and a general oligonucleotide labelled with a fluorescence extinguisher of the following nucleotide composition: MMP9-1562s CGAAACCAGCCTGGTCAACG; MMP9-1562a TCTGCCTCCCGGGTTCAAGC; MMP9-1562p1 GGCGCACGCCTATAA-FAM; MMP9-1562p2 GGCGCATGCCTATAA-HEX; MMP9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), wherein FAM means the fluorescence extinguisher FAM, HEX means the fluorescence extinguisher HEX, BHQ1 means the dark fluorescence extinguisher attached to 5'-terminal nucleotide. Referring the sample to a homozygote or a heterozygote by the allele is determined by a DNA melting profile shape that is a maximum of the first fluorescence curve derivative.

EFFECT: invention enables providing more reliable and accessible genotyping.

1 dwg

FIELD: biotechnology.

SUBSTANCE: invention is the mutant variants of recombinant L-asparaginase characterised by amino acid sequence corresponding to the amino acid sequences of L-asparaginase of bacteria Wolinella succinogenes, in which the lysine amino acid residue in the position 24 is replaced by the serine residue or the valine amino acid residue in the position 23 is replaced by the glutamine residue, and the lysine amino acid residue in the position 24 is replaced by the threonine residue.

EFFECT: invention enables to obtain variants of L-asparaginase with improved resistance to proteolysis under the action of trypsin when compared to the unmodified recombinant protein and different levels of glutaminase activity while complete maintaining asparaginase activity, which makes them attractive objects for development on their basis of new antitumor therapeutics preparations.

2 cl, 1 dwg, 1 tbl, 11 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and immunology. What is presented is a host cell of Bordetella pertussis, Bordetella bronchiseptica or Bordetella parapertussis, which is used as an adjuvant or for preventing or treating whooping cough, having the low activity of endogenous glycosyltransferase at least 98% identical to the amino acid sequence SEQ ID NO: 2 as compared to the activity of glycosyltransferase of a relative parent strain, wherein the low activity is ensured by using an inactivating vector, which causes the inactivation of expression of a sequence of endogenous nucleic acid coding glycosyltransferase, or reduces to a low level of expression of the sequence of endogenous nucleic acid coding glycosyltransferase by the fusion of nucleic acid coding glycosyltransferase with a low-level or inducible promotor. What is disclosed is a preparation consisting of LPS of the above host cell with an increased replacement of hexosamine 1' or 4' phosphate groups of LPS referred to a lipid A, as compared to a LPS preparation from the related parent strain; thereby LPS is characterised by producing at least 8 ions in the ESI-MS spectrum, wherein the preparation is used as an adjuvant or for preventing or treating whooping cough. What is presented is using the above host cells or the LPS preparation for producing the preparation for preventing and/or treating whooping cough, or producing the drug preparation for immunising a mammal, wherein the host cells or LPS is used as an adjuvant. What is described is a pharmaceutical composition used as the adjuvant or for preventing or treating Bordetella infection containing the above host cell or above LPS preparation in an effective amount and a pharmaceutically acceptable carrier.

EFFECT: invention enables producing the pharmaceutical preparation of Bordetella cells or LPS, possessing the high immunogenicity as compared to the preparation of the related parent strain Bordetella.

12 cl, 7 dwg, 3 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, in particular to tumour-specific promoters, and can be used in the anti-cancer therapy. There are constructed the broad-spectrum tumour-specific promoters providing the therapeutic gene expression inside a cancer cell. The invention also involves expression cassettes, expression vectors, pharmaceutical compositions, methods of treating cancer and using the expression cassettes and vectors.

EFFECT: promoters of the present invention provide a high expression level of the operatively linked therapeutic gene in the cancer cells of different origin, wherein the normal cell expression is absent or low.

29 cl, 19 dwg, 4 tbl, 20 ex

Up!