Concatemers for immune modulation

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biochemistry. There are presented pharmaceutical compositions having a concatemer molecule and a kit, as well as using for preparing an agent for immune system modulation or for human's or animal's immune system activity modulation, and a composition according to the invention. The given invention can find further application as an immunomodulatory agent in therapy of various diseases.

EFFECT: what is presented is a concatemer molecule of non-coding nucleic acid containing at least four single-strand sites with non-methylated CG motives for human's or animal's immune system activity modulation.

20 cl, 4 dwg

 

The invention relates to polymer the non-coding nucleic acid molecule to modulate the activity of the immune system of humans and animals, as well as the method of production mentioned above and vaccines comprising polymer a non-coding nucleic acid molecule, where the polymer under a non-coding nucleic acid molecules imply a non-coding nucleic acid molecule, comprising at least four covalently linked molecules (tetramer) of the non-coding nucleic acid molecules.

While the adaptive immune response starts with a delay (3-5 days) after the selection of specific cells for specific pathogen, their clonal expansion and differentiation into effector cells, but then provides long term protection against the corresponding pathogen by formation of immunological memory cells of the innate immune system recognize pathogen through the interaction of pathogen-associated molecular patterns (the AGENCY) with the receptor encoded by the germ cells, and react instantly. Different reactions belong to different kinds of cell types as the secretion of cytokines (e.g., IL-1, IL-6, TNF-α) and chemokines (e.g., IL-8/CXCL8, MIP-1α/β, MCP-1), activation of effector mechanisms (phagocytosis, respiratory burst, release of bactericidal Il� cytotoxic substances or lytic granules), the expression of costimulatory molecules (CD80, CD86) and increased expression of MHC-molecules. Thus, on the one hand, the effector cells are recruited and activated, and is able to eliminate the pathogen has penetrated, on the other hand, cells of the adaptive immune system receive the necessary signals to activate them.

With the aim of improving the immune response of a CpG-oligonucleotides (CpG-ODN) have been used as a new class of immunomodulatory molecules. Such neetilirovannye CG-motifs can be detected in bacterial DNA and represent a "danger signal" for the immune system. As pathogen-associated molecular pattern (the AGENCY), they cause non-specific activation of innate immune system (Krieg, Nat. Med 2003; 9: 831-835). CpG-ODN induces based on TH1 immune response by cytokines: interleukin-12, interferon-γ and factor-α tumor necrosis.

Immunostimulatory nucleic acids (ISS), including the above CpG-ODN, have a length of several reasons and do not include open reading frames for protein expression.

ISS represent a linear nucleic acid molecule, the ends of which are free (with free hydroxyl and a phosphate group) or a protected synthetic groups.

Stimulation of the cellular immune response enables you to affect the feedback that not lead to an acceptable immune activity in a patient without exposure.

Modification of CpG-ODN with phosphothioate skeleton, which is used to stabilize the CpG-DNA, has some serious drawbacks. In particular, it relates to observed toxicity (Heikenwalder 2004, Levin 1999), and nonspecific protein binding (Brown 1994).

In this regard, we developed a new class of covalently continuous immunomodulatory DNA (WO 01/07055/EP 1196178). These DNA molecules are composed of two chemically synthesized DNA ODN with semicomplete part at the 5'- and 3'-end palindrome, overlapping the ends so that ligation of the two DNA molecules leads to the formation of covalently continuous molecule. These DNA molecules with GC-motifs in complementary parts demonstrate the activity, similar to CpG-ODN (increased expression of surface molecules CD80, CD40, MHC on b cells and the secretion of IL-6, IFN-γ, IFN-α, IL-12, TNFα mononuclear cells, peripheral blood), but compared with CpG-ODN with phosphorothioate skeleton they show differences regarding the pattern of expression of induced cytokines and clearly lower toxicity in mice. Based on the existing level of technology, immunomodulatory DNA has a number of shortcomings in relation to the modulation of the activity of the immune system of humans and animals. It is impossible to modulate the activity of the immune system of humans and animals in not�required extent, in particular, activate it. Molecules according to WO 01/07055, as shown in the example in figure 1 or in paragraph 11 of the claims, consist of several deoxyribonucleotide residues that form a partially single-stranded dumbbell and covalently continuous DNA molecule that is designed as a dimer in the framework of the present invention. According to WO 01/07055 Monomeric nucleic acid used as starting material were heated prior to ligation, getting the same type of nucleic acid molecules, each of which consists of a dumbbell dimer (compare with figure 1 WO 01/07055). The resulting nucleic acid has the appearance of a dumbbell according to the drawing 1 WO 01/07055. The monomer in the framework of the invention does not mean a structure consisting, for example, from a single base, and means a nucleic acid, which itself consists of several deoxyribonucleotides (compare with figure 1 or paragraph 11 of the claims WO 01/07055), which together form a typical monomer properties due to the given sequence of bases or a predetermined three-dimensional conformation.

Proceeding from this prior art, the present invention is the provision of suitable immunomodulatory DNA molecules that trigger an improved immune response and ability� their manufacture, as well as vaccines comprising the above immunomodulatory DNA molecule.

In the context of the present invention immunomodulation means that the mediator and effector cells of the immune system, mainly currently known thymocytes with helper function and cytotoxic thymocytes, b cells and so-called NK (natural killer) cells, macrophages and monocytes, and dendritic cells and their precursors, as well as the cell population with features currently not clearly identified, which have the function within the immune system that are exposed to stimulation by the use of nucleic acid molecules for cell proliferation, migration, differentiation or activity. Immunomodulation means that along with the improvement of the immune response in the above sense are also subjected to the influence of the type or nature of the immune response or by effect on starting or maturing immune response, either by changing the held reaction against her character.

Molecule with enhanced immunomodulatory properties claimed in the present invention, polymer a non-coding nucleic acid molecule, compared with the dimeric substances from WO 01/07055. Under polymeric nucleic acid molecule should be understood so-called high�molecularly concatemer. Polymer molecule according to the invention can be manufactured by a method comprising the following stages:

- provide 5'-phosphorylated deoxyribonucleic acid,

- alcohol deposition with subsequent drying of the precipitate at 50°C or lyophilisate DNA molecules at 50°C, in particular, in the presence of MgCl2until the dry residue with subsequent resuspendable in the buffer.

add T4 DNA ligase, thereby forming a reaction mixture, and

incubation of reaction mixture at 37°C for at least 30 minutes.

Concatemer consist of covalently linked monomer units that are fully self-contained in the ring, having within reach of the constituent monomers of the double-stranded portion and immunomodulating CG-motifs preferentially in single-stranded parts. It was a complete surprise that these polymers, including tetramers, hexamers or high molecular ordered structure covalently continuous immunomodulatory DNA, have an extremely superior effect compared with the dimeric molecules of the present level of technology.

The claimed polymer molecules shown in figures 1 and 2 in terms of molecular properties on figures 3 and 4 in terms of their functional properties, which follow to a person skilled in the art as R�result of the manufacturing method according to the invention. The use of nucleic acid molecules with palindromic respectively 5' and 3'ends as waste products in the described method, leads to the formation of polymers of different sizes, of which only stated tetramers or high molecular ordered structure perform high-level function. Since the characteristic structural properties impossible due to increased and different molecular size characterization of polymers by means of the manufacture method is very accurate. The new method provides a product different from that described in the existing art. This may be demonstrated clear differences in the properties of dimers and polymers according to the invention, as shown in figure 3. High molecular weight polymers of the invention are surprisingly better for immune modulation than polimernye structure known from the existing level of technology.

Molecules of the invention can also be manufactured by providing a 5'-phosphorylated deoxyribonucleic acid in water, if they are purified by a method equivalent to polyacrylamide gel electrophoresis, in particular, the combined purification via HPLC followed by FPLC. Specialists in the art it is known that through a combination of several you�ecoefficiency methods like HPLC or FPLC can be obtained the degree of purification, similar PAGE-cleaning.

Surprisingly, the chronology of the individual stages of the method leads to the formation of multimeric molecules comprising an annular stably and covalently linked to each other monomers in length, at least 24 nucleotides. Simultaneously formed by high molecular weight polymers always consist of an even number of Monomeric components. Form a chain of molecules does not contain a free 5'- or 3'-ends. The monomers are formed through intermolecular esterification of the molecule according to the invention, characterized by:

- inclusion of land at least two contiguous nucleotides that forms under suitable conditions, the double-stranded stem with the other part of the monomer,

- between the back of the complementary parts are at least 4 nucleotide

- CG-motifs that are recognized by cellular structures, preferably located in a single-stranded part,

modified nucleotides may also be part of a single-stranded region that is covalently linked to fatty acids, sugars or amino acids.

The molecule according to the invention contains at least four monomer and is formed with regard to its conformation during the aforementioned synthesis. The monomers are formed by intermolecular bonds of a chain of two, four, six or more molecules through education�Oia covalent bonds. The result is the formation of so-called di-, Tetra - or hexamers, which are all, except for the dimers are referred to as polymers.

The molecule according to the invention may also be defined as concatemer. In a preferred embodiment of the invention, it is assumed that a molecule of the invention is concatemeric molecule, where at least four separate loops of monomers linked to each other, preferably linearly, so that preferably two, particularly preferably multiple double-stranded parts each separated from each other by single-stranded loop elements.

Molecule of the invention can modulate activity of the immune system of human or animal better molecules existing level of technology. Molecules of an existing prior art are known immunomodulatory nucleic acid sequences which are effective in the form of low-molecular-weight dumbbell structures. The most famous immunomodifier short oligodeoxyribonucleotide acids consist of demetilirovannogo cytosine-guanosine-motive. Under physiological effect of such nucleic acids are to be understood relatively immune modulation modulation of immune system activity in the framework of this invention. EP 1 196 178 additionally considers several m�of molecules, consisting of a stem, at least one loop, as they considered, for example, in the figures 1 and 2 in EP 1 196 178. From the point of view of the present invention, such molecules are dimeric structure. The present invention does not include such dimers. It should be noted that the term polymer is used in several different meanings in science. The polymer can be, for example, a longer nucleic acid, and a structure comprising several identical or similar molecules, forming a larger size ordered structure. The polymer in the framework of the invention means a chain of molecules that includes at least four of the monomer. When using the preferred monomers, the molecular weight of the resulting tetramer corresponds to approximately 170 kDa (Matt. Fig. 2). Polymers within the invention are, for example, stem-loop structures, as shown in Fig. 1, forming an ordered structure with multiple same or similar stem-loop structures to form the structure of a higher order (polymer). A polymer is a molecule of the invention that more than 23 kDa. The described reaction conditions cause during ligation temporary connection of monomers that can be tarifitsirovana a ligase. The final polymer will be formed during si�thesis based on conformation only in special reaction conditions. It is impossible to produce high molecular weight polymers of dimers that have already been formed. The monomer structure, forming a polymer covalently linked to each other. Formed polymer is stable against heating or denaturing agents, which means conversely that the dimers cannot be obtained by simple physical methods of high molecular weight molecules according to the invention.

It is striking that the relatively simple steps of the method can be obtained such polymeric structures having improved and not obvious properties compared with dimeric structures. Manufacture of high molecular ordered structures, for example, can be performed by centrifugation, electrophoresis in a gel or column chromatography to identify and obtain complex structures of high order, like, for example, tetramers, hexamers or others, which are compared with the dimers possess improved properties in relation to modulation of the immune system (compare Fig. 3 and 4). Various forms of immune modulation in laboratory organisms or human prove it.

All of the deoxyribonucleic acid according to the following characteristics can be used in the method of polymerization.

5'-P-W-S-3', where

- P, W, S are nucleic acids associated �Rog with each other in the order listed reading through fosfolipidnyh relations "-",

- a nucleic acid sequence P, W, or S contains at least one motif deoxyribonucleotides CG sequence.

- W has at least a length of 4 nucleotide and

sequences of parts of nucleic acids S and P is inversely complementary to each other.

Formed in the end, the polymers correspond to the formula:

,where

- nucleic acid P on the right side of the formula covalently linked to the nucleic acid W located on the left

- "n" describes the degree of concatemeric, indicating the number of internal monomer units.

Since the properties of the claimed polymers are determined by their conformation, the polymer structure in the framework of this application can be organized into ordered structures is not identical for each sequence of monomers. The group W of nucleic acids can contain, in this regard, molecules with sequences B, U, K, Y, group, P nucleic acids may contain molecules with sequences J, E, R, G, and the group's nucleic acid can contain a sequence M, A, T, I. depending on the set n of monomers in the cow part of the resulting polymer, there are several different parts of the sequence J-U-A relatively R-Y-I, which need not be identical in sequence Rel�relative to each other, what is indicated by index "i" for an "n-i+1". The claimed polymers with identical sequence or varying sequences of Monomeric components correspond to the formula:

,where

- A, B, E, G, I, J, K, M, R, T, U, Y are deoxyribonucleotide molecules and

- sequence component i of the nucleic acid molecule may be different, but should not be compared to the (i+1), the same molecule and

- at least one nucleic acid includes a motive with deoxyribonucleotides CG sequence and

- B Ui, K and Yn-i+1mostly single-stranded and

- B Ui, K and Yn-i+1each collected at least 4 deoxyribonucleotides and

sequences Jifor In-i+1, Aiin relation to Rn-i+1M relative to G, respectively E relative to T are inversely complementary to each other and

- G covalently linked via a phosphodiester bond with V.

Preferably, the polymer according to the invention is characterized in that the deoxyribonucleic acid used in the method contains the following sequence:

- where deoxyribonucleic acid has a length of from 20 to 400 nucleotides.

The result of the synthesis product from predpochtitel�governmental sequences are molecules that wonderfully suitable for modulation of the immune response. Particularly preferably, if the sequence within the single-stranded parts of the molecule are partially or completely correspond to the sequence

Strikingly, the presence of these sequences leads to a very good activity concatemeric polymers. Inside concatemeric structure of the molecule is partially single-stranded covalently closed chain of deoxyribonucleotides are responsible for the prolonged action of molecules in the target organism in which they are administered.

In an additional preferred embodiment, it is assumed that the monomer consists of a core sequence of N1N2CGN3N4where N1N2is a group element of GT, GG, GA, AT or AA, N3N4is an element of the group CT or TT, as well as With detoxication, G deoxyguanosine And deoxyadenosine and T deoxythymidine.

In a particularly preferred embodiment, it is assumed that the primary sequence of N1N2CGN3N4located within the single-stranded part of a closed chain of deoxyribonucleotides. In particular, these preferred molecules have a very strong impact during optical�and immune systems.

It is obvious that the molecule according to the invention can have one or more substituents linked through covalent bonds. Such substituents may be, for example, peptides, proteins, saccharides, lipids, antigenic structures, DNA and/or RNA.

The invention considers, in addition to the above structural and functional properties of the product also a method of manufacturing a molecule, comprising the following stages:

- provide 5'-phosphorylated DNA in water, purified by polyacrylamide gel electrophoresis,

- lyophilization at 50°C until then, until the dry residue, and the subsequent resuspension in buffer,

add T4 DNA ligase, forming a reaction mixture, and

incubation of reaction mixture at 37°C for at least 30 minutes,

or

- providing monomer deoxyribonucleic acid after deposition with subsequent drying of the precipitate at 50°C or lyophilization of the DNA molecule at 50°C in the presence of magnesium chloride

- add T4-DNA-ligase and

incubation at least for 10 minutes at 37°C, preferably at least for 30 minutes.

The same results regarding the manufacture of the polymer can be obtained by precipitation or lyophilization in the presence of magnesium chloride, in particular, if deoxyribonucleic acid would�and purified by polyacrylamide gel electrophoresis or a combination of HPLC and FPLC.

It was a complete surprise that the result of applying the method is to obtain different molecular structures in comparison with the dimers described in the existing level of technology (WO 2007/131495 or WO 01/07055). Since these methods differ only in several stages, it is surprising that relatively small modifications is to obtain different molecules. The structure obtained by the method known in the existing level of technology (WO 01/07055 or WO 2007/131495), showing significant differences in their properties. Molecules are clearly differentiated in relation to the immunomodulatory actions, but also on other characteristics, such as side effects. In addition to the various stages of the methods, the use of the products obtained with the preferred sequences leads to the formation of highly specific reaction product with a specific and exclusive properties. The use of sequences according to the invention together with the above stages of the method leads to the formation of effective polymers, demonstrating the preferred properties relative to those of the existing level of technology.

The polymer according to the invention is preferably from 2+2 monomers (Matt. Fig. 1), preferably partially single-stranded, covalently closed circuits deoxyribonucleotide to�of mponents, where the monomers have a stem and a loop, where the stem has at least 2 deoxyribonucleotide, and loop has at least 4 deoxyribonucleotide, and loop has from 1 to 6 CG-motif, and variable n is an element of the set of natural numbers.

The invention relates further to a composition that includes at least a molecule of the invention and a chemotherapeutic drug. Strikingly, unexpected significant improvement in the immune response under the action of the molecules of the invention can optionally be distinctly improved by a combination of means according to the invention with known chemotherapeutic drugs and the use of the composition is preferably, for example, for the treatment of tumors. Although the specialist in the art it is known that the dimer according to WO 01/07055 have immunomodulatory effects, and it was further known that chemotherapeutic drugs affect the tumor, the surprise was that the immunomodulatory dimer consisting of monomers, cause in combination with chemotherapeutic drugs super-additive effect. More unexpected was the fact that polymers consisting of monomers, respectively concatemers, in combination with chemotherapeutic drugs showed a more positive effect than the dimers. These elements,�yedinenye in the composition according to the invention, have the same target for the treatment of pathogens, in particular, tumors. Each element defines a single result inside the composition of the invention, but the interaction between the individual elements leads to an unexpected effect which is more pronounced in polymers than dimers. A composition according to the invention can be presented in the form of a kit in which the molecule according to the invention and a chemotherapeutic agent in accordance with the existing level of technology presented separately. Thus, in a preferred embodiment of the invention, at least two component sets can be used simultaneously or with a time shift. Use of the composition according to the invention may, for example, to activate the immune system so that subsequent use of chemotherapeutic drugs can have a very good impact. Obviously, it is possible to apply a person or an animal first, a chemotherapy drug, and then with time delay - molecule according to the invention. For certain tumors, the simultaneous use of a molecule according to the invention and a chemotherapeutic drug, preferably.

In a preferred embodiment, the chemotherapeutic drug is selected from the group comprising antibodies, alkylating agents, n�tinavie analogues intercalating agents, antibiotics, mitosis suppressor, taxanes, topoisomerases suppressors, anti-metabolites and/or L-asparaginase, hydroxyurea, mitotane and/or amanitine.

In a preferred embodiment the alkylating agents are selected from the group including

- derivatives of nitrogen mustard gas, in particular

- cyclophosphamide,

- ifosfamide,

trofosfamide,

- melphalan and/or

- chlorambucil

- alkylsulfonyl, in particular

- busulfan, and/or

treosulfan

- nitrosoanatabine, in particular

- carmustine,

- lomustine,

- nimustine

- estramustine and/or

- streptozotocin

- procarbazine and dacarbazine,

- temozolomide and/or

- thiotepa.

Alkylating agents have very good effect on tumors, by inhibiting their growth.

In a preferred embodiment, platinum analogs selected from the group including:

- cisplatin,

- carboplatin and/or

- oxaliplatin.

In an additional preferred embodiment, it is assumed that the intercalating agents are selected from the group including:

- anthracycline, in particular

- doxorubicin (adriamycin),

- daunorubicin,

- epirubicin and/or

- idarubicin,

- mitoxantrone

- amsacrine and/or

- doxifluridine.

In additional�ohms preferred embodiment, it is assumed, antibiotics are selected from the group including:

- bleomycin,

- actinomycin D (dactinomycin) and/or

- mitomycin.

In addition, in another preferred embodiment of the invention is planned as an advantage selection of suppressors of mitosis from the group including:

- Vinca alkaloids, in particular

- vinorelbine,

- vincristine (oncovin),

- vinblastine and/or

- vindesine.

In a further particularly preferred embodiment, taxanes selected from the group including:

paclitaxel and/or

- docetaxel.

Further, it may be appropriate to the topoisomerases suppressors were selected from the group including:

inhibitors of topoisomerase I, in particular

- camptothecin,

- topotecan and/or

- irinotecan and/or

inhibitors of topoisomerase II, in particular,

- etoposide,

- teniposide.

Further, appropriate in the private embodiment, the invention is selecting from the group of antimetabolites, including:

- folic acid antagonists, in particular

methotrexate,

- pyrimidine analogs, in particular

- 5-fluorouracil,

- capecitabine,

- the cytosine arabinoside (cytarabine) and/or

- gemcitabine

- purine analogues, in particular

- 6-thioguanine,

- pentostatin,

- azathioprine,

- 6-mercaptopurine,

- flooder�bin and/or

- cladribine.

In addition, the invention relates to a kit comprising a molecule according to the invention and a chemotherapeutic agent, if necessary, together with information on the combinations of the contents of the set. The invention relates also - as already described - to a pharmaceutical product comprising a molecule according to the invention or the composition if necessary with a compatible pharmaceutical carrier.

In addition, the invention relates to the use of molecules, compositions or pharmaceutical preparation for the production of tools for the modulation of the immune system of a person or animal or for modulating activity referred to the immune system. Under the modulation of the immune system of a human or animal should understand the impact of each on the immune system, having the effect that the immune system to inhibit tumor or cancer. Modulation of immune system activity can be interpreted synonymous with this or be described to a person skilled in the art as known activity of the immune system that are directed against tumors, and strangely find themselves elevated in their action as a result of the use of means according to the invention. Modulation is, in particular, stimulation or increase of the immune system relative to itself the immune system, meaning �tableuse tumor or remittent preventive effect. Thus, the tool according to the invention can be used in a preferred embodiment of the invention for stimulation mediated T-cell immune response, but also to change not dependent on T-cell immune response. This process may include in a preferred embodiment of the invention the proliferation of b-cells or activation of b-cells.

In a particularly preferred embodiment, modulation of the activity of the immune system leads to improved, resulting in the secretion of various cytokines relevant cellular populations changed, respectively, is returned to its previous state. Especially it is preferable that the molecule according to the invention, accordingly, the composition according to the invention, is used as an adjuvant in therapeutic or prophylactic vaccination. The tool according to the invention can be used very effectively for the treatment of disorders of cell growth, where in a preferred embodiment, the violation of cell growth is a tumor disease. Preferably, a tumor disease is a disease selected from the group comprising tumors of ear-nose and throat, comprising tumors of the inner part of the nose, paranasal cavities of the nose, nasopharynx, lips, oral cavity, oropharynx, respiratory throat, ear, salivary glands and paragangliomas, tumors of the lungs comprising non-small cell bronchial carcinoma, small cell bronchial carcinoma, tumors of the mediastinum, tumors of the gastrointestinal tract, comprising tumors of the esophagus, stomach, pancreas, liver, gallbladder and bile ducts, small intestine, colon and carcinoma of the rectum and carcinoma of the anal canal, urogenital tumors comprising tumors of the kidneys, ureter, bladder, prostate, urethra, penis and testicles, gynecological tumors comprising tumors of the cervix, vagina, vulva, uterine cancer, malignant trophoblast disease, ovarian carcinoma, tumors of the uterine tube (fallopian tube), tumors of the abdominal cavity, carcinoma of the breast, tumors of endocrine organs, comprising tumors of the thyroid, parathyroid, adrenal, endocrine pancreatic tumors, carcinoid tumors and carcinoid syndrome, multiple endocrine neoplasias, bone sarcomas and soft tissue, mesothelioma, skin tumors, melanomas comprising cutaneous and intraocular melanomas, tumors of the Central nervous system, tumors of childhood, comprising retinoblastoma, Wilms tumor, neurofibromatosis, near�the blastoma, family of tumors Ewing's sarcoma, rhabdomyosarcoma, lymphomas comprising nahodkinskuju lymphoma, T-cell lymphoma of the skin, primary lymphoma of the Central nervous system, Hodgkin's disease, leukemias comprising acute leukemias, chronic myeloid and lymphocytic leukemia, a neoplasm of plasma cells, syndrome myelodysplasia, paraneoplastic syndrome, metastases with unknown primary tumor (CUP syndrome), metastasized tumors comprising brain metastases, lung metastases, liver metastases, bone metastases, pleural and pericardial metastases and malignant ascites, peritoneal carcinomatosis associated with immunosuppression malignancy comprising AIDS-associated cancer, such as Kaposi's sarcoma, AIDS-associated lymphoma, AIDS-associated lymphoma of the Central nervous system, AIDS-associated Hodgkin's disease and AIDS-associated anogenital tumors, associated with the transplantation of a malignant neoplasm.

The invention is further illustrated by examples, not limited to these examples.

Examples of the preparation of immunomodulatory nucleic acid molecules:

a) Manufacturing of undeclared dimeric monomer:

5'-phosphorylated oligodeoxyribonucleotide (ODN) with posledovatel�of (SEQ ID No. 3) was heated for 5 minutes to 90°C and subsequently chilled on ice to give the opportunity to form a hairpin structure. Semicomplete protruding parts were legirovanyh at a final concentration of 1 mg/ml DNA in the presence of T4 DNA ligase (0,1 U/μg ODN) for 24 h at 37°C.

Fractionation of the purified ligation product in a 3% agarose gel, compare Fig. 2 track 2.

(b) the Manufacture tetramer as an example of the claimed polymers:

The degree of polymerization can only be influenced to a certain extent the concentration of the used nucleic acid. For manufacturer specific dimeric concatemers, as shown in Fig. 2, the manufacturing method was modified as follows:

in equimolar concentrations (50 µm) were denatured for 5 min at 95°C and subsequently slowly cooled for 50 min at 25°C.

- to this mixture, 5'-phosphorylated nucleic acid sequence with

was added to odnomestnom excess

all further steps were performed in accordance with the above-mentioned method.

Fractionation of the purified ligation product in a 3% agarose gel, compare Fig. 2 track 2.

(C) production of high polymers:

Nucleic acid with posledovatelno�'yu

at a concentration of 1 mg/ml were precipitated with 0.3 M sodium acetate (pH 5,25), 10 mm MgCl2and triple the amount of ethanol abs.. After centrifugation (4°C, 13000 rpm) ODN was dried at 50°C for 10 min, the Residue was directly used for ligation (0.5 units/μg ODN) and incubated for 60 min at 37°C. Fractionation of the ligation product in a 3% agarose gel, compare Fig. 2 track 4.

Description Fig. 2:

To determine the molecular weights of the produced molecules were fractionated in 3% agarose gel. Track 1 on the left shows the molecular weight double-stranded DNA by weight of each bar, corresponding to the different distances of migration. On tracks 2 and 4 were caused by various products of polymerization reactions. It is possible to observe only one band corresponding to the dimer (lane 2) relative to the tetramer (track 3) relative to the set of fragments, including all types of polymers (track 4).

Demonstration of the functional properties of the molecules of the invention are:

Various experiments on cell cultures have been performed to demonstrate the existence of immunomodulatory properties of molecules according to the invention. The ability to stimulate TLR9 was examined by using a murine macrophage cell line RAW 264 in which the expression of green fluorescent protein EGFP is under the control� positively regulated under the effect of TLR9, NF-κb promoter. Cells were sown with a density of 125,000 cells/cm2and after 16h dimeric (produced by method (a) and polymer (produced by method (C) molecules of the invention have been applied. After 7 h of incubation (37°C, 5% CO2cells were collected, and was measured by EGFP expression using a cell sorter with activation of fluorescence (FACS). The results were used to plot concentration-effect shown in Fig. 3; as the molecular weight for both groups of molecules weight of the dimer was taken as a basis for direct comparison.

The efficiency of polymer molecules according to the invention is increased by 10 (upper curve with shaded symbols) compared with low-molecular-weight molecules (lower dotted line with unshaded symbols). High molecular weight polymers according to the invention have clearly the best effect used in equivalent quantities, such as a comparable amount of dimeric or Monomeric molecules. Higher efficiency in the stimulation of TLR9 may be due to a locally higher concentration achieved multimeric molecules, which cannot, especially in vivo, to be achieved by using higher doses, for example, for reasons of the applied quantity. At the same time, a high-molecular concatemer exhibit increased efficiency�axis, what is completely unexpected and cannot be explained in accordance with modern knowledge in science.

Stimulation of PBMCs for cytokine production

To perform analysis on the stimulation of mononuclear cells of peripheral blood (PBMC) were isolated from whole human blood or so-called "leukocyte film". The isolated cells (PBMC) were precipitated in multi-well plates. The first mixture contained estimulando cells as a negative control, the second mixture was stimulated by the dimers in comparison with the existing level of technology, the third - tetrameric polymers; the same mass of the dimers relative to the polymers was used in the same volume. Two days later, the ELISA method was revealed secretion of the cytokines interferon-γ, interferon-α and interleukin-6 from cell culture supernatant, compare Fig. 4.

According to Fig. 4 stimulation of PBMCs polymer molecules according to the invention leads to a renewed secretion of interferon compared to the stimulation of dimeric molecules. In addition, the drawing shows that the secretion of IL-6 due to stimulation of polymer molecules is much higher in comparison with the stimulation of the dimers.

It is possible to obtain molecules according to the invention by the use of monomers with the following sequences:

(C) each phosphorylated at the 5'-end of nucleic acid or mixture of nucleic acids having a sequence capable of assuming the conformation as shown in figure 1, fulfilling criteria depicted conformation, and gibridizatsiya with each other via single-stranded protruding parts (sticky ends), at least four of matching nucleotides.

The sequence of deoxyribonucleic acid, is used as the waste product, is not subject to high temperatures prior to ligation and degree of purification, comparable to polyacrylamide gel electrophoresis. The products of excretion can be purified by the method of HPLC with subsequent FPLC. The result of combining HPLC and FPLC is the degree of purification, equivalent to polyacrylamide gel electrophoresis. Subsequently, the DNA products of excretion liofilizat at 50°C until then, until the dry residue. Spend resuspension in buffer and add T4 DNA ligase, followed by incubation at 37°C for 40 minutes. The amazing thing was that concatemer caused enhanced immunomodulation in mice. Strikingly, the combination of the individual components of concatemer according to the invention with chemotherapeutic drugs results in an improved effect. Improved effect is surprisingly higher than that of the individual component�tov and more than additive effect. As a chemotherapeutic drug can be used antibodies, alkylating agents, platinum analogs, intercalating agents, antibiotics, mitosis suppressor, taxanes, topoisomerases suppressors, anti-metabolites and/or L-asparaginase, hydroxyurea, mitotane and/or amanitine.

1. Concatemer molecule to modulate the activity of the immune system of a human or animal, where concatemer molecule contains at least four sequences of deoxyribonucleic acid as Monomeric units that are covalently linked and correspond to the formula:
where
- IN0refers to the number of the natural numbers, and
- A, b, E, G, I, J, K, M, R, T, U, Υ are nucleic acids, and
- "-" denotes fosfodiesterazu communication through which nucleic acids are covalently linked to each other, and
- sequence component i of the nucleic acid compared with the component (i+1) of the same nucleic acid may vary or not to vary, and
- B Ui, K and Yn-i+1_single-stranded, and
- each single-stranded region contains at least one motif with demetilirovanny deoxyribonucleotides CG sequence,
- B Ui, K and Yn-i+1- each collected from at least 4 of deoxyribonucleotides, and
- consisten�Telenesti J ifor In-i+1, Aiin relation to Rn-i+1, Μ relative to G, and, respectively, Ε to Τ are inversely complementary to each other, and
- G are covalently linked by phosphodiester bonds, and
where the monomer units of deoxyribonucleic acid have up to 400 nucleotides.

2. A molecule according to claim 1, characterized in that the monomer units of deoxyribonucleic acid contain the following sequence:

3. Composition for modulating immune system activity, containing an effective amount of a molecule according to claim 1 or 2 and a chemotherapeutic agent selected from the group comprising antibodies, alkylating agents, platinum analogs, intercalating agents, antibiotics, mitosis suppressor, taxanes, topoisomerases suppressors, antimetabolites and/or L-asparaginase, hydroxyurea, mitotane and/or amanitine.

4. A composition according to claim 3, characterized in that the alkylating agent is selected from the group including:
- derivatives of nitrogen mustard gas, in particular
- cyclophosphamide,
- ifosfamide,
trofosfamide,
- melphalan and/or
- chlorambucil,
- alkylsulfonyl, in particular
- busulfan and/or
treosulfan,
- nitrosoanatabine, in particular
- carmustine,
- lomustine,
- nimustine,
- estramustine and/or
- streptozotocin
- p�akrobatin and dacarbazine,
- temozolomide and/or
- thiotepa.

5. A composition according to claim 3, characterized in that the platinum analogs selected from the group including:
- cisplatin,
- carboplatin and/or
- oxaliplatin.

6. A composition according to claim 3, characterized in that the intercalating agents are selected from the group including:
- anthracycline, in particular
- doxorubicin (adriamycin),
- daunorubicin,
- epirubicin and/or
- idarubicin,
- mitoxantrone,
- amsacrine and/or
- doxifluridine.

7. A composition according to claim 3, characterized in that the antibiotic is selected from the group including:
- bleomycin,
- actinomycin D (dactinomycin) and/or
- mitomycin.

8. A composition according to claim 3, characterized in that the suppressor of mitosis selected from the group including:
- Vinca alkaloids, in particular
- vinorelbine,
- vincristine (oncovin),
- vinblastine and/or
- vindesine.

9. A composition according to claim 3, characterized in that the taxanes selected from the group including:
paclitaxel and/or
- docetaxel.

10. A composition according to claim 3, characterized in that the suppressor topoisomerase selected from the group including:
inhibitors of topoisomerase I, in particular
- camptothecin,
- topotecan and/or
- irinotecan, and/or
inhibitors of topoisomerase II, in particular
- etoposide,
- teniposide.

11. A composition according to claim 3, wherein the antimetabolite is selected from the group including:
- �tagonist folic acid, in particular
methotrexate,
- pyrimidine analogs, in particular
- 5-fluorouracil,
- capecitabine,
- the cytosine arabinoside (cytarabine) and/or
- gemcitabine,
- purine analogues, in particular
- 6-thioguanine,
- pentostatin,
- azathioprine,
- 6-mercaptopurine,
- fludarabine and/or
- cladribine.

12. Set for the modulation of immune system activity, containing an effective amount of a molecule according to any one of claims.1 or 2 and/or of a composition according to any one of claims.3-11 and, if necessary, information on the combination of the contents of the set.

13. Pharmaceutical composition for the modulation of immune system activity, containing an effective amount of a molecule according to any one of claims.1 or 2 and/or of a composition according to any one of claims.3-11, if necessary, together with a pharmaceutical acceptable carrier.

14. Pharmaceutical composition according to claim 13, characterized in that the carrier is selected from the group comprising antibodies, alkylating agents, platinum analogs, intercalating agents, antibiotics, mitosis suppressor, taxanes, topoisomerases suppressors, antimetabolites and/or L-asparaginase, hydroxyurea, mitotane and/or amanitine.

15. The use of a molecule according to claims.1 or 2, the composition according to claims.3 to 11 or the pharmaceutical composition according to claims.14 or 15 for the manufacture of tools for the modulation of the immune system of a person or animal or for mod�lation activity specified in the immune system.

16. The use according to claim 15, characterized in that the modulation is an increase in immune system activity, where the activity of individual cells or cell subpopulations of the immune system stimulated or accelerated or inhibited or weakened.

17. The use according to claim 16, characterized in that the modulation includes mediated by T-cells or not dependent on T-cell immune response.

18. The use according to claim 17, characterized by the fact that the immune response comprises proliferation of b-cells and/or activation of b-cells.

19. The use according to claim 18, characterized in that the stimulation of the immune system includes the secretion of cytokines.

20. The use according to claim 15, characterized in that the molecule according to one of claims.1 or 2 and/or composition according to claims.3-11 is used as an adjuvant in therapeutic or prophylactic vaccination.



 

Same patents:

FIELD: biotechnologies.

SUBSTANCE: invention refers to a method of detection of Mycobacterium tuberculosis isolates resistant to pyrazinamide by detection of mutations in pncA gene, associated with evolving resistance to pyrazinamide, by PCR in real time mode using HRM analysis. It involves amplification in a mixture of equal amounts of tested DNA and wild type DNA using primers: Pnc18U: 5'-TACGCTCCGGTGTAGGCAC-3' and Pnc15R: 5'-GAAGCGGCGGACTACCATC-3', formation of heteroduplexes due to simultaneous co-amplification of wild type DNA and test DNA, where the first PCR stage includes concentration equalisation by quantitative PCR using the same pair of primers (Pnc18U/Pnc15R) with calibration curve generation and use of regression equation.

EFFECT: reliable and fast detection of mutations in pncA gene associated with evolving resistance to pyrazinamide, due to high specificity and sensitivity.

1 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to oligopeptides, containing the sequence NLSSAEVVV (SEQ ID NO:6), in which one or two amino acids can be substituted, possessing the inducibility of cytotoxic T-cells, their pharmaceutical compositions and application for the production of anti-cancer vaccines.

EFFECT: obtaining pharmaceutical compositions for the production of anti-cancer vaccines.

20 cl, 6 dwg, 1 tbl, 1 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and represents a method of obtaining useful metabolites with the application of bacteria of the Enterobacteriaceae family, in particular bacteria, belonging to the genus Escherichia, which is modified in such a way that it contains a genetic expression system, including a transcription apparatus, regulated by a protein of the LysR type, and modified in such a way that the self-induced positive regulation of the feedback type in the said system is mediated by a coinducer.

EFFECT: method is suitable for the production of L-amino acids with a branched chain, in particular L-valine, L-isoleucine and L-leucine, higher alcohols and D-pantothenic acid; invention makes it possible to obtain L-amino acids with the high degree of efficiency.

23 cl, 2 dwg, 5 tbl, 6 ex

FIELD: biotechnology.

SUBSTANCE: proposed RNA-aptamer is a 57-unit mixed-type oligonucleotide having the nucleotide sequence GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, where A, G are ribonucleotides, U, C are 2'-desoxy-2'-fluoro-ribonucleotides, has the ability to recognise autoantibodies specific to disseminated sclerosis.

EFFECT: characterised invention binds specifically and highly affine with autoantibodies specific to disseminated sclerosis, and can be used for the diagnostics of disseminated sclerosis.

3 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used to determine a human genotype by polymorphism in matrix metalloproteinase MMP9-1562 C>T (rs3918242) gene. The method is based on the establishment of a melting profile with fluorescence-labelled specific oligonucleotide samples. The method uses an allele-shared pair of primers, fluorescence-labelled allele-specific oligonucleotide samples different for each allele and a general oligonucleotide labelled with a fluorescence extinguisher of the following nucleotide composition: MMP9-1562s CGAAACCAGCCTGGTCAACG; MMP9-1562a TCTGCCTCCCGGGTTCAAGC; MMP9-1562p1 GGCGCACGCCTATAA-FAM; MMP9-1562p2 GGCGCATGCCTATAA-HEX; MMP9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), wherein FAM means the fluorescence extinguisher FAM, HEX means the fluorescence extinguisher HEX, BHQ1 means the dark fluorescence extinguisher attached to 5'-terminal nucleotide. Referring the sample to a homozygote or a heterozygote by the allele is determined by a DNA melting profile shape that is a maximum of the first fluorescence curve derivative.

EFFECT: invention enables providing more reliable and accessible genotyping.

1 dwg

FIELD: biotechnology.

SUBSTANCE: invention provides method of simultaneous (multiplex) amplification and fluorescent marking of DNA of several segments of the genome of mycobacteria of tuberculosis complex (Mycobacterium tuberculosis, M. bovis, M. bovis BCG, M. africanum and M. microti). Then the hybridisation or electrophoretic analysis of the sequences of these segments is carried out. The multiplex PCR is carried out in a single reaction volume with use of specific and adapter primers, the fluorescent substrate embedded into the growing DNA chain during PCR, and genomic DNA as a matrix. The multiplex PCR comprises two consecutive amplification profiles, different in annealing temperatures of specific and adapter primers by not less than 10°C. The invention enables to carry out the analysis of sequences of these genes to identify mutations associated with resistance to anti-tuberculosis preparations.

EFFECT: method according to this invention reduces the number of stages of amplifications to obtain single stranded fluorescent-labelled PCR-products, eliminates the transfer of a DNA-matrix from one reaction volume to another, which increases the stability of the procedure to contamination with PCR-products and reduces significantly the time and complexity of the analysis.

4 dwg, 1 tbl, 1 ex

FIELD: biotechnologies.

SUBSTANCE: invention represents pCFP10-DBD recombinant plasmide consisting of an artificial bacterial operon of a chimeric protein including a promoter region of early promoter of T5 bacteriophage, a chimeric protein gene consisting of a sequence of protein antigene CFP10 from Mycobacterium tuberculosis, which is merged with a sequence of a dextrane-binding domain (DBD) of dextrane sucrase Leuconostoc citreum KM20, and a transcription terminator, a bacterial operon of beta-lactamase and a bacterial initiation section of replication of ColE1 type. Besides, strain Escherichia coli - a producer of CFP10-DBD chimeric protein is presented. The invention describes a method of immobilisation, concentration and cleaning of the obtained protein on cellulose. The invention describes an immunogenic composition containing CFP10-DBD recombinant protein, which is aimed at induction of immunity against tuberculous infection.

EFFECT: invention enlarges the range of devices used for treatment of tuberculosis.

4 cl, 6 dwg, 1 tbl, 4 ex

FIELD: process engineering.

SUBSTANCE: set of invention relates to biology, particularly, to automated purification of biological specimens at extraction of target matters involving the magnetic field application. Magnetic field application element and heater are integrated for up and down movement. Automatic device comprises unit 100 displacing vertically and horizontally to accommodate pipettes 141, 142 for suction and discharge of fluid. Heater 810 heats a particular unit of holes of multihole tray 420, 420' while element 700 for magnetic field application is arranged on support plate 400 including magnet seat 710. Element 700 accommodates magnet 711 at bottom side of said unit of said tray Proposed method exploits above described device.

EFFECT: higher process efficiency.

26 cl, 48 dwg

FIELD: biotechnology.

SUBSTANCE: bionanoconjugate comprises a nano-sized superparamagnetic particle of cobalt ferrite spinel CoxFe3-xO4, where 0.6≤x≤0.98, obtained by mechanochemical synthesis. To isolate the nucleic acid containing oligo- or poly-A/dA sequence the synthetic single stranded oligonucleotide 5'-dGndTm is used, where n=5-30, m=10-35, one portion of which, consisting of guanine nucleotides in the presence of phosphate anions in the solution is specifically associated with the surface of the nanoparticle and the other - consisting of thymine nucleotides is able to enter into hybridisation with oligo- or poly-A/dA nucleotide sequences. For isolation from the solution in the presence of phosphate anions of specific hetero-nucleotide sequence additionally create a molecule of oligonucleotide-adapter containing the sequence of oligo-dAx at the 3'-end, hybridised with thymine nucleotides of a complex 5'-dGndTm, where n=5-30, m=10-35, and a portion at the 5'-end complementary to a specific hetero-nucleotide sequence in the solution.

EFFECT: invention enables to detect effectively and to isolate the single-stranded nucleic acids.

3 cl, 8 dwg, 1 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to field of biotechnology, in particular to methods of obtaining enzyme preparations. Invention deals with thermally stable two-domain laccase of bacterium Streptomyces griseoflavus Ac-993 with alkaline optimum of activity, DNA sequence, coding said enzyme, and method of obtaining enzyme, including cloning enzyme gene in cells of bacterium Escherichia coli, production of enzyme in cells of Escherichia coli, introduction of copper ions in medium for cultivation of recombinant strain in order to form active enzyme, obtaining enzyme preparation by methods of metal chelate chromatography and gel filtration.

EFFECT: invention makes it possible to extend assortment of enzymes such as laccase.

3 cl, 3 dwg

FIELD: medicine.

SUBSTANCE: invention represents an oral anti-enteroviral and immunostimulant agent in the form of capsules containing interferon and additives, differing by the fact that a therapeutic substance is human recombinant interferon alpha-2b immobilised on polyethylene glycol, having a molecular weight of 1.5 kD by a physical method of binding by an accelerated electron flow in a dose of 1.5 Mrad. The ingredients in the agent are taken in a certain ratio.

EFFECT: extending the range of anti-enteroviral agents possessing immunostimulant properties.

6 ex, 10 tbl

FIELD: medicine.

SUBSTANCE: immunomodulatory agent contains 3-O-propionate allobetulenole (19beta,28-epoxy-18alpha-oleanane-3beta-yl and propionate) as an active substance. The immunomodulatory agent stimulates a humoral immune response. The T-cell immune response develops in a delayed-type hypersensitivity test of the immunomodulatory agent of 3-O-propionate allobetulenole (19beta,28-epoxy-18alpha-oleanane-3beta-yl and propionate).

EFFECT: reduced oedema.

1 dwg, 2 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: drops possessing antiviral and immunomodulatory effects characterised by the fact that they represent a 95% ethanol infusion of wild strawberry leaves and fruit specified in: red raspberry fruit, mountain ash fruit, bilberry fruit, blood-red hawthorn fruit, cinnamon rose fruit; 15-25 mg of the substance in 1 ml of the infusion.

EFFECT: drops possess pronounced antiviral and immunomodulatory effects.

15 tbl, 5 ex

FIELD: biotechnology.

SUBSTANCE: increase in biocidal and immunobiological action due to the use of distilled water ionised with silver ions and adding into the composition of succinic, ascorbic, citric acid and aethonium.

EFFECT: increase in biocidal immunobiological properties of the antiseptic-stimulant of Dorogov ASD-2F.

6 ex, 1 tbl

FIELD: medicine.

SUBSTANCE: method includes carrying out complex treatment at the background of diet therapy. Intake of antihelmintic of vegetable origin and immunomodulator is carried out daily with washing down each of them with 200 ml of radon water. Intestinal lavage is performed every second day. On days of performing intestinal lavage, patient takes bath with radon water in the morning before lavage, with performing underwater hydrodynamic massage (UHM) on other days. On days, when intestinal lavage is not performed, sessions of sound therapy are carried out after UHM.

EFFECT: method provides correction of biological age of organism as prevention of premature ageing.

3 cl, 4 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: before Mantoux test with 2 TE PDD-L, Ergoferon preparation is used in the infants infected with tuberculosis mycobacteria with the suspected early period of primary tuberculosis infection and active tuberculosis infection, in a dose of 1 tablet 20-30 minutes before or after a meal, once a day for 45 days.

EFFECT: invention provides the complex preparation of frequently and chronically ill children with an allergic pathology, for Mantoux test with 2 TE PDD-L.

3 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: before Mantoux test with 2 TE PPD-L, general advice for phthisiologist-controlled preparation of the infants are given. That is added with prescribing the immunomodulatory preparation Anaferon for children aged 1 year and older 1 tablet 20-30 minutes before and after meals once a day for 30 days.

EFFECT: invention provides the complex preparation of frequently and chronically ill children for Mantoux test with 2 TE PDD-L.

3 tbl, 2 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology, specifically to immunostimulating compounds and may be used in medicine. An immunostimulating peptide of an amino acid sequence XLYDKGYTSKEQKDCVGI, where N-terminal X is N-acetylalanine, and may be covalently linked to fatty acids, selected from C2-C25, to form PDAG (peptidyl-2,3-diacylglycerides). The resulted compound may be included in pharmaceutical formulations for stimulating an immune response.

EFFECT: invention provides efficient stimulation of an immune response in subjects and may enhance the immunogenicity of the antigenic peptide when administered with PDAG.

29 cl, 10 dwg, 9 ex

FIELD: medicine.

SUBSTANCE: first stage involves a cervical uterine repair by staged dissection on the 5-7th menstruation day in a combination with laser destruction of exophytic condylomas. Laser light power is 6-9 Wt, spot diameter is 1.5 mm, and exophytic condylomas penetration is 1-1.5mm. The second stage involves the immunomodulatory therapy.

EFFECT: method enables increasing the clinical effectiveness by recovering the immunological homeostasis of the uterine cervix by potentiating two effects: recovering archtechtonics of the cervical canal and immunomodulatory therapy.

4 tbl, 2 ex

Fingolimod salts // 2543621

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to new 2-amino-2-[2-(4-C2-20alkylphenyl)ethyl]propan-1,3-diol salts specified in tartrate, lactate benzoate, succinate, malonate, acetate and propionate in the crystalline form. Each of the above salts is characterised by powder X-ray pattern data. Compounds in the therapeutically effective amount can be used in treating autoimmune diseases.

EFFECT: crystalline salts of the present invention possess higher stability, better solubility, more convenient to store and handle.

11 cl, 7 dwg, 1 tbl, 10 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to the field of biotechnology, namely to obtaining oligopeptide compounds, containing a motive, interacting with a proliferating cell nuclear antigen (PCNA) and can be used in medicine. The oligopeptide compound consists of 14-70 amino acids and contains. a PCNA-interacting motive, representing [K/R]-[F/Y/W]-[L/I/V/A]-[L/I/V/A]-[K/R], at least one signal sequence of nuclear localisation and at least one signal sequence of penetration into a cell, with the PCNA-interacting motive being located towards an N-end relative to the signal sequence.

EFFECT: invention makes it possible to carry out the efficient treatment of hyperproliferative disorders by the application of the oligopeptide compound in cyctostatic therapy or in radiotherapy as a sensitising substance.

34 cl, 6 dwg, 4 tbl, 8 ex

Up!