Humanised antibody to tnf-α, its antigen-binding fragment (fab) and their application

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to the field of biochemistry, in particular to a humanised antibody to a tumour necrosis factor-α or its antigen-binding fragment Fab. Also disclosed are: gene, coding the protein of the antibody or Fab, genetic material, expressing the said antibody or Fab-fragment. Disclosed are: application of the antibody of Fab for obtaining a medication for the prevention or treatment of diseases, associated with the human tumour necrosis factor-α and a pharmaceutical composition for the treatment of diseases, associated with the human tumour necrosis factor-α, containing an effective quantity of the said antibody or Fab.

EFFECT: invention possesses a reduced immune response, in comparison with the pharmaceutical antibody Remicade, which makes it possible to treat diseases, associated with the human tumour necrosis factor-α, in an effective way.

23 cl, 5 dwg, 9 tbl, 7 ex

 

AREA of TECHNOLOGY

The present invention relates to humanised antibodies to tumor necrosis factor-α (TNF-α) and their antigen-binding fragments (Fab) and the application of these antibodies and fragments.

The LEVEL of TECHNOLOGY

The development and progression of autoimmune diseases is a complex process that occurs as a consequence of imbalance in the regulation of many active cytokines. It has been shown that tumor necrosis factor-α (TNF-α) plays an important role in immune regulation of multiple cytokines. However, it was demonstrated that its overexpression is one of the main causes of autoimmune and other diseases. Accordingly, the application of biopharmaceutical drugs that suppress the activity of TNF-α, becomes one of the most successful methods for treating such diseases. Indications that have been approved for such administration include mainly rheumatoid arthritis, Crohn's disease, plaque psoriasis, psoriatic arthritis, ankylosing spondylitis, ulcerative colitis and juvenile idiopathic arthritis, and many similar diseases are currently being studied in clinical trials.

Currently on the market of Europe and America appeared pharmaceutical antibodies against TNF-α and medicines on the basis of antibody-like hybrid� Fc proteins, such as Remicade. However, Remicade has a shorter half-life in vivo of approximately 9 days. In addition, although Remicade has a high binding affinity, biological activity and clinical efficacy, as it is a chimeric antibody containing 1/3 of sequences from mouse and 2/3 of sequences from humans, approximately 10%-47% of patients after administration of Remicade immune response occurs, usually leading to the formation of anti-mouse antibody (HAMA), which badly affect the activity and duration of use of the indicated antibodies. Accordingly, there is a great need for the development of antibodies against TNF-α with a high degree of humanization and most reduced fraction of sequences obtained from mouse to reduce the percentage of material of murine origin and to ensure safe use in the treatment of diseases in humans. The usual way of humanization of antibodies is to graft parts of the hypervariable regions (CDR) of the variable regions (VHVK) antibodies derived from mouse, in frame region previously identified antibodies. The resulting antibody generally contains a sequence derived from a person, and can save the selectivity of the original antibody of murine origin�Oia in relation to the same antigen. However, this method usually entails the loss of affinity of the specified antibodies.

BRIEF description of the INVENTION

One of the objectives of the present invention is to provide humanized antibodies to tumor necrosis factor-α (TNF-α) and their antigen-binding fragments (Fab), the affinity of which to the tumor necrosis factor-α person comparable or even higher than that Remicade is a chimeric human antibody/mouse.

Humanized antibodies to tumor necrosis factor-α (TNF-α) or Fab, proposed in the present invention, contain a variable region of the heavy chain and variable region light chain, wherein the amino acid sequence of variable regions of the heavy chain shown in SEQ ID no:1 or 3 in the sequence listing, and the amino acid sequence of variable region of light chain shown in SEQ ID№:15, 9, 11, 7, 13 or 5 in the sequence listing, and the first amino acid residue in SEQ ID no:1 is Glu or Gln.

The specified antibody is chosen in particular from one of the following a) to l):

a) KS10, containing the variable region of the heavy chain SH01 with the amino acid sequence shown in SEQ ID no:1, and variable area light chain SH08 with the amino acid sequence shown in SEQ ID no:15;

(b) KS03 containing the variable region of the heavy chain SH01 with the follower�awn amino acids, shown in SEQ ID no:1, and variable area light chain SH05 with the amino acid sequence shown in SEQ ID no:9;

c) KS06 containing the variable region of the heavy chain SH01 with the amino acid sequence shown in SEQ ID no:1, and variable area light chain SH06 with the amino acid sequence shown in SEQ ID no:11;

(d) KS12 containing the variable region of the heavy chain SH02 with the amino acid sequence shown in SEQ ID no:3, and variable area light chain SH08 with the amino acid sequence shown in SEQ ID no:15;

e) KS04 containing the variable region of the heavy chain SH02 with the amino acid sequence shown in SEQ ID no:3, and variable area light chain SH05 with the amino acid sequence shown in SEQ ID no:9;

f) KS07 containing the variable region of the heavy chain SH02 with the amino acid sequence shown in SEQ ID no:3, and variable area light chain SH06 with the amino acid sequence shown in SEQ ID no:11;

(g) KS02 containing the variable region of the heavy chain SH02 with the amino acid sequence shown in SEQ ID no:3, and variable area light chain SH03 with the amino acid sequence shown in SEQ ID no:5;

h) KS08 containing the variable region of the heavy chain SH02 with the amino acid sequence shown in SEQ ID no:3, and variable region formed�Oh chain SH04 with the amino acid sequence, shown in SEQ ID no:7;

(i) KS11 containing the variable region of the heavy chain SH02 with the amino acid sequence shown in SEQ ID no:3, and variable area light chain SH07 with the amino acid sequence shown in SEQ ID no:13;

j) KS01 containing the variable region of the heavy chain SH01 with the amino acid sequence shown in SEQ ID no:1, and variable area light chain SH03 with the amino acid sequence shown in SEQ ID no:5;

k) KS05 containing the variable region of the heavy chain SH01 with the amino acid sequence shown in SEQ ID no:1, and variable area light chain SH04 with the amino acid sequence shown in SEQ ID no:7;

l) KS09 containing the variable region of the heavy chain SH01 with the amino acid sequence shown in SEQ ID no:1, and variable area light chain SH07 with the amino acid sequence shown in SEQ ID no:13;

moreover, the first amino acid residue in SEQ ID no:1 is Glu or Gln.

Another object of the present invention is to provide antigen-binding fragment (Fab) of humanized antibody to tumor necrosis factor-α man. The specified Fab contains the variable region of the heavy chain, the amino acid sequence of which corresponds to the provisions of 1-20 in SEQ ID no:27 or SEQ ID no: DQ25 in the sequence listing, and variable area light �ETUI, the amino acid sequence of which corresponds to the provisions 1-109 in SEQ ID no:31 or SEQ ID no:29 in the sequence listing.

The antibody, proposed in the present invention, comprises a heavy chain in which the amino acid sequence of the constant region identical to the amino acid sequence of the heavy chain of a human antibody and a light chain in which the amino acid sequence of the constant region identical to the amino acid sequence of light chain antibodies.

The constant region of the heavy chain described antibodies may be obtained from the human constant region of any class (IgG, IgA, IgM, IgE, IgD) or subclass (IgG1, IgG2, IgG3, IgG4, IgM1, IgM2, and IgA1, IgA2), and a constant region light chain described antibodies may be obtained from human constant region light chain of any class (κ or λ) or subclass (λ1, λ2, λ3, λ4) or allotype (κm (1), κm (2), κm (3)).

The amino acid sequence of the constant region of the heavy chain of the specified antibodies, in particular, is shown in SEQ ID no:17 in the sequence listing; and the amino acid sequence of the constant region of light chain, in particular, is shown in SEQ ID no:19 in the sequence listing.

The amino acid sequence of the specified heavy chain shown in SEQ ID no:21 in the sequence listing; and the amino acid sequence� specified light chain, in particular, it is shown in SEQ ID no:23 in sequence listing. The amino acid residues in positions 1 to 120 of SEQ ID no:21 correspond to the variable regions of the heavy chain and the amino acid residues in positions 121-450 the same sequence correspond to the constant region of the heavy chain. The amino acid residues in positions 1-109 of SEQ ID no:23 correspond to the variable regions of light chain and the amino acid residues in positions 110-214 the same sequence correspond to a constant region light chain. The first amino acid residue in SEQ ID no:21 is Glu or Gln.

The Fab fragment, proposed in the present invention, consists of a Fd fragment of the heavy chain and light chain; and the said Fd fragment of the heavy chain includes a VHand CH1, and the specified light chain includes a VKand a constant region light chain; wherein the amino acid sequence specified CH1 is identical to the CH1 constant region of the heavy chain of a human antibody and the amino acid sequence of the specified constant region light chain is identical to a constant region light chain antibodies.

CH1 specified Fd fragment described above Fab can be CH1 constant region derived from a person of any class (IgG, IgA, IgM, IgE, IgD) or subclass (IgG1, IgG2, IgG3, IgG4, IgM1, IgM2, and IgA1, IgA2); and a constant region light chain described above Fab may be a constant region formed�Oh chain, obtained from a man of any class (κ or λ) or subclass (λ1, λ2, λ3, λ4) or allotype (κm (1), κm (2), κm (3)).

The amino acid sequence of CH1 is shown in SEQ ID no:33 in the sequence listing; the amino acid sequence of the constant region of the specified light chain shown in SEQ ID no:19 in the sequence listing.

According to specific variants of implementation of the present invention, the specified Fab is one of the following b1)-b3):

b1) KS-7F: the amino acid sequence of a fragment of the heavy chain shown in SEQ ID no:27 in sequence listing; and the amino acid sequence of light chain shown in SEQ ID no:31 in the sequence listing;

b2) KS-7A: the amino acid sequence of a fragment of the heavy chain shown in SEQ ID no:25 in the sequence listing; and the amino acid sequence of the specified light chain shown in SEQ ID no:31 in the sequence listing;

b3) KS-2E: the amino acid sequence of a fragment of the heavy chain shown b SEQ ID no:25 in the sequence listing; and the amino acid sequence of the specified light chain shown in SEQ ID no:29 in the sequence listing.

Another object of the present invention is to provide antigen-binding fragment or A antigen-binding fragment B, where the specified antigen-binding fragment of A is A Fab, Fab', F(ab' 2, Fv (fragment variable regions of antibodies), the variable region of the heavy chain, variable region of light chain, polypeptide fragments selected from variable regions of the heavy chain, or polypeptide fragments selected from a variable region light chain, which are derived from the specified antibody; antigen-binding fragment B represents Fab', F(ab')2, Fv, variable region of the heavy chain, variable region of light chain, polypeptide fragments selected from variable regions of the heavy chain, or polypeptide fragments selected from a variable region light chain, which are derived from the specified Fab.

Mentioned above F(ab')2consists of a pair of light chains and pairs of heavy chains (denoted as Fd'), which are slightly larger than Fd. Hydrolysis of IgG molecules under the action of pepsin may result in the indicated fragment F(ab')2that contains two Fab, and thus, may communicate with two antigenic epitopes. Fd' contains about 235 amino acid residues that span the VH, CH1 and hinge region. Fv consists of a variable region light chain (VL) and variable region of the heavy chain (VH), which are connected together non-covalent bonds. Fv has a molecular weight of approximately six times greater than the intact molecule �Titel, and contains a single antigen-binding site. Fv includes ScFv (single-chain antibodies), DsFv (stable disulfide bonds of the antibody). ScFv is a single peptide chain, expressed with VHand VLbonded together by a suitable fragment of an oligonucleotide (linker). DsFv is an immobilized disulfide bonds Fv fragment, formed through the introduction of a cysteine in the light chain and the variable region of the heavy chain in the corresponding website. It was shown that DsFv is superior as ScFv for binding affinity and stability.

Also in the scope of the invention includes a gene encoding any one of proteins (A) to (C):

(A) the specified antibody; (B) the specified Fab; C) antigen-binding fragment A or B.

Sequences encoding the variable regions of the heavy chains as specified antibodies and antigen-binding fragment of A as shown in SEQ ID no:2 or 4 in the sequence listing. Sequences encoding the variable regions of light chains as specified antibodies and antigen-binding fragment A, is selected from SEQ ID№:16, 10, 12, 8, 14 and 6 in the sequence listing. Sequences encoding the variable regions of the heavy chains as specified Fab and the antigen-binding fragment B, consistent with the provisions 1-360 in any of the after�of euteleostei SEQ ID no:2, 4, 28 and the provisions 1-360 of SEQ ID no:26 in the sequence listing. Sequences encoding the variable regions of light chains, as Fab, antigen-binding fragment B, consistent with the provisions 1-327 in any of the sequences SEQ ID№:16, 10, 12, 8, 14, 6, 32 and provisions 1-327 sequence SEQ ID no:30 in the sequence listing.

Among the above sequences as SEQ ID no:2 and SEQ ID no: 4 contains 360 nucleotides, and all the sequences SEQ ID№:6, 8, 14, 10, 12 and 16 contain 327 nucleotides.

The sequence that encodes the constant region of the heavy chain of the indicated antibody shown in SEQ ID no:18 in the sequence listing; and the sequence that encodes the constant region of the light chain of the indicated antibody shown in SEQ ID no:20 in the sequence listing.

The sequence encoding the CH1 region of the specified Fab shown in SEQ ID no:34 in the sequence listing, the sequence that encodes the constant region of the light chain of the specified Fab shown in SEQ ID no:20 in the sequence listing.

According to a variant implementation of the present invention, the sequence that encodes the heavy chain of the indicated antibody, shown in particular in SEQ ID no:22 in the sequence listing, the sequence that encodes the light chain of the indicated antibody, shown in particular in SEQ ID no:24 in Li�e sequences.

The sequence that encodes the specified Fab, is one of the following c1-c3):

c1) KS-7F: a sequence that encodes a fragment of the heavy chain of the specified Fab is shown in SEQ ID no:28 in the sequence listing; and the sequence that encodes the light chain of the specified Fab shown in SEQ ID no:32 in the sequence listing;

c2) KS-7A: a sequence that encodes a fragment of the heavy chain of the specified Fab is shown in SEQ ID no:26 in the sequence listing; and the sequence that encodes the light chain of the specified Fab shown in SEQ ID no:32 in the sequence listing;

c3) KS-2E: a sequence that encodes a fragment of the heavy chain of the specified Fab is shown in SEQ ID no:26 in the sequence listing; and the sequence that encodes the light chain of the specified Fab shown in SEQ ID no:30 in the sequence listing.

Whereas the nucleotides in positions 1-360 and 360-1350 sequence SEQ ID no:22 correspond to the nucleotides mentioned variable regions of the heavy chain and the nucleotide constant region of the heavy chain, respectively; the nucleotides at positions 1-327 and 328-642 sequence SEQ ID no:24 correspond to the nucleotides mentioned variable region light chain and the nucleotide constant region of light chain, respectively.

Another object of the present invention to ensure that the genetic mater�al: recombinant vector, recombinant bacteria

recombinant cell lines; recombinant virus or expression cassette containing the gene described above.

The indicated recombinant vector is an expression vector in prokaryotes or eukaryote for expression of the indicated antibodies, Fab or antigen-binding fragment. Specified recombinant bacterium is an Escherichia coli containing the gene described above. Specified recombinant cell line is a transgenic cell line or hybrid line of cells, and the indicated transgenic cell line may be a line of mammalian cells, transfetsirovannyh specified gene encoding a humanized antibody to tumor necrosis factor-α person, or Fab, or antigen-binding fragment according to the present invention, preferably the cell line CHO (Chinese hamster ovary), or cell line 293 and its subline; the indicated hybrid cell line is a cell hybridomas, which can secrete specified a humanized antibody to tumor necrosis factor-α person referred to in the present invention. The indicated recombinant virus is a recombinant adenovirus or recombinant adeno-associated virus, etc. that contain the gene described above. Specified Cass�ETA expression is a DNA molecule, which includes three fragments in the flow direction of transcription in the following order: a promoter; a gene that encodes the said antibody or Fab, or antigen-binding fragment, transcription of which is initiated from a specific promoter; and a terminator.

If a host cell transferout or transforming a recombinant vector containing the gene encoding the specified antibody, Fab or antigen-binding fragment, can be expressed the corresponding proteins, and thus it is possible to receive the specified antibody, Fab or antigen-binding fragment. The specified host can be a eukaryotic cell, and can be a cell prokaryotes, including, but not limited to mammalian cells, bacteria, yeast, insects, etc. For large-scale protein expression is applicable to a wide range of mammalian cells, such as 293 cells, CHO, SP20, NS0, COS, BHK or PerC6, etc. There are different ways transfection of cells, including, without limitation, electroporation, mediated by liposome transfection mediated by calcium phosphate transfection, etc.

The preferred method of expression of the indicated antibodies, Fab or antigen-binding fragment of the following: carrying out amplification of the gene with the recombinant vector is stably transfected the host cell to increase the expression level of the specified Ryoko�biantoro protein. For example, deficient in DHFR, a host cell stably transferout recombinant vector containing the gene for dihydrofolate reductase (DHFR), and then in a nutrient medium for cultivation of cells can be added methotrexate (MTX) in sufficient concentration to increase the number of copies specified recombinant vector into the host cell.

After expression of the specified Fab or IgG containing a combination of the coding sequences of a gene, to determine the concentration of protein in a nutrient medium can be applied enzyme-linked immunoassay (ELISA) or other types of analysis. For these Fab fragments can be cleaned using affinity chromatography with the use of protein G, protein a IgG can be cleaned using affinity chromatography with the use of protein A.

Also in the scope of the present invention gets the use of the specified antibodies, or Fab or antigen-binding fragment, or a specified gene, or the genetic material, with:

d1) obtaining a medicinal product for the prevention and/or treatment of diseases associated with tumor necrosis factor-α person, or

d2) receiving product for neutralization of tumor necrosis factor-α person, or

d3) receiving the kit for qualitative and quantitative determination of tumor necrosis factor-α.

And� disease associated with tumor necrosis factor-α, is a disease caused by increased levels of tumor necrosis factor-α human, preferably rheumatoid arthritis, autoimmune uveitis, Crohn's disease, plaque psoriasis, psoriatic arthritis, ankylosing spondylitis, ulcerative colitis, or juvenile idiopathic arthritis.

Another object of the present invention is to provide pharmaceutical compositions containing excipients and active ingredients, these active ingredients include at least one of the following: an antibody, Fab, antigen-binding fragment, gene and genetic material as described above; and the excipient is a pharmaceutically acceptable carrier or excipient. Specified active ingredients in pharmaceutical compositions can be only one any of the Fab or antibody described above, or any one of the antigen-binding fragments described above, or any one of the genes described above, or any one of the genetic materials described above.

Also in the scope of the present invention gets the use of any of the following substances for the treatment of diseases associated with tumor necrosis factor-α man: the specified antibodies, Fab, antigenes�ment of the fragment, specified gene, genetic material and the pharmaceutical composition described above.

The disease associated with tumor necrosis factor-α humans caused by increased levels of tumor necrosis factor-α human, and preferably is an autoimmune uveitis, rheumatoid arthritis, Crohn's disease, plaque psoriasis, psoriatic arthritis, ankylosing spondylitis, ulcerative colitis, or juvenile idiopathic arthritis.

Description of the annexed drawings:

Fig.1 shows the definition of the biological activity of the specified humanized Fab against the suppression of TNF-α using ELISA.

Fig.2 shows the determination of the biological activity of the specified humanized Fab against the neutralization of TNF-α in the experiment assessing the cytotoxicity of L929.

Fig.3 shows an analysis of binding KS10 with antigenic TNF-α from different species.

Fig.4 shows the scores that assess treatment KS10 in experimental rats suffering from rheumatoid arthritis. Shown from left to right - healthy group, negative control, model group, the group receiving 5 mg/kg KS10, the group receiving 10 mg/kg KS10, and the group receiving 20 mg/kg KS10.

Fig.5 shows the effect of KS10 on the level of IL-1β (interleukin-1β) in synovial fluid/tissue of the joints experimental rats suffering from re�Matigny arthritis. Shown from left to right - healthy group, negative control, model group, the group receiving 5 mg/kg KS10, the group receiving 10 mg/kg KS10, and the group receiving 20 mg/kg KS10.

Fig.6 shows the effect of KS10 on the level of IL-6 in synovial fluid/tissue of the joints of the experimental rats with rheumatoid arthritis. Shown from left to right - healthy group, negative control, model group, the group receiving 5 mg/kg KS10, the group receiving 10 mg/kg KS10, and the group receiving 20 mg/kg KS10.

Examples

The following examples are presented to provide a more complete understanding of the present invention but not to limit the invention. Unless otherwise specified, the experimental methods mentioned below correspond to traditional experimental methods. Unless otherwise specified, the experimental materials used in these examples, all can be purchased in the various companies that produce biomedical reagents. Quantitative analysis in the following examples was carried out in three parallel determinations, and for the result took the average values.

Grafting CDR of the heavy and light chains of the humanized antibody to TNF-α, site-directed mutagenesis using PCR (polymerase-chain reaction) and screening the library of mutant genes described in the present invention, carried out in accordance with the USA�AI with traditional technologies of recombinant DNA and immunological methods based on the interaction of tigen-antibody, and detailed experimental methods and steps documented in "Molecular Cloning: a Laboratory Manual", 3rd edition, by Joseph Sambrook, Science Press, and similar handbooks experiment. EC50(concentration providing 50% of maximum effect) in the following examples was obtained by introducing the values of optical density (OD450in the program GraphPad Prism 5, and generate the final graph.

Example 1: Expression of Fab humanized antibody to TNF-α and definition activity

This example used three Fab humanized antibody to TNF-α (the said Fab consists of a Fd fragment of the heavy chain and light chain of the indicated antibody), namely KS-2E, KS-7 and KS-7F.

1. Construction of expression vectors for KS-2E, KS-7 and KS-7F

(1) Obtaining sequences of light and heavy chains

Cells of hybridomas obtained from mice immunized TNF-α (R&D Co., catalogue number: 210-TA-050) and subjected them to screening for producers of monoclonal antibodies, and then total RNA was extracted and used as template, which was amplified nucleotide sequences for the variable regions of the heavy chain using PCR with conventional primers P1: 5'-GCGAATTCAGGTSMARCTGCAGSAGTCWGG-3', P2: 5'-TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG-3'; and of a nucleotide sequence for a variable region light chain amplificative�and using PCR with conventional primers P3: 5'-GACATTCTGMTSACMCAGMCTCC-3', P4: 5'-GTTAGATCTCGAGCTTGGTCCC-3'. The gel slices containing the considered bands excised for further recovery. Amplification products of heavy and light chains of the indicated antibodies individually inserted into the vector pMD18-T (TaKaRa Co., catalogue number: D101C). Single colonies separately extracted and sequenced to identify the nucleotide sequences of variable regions of light and heavy chains of the indicated antibodies.

(2) Construction of humanized Fab

We compared the similarities of amino acid sequence between the received variable region light chain and variable region light chain of a humanized antibody, between a variable region of the heavy chain and the variable region of the heavy chain of a humanized antibody. Similarity search of the sequences was carried out separately in the IgBLAST (http://www.ncbi.nlm.nih.gov/igblast/) and IMGT (ImMunoGeneTics, IMGT: http://www.imgt.org). Based on the search results as a matrix for obtaining a humanized antibody selected antibody with a higher percentage of similarity of sequences against both light and heavy chains. Derived variable region of the heavy chain VH were inoculated in a frame region of a human antibody IGHV3-15*07 (access Number: M), which have a higher percentage of similarity of the sequences, and the floor�Chennai variable region light chain VK planted in a frame region of a human antibody IGKV6-21*01 (access Number: H), having a high percentage of similarity of sequences.

After multiple cycles of mutagenesis in the original fragments of the heavy chain (Fd) and light chains person of the combination of different light chains and fragments of the heavy chain (Fd) inserted into the vector pTLR (modified pET22b (+) vector). More specifically, preparing different DNA for light chains with the restriction sites BamHI and EcoRI, respectively, at each end, and different DNA for fragments of the heavy chain (Fd) with the restriction sites NotI and XhoI, respectively, at each end. Two groups of DNA separately cloned into the vector pTLR (modified pET22b (+) vector) between the corresponding restriction sites, i.e., different DNA for the light chains inserted between the restriction sites BamHI and EcoRI, different DNA for the indicated fragments of the heavy chain (Fd) inserted between the restriction sites NotI and XhoI, which led to several Fab expression vectors (including three of the Fab expression vector, which is expressed KS-2E, KS-7 and KS-7F, respectively).

Different combinations of the light chains and the indicated fragments of heavy chains referred to above, include these three Fab, KS-2E, KS-7F, and KS-7A. The amino acid sequence of a fragment of the heavy chain KS-2E shown in SEQ ID no:25 in the sequence listing, the nucleotide sequence shown in SEQ ID no:26, and a sequence� amino acid light chain KS-2E shown in SEQ ID no:29 in the sequence listing, the nucleotide sequence shown in SEQ ID no:30. The amino acid sequence of a fragment of the heavy chain KS-7A shown in SEQ ID no:25 in the sequence listing, the nucleotide sequence shown in SEQ ID no:26, and the amino acid sequence of light chain KS-7A shown in SEQ ID no:31 in the sequence listing, the nucleotide sequence shown in SEQ ID no:32. The amino acid sequence of a fragment of the heavy chain KS-7F shown in SEQ ID no:27 in sequence listing, the nucleotide sequence shown in SEQ ID no:28, and the amino acid sequence of light chain KS-7F shown in SEQ ID no:31 in the sequence listing, the nucleotide sequence shown in SEQ ID no:32.

In more detail, a method of modifying the vector pET22b (+) for the purpose of obtaining the above mentioned vector pTLR was as follows: first artificially synthesized DNA segment (abbreviated DNA sequence T-L-R, shown in SEQ ID no:35 in the sequence listing), which contained the promoter sequence of P7, the operator of the lactose operon and the binding site with the ribosome (RBS), with the restriction sites SalI and NotI, located at each end; then separately subjected to cleavage vector pET22b (+) (product of Novage Co., USA) and the DNA sequence of T-L-R the restriction enzymes SalI and NotI, and then sewn together using NAM�-T4 ligase and transformed; and the traditional method were selected a separate colony and subsequent screening was performed on a properly modified vector.

2. The expression of KS-2E, KS-7 and KS-7F in prokaryotes

The E. coli strain Top 10 was transformed separately constructed, as mentioned above, expression vectors Fab (including three of the Fab expression vector that Express KS-2E, KS-7 and KS-7F, respectively), and then it was placed in the tablet 2-YT (peptone of 1.6%, yeast extract 1%, NaCl 0.5%, and agar powder 1,5%) with chloramphenicol. The next day was choosing a tablet with a suitable density of the colony for the selection of several single colonies. For each positive colony was selected eight single colonies and placed in a tablet with a 96 deep-well, then induced the expression using IPTG (isopropylthioxanthone). Each single colony was added to the tube containing 6 ml of a liquid medium 2-YT YT (peptone of 1.6%, yeast extract 1%, NaCl 0,5%) containing chloramphenicol, and were stirred at 250 rpm at 37°C for 12 hours. 0,2 µl of the specified suspension of bacteria was collected by pipette from each tube and transferred to a tablet with 2-YT with chloramphenicol for storage. 5 ml of the specified suspension of bacteria was inoculated in 500 ml of a liquid medium 2-YT containing chloramphenicol, and cultured at 33°C, 300 rpm up until the OD600not reached to 0.6. Then in the specified medium was added IPTG to�echnol concentration of 50 μl to induce the expression of different Fab, with the induction time of 3 hours. After induced expression was completed, a specified culture medium was centrifuged at 5100 rpm and 10°C for 15 minutes. The supernatant was decanted, and the pellet bacteria completely re-suspended in 40 ml of pre-cooled solution of TES (Tris(gidroximetil)-methyl-2-aminoethanesulfonic acid); 66 ml of pre-cooled dilute 20% solution TES with H2O re-added re-suspended in a solution of bacteria and incubated on ice for 40 minutes, then centrifuged at 13000 rpm, 4°C for 10 minutes. After centrifugation supernatant was collected fluid, which is a periplasmic extract containing Fab proteins (proteins KS-2E, KS-7A or KS-7F). Specified the periplasmic extract was desalted by passing through a column of G-25 (GE Co.", 17-0034-01). Preparing a column pre-filled with protein G (GE Co.", 17-0618-04), balanced it with a solution to balance (20 mm phosphate buffer, pH 6.5), and then loaded on it specified the sample protein. After the download of the specified column samples were successively washed with a solution to balance, and then desorption was carried out directly with a solution for desorption (0.1 M Gly-HCl, pH of 2.5). The eluting fractions of�, were taken to pieces, and the pH of the eluting fractions quickly adjusted to 7.0, pre adding 1.0 M Tris-HCl buffer (pH 9,0) tubes for collecting fractions prior to their selection, and the ratio of the volumes of Tris-buffer and eluting fractions was 1:9. Selected fluid contains proteins considered. The specified purity of protein was assessed using SDS-PAGE (polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate), and estimated the protein concentration in the samples of protein. In the end, the specified protein sample was Packed and stored at -80°C, resulting in Fab proteins with a higher degree of purity (including three protein KS-2E, KS-7 and KS-7F).

3. Determination of the biological activity of KS-2E, KS-7 and KS-7F

1) Analysis of binding of humanized Fab to TNF-α ELISA method

Proteins Fab that bind to TNF-α, was subjected to screening through the following stages: the tablet for ELISA as a substrate were coated with 100 ng obtained from human TNF-α (R&D Co., catalogue number: 210-TA-050) on the hole; was added 2-fold serial dilutions of 40 nm Fab proteins (prepared in step 2, including three protein KS-2E, KS-7 and KS-7F), and then incubated; added secondary goat anti-human antibody With Kappa, labeled with horseradish peroxidase (Sigma Co., catalogue number: K3502) and eventually added TMB (tetramethylbenzidine) for the development of the reaction and 2 M sulfuric acid to stop the reaction�; thus, we determined the protein binding of Fab with TNF-α. In accordance with this method of screening were obtained three Fab with higher activity: KS-2E, KS-7F and KS-7A indicated proteins in General contain two different VH (VH01 and VH02, and the amino acid sequence of VH01 shown in SEQ ID no:25, and its nucleotide sequence shown in SEQ ID no:26; amino acid sequence VH02 shown in SEQ ID no:27, and its nucleotide sequence shown in SEQ ID no:28), and two different VK (VK03 and VK05, moreover, the amino acid sequence of VK03 shown in SEQ ID no:29, and its nucleotide sequence shown in SEQ ID no:30; amino acid sequence VK05 shown in SEQ ID no:31 and the nucleotide sequence shown in SEQ ID no:32 (table 1)).

The result of testing binding activity of humanized Fab to TNF-α ELISA method illustrated in Fig.1. This result shows that the three humanized Fab obtained as described above, possess affinity for the antigen with a similar affinity, which has a Fab fragment Remicade is a chimeric antibody human, mouse, and EC50to link KS-7 and KS-7F with TNF-α higher than for the binding of the Fab fragment of the chimeric antibody human, mouse Remicade (table 2).

Table 1
Fab humanized antibody to TNF-α
The Fab fragmentVHVK
KS-2EVH01VK03
NPVH02VK03
KS-7FVH01VK05
KS-7AVH02VK05
Note: "NP" indicates that the Fab fragment was not characterized due to low activity.

Table 2 shows the EC50for binding of the Fab fragment of humanized antibody to TNF-α with TNF-α at ELISA

Table 2
SampleEC50(nm)
Fab Remicade3,324
KS-2E6,659
KS-7A3,027
KS-7F2,740
Note: the Data in Table 2 are presented�s as mean values for three experiments.

2. Determination of the biological activity of humanized Fab in the suppression of TNF-α in the experiment with the L929 cytotoxicity.

In addition, the biological activity of three humanized Fab listed above (KS-2E, KS-7F and KS-7A) in respect of the neutralization of TNF-α was examined in a cell-biological experiments - in the sample on the L929 cytotoxicity. In this experiment, 1×104of L929 cells in logarithmic growth phase were seeded in DMEM (Wednesday Needle, modified by way of Dulbecco) (10% fetal bovine serum - ELS, "Gibco") in a plate of 96 wells. After 24 hours there was added 0.5 ng/ml TNF-α of human origin ("R&D Co., catalogue number: 210-TA-050) and 0.5 μg/ml of actinomycin D ("Fluka"). These cells were divided into four groups, and three humanized Fab mentioned above and the Fab fragment of the control antibody Remicade individually added to each group, these cells were cultured for another 24 hours. In the end, cell viability was analyzed using a CCK8 kit ("Dojindo Laboratories). The result is shown in Fig.2 and it shows that the three humanized Fab, mentioned above, can exhibit biological activity, effectively neutralizing TNF-α, and biological activity of KS-7A in relation to the neutralization of TNF-α surpasses the activity of the Fab fragment of the chimeric human antibody�and-mouse Remicade. The data in Fig.2 are presented as mean ± standard deviation for three experiments.

Example 2: Design library "affinity maturation" for CDR3 Fab humanized antibody to TNF-α

To further increase the affinity of the Fab fragments mentioned above humanized antibody to TNF-α to the antigen, separately create library "affinity maturation" for CDR3 of the heavy chain VH02 and CDR3 light chain VK05 in the Fab expression vector of humanized antibody to TNF-α. Since the CDR3 region of the heavy chain and light chain are the most important areas for the binding of the antibody with the antigen for obtaining antibodies with a higher affinity can be performed site-saturation mutagenesis of the CDR3 region, and then screening. For designing a library web site-saturating mutagenesis for CDR3 of the heavy and light chains, developed a series of primers for site-directed mutagenesis and used in PCR. The products obtained, amplified by PCR, mixed with a series of primers in equal relations degenerated and cloned in the expression vector for Fab humanized antibody to TNF-α. Designing library web site-directed mutagenesis for CDR3 of the light chain was performed as follows: PCR with a series of primer 5 and reverse primer 6 for light chains (5'-CGGAATTCCGTACGTTTCACTTCCAGATTGG-3') and �also with the use of DNA light chain as a template for the production of these products by DNA then the cloning of these DNA products in the Fab expression vector, carrying electro transfer and incubation in tablets with the library site-directed mutagenesis for light chain CDR3. A series of primers 5 contains the mutant site in CDR3, and only includes 19 primers listed in Table 3. Designing library web site-directed mutagenesis for CDR3 of the heavy chain was performed as follows: PCR with a series of primers 7 and reverse primer 8 for the heavy chain (5'-CCGCTCGAGGCGCTCACGGTCAGGGTGGTGCCCTG-3'), and with the use of DNA heavy chain as a template for the production of these products by the DNA, and then cloning these products DNA in the plasmid expression Fab, conducting electro transfer and incubation in tablets with the library site-directed mutagenesis for CDR3 of the heavy chain. Series 7 contains primers mutant site in CDR3, and only includes 22 primers listed in Table 4. From the resulting library of mutagenesis for light and heavy chains of the Fab chose Fab humanized antibody to TNF-α with higher binding capacity of the antigen TNF-α (R&D Co.") based on the results of ELISA. Screening of mutant heavy chains for the two variable regions of heavy chains with higher activity, namely SH01 and SH02; and screening of mutant light chains DL� of six variable regions of light chains with higher activity namely, SH03, SH04, SH05, SH06, SH07 and SH08.

Table 3
A series of primers 5 for site-directed mutagenesis in light chain CDR3
SymbolSequence
Primer 5-1Q1GCAACCTACTACTGCNBKCAGAGCCATAGCTGG
Primer 5-1Q2GCAACCTACTACTGCDAKCAGAGCCATAGCTGG
Primer 5-1Q3GCAACCTACTACTGCCATCAGAGCCATAGCTGG
Primer 5-2Q1GCAACCTACTACTGCCAGNBKAGCCATAGCTGGCCG
Primer 5-2Q2GCAACCTACTACTGCCAGDAKAGCCATAGCTGGCCG
Primer 5-2Q3GCAACCTACTACTGCCAGCATAGCCATAGCTGGCCG
Primer 5-3S1GCAACCTACTACTGCCAGCAGBDKCATAGCTGGCCGTTC
Primer 5-3S2GCAACCTACTACTGCCAGCAGVCTCATAGCTGGCCGTTC
Primer 5-3S3GCAACCTACTACTGCCAGCAGAWKCATAGCTGGCCGTTC
Primer 5-NGCAACCTACTACTGCCAGCAGAGCNBKAGCTGGCCGTTCACC
Primer 5-NGCAACCTATACTGCCAGCAGAGCDAKAGCTGGCCGTTCACC
Primer 5-NGCAACCTACTACTGCCAGCAGAGCCAGAGCTGGCCGTTCACC
Primer 5-5S1GCAACCTACTACTGCCAGCAGAGCCATBDKTGGCCGTTCACCTTC
Primer 5-5S2GCAACCTACTACTGCCAGCAGAGCCATVCTTGGCCGTTCACCTTC
Primer 5-5S3GCAACCTACTACTGCCAGCAGAGCCATAWKTGGCCGTTCACCTTC
Primer 5-6W1GCAACCTACTACTGCCAGCAGAGCCATAGCHNKCCGTTCACCTTCGGC
Primer 5-6W2GCAACCTACTACTGCCAGCAGAGCCATAGCHGTCCGTTCACCTTCGGC
Primer 5-RGCAACCTACTACTGCCAGCAGAGCCATAGCTGGNDKTTCACCTTCGGCAGC
Primer 5-RGCAACCTACTACTGCCAGCAGAGCCATAGCTGGDCTTTCACCTTCGGCAGC

GTATTACTGCAGCCGTAATTACTACGGCAGCACCTACNBKTACTGGGGCCAGGGC
Table 4
A series of primers dla site-directed mutagenesis in heavy chain CDR3
SymbolSequence
Primer 7-1N1GTATTACTGCAGCCGTNBKTACTACGGCAGCACC
Primer 7-1N2GTATTACTGCAGCCGTBAKTACTACGGCAGCACC
Primer 7-1N3 GTATTACTGCAGCCGTAAATACTACGGCAGCACC
Primer 7-2Y1GTATTACTGCAGCCGTAATNBKTACGGCAGCACCTACG
Primer 7-2Y2GTATTACTGCAGCCGTAATVAKTACGGCAGCACCTACG
Primer 7-3Y1GTATTACTGCAGCCGTAATTACNBKGGCAGCACCTACGATTAC
Primer 7-3Y2GTATTACTGCAGCCGTAATTACVAKGGCAGCACCTACGATTAC
Primer 7-4G1GTATTACTGCAGCCGTAATTACTACNHKAGCACCTACGATTACTG
Primer 7-4G2GTATTACTGCAGCCGTAATTACTACHGKAGCACCTACGATTACTG
Primer 7-5S1GTATTACTGCAGCCGTAATTACTACGGCBDKACCTACGATTACTGGGC
Primer 7-5S2GTATTACTGCAGCCGTAATTACTACGGCVCTACCTACGATTACTGGGC
Primer 7-5S3GTATTACTGCAGCCGTAATTACTACGGCAWKACCTACGATTACTGGGC
Primer 7-TGTATTACTGCAGCCGTAATTACTACGGCAGCNDKTACGATTACTGGGCCC
Primer 7-TGTATTACTGCAGCCGTAATTACTACGGCAGCBCTTACGATTACTGGGCCC
Primer 7-7Y1GTATTACTGCAGCCGTAATTACTACGGCAGCACCNBKGATTACTGGGGCCAGG
Primer 7-7Y2GTATTACTGCAGCCGTAATTACTACGGCAGCACCVAKGATTACTGGGGCCAGG
Primer 7-8D1
Primer 7-8D2GTATTACTGCAGCCGTAATTACTACGGCAGCACCTACHAKTACTGGGGCCAGGGC
Primer 7-8D3GTATTACTGCAGCCGTAATTACTACGGCAGCACCTACGAATACTGGGGCCAGGGC
Primer 7-9Y1GTATTACTGCAGCCGTAATTACTACGGCAGCACCTACGATNBKTGGGGCCAGGGCACC
Primer 7-9Y2GTATTACTGCAGCCGTAATTACTACGGCAGCACCTACGATVAKTGGGGCCAGGGCACC

Example 3: Expression of Fab humanized antibody to TNF-α with high affinity and activity analysis

This example refers to two Fab humanized antibody to TNF-α, which indicate FA01 and FA02, respectively. The amino acid sequence of variable region light chain FA01 shown in SEQ ID no:15 in sequence listing (its nucleotide sequence shown in SEQ ID no:16 in sequence listing) and the amino acid sequence of the constant region of light chain shown in SEQ ID no:19 in the sequence listing (the nucleotide sequence shown in SEQ ID no:20 in the sequence listing), the amino acid sequence of variable regions of the Fd fragment of its heavy chain shown in SEQ ID no:1 in the sequence listing (the nucleotide sequence shown in SEQ ID no:2 in sequence listing)but the follower�spine of amino acids of the constant region of the heavy chain CH1 shown in SEQ ID no:33 in the sequence listing (the nucleotide sequence shown in SEQ ID no:34 in the sequence listing). The amino acid sequence of variable region light chain FA02 shown in SEQ ID no:9 in sequence listing (its nucleotide sequence shown in SEQ ID no:10 in sequence listing), the amino acid sequence of the constant region of light chain shown in SEQ ID no:19 in the sequence listing (the nucleotide sequence shown in SEQ ID no:20 in the sequence listing), the amino acid sequence of variable regions of the Fd fragment of the heavy chain shown in SEQ ID no:1 in the sequence listing (the nucleotide sequence shown in SEQ ID no:2 in sequence listing), the amino acid sequence of a constant region light chain CH1 her shown in SEQ ID no:33 in the sequence listing (the nucleotide sequence shown in SEQ ID no:34 in the sequence listing).

1. Construction and expression of humanized Fab antibody to TNF-α with high affinity

Method of constructing two specified Fab humanized antibody to TNF-α was similar to the method in example 1. DNA encoding the heavy and light chains of two Fab humanized antibody to TNF-α, referred to above, individually inserted into the corresponding sites in the vector pTLR, getting the expression vectors pFA01Fab for FA01 and pFA02Fab for FA02. Proteins FA01 and FA02 with a higher degree of purity semi�Ali in accordance with the Protocol, given in example 1.

2. Determination of biological activity of humanized Fab antibody to TNF-α with high affinity

With the help of the experiment with cytotoxicity L929 two Fab humanized antibody to TNF-α (FA01 and FA02), mentioned above, were analyzed to assess biological activity. In more detail, the method coincides with the method described in example 1. The resulting OD450 values were entered into the program GraphPad Prism 5 and expected EC50. The results are shown in table 5 and they show that the activity FA01 and FA02 higher than the activity of the Fab fragment of the antibody Remicade.

Table 5
Biological activity of humanized Fab against the neutralization of TNF-α
GroupEC50(nm)
Fab Remicade3,184
FA012,582
FA022,870
Note: the Data in table 5 are presented as mean values for three experiments.

Example 4: Expression of a humanized IgG anti�La to TNF-α and definition activity

1. Construction of recombinant expression vector of humanized IgG antibodies to TNF-α

The DNA fragments encoding the two said Fd fragment of the heavy chains (including SH01 and SH02 respectively) and six light chains (including SH03, SH05, SH04, SH06, SH07 and SH08, respectively) obtained in example 1 and 2, which are mutually combined thus, as shown in table 6, collecting them together with the DNA fragment for the constant region IgG1 Fc by PCR overlapping extension, then inserted in the expression plasmid with pcDNA3.1(+) through recombination. So constructed expression plasmids were transferrable CHO cells, and expressively full-size humanized antibodies.

More Protocol can be summarized as follows: (1) DNA fragments for the light chains were embedded directly into the expression vector with pcDNA3 eukaryotic.1(+) by recombination. Were designed the following primers 5'-TGAAAGCTTATGGAAATTGTGCTGACTCAGTCTC-3' (underlined, the restriction site HindIII); 5'-AATCTCGAGTCAACACTCTCCCCTGTTGAAGCT-3' (underlined, the restriction site XhoI), and they were used for amplification by PCR. Amplified products were subjected to double splitting involving restriction enzymes HindIII (R0104L, the company's product "NEB Co.) and XhoI (R0146L, the company's product "NEB."), sewn with large fragments with pcDNA3.1 (+) that was subjected to the double cleavage with �a portion of DNA ligase T4. (2) the DNA fragments for the heavy chain were required to gather together with the DNA fragment for the constant region IgG1 Fc by PCR with overlapping elongation, and these may have been built in with pcDNA3.1 (+) through recombination. 5'-ACTGGTACCATGGAGGTGCAGCTGGTGGAGTCTGGGG-3' (underlined, the restriction site KpnI); 5'-GATGGGCCCTTGGTGCTAGCGGAGCTCACGGTCAGGGTGGTGCCC-3'; 5'-GATGGGCCCTTGGTGCTAGCGGAGCTCACGGTCAGGGTGGTGCCC-3'; 5'-AATCTCGAGTCATTTACCCGGAGACAGGGAGAGG-3' (underlined, the restriction site XhoI). Taken together, the PCR products were subjected to double splitting involving restriction enzymes KpnI (R0142L, the company's product "NEB Co.) and XhoI (R0146L, the company's product "NEB Co.), then inserted in the expression plasmid with pcDNA3.1 ( + ) that had been double cleavage with participation of the same enzymes, through recombination, and identified by restriction analysis and sequencing, getting the desired recombinant.

The expression vectors for 18 antibodies in table 7 was obtained according to the method described above. All DNA sequences encoding the variable regions of the heavy chains KS01 (Glu), KS03 (Glu), KS05 (Glu), KS06 (Glu), KS09 (Glu) and KS10 (Glu) is shown in SEQ ID no:2 in the sequence listing (sequence of nucleotides at positions 1-3 is GAG), and encode the variable regions of the heavy chains shown in SEQ ID no:1 (the first amino acid is Gln; all of DNA sequences encoding variable regions of heavy chains KS01 (Gln), KS03 (Gln), KS5 (Gln), KS06 (Gln), KS09 (Gln) and KS10 (Gln), shown in SEQ ID no:2 in sequence listing, in which the sequence of nucleotides in position 1-3 was replaced by CAG, and encode the variable regions of the heavy chains shown in SEQ ID no:1 (the first amino acid is Gln; all of DNA sequences encoding variable regions of heavy chains KS02, KS04, KS07, KS08, KS11 and KS12 shown in SEQ ID no:4 in sequence listing, and coding for variable regions of heavy chains, shown in SEQ ID no:3; all of the DNA sequences encoding the variable regions of light chains KS01 (Glu), KS01 (Gln) and KS02 shown in SEQ ID no:6 in sequence listing, and coding for variable regions of light chains shown in SEQ ID no:5; all of the DNA sequences encoding the variable regions of light chains KS03 (Glu), KS03 (Gln) and KS04 shown in SEQ ID no:10 in sequence listing, and coding for variable regions of light chains shown in SEQ ID no:9; all of the DNA sequences encoding the variable regions of light chains KS05 (Glu); KS05 (Gln) and KS08 shown in SEQ ID no:8 in sequence listing, and coding for variable regions of light chains shown in SEQ ID no:7; all of DNA sequences encoding the variable regions of light chains KS06 (Glu), KS06 (Gln) and KS07 shown in SEQ ID no:12 in sequence listing, and coding for variable regions of light chains shown in SQ ID no:11; all of DNA sequences encoding the variable regions of light chains KS09 (Glu), KS09 (Gln) and KS11 shown in SEQ ID no:14 in sequence listing, and coding for variable regions of light chains shown in SEQ ID no:13; all of the DNA sequences encoding the variable regions of light chains KS10 (Glu), KS10 (Gln) and KS12 shown in SEQ ID no:16 in sequence listing, and coding for variable regions of light chains shown in SEQ ID no:15. A DNA sequence that encodes the constant region of the heavy chain eighteen of these antibodies are shown in SEQ ID no:18 in the sequence listing, and encodes a constant region of the heavy chain shown in SEQ ID no:17; a DNA sequence that encodes the constant region of the heavy chain eighteen of these antibodies are shown in SEQ ID no:20 in the sequence listing, and encodes a constant region of light chain shown in SEQ ID no:19.

2. Expression and purification of full-size IgG humanized antibody to TNF-α

Recombinant plasmids for light chains and recombinant plaidy for the heavy chain, obtained in stage 1, was jointly transferrable in CHO cells to Express the full-size humanized antibodies. After the joint stable transfection of a combination of the respective plasmids, as shown in table 6, in CHO cells using conventional methods, � supernatant liquid nutrient medium secretarials twelve respective recombinant full-size antibodies. Specified the supernatant was purified, yielding the corresponding full-size IgG antibodies. In more detail, the cleaning steps were as follows:

1) the Filler for chromatography

Mabselect Sure (product of GE Co."), Superdex 200 (product of GE With.")

2) a Buffer

The equilibrium buffer for affinity chromatography (FSB): 0.2 M secondary sodium acid phosphate: 82,5 ml/l of 0.2 M primary acid phosphate sodium: 17,5 ml/l of sodium chloride; 2M sodium chloride: 75 ml/l; add water ultra high purity, fully stirred and mixed thoroughly, adjust pH with 1 M sodium hydroxide or 1M hydrochloric acid to 7.1 to 7.3.

Elution buffer for affinity chromatography: NaCl 2,922 g/l, anhydrous sodium acetate 0.49 g/l, was added to 2.9 ml/l glacial acetic acid, pH 3.4 to 3.6.

Regenerating buffer for affinity chromatography: 5,8 ml/l glacial acetic acid, pH 3.0.

Buffer for cleaning in place (CIP) for affinity chromatography: 1M sodium hydroxide 100 ml/L.

Solution gelfiltration (FSB): 0.2 M secondary sodium acid phosphate: 82,5 ml/l; 0.2 M primary acid phosphate sodium: 17,5 ml/l of sodium chloride; 2M sodium chloride: 75 ml/l; add water ultra high purity, fully stirred and mixed thoroughly, adjust pH with 1 M sodium hydroxide or 1M hydrochloric acid to 6.8.

3) sample Preparation (clarifying filtration)

Centrifugation: the specified sample was centrifuged at 5000-6000 rpm for 10-15 min.

Filtration: after centrifugation, the supernatant from the indicated samples was filtered using a filter N7 (of 0.45+0.2 μm).

4) Affinity chromatography

Set AKTA purification system and a column for affinity chromatography (Mabselect or Mabselect Sure). Washed with 2 column volumes of ultrapure water. Washed with 5 column volumes of equilibrium buffer for affinity chromatography to until the baseline becomes stable, and injected sample. After injection the sample was washed with 5-10 column volumes of equilibrium buffer for affinity chromatography. Then carry out desorption of the contents of column elution buffer for affinity chromatography, the fractions corresponding to the main peak of absorption at 280 nm, are selected, conduct further desorption of 1 column volume. Carry out desorption of the contents of column 3 column volumes of regeneration buffer for affinity chromatography. Washed with the equilibrium buffer for affinity chromatography to neutral pH. The purification is carried out on the spot with 5 column volumes of buffer Mabselect CIP buffer or Mabselect Sure CIP. Washed with 3 column volumes of equilibrium buffer for affinity chromatography to until the baseline is stable. Washed with 3 column volumes of ultrapure water to until the baseline is stable. Washed with 3 column volumes of 20% ethanol and store to�Lanco for affinity chromatography.

5) Gelfiltration

Set AKTA purification system with the analyzer and a column for gelfiltration Superdex 200. Adjust the flow rate to 5 ml/min, washed with 1 column volume of ultrapure water and washed with 2 column volumes of the equilibrium solution for Superdex 200. Adjust the flow rate to 2.5 ml/min, in the collected fractions corresponding to the peaks of affinity chromatography, correct pH and carry out their introduction directly to the specified column. After sample introduction, conduct desorption of the content column of the equilibrium solution for Superdex 200, and away considered the peak at 280 nm. Keep washed with 1 column volume. Specified chromatographic column store with 0.01 M NaOH.

3. Determination of the activity of a humanized IgG antibody to TNF-α

12 humanized IgG antibody to TNF-α obtained in step 2 was subjected to testing to determine their biological activity against neutralization of TNF-α in the experiment with the L929 cytotoxicity (detail manipulation described in example 1), received totals OD450and entered them into the program GraphPad Prism 5 for calculation of the EC50. The values of EC50for twelve of these humanized IgG antibody to TNF-α, showing the suppression of the biological activity of TNF-α, are shown in table 7. The results show that the biological activity of the decree�tion of the humanized antibody to TNF-α significantly increased, and what KS10 has the highest activity. Thus, further study of the activity of antibodies was conducted mainly in relation to the KS10.

Table 6
Humanized antibodies to TNF-α with high affinity
Antibody IgGVHVK
KS01SH01SH03
KS02SH02SH03
KS03SH01SH05
KS04SH02SH05
KS05SH01SH04
KS06SH01SH06
KS07SH02SH06
KS08SH02SH04
KS09SH01SH07
KS10SH01SH08
KS11SH02SH07
KS12SH02SH08

Table 7
The biological activity of the full-size humanized antibody to TNF-α in relation to the neutralization of TNF-α
GroupEC50(nm)
KS01 (Glu)0,081
KS01 (Gln)0,087
KS020,109
KS03 (Glu)0,087
KS03 (Gln)0,093
KS040,126
KS05 (Glu)0,051
KS05 (Gln)0,064
KS06 (Glu)0,059
KS06 (Gln)0,068
S07 0,100
KS080,113
KS09 (Glu)0,036
KS09 (Gln)0,032
KS10 (Glu)0,028
KS10 (Gln)0,025
KS110,059
KS120,136
Remicade0.174 were revealed

Example 5 Kinetic analysis of binding KS10 (Glu) with cfno-α

cfno-α (R&D Co., 210-TA-050) and NHS-LCLC-Biotin (catalog number: 21338, purchased from Thermo-fisher Co.") mixed to a homogeneous state in the ratio of 1:3 and kept at room temperature for 1 hour. Then the remaining NHS-LCLC-Biotin was removed using a demineralization column PD-10 (catalog number: 17-0851-01, purchased from GE With."). The final conjugation products included 50 μg/ml Biotin-CFNA-α.

Kinetic parameters of binding KS10 with cfno-α were determined using the Octet system RED 96 ("ForteBio Co.") on the technology platform Octet, and the experimental method configured in accordance with the instructions specified instrument. 50 μg/ml Biotin-CFNA-� contacted with the biosensor based on streptavidin (SA) through the load; the appropriate range of concentrations of the indicated antibodies was determined in a trial test, and it amounted to: 6000 nm, 2000 nm, 666,7 nm, 222,2 nm, 74,1 nm and 24.7 nm. As a positive control was used Remicade and blank samples were used FSB (pH of 7.4). The result (table 8) shows that the value of KD (dissociation constants) KS10 less than the Remicade, which indicates that the affinity to the KS10 cfno-α is higher than the affinity of the chimeric antibody human mouse-Remicade.

In addition, we determined the binding affinity KS10 with TNF-α chimpanzees (with the amino acid sequence shown in SEQ ID no:36 and the nucleotide sequence shown in SEQ ID no:37), rhesus (the amino acid sequence shown by SEQ ID no:38 and the nucleotide sequence shown in SEQ ID no:39), mouse (mpno-α) (catalogue number: CYT-252, purchased from the company "PROSPEC") and TNF-β (catalogue number: CYT-224, purchased from the company "PROSPEC"). In accordance with the evaluation criteria of affinity inherent in the system Octet RED 96, the distance of the replacement of a light wave due to the binding of antigen with antibody is indirectly reflects the affinity between the two substances, and the greater the distance the replacement of a light wave, the higher the affinity. The Result (Fig.3) shows that KS10 is very strongly associated with TNF-α also significantly associated with TNF-α chimpanzees, weak� binds to TNF-α rhesus, unsteadily with TNF-α mice and TNF-β humans. Therefore, it is confirmed that the antibody, proposed in the present invention are capable of specific binding after humanization.

Table 8
kinetic parameters of binding KS10 with cfno-α
Class antibodiesKD (M)kon (l/Ms)kdis (l/s)
Remicade8,12 E-121,95 E+041,58 E-07
KS102,18 E-124,69 E+041,02 E-07
Note: KD is the affinity constant; kon is the binding constant; a kdis the dissociation constant.

Example 6: Effect KS10 (Glu) - induced TNF-α human rheumatoid arthritis model in rats

Used seventy-two rats Sprague-Dole (license for work with laboratory animals: SCXK (Sichuan) 2008-24) aged 4-6 weeks, the degree of SPF, half of which were females and half males, weighing 140-180 g. These rats were subjected to acclimatization for one �Adele, and then randomizable in six groups of 12 rats per group, namely the group of healthy rats, the negative control group, the control group model, the group receiving 5 mg/kg KS10, the group receiving 10 mg/kg KS10, and the group receiving 20 mg/kg KS10. In the beginning of the experiment, rats of each group were subjected to anesthesia using 10% of chloralhydrate (350 mg/kg), except for rats healthy groups. Before receiving the model rats of the groups receiving the drug via the tail vein was injected with three different doses KS10 (5 mg/kg, 10 mg/kg and 20 mg/kg) and rats of the negative control group and the control group model was injected into the tail vein of equivalent volumes of saline. Fifteen minutes later were injected with 0.5 mg/ml cfno-α (R&D Co., catalogue number 210-TA-050) (dissolved in 1% BSA, with the input volume of 60 ál/rat) was injected using a syringe with a volume of 1 ml into the joint cavity of the left ankle joint of rats of the three groups treated with KS10, and rats from the control group model to induce acute arthritis (modeling in one foot), and rats from the group of negative control into the joint cavity of the left ankle joint was injected with equivalent volume of 1% BSA. A successful injection is indicated gradually growing swelling on both sides with depressions of the articular cavity. The rats from the healthy group were not subjected to any �abovementioned injection.

18 hours after creating the model, the degree of swelling of the left ankle joint of rats in each group were evaluated individually in scores according to the modified criteria of assessment of 0-4 as follows: 0: no erythema and swelling; 1: redness and/or swelling only in the ankle joint; 2: redness and/or swelling in the ankle joint and swelling of the sole of the foot; 3: redness and/or swelling of the ankle and on the sole; 4: redness and/or swelling of the ankle, with outer soles and on the surface of the foot [Link: R O Williams, Feldmann M, and R N Maini. Anti-tumor necrosis factor ameliorates joint disease in murine collagen-induced arthritis. Proc Natl Acad Sci USA. 1992 October 15; 89 (20): 9784-9788]. After 20 hours after the creation of this model was collected synovial fluid from the joint. Soft tissue surrounding the specified joint, separated, homogenized, centrifuged and frozen together at -70°C. the Levels of IL-1β and IL-6 were determined using a kit based on the ELISA (IL-1β purchased from R&D Co., catalogue number: RLB00; IL-6 purchased from R&D Co., catalogue number: R6000B).

On the basis of points (Figure 4) shows that these three doses KS10 can greatly facilitate call cfno-α redness and swelling of the joints in rats and largely to counter the development caused by cfno-α rheumatoid arthritis. In the sample with the indicated cytokines show�about, what these three doses KS10 can significantly reduce the level of IL-1β (Fig.5) and IL-6 (Fig.6) in synovial fluid and in the soft tissues surrounding the joint, which indicates that the KS10 can completely block the increase in the level of IL-1β and IL-6 induced TNF-α, and serves as direct evidence of the action of KS10 against TNF-α.

Example 7: therapeutic effect KS10 (Glu) in uveitis induced TNF-α human models in rats

40 healthy rats line Lewis randomizable in the normal group, model group, negative control group and the group receiving KS10. These rats were injected intraperitoneally 10% chloralhydrate (dose of 0.35 mg/kg). After anesthesia, the rats were injected 10 µl of physiological solution (using a needle 30 G1/2) into the vitreous body through the flat part of the ciliary muscle from each rat of the control group model and the negative control group, 10 μl of a solution KS10 in a concentration of 4 mg/ml (containing PBS) was administered the same way each rat from group KS10. Thirty minutes later each rat of the control group model and group KS10 in the vitreous was injected with 10 μl of cfno-α (approximately 0.5 mg/ml), and each rat in the group of negative control in the vitreous was injected with 10 μl 1% BSA. After 24 hours and 48 hours after create this model by the first injection, rats were subjected to anesthesia, examined p�d slit lamp, and were scored accordingly. Evaluation criteria were taken from the literature [Fleisher LN, Ferrell JB, Smith MG, McGahan MC. Lipid mediators of tumor necrosis factor-α-induced uveitis. Invest Ophthalmol Vis Sci. 1991 Aug; 32 (8): 2393-9.] and several revised: 0-2: hyperemia of the iris 0-2 (0: no redness, 1: slight hyperemia; 2: severe hyperemia); constriction of the pupil 0-1 (0: normal pupil; 1: narrowed pupil); the exudation in the anterior chamber 0-2 (0: no exudation in the anterior chamber; 1: slight exudation in the anterior chamber; 2: strong exudation in the anterior chamber), the cloudiness of the pupil or rear synechia 0-2 (0: no adhesions; 1: synechia in one of the polling stations; 2: synechia in both sites).

The resulting scores are shown in table 9 and indicates that the KS10 can significantly lower score on the evaluation criteria of uveitis, which corresponds to the reduction of hyperemia of the iris, exudation of fibrin and opacity of the pupil or posterior synechia, increasing the transparency of the ocular media. Thus, it was shown that the KS10 has a significant antagonistic activity against induced by cfno-α uveitis.

Table 9
The points corresponding to therapeutic action on KS10 caused by TNF-α human uveitis in the model rats
GroupTime after the model is created by first introduction
24 h48 hours
Healthy0,88±0,8340,38±0,518
Negative control0,90±0,7370,38±0,744
Model3,5±0,971A 3.78±1,202
KS102,5±0,971*1,55±2,422*
Note: * indicates *P<0,05, compared with model group(X±SD,n=10)

Industrial applications

Through mutagenesis of antibody CDR-grafted the present invention can effectively overcome the disadvantage that the affinity of the antibody is usually violated in the traditional method of humanizing antibodies (in which hypervariable region (CDR) of the variable regions derived from mouse antibodies�a (VH, VK) directly grafted in a frame region of a human antibody), and eventually receive a humanized antibody, similar to the original antibody. Fab and IgG antibodies, proposed in the present invention, has a significantly higher degree of humanization (95% and above) and experimentally confirmed that they have affinity and biological activity, loved ones or even exceeding the affinity and biological activity of the chimeric antibody human, mouse Remicade, more pronounced neutralizing effect on TNF-α and more effective in the treatment of diseases associated with TNF-α, preferably of rheumatoid arthritis, autoimmune uveitis, Crohn's disease, plaque psoriasis, psoriatic arthritis, ankylosing spondylitis, ulcerative colitis, or juvenile idiopathic arthritis.

1. A humanized antibody to tumor necrosis factor-α person or antigen-binding fragment Fab of the specified antibodies, to bind to the tumor necrosis factor-α of the person, which contains the variable region of the heavy chain and variable region light chain, wherein the amino acid sequence of variable regions of the heavy chain shown in SEQ ID no: 1 or 3 in the sequence listing; the amino acid sequence of variable region of light chain shown in SEQ ID№: 15, 9, 11, 7, 13 and 5 in per�cine sequences, and the first amino acid residue sequence of SEQ ID no: 1 is Glu or Gln.

2. The antibody according to claim 1, characterized in that said antibody is one of the following (a)-1):
a) KS10, containing the variable region of the heavy chain SH01 with the amino acid sequence shown in SEQ ID no: 1, and variable area light chain SH08 with the amino acid sequence shown in SEQ ID no: 15;
(b) KS03 containing the variable region of the heavy chain SH01 with the amino acid sequence shown in SEQ ID no: 1, and variable area light chain SH05 with the amino acid sequence shown in SEQ ID no: 9;
c) KS06 containing the variable region of the heavy chain SH01 with the amino acid sequence shown in SEQ ID no: 1, and variable area light chain SH06 with the amino acid sequence shown in SEQ ID no: 11;
(d) KS12 containing the variable region of the heavy chain SH02 with the amino acid sequence shown in SEQ ID no: 3, and variable area light chain SH08 with the amino acid sequence shown in SEQ ID no: 15;
e) KS04 containing the variable region of the heavy chain SH02 with the amino acid sequence shown in SEQ ID no: 3, and variable area light chain S05 with the amino acid sequence shown in SEQ ID no: 9;
f) KS07 containing the variable region of the heavy chain SH02 with the sequence of amino�slot, shown in SEQ ID no: 3, and variable area light chain SH06 with the amino acid sequence shown in SEQ ID no: 11;
(g) KS02 containing the variable region of the heavy chain SH02 with the amino acid sequence shown in SEQ ID no: 3, and variable area light chain SH03 with the amino acid sequence shown in SEQ ID no: 5;
h) KS08 containing the variable region of the heavy chain SH02 with the amino acid sequence shown in SEQ ID no: 3, and variable area light chain SH04 with the amino acid sequence shown in SEQ ID no: 7;
(i) KS11 containing the variable region of the heavy chain SH02 with the amino acid sequence shown in SEQ ID no: 3, and variable area light chain SH07 with the amino acid sequence shown in SEQ ID no: 13;
j) KS01 containing the variable region of the heavy chain SH01 with the amino acid sequence shown in SEQ ID no: 1, and variable area light chain SH03 with the amino acid sequence shown in SEQ ID no: 5;
k) KS05 containing the variable region of the heavy chain SH01 with the amino acid sequence shown in SEQ ID no: 1, and variable area light chain S04 with the amino acid sequence shown in SEQ ID no: 7;
l) KS09 containing the variable region of the heavy chain SH01 with the amino acid sequence shown in SEQ ID no: 1, and the variable region is easy� chain SH07 with the amino acid sequence, shown in SEQ ID no: 13;
moreover, the first amino acid residue in SEQ ID no: 1 is Glu or Gln.

3. The antibody according to claim 1 or 2, characterized in that said antibody comprises the heavy chain in which the amino acid sequence of the constant region identical to the amino acid sequence of the constant region of the heavy chain of a human antibody and a light chain in which the amino acid sequence of the constant region identical to the amino acid sequence of the constant region light chain antibodies.

4. The antibody according to claim 3, characterized in that the amino acid sequence of the constant region of the specified heavy chain shown in SEQ ID no: 17 in the sequence listing, and the amino acid sequence of the constant region of the specified light chain shown in SEQ ID no: 19 in the sequence listing.

5. The antibody according to claim 3, characterized in that the amino acid sequence of the specified heavy chain shown in SEQ ID no: 21 in the sequence listing, and the amino acid sequence of the specified light chain shown in SEQ ID no: 23 in sequence listing, wherein the first amino acid residue in SEQ ID no: 21 is Glu or Gln.

6. Fab according to claim 1, characterized in that the said Fab consists of a fragment of the heavy chain consisting of the variable regions of the specified heavy chain and the constant region CH1 of the heavy�Oh chain, and a light chain consisting of the variable regions of the specified light chain and the constant region of light chain, wherein the amino acid sequence specified CH1 is identical to the CH1 constant region of the heavy chain of a human antibody and the amino acid sequence of the specified constant region light chain is identical to the sequence of a constant region light chain antibodies.

7. Fab according to claim 6, characterized in that the amino acid sequence specified CH1 shown in SEQ ID no: 33 in the sequence listing, and the amino acid sequence of the constant region in said light chain is shown in SEQ ID no: 19 in the sequence listing.

8. Fab according to claim 6, characterized in that the Fab is one of the following b1)-b3):
b1) KS-7F: the amino acid sequence of the indicated fragment of the heavy chain shown in SEQ ID no: 27 in sequence listing, and the amino acid sequence of the specified light chain shown in SEQ ID no: 31 in the sequence listing;
b2) KS-7A: the amino acid sequence of the indicated fragment of the heavy chain shown in SEQ ID no: 25 in the sequence listing, and the amino acid sequence of the specified light chain shown in SEQ ID no: 31 in the sequence listing;
b3) KS-2E: the amino acid sequence of the indicated fragment of the heavy chain shown in SEQ ID no: 25 in re�not sequences and the amino acid sequence of the specified light chain shown in SEQ ID no: 29 in the sequence listing.

9. The antigen-binding Fab fragment of humanized antibody to tumor necrosis factor-α of a person, containing the variable region of the heavy chain and variable region light chain, wherein the amino acid sequence of the specified variable regions of the heavy chain complies with the provisions 1-120 in SEQ ID no: 27 or the provisions 1-120 in SEQ ID no: 25 in the sequence listing, and the amino acid sequence of the specified variable region light chain complies with the provisions 1-109 in SEQ ID no: 31 or the provisions 1-109 in SEQ ID no: 29 in the sequence listing.

10. Fab according to claim 9, characterized in that the said Fab consists of a fragment of the heavy chain consisting of the variable regions of the specified heavy chain and the constant region CH1 of the heavy chain and light chain consisting of the variable regions of the specified light chain and the constant region of light chain, wherein the amino acid sequence specified CH1 is identical to the CH1 constant region of the heavy chain of a human antibody and the amino acid sequence of the specified constant region light chain is identical to the sequence of a constant region light chain antibodies.

11. Fab according to claim 10, characterized in that the sequence of amino acids provide during account creation�th CH1 shown in SEQ ID no: 33 in the sequence listing, and the amino acid sequence of the constant region in said light chain is shown in SEQ ID no: 19 in the sequence listing.

12. Fab according to claim 10, characterized in that the Fab is one of the following b1)-b3):
bl) KS-7F: the amino acid sequence of the indicated fragment of the heavy chain shown in SEQ ID no: 27 in sequence listing, and the amino acid sequence of the specified light chain shown in SEQ ID no: 31 in the sequence listing;
b2) KS-7A: the amino acid sequence of the indicated fragment of the heavy chain shown in SEQ ID no: 25 in the sequence listing, and the amino acid sequence of the specified light chain shown in SEQ ID no: 31 in the sequence listing;
b3) KS-2E: the amino acid sequence of the indicated fragment of the heavy chain shown in SEQ ID no: 25 in the sequence listing, and the amino acid sequence of the specified light chain shown in SEQ ID no: 29 in the sequence listing.

13. The gene encoding any of the following proteins (A) to (C) below:
(A) the antibody according to any one of claims. 1-5;
B) Fab according to any one of claims. 1 and 6-12;

14. The gene according to claim 13, characterized in that the sequence encoding the variable region of the heavy chains of the antibody according to any one of claims. 1-5, shown in SEQ ID no: 2 or 4 in the sequence listing; sequences encoding the variable regions of light chains �of NITEL according to any one of claims. 1-5, shown in any of SEQ ID№: 16, 10, 12, 8, 14 and 6 in the sequence listing;
sequences encoding the variable regions of the heavy chains of the Fab according to any one of claims. 1 and 6-12, consistent with the provisions 1-360 in any of the sequences SEQ ID nos: 2, 4, 28 and 26 in the sequence listing; sequences encoding the variable regions of light chains of the Fab according to any one of claims. 1 and 6-12, consistent with the provisions 1-327 in any of the sequences SEQ ID№: 16, 10, 12, 8, 14, 6, 32 and 30 in the sequence listing.

15. The gene according to claim 13 or 14, characterized in that the sequence encoding the constant region of the heavy chain of the indicated antibody shown in SEQ ID no: 18 in the sequence listing, and the sequence that encodes the constant region of the light chain of the indicated antibody shown in SEQ ID no: 20 in the sequence listing;
the sequence that encodes the specified CHI Fab shown in SEQ ID no: 34 in the sequence listing; and the sequence that encodes the constant region of the light chain of the specified Fab shown in SEQ ID no: 20 in the sequence listing.

16. The gene according to claim 13 or 14, characterized in that the sequence that encodes the heavy chain of the indicated antibody shown in SEQ ID no: 22 in the sequence listing, and the sequence that encodes the light chain of the indicated antibody shown in SEQ ID no: 24 in the list of posledovatel�values;
the sequence that encodes the Fab according to any one of claims. 6-12 is one of the following c1)-(C3):
cl) KS-7F: a sequence that encodes a fragment of the heavy chain of the specified Fab shown in SEQ ID no: 28 in the sequence listing, and the sequence that encodes the light chain of the specified Fab shown in SEQ ID no: 32 in the sequence listing;
C2) KS-7A: a sequence that encodes a fragment of the heavy chain of the specified Fab shown in SEQ ID no: 26 in the sequence listing, and the sequence that encodes the light chain of the specified Fab shown in SEQ ID no: 32 in the sequence listing;
C3) KS-2E: a sequence that encodes a fragment of the heavy chain of the specified Fab shown in SEQ ID no: 26 in the sequence listing, and the sequence that encodes the light chain of the specified Fab shown in SEQ ID no: 30 in the sequence listing.

17. The genetic material for expression of the indicated antibodies or Fab-fragments, such as described next: recombinant vector, the recombinant bacterium, the recombinant cell line; recombinant virus or expression cassette containing a gene according to any one of claims. 13-16.

18. Genetic material according to claim 17, characterized in that the specified recombinant vector is an expression vector in prokaryotes or eukaryote for expression of the specified Fab or antibody; specified recombinant bacterium I�is Escherichia coli, containing the specified gene; the indicated recombinant cell line is a line of mammalian cells, in which transferrable specified gene, preferably the cell line Cho (Chinese hamster ovary), or 293 cells and a subline; recombinant virus is a recombinant adenovirus or recombinant adeno-associated virus containing the specified gene.

19. The use of an antibody according to any one of claims. 1-5, or Fab according to any one of claims. 1 and 6-12, or a gene according to any one of claims. 13-16, or genetic material according to claim 17 or 18 to obtain drugs for prevention or treatment of diseases associated with tumor necrosis factor-α.

20. The use according to claim 19, characterized in that the specified disease associated with tumor necrosis factor-α, is a disease caused by increased levels of tumor necrosis factor-α human, preferably rheumatoid arthritis, autoimmune uveitis, Crohn's disease, plaque psoriasis, psoriatic arthritis, ankylosing spondylitis, ulcerative colitis, or juvenile idiopathic arthritis.

21. Pharmaceutical composition for prevention or treatment of diseases associated with tumor necrosis factor-α of a person, containing the excipient and an effective amount of active ingredients, and these activeingredient include at least one of the following substances: the antibody according to any one of claims. 1-5, or Fab according to any one of claims. 1 and 6-12, or a gene according to any one of claims. 13-16, and the genetic material according to claim 17 or 18; and the auxiliary substance is a pharmaceutically acceptable carrier or excipient.

22. The use of any of the following substances for the treatment of diseases associated with tumor necrosis factor-α: the antibody according to any one of claims. 1-5, or Fab according to any one of claims. 1 and 6-12, or a gene according to any one of claims. 13-16, and the genetic material according to claim 17 or. 18; and the pharmaceutical composition according to claim 21.

23. The use according to claim 22, characterized in that the specified disease associated with tumor necrosis factor-α, is a disease caused by increased levels of tumor necrosis factor-α human, preferably rheumatoid arthritis, autoimmune uveitis, Crohn's disease, plaque psoriasis, psoriatic arthritis, ankylosing spondylitis, ulcerative colitis, or juvenile idiopathic arthritis.



 

Same patents:

FIELD: medicine, pharmaceutics.

SUBSTANCE: presented invention refers to immunology. What is presented is a monoclonal anti-IFNAR1 antibodies with L234F, L235E and P331S Fc mutations of human IgG1 possessing a lower affinity to Fcgamma RI, Fcgamma RIIIA and c1q receptors as compared to a non-modified antibody. There are described the recovered nucleic acid providing expression of the above antibody containing a nucleotide sequence coding the antibody, and a pharmaceutical composition based on the above antibody.

EFFECT: using the invention provides the antibody possessing the lower affinity to Fcgamma RI, Fcgamma RIIIA and c1q receptors that provides reducing the undesired effector functions in treating chronic inflammation and autoimmune conditions.

9 cl, 34 dwg, 7 tbl, 36 ex

FIELD: biotechnologies.

SUBSTANCE: invention offers recombinant plasmid DNA coding a chimeric antibody against human tumour necrosis factor-alpha (TNF-alpha) based on pOptiVECTM-TOPO® plasmid. Invention refers to eukaryotic cell line as a producer of antibody to TNF-alpha, method of cell line obtainment by transfection of plasmid DNA according to the invention, and method of chimeric antibody obtainment for TNF-alpha by cultivation of cell line according to the invention.

EFFECT: increased synthesis level for antibodies against TNF-alpha by producer cells.

12 cl, 8 dwg, 1 tbl, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: presented invention refers to immunology. There are presented versions of antibodies neutralising a subtype group 1 and subtype group 2 influenza A virus infection. The antibody is characterised by: either a set of 3 CDR of a light and 3 CDR of a heavy chain, or the presence of variable regions of the light and heavy chains. There are disclosed: a nucleic acid molecule coding the antibody; a cell expressing the antibody; as well as a method for the attenuation of the influenza A virus infection or reducing a risk thereof with the use of the antibody in a therapeutically or preventatively effective amount.

EFFECT: using the invention provides the antibodies neutralising the influenza A virus, which can find application in medicine in treating subtypes H1, H2, H3, H5, H7, H9 influenza.

18 cl, 6 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: presented invention refers to immunology. Disclosed are versions of a human antibody or an antigen-binding fragment of the human antibody, which specifically bind and inhibit human proprotein convertase subtilisin/kexin type 9 (hPCSK9). Each version is characterised by the fact that it contains 6 CDRs of heavy and light chains. Described are: an isolated coding nucleic acid, and expression vector and a method for producing the antibody with the use of the above vector. Presented is a pharmaceutical formulation based on the antibody for treating a disease or a condition which can be relieved, improved, suppressed or prevented by means of the anti-PCSK9 antibody.

EFFECT: using the invention provides the new versions of the antibodies able to reduce serum low-density lipoprotein cholesterol accompanied by no considerable changes or no effect on the hepatic function according to measured alanine-aminotransferase and aspartate-aminotransferase.

8 cl, 14 dwg, 28 tbl, 17 ex

FIELD: medicine.

SUBSTANCE: presented invention refers to immunology. There are described versions of antibodies or antigen-binding fragments binding to human 4-1BB. One of the versions is characterised by the presence of respective 3 CDR light chain sites and 3 CDR of heavy chain sites. The other version is characterised by the presence of the heavy and light chain with respective amino acid sequences. There are described versions of a pharmaceutical composition for reducing tumour growth or for treating cancer in an individual, as well as methods for reducing the tumour growth or treating cancer in the individual using the versions of antibodies or antigen-binding fragments in a therapeutically effective amount. What is described is a method of treating cancer with using a combination of the antibody and an immunotherapeutic agent. There are disclosed: versions of coding nucleic acids, an expression vector and a host cell containing the antibody expression vector. What is disclosed is a method for producing the antibody with using the cell.

EFFECT: invention provides the new agonist anti-human 4-1BB (also called CD137 or TNFRSF9) antibodies, which recognise an epitope within the amino acid residues K115, C121, R134, R154, V156 of the antigen, have Kd affinity measured by the BIACORE method and approximated to nM, eg 0,4 nM or 8 nM (for the anti-IgG1 antibody format) that can find application in the therapy of cancer and cancerous diseases.

19 cl, 8 dwg, 11 tbl, 9 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to biotechnology and immunology. What is presented is a hybridoma cell line FP12H3-C2 deposited under No. DSM ACC2750 producing the anti-beta-amyloid antibody. Presented are methods for preparing an antibody, including a humanised antibody with using a hybridoma line according to the invention, as well as diagnostic techniques for a beta-amyloid associated disease or condition in a patient or a liability to such disease or condition, a method for determining a degree of the tissue involvement into amyloidogenic plaques, a method for monitoring minimal residual signs of the disease into a patient following treating with the antibody or its active fragment, a method for prediction of sensitivity in the patient treated with the antibody or its active fragment.

EFFECT: present invention can find further application in diagnosing and therapy of beta-amyloid related diseases, such as Alzheimer disease.

9 cl, 4 dwg, 5 tbl, 17 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to immunology. What is presented is a completely human monoclonal antibody, which binds insulin-like growth factor-II (IGF-II) and has a cross responsiveness to IGF-I, as well as its antigen-binding fragment. There are disclosed a nucleic acid molecule coding an antibody according to the invention, a vector and a host cell for the expression of the antibody according the invention. There are described a pharmaceutical composition, as well as conjugates for treating and diagnosing malignant tumour, using the antibody according to the invention in preparing the therapeutic agent and a method for determining IGF-II and IGF-I levels in a patient's sample.

EFFECT: present invention can find further application in cancer therapy.

16 cl, 27 ex, 18 tbl

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and immunology. There are presented optimised genes of light and heavy chains of Infliximab, an anti-tumour necrosis factor alpha (TNF-alpha) antibody, as well as a cell line VKPM-N-131, and a method for antibody biosynthesis. Nucleotide sequences of the genes coding the light and heavy chains of Infliximab are optimised in order to provide the content of codones most specific for mammals; the G/C content is expected to make 50-60% of the total composition; the absence of expanded tracts of a degenerate composition and the absence of RNA secondary structures.

EFFECT: Chinese hamster ovary cell line (CHO) produced by transfection by expression structures containing the genetic sequences according to the invention, enables producing at least 50 mg/l of the monoclonal antibody Infliximab.

4 cl, 3 dwg, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to biotechnology and represents anti-nerve growth factor (NGF) antibodies. The present invention also discloses a pharmaceutical composition for relieving pain associated with a disease or a condition, wherein pain progression or persistence is mediated by NGF, containing the above antibodies, as well as a kit for treating a HGF-related disease, such as e.g. osteoarthritis, nucleic acids coding a heavy or light chain of the antibody, an expression vector, a host cell for preparing the above antibodies, a method for expressing the above anti-NGF antibodies, as well as using the above antibodies in managing pain and for preparing a therapeutic agent for managing pain associated with the disease or condition, wherein pain progression or persistence is mediated by NGF.

EFFECT: present invention enables producing the anti-NGF antibodies characterised by high stability in vivo.

16 cl, 7 dwg, 13 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: present invention refers to immunology. Presented is an antibody able to bind to an amplified epidermal growth factor receptor (EGFR) and to de2-7 EGFR, a truncated version of EGFR, and characterised by sequences of variable domains. There are also disclosed a kit for diagnosing a tumour, an immunoconjugate, pharmaceutical compositions and methods of treating a malignant tumour based on using the antibody according to the invention, as well as a single-cell host to form the antibody according to the present invention.

EFFECT: invention can find further application in diagnosing and treating cancer.

43 cl, 98 dwg, 20 tbl, 26 ex

FIELD: medicine.

SUBSTANCE: invention relates to field of biotechnology and immunology. Described is antibody, which specifically binds denatured CD70. Claimed group of inventions can be used in medicine.

EFFECT: disclosed is method of diagnostics, prediction, prevention and treatment of malignant tumours of ovaries, pancreas and other malignant tumours with application of antibodies.

5 cl, 10 dwg, 2 tbl, 9 ex

FIELD: biotechnologies.

SUBSTANCE: invention offers recombinant plasmid DNA coding a chimeric antibody against human tumour necrosis factor-alpha (TNF-alpha) based on pOptiVECTM-TOPO® plasmid. Invention refers to eukaryotic cell line as a producer of antibody to TNF-alpha, method of cell line obtainment by transfection of plasmid DNA according to the invention, and method of chimeric antibody obtainment for TNF-alpha by cultivation of cell line according to the invention.

EFFECT: increased synthesis level for antibodies against TNF-alpha by producer cells.

12 cl, 8 dwg, 1 tbl, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and immunology. Described are various variants of anti-IL-1R1 antibodies. The disclosed antibodies can be applicable for treating IL-1R1-mediated disorders, including rheumatoid arthritis, asthma, and chronic obstructive pulmonary disease (COPD).

EFFECT: presented group of inventions can be used in medicine.

21 cl, 14 dwg, 12 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to the field of obtaining and separation of single-domain molecules (SDAB). Described is a method of the separation or purification of the SDAB molecule, which represents a trivalent molecule of a ATN-103 nanobody, targeting TNFα and HAS, from a mixture, containing the said SDAB molecule and one or more polluting substances. The mixture is brought in contact with a cation-exchange carrier under conditions, which make it possible for the SDAB molecule to bind with the carrier or be absorbed on the carrier. One or more polluting substances are removed and SDAB is selectively eluted from the carrier. The conductivity of a conditioning medium (CM), used for the carrier loading, constitutes from approximately 12 to 9 mS/cm and pH under conditions of loading is corrected to a value from 4.0 to 4.3. The buffer for elution corresponds to approximately 50 mM of sodium chloride or less and has pH from approximately 5.5 to 7.2. Disclosed is a method or a process of obtaining recombinant SDAB of ATN-103. A host-cell is supported in the conditions at which recombinant ATN-103 SDAB is expressed. The mixture of molecule SDAB and one or more polluting substances is obtained. ATN-103 SDAB is purified or separated with the application of cation-exchange chromatography, as said above.

EFFECT: application of the invention provides new methods of the separation or purification of the nanobody, which can be applied in obtaining the ATN-103 nanobody.

19 cl, 4 dwg, 6 ex

FIELD: biotechnology.

SUBSTANCE: monoclonal antibody against human interleukin-6 is represented, which comprises hypervariable regions of the heavy chain CDRH-1: GFSLSTSGMGVG; CDRH-2: HIWWDDDKYYNPSLKS; and CDRH-3: RANYGTSYDYGMDY; and the hypervariable regions of the light chain CDRs CDRL-1: KASQSVSDVLT; CDRL-2: YASNRYT; and CDRL-3: QQGYRSPYT. In addition, the invention also relates to a hybridoma strain deposited in the Russian Collection of Cell Cultures under number RKKK(P) 751D, and producing the said antibody.

EFFECT: invention enables to expand the range of antibodies against human IL-6, having high ability to inhibit IL-6.

4 cl, 3 dwg, 2 tbl, 4 ex

FIELD: biotechnology.

SUBSTANCE: humanised monoclonal antibody against TNF and its application are described.

EFFECT: invention enables to reduce significantly the immunogenicity of murine antibody while maintaining the ability of the antibody to recognise the antigen as compared with the conservative chimeric murine antibody, increased antibody safety in clinical applications.

11 cl, 3 dwg, 5 tbl, 16 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to field of immunology and biotechnology. Described are: humanised antibody and its antigen-binding fragment (Fab), which selectively bind human IFN-γ and contain variable site of heavy chain (VH) and variable site of light chain (VL), where VH and VL have sequences of amino acids respectively SEQ ID NO:1 and 2, presented in description. Also disclosed are fragments of DNA, which code said antibody and its Fab-fragment; plasmid DNA for expression of said specific proteins; and modified cells of bacteria and eukaryotes, which contain said plasmid DAN and intended for expression of said antibody and its Fab-fragment. Claimed are methods of obtaining said antibody and its Fab-fragment, which include cultivation of said modified cells in nutritional medium and isolation of antibody and its Fab-fragment by claimed invention from cultural liquid.

EFFECT: invention makes it possible to obtain humanised antibody or its Fab-fragment, binding with IFN-γ with kD 4,6 and IC50 not less than 1,5 nM in test on cells U937, with preservation of affinity of initial mouse monoclonal antibody.

13 cl, 3 dwg, 1 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: present invention refers to biotechnology, more specifically to granulocyte-macrophage colony-stimulating factor (GM-CSF) antagonists, and can be used in medicine. The invention consisting in using the GM-CSF specific antibody in treating or preventing multiple sclerosis in the patients with multiple sclerosis.

EFFECT: invention enables delaying the onset of multiple sclerosis recurrences.

9 cl, 5 dwg, 8 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to immunology. There are presented: an antibody binding to interleukin-17 (IL-17) characterised by 6 CDR of a light and heavy chain, as well as a coding nucleic acid and a vector for expression of the above antibody. What is described is a pharmaceutical composition for treating a patient with multiple sclerosis, rheumatoid arthritis, psoriasis, Crohn's disease, chronic obstructive pulmonary disease, asthma, graft rejection on the basis of the above antibody. What is disclosed is a method for preparing the antibody by means of expressing the respective nucleic acid and recovering the antibody from a cell culture or a cell culture supernatant.

EFFECT: using this invention provides the antibody with IC50 twice as much as shown by in vitro IL-6 and IL-8 neutralisation as compared to the known NVP-AIN-497 antibody, which binds human IL-17A and IL-17F that can find application in medicine in therapy of various inflammatory diseases.

9 cl, 6 tbl, 11 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely to treating diseases related to insulin resistance. A method of treating involves administering an effective amount of IL-17A and/or IL-17F antagonist, wherein the above agonist represents an antibody or its antigen-binding fragment. The group of inventions also refers to a pharmaceutical composition containing the IL-17A and/or IL-17F antagonist with a pharmaceutically acceptable additive added, and to a set containing the above agonist, and an administration instruction.

EFFECT: using the given group of inventions enables reducing the insulin resistance in an individual by administering pro-inflammatory factors IL-17A and/or IL-17F antagonists.

20 cl, 3 ex, 14 dwg

FIELD: medicine.

SUBSTANCE: early postoperative period involves administering low-molecular heparins and anti-inflammatory agents. Anti-inflammatory therapy requires administering cycloferon according to the schedule: 2 tablets of cycloferon 0.15 mg on the first preoperative day, 2 tablets on the first postoperative day, 2 tablets in the morning on the 2nd, 4th, 6th postoperative day, and further, every third day throughout 1 postoperative month (on the 9th, 12th, 15th, 18th, 21st, 24th, 27th, 30th day).

EFFECT: method provides the effective prevention of postpericardiotomy syndrome with a lower risk of side effects by administering cycloferon according to the developed schedule requiring non-steroidal anti-inflammatory agents and glucocorticosteroids.

2 ex, 3 tbl

Up!