Oligodeoxyribonucleotide inhibitor of human dna-methyltransferase 1

FIELD: biotechnology.

SUBSTANCE: oligodeoxyribonucleotide inhibitor of human DNA-methyltransferase 1 (Dnmt1) is provided, characterized in that it has a self-complementary structure, which forms a double-stranded pin, has an unpaired CA pair in the recognition site of the enzyme of human DNA-methyltransferase 1 and comprises in its composition 5-methylcytosine (5mC) and thiophosphates instead of phosphates.

EFFECT: invention provides selective inhibition of the Dnmt1 enzyme activity in reactions in vitro and in vivo.

3 dwg, 3 ex

 

The invention relates to molecular biology and can be used in medicine. The invention is intended for selective inhibition of the activity of the enzyme DNA methyltransferase 1 (Dnmt1) as in reactions in vitro and in human cells with overexpression of Dnmt1, such as in some types of cancer cells.

Currently known specific inhibitors of Dnmt1 can be divided into two groups: nucleoside and non-nucleoside reverse transcriptase inhibitors [Delpu Y, Cordelier P, Cho WC, Torrisani J. DNA methylationandcancerdiagnosis // Int J MolSci. 2013 Jul 18;14(7):15029-58]. The first group includes modified cytidine analogues, which are embedded in the newly synthesized strand of DNA and/or RNA and covalently bind to the enzyme Dnmt1, resulting in a reduction in the number of active molecules. Typical representatives of this group: 5-Aza-cytidine (Vidaza®), 5-Aza-2'-deoxycytidine (Dacogen®) and 1-(β-D-ribofuranosyl)-2(1H)-pyrimidinone (Tabulary). These three nucleoside was shown to be effective and approved for treatment of acute myeloid leukemia and myelodysplastic syndrome, however they are extremely toxic and have a strong mutagenic effect [Robak T. Newnucleoside-analogsforpatientswithhematologicalmalignancies. ExpertOpin. Investig. Drugs. 2011;20:343-359]. In addition, the mechanism of their effect on the system of DNA methylation can activate prometastatic genes [Chik F., Szyf M. Effectsofspecific DNMT genedepletiononcancercelltransformation-andbreastcacercellinvasion; towardselective DNMT inhibitors. Carcinogenesis. 2011;32:224-232] and the unresolved question of their metabolism in healthy cells.

The group of non-nucleoside more extensive. It includes, for example, flavonoids, hydralazine, derivative of procaine, antisense oligonucleotides, and synthetic oligonucleotides analogues of natural substrates Dnmt1 with greater affinity than natural substrates or irreversibly binding to the enzyme [J. D. Knox, F. D. Araujo, P. Bigey, Slack A. D., Price G. B., and Zannis-Hadjopoulos M., Szyf M. 2000.Inhibition of DNA methyltransferase inhibits DNA replication. J. Biol. Chem. 275, 17986-17990. Stewart D. J., Donehower, R. C., E. A. Eisenhauer, N. Wainman, A. K. Shah, C. Bonfils, A. R. MacLeod, J. M. Besterman, Reid G. K. 2003. A phase I pharmacokinetic and pharmacodynamic study of the DNA methyltransferase 1 inhibitor MG98 administered twice weekly. Ann. Oncol. 14, 766-774. Flynn J., Fang J. Y., J. A. Mikovits, N. O. Reich 2003. A potent cell-active allosteric inhibitor of murine DNA cytosine C5 methyltransferase.J. Biol. Chem. 278, 8238-8243]. These inhibitors have different mechanisms of action, but one thing in common - the lack of a stage to be built into the DNA, and therefore, significantly reduced the toxic and mutagenic effects, which makes them, along with good inhibitory properties, promising for therapy of the brain.

Known inhibitor-analogue Modulators of DNA cytosine-5 methyltransferase and methods for use thereof" (U.S. patent for the invention №7138384 (B1), IPC AC 38/00, publ. 21.11.2006) having a double-stranded structure, containing in its composition methylcytosine. The length and sequence of the decree�tion known patented structures and the proposed application for the invention have significant differences.

The use of this inhibitor to inhibit the activity of DNA methyltransferase 1 is possible, but the efficiency of this process is significantly lower than when using our proposed inhibitor. These drawbacks relate to the fact that there is only one modification site enzyme recognition, and there is no protection Sharafutdinova frame from the action of nucleases in the cell.

Another known inhibitor-analog "OLIGONUCLEOTIDE INHIBITORS OF DNA METHYLTRANSFERASES AND THEIR USE IN TREATING DISEASES" (international application No. WO2014011573 (A2), IPC AC 38/55, publ. 16.01.2014 G.), representing semicomplementary oligonucleotide that forms a hairpin having a site of recognition of CpG methyltransferase and methylcytosine in the website of recognition and protection Sharafutdinova frame from the action of nucleases in the cell.

However, in the international application in the structure of the oligonucleotide used cytidine analogues: azacytidine and zebulin, and the length and sequence of these structures differ significantly from those offered by the authors of the present application. The application of these inhibitors to inhibit the activity of DNA methyltransferase 1 is possible, but the efficiency of this process is significantly lower than when using the proposed in the present application of the inhibitor.

The closest analogue to the claimed object of the invention is the selective inhibition tion�PR GC-boxmet [J. Flynn, Fang J. Y., J. A. Mikovits, N. O. Reich 2003.A potent cell-active allosteric inhibitor of murine DNA cytosine C5 methyltransferase. J. Biol. Chem. 278, 8238-8243] (prototype). It is oligodeoxyribonucleotide the structure 5'-CTGGATCCTTGCCC(5mC)GCCCCTTGAATTCCC-3' and showed good inhibitory potential of murine Dnmt1 and bacterial DNA SssI. The disadvantages of the prototype include:

1. Single-stranded structure less affinity than double-stranded DNA.

2. High bioavailability for Exo - and endonucleases restriction.

3. Relatively low inhibitory activity against human Dnmt1.

The technical result of the invention is to obtain a higher inhibiting activity oligodeoxyribonucleotides inhibitor by increasing the affinity for human Dnmt1 and modifying it to give resistance to endo - and ectonucleotide in living cells.

Said technical result is achieved by obtaining oligodeoxyribonucleotides inhibitor of DNA methyltransferase 1, characterized in that it has a structure semicomplete(5'→3'):

5'GAATGGATCCGCTCTAACTGCCCCCAGTTAGAG(5mC)AGATCCATTC3', which forms a double-stranded hairpin, is unpaired SA couple in the website recognizing enzyme DNA methyltransferase 1 person 5'-CG-3/3'-A(5mC)-5' and contains thiophosphate instead of phosphates, where 5mC-5-methylcytosine (to increase creds�VA to the enzyme and protect against nuclease activity in a living cell).

Defining the distinctive features of the present invention in comparison with the prototype are:

1. Education semicomplete double-stranded hairpins.

2. The presence of unpaired With:A pair at the site of recognition of the Dnmt1 enzyme 5'-CG-3/3'-A(5mC)-5'

3. Replace all of the phosphates on thiophosphate.

The above distinctive features help to increase inhibitory activity oligodeoxyribonucleotides inhibitor by increasing the affinity for human Dnmt1 and modifying it to give resistance to endo - and ectonucleotide in living cells.

The invention is illustrated by the following graphic materials. Fig. 1 presents the nucleotide sequence of oligodeoxyribonucleotides inhibitor of DNA methyltransferase 1, forming a double-stranded hairpin. Fig. 2 shows the dependence of the activity of the enzyme Dnmt1 (A) on the concentration of the inventive inhibitor (I). Fig. 3 shows the dependence of the number of living HeLa cells (Fig. 3, a), CaSki (Fig.3, b) and L-68 (Fig. 3) on the concentration of the inventive inhibitor.

Example 1. Synthesis oligodeoxyribonucleotides inhibitor. Oligonucleotide inhibitor was synthesized standard aminophosphines method on an automated synthesizer using phosphoramidites firm "Glen Research (USA) [Beaucage S. L., and Caruthers, M. N. Deoxynucleoside phosphoramidites - A new class of key solution intermediates for deoxypolynuleotide synthesis. Tetrahedron Lett.,22, 1859-1862, (1981)]. Then there was the reaction of oxidation of phosphates to phosphothioate using the Beaucage reagent ("Glen Research, USA) as sulfonating agent [R. P. Iyer, W. Egan, Regan J. W., Beaucage S. L. 3H-l,2-Benzodithiole-3-one 1,1-dioxide as an improved sulfurizing reagent in the solid-phase synthesis of oligodeoxyribonucleoside phosphorothioates // J. Am. Chem. Soc. 1990. 112. №3. 1253-1254]. The final purification was performed using HPLC. The concentration of oligonucleotide was determined spectrophotometrically, the molar extinction coefficient was calculated based on the nucleotide sequence. Hairpin DNA structures were obtained by annealing oligonucleotide with increasing temperature up to 85°C and a gradual decrease to +25°C. the Hairpin is formed because of the characteristics of the sequence of the oligonucleotide, different parts of which have a great affinity for each other. Received oligodeoxyribonucleotides inhibitor of DNA methyltransferase has the nucleotide sequence (see Annex), forming a double-stranded hairpin.

Example 2. Inhibition of Dnmtl in vitro. Methylation reactions of DNA was performed at 37°C. the Reaction mixture contained 50 mmtris-HCl, pH 7.8, 1 mMEDTA, 1 mm DTT, 5% glycerol and 0.1 mg/ml BSA. The concentration of the enzyme Dnmt1 person, AdoMet, DNA substrate ((insisterade polymer poly(dI-dC)•poly(dI-dC) length 1755 BP (GE Healthcare, UK)) and oligonucleotide inhibitor were 0.05 and E../ál (~ 10-9M), 0 μm, 1 μm (in terms of sites), and 1 µm, respectively. The reaction was started by adding a solution of Dnmt1 to the mixture of radioactively labeled with tritium [3H-CH3]AdoMet (GE Healthcare, UK) and DNA substrate (with or without inhibitor) to a final volume of 20 µl. Mix the solutions were pre-heated to 37°C. the reaction Time was 3 h. aliquots of the reaction mixtures with a volume of 18 μl were applied to the disks anyone-exchange filters DE-81 (“Whatman, UK). Filters were washed three times with a solution of 0.02 M NH4HCO3twice with water and once with 75% ethanol, after which the filters were dried and counted them3H-radioactivity in the toluene scintillator counter Mark III (“SearleAnalytic, USA).

A preliminary assessment of substrate and inhibitor properties were carried out on the basis of comparison of the degrees of methylation by the DNA methyltransferase Dnmt1 substrate poly(dI-dC)•poly(dI-dC) (D), synthetic oligonucleotide inhibitor (B) and mixtures thereof with the substrate (C). The percentage of inhibition of methylation reactions of poly(dIdC)•poly(dIdC) in the mixtures was calculated as follows: 100% × (1 - (C - B) / D). According to the activity of Dnmt1 (A) concentration of inhibitor (I) shown in Fig. 2, were analyzed using software for nonlinear regression analysis Origin 8.0 (“OriginLab”) by calculating the 50% inhibitory concentration (IC50) according to the standard terms�Oia: A = A max/ (1 + ([I] / IC50)n), where n is the hill coefficient.

The experiment showed that the inhibitor is not affected by the methylation and causes 82% inhibition of the reaction under these conditions. The calculated value of IC50was 144±7 nm.

Example 3. Inhibition of Dnmt1 in vivo. To assess cytotoxic activity oligodeoxyribonucleotides inhibitor used following standard methodology. The monolayer cell culture L-68, HeLa and CaSki were grown in the wells of flat-bottomed 96-well plates. After replacing the medium with a fresh without bovine serum and antibiotics in culture medium was added to serial dilutions of the investigated inhibitor or a control oligonucleotide without the inhibitory effects mixed with transfairusa agent (Lipofectamine 2000 (Invitrogen, USA) in selected proportions. After incubation for 4 hours, the medium was changed to growth with serum and were cultured for 24 hours. After that, the medium was removed, and the monolayers were stained vital dye neutral red, which is included only in viable cells and does not stain dead. After removal of the dye and washing, wells were added lysing buffer. The amount of dye adsorbed living cell monolayer was measured spectrophotometrically according to the intensity of absorption at a wavelength of 540 nm. As controls used�isovale plate wells, which was added the control oligonucleotide, and the wells without inhibitor, but with added Lipofectamine'ohms. The findings were calculated using a tablet Emax spectrophotometer (MolecularDevices, USA). 50% toxic concentration (TC50) drugs were calculated using the software Origin 8.0 (“OriginLab”) according to the formula is the same as for IC50. Statistical processing of obtained results was done by conventional methods.

Fig. 3 shows the dependence of the number of living HeLa cells (Fig. 3A), CaSki (Fig. 3b) and L-68 (Fig. 3b) on the concentration of the inhibitor. The obtained values of TC50was 236±10 nm for HeLa cells, 118±3 nm for CaSki cells and > 10000 nm for cells L-68. Half toxic concentration for controls was 4 and >50 μm for Lipofectamin'and a control oligonucleotide, respectively.

Oligodeoxyribonucleotides inhibitor of DNA methyltransferase 1, characterized in that it has semicomplete structure (5'→3'):
5'GAATGGATCCGCTCTAACTGCCCCCAGTTAGAG(5mC)AGATCCATTC3', which forms a double-stranded hairpin, is unpaired SA couple in the website recognizing enzyme DNA methyltransferase 1 person 5'-CG-3/3'-A(5mC)-5' and contains thiophosphate instead of phosphates, where 5mC - 5-methylcytosine.



 

Same patents:

FIELD: biotechnologies.

SUBSTANCE: invention offers method of printing biological ligands in the form of oligosaccharides and/or polysaccharides, and/or peptides, and/or glycopeptides, and/or biotin. A layer of hydrophobic non-volatile fluid not mixing with biological ligand solvent and having lower specific weight than biological ligand solution is applied in advance onto a substrate. Then biological ligands are printed by contact-free method. Vaseline, mineral oil or higher saturated hydrocarbons or mix thereof are used as hydrophobic non-volatile fluid. Preferable thickness of hydrophobic nonvolatile fluid layer is 50-200 mcm.

EFFECT: more level drying of biological ligand solution drops on substrate along with protection of biological ligands against early hydrolysis and improvement of spot morphology.

3 cl, 2 dwg, 3 ex

FIELD: chemistry.

SUBSTANCE: group of inventions relates to a target-discriminating probe (TD-probe), method of its constructing and methods of detecting a nucleic acid target-sequence with its application. The TD-probe is hybridised with the nucleic acid target-sequence both via a 5'-terminal second site of hybridisation and a 3'-terminal first site of hybridisation. When the TD-probe is hybridised with the nucleic acid sequence which is not a target, then the 5'-terminal second site of hybridisation and a separating site both are not hybridised with the nucleic acid sequence, which is not a target, in such a way that both the sites form a single chain as a result of a low value of its Ts.

EFFECT: claimed inventions make it possible to increase the specificity of hybridisation and can be used in the area of clinical diagnostics and genetic research.

39 cl, 14 dwg, 9 ex

FIELD: chemistry.

SUBSTANCE: method of purifying G-rich oligodeoxyribonucleotides with size of 20-50 bases from silicic acid derivative impurities comprises the following consecutive steps: using oligodeoxyribonucleotides synthesised on controlled pore glass (CPG), where the last dimethoxytrityl protection is not removed; preparing an oligodeoxyribonucleotide solution by mixing 300 mcl of oligodeoxyribonucleotide with concentration of 0.5 mcm/ml with 25 ml of water and 0.5 ml of 2.0 M solution of an ion-pair reagent of triethylammonium acetate, hereinafter TEAA; the solutions are deposited on Glen Research Poly-Pak Cartridges, 60-1100-10, which contain a polymer carrier having dimethoxytrityl affinity; 50 ml Millipore, Plastic syringes, XX1105005, without plungers are connected to the cartridges; the cartridges with syringes are connected to a vacuum manifold CHROMBOND 730151; a 50 kPa vacuum is formed using a water-jet pump; the cartridges are washed with 2 ml aqueous solution of ammonia and TEAA of the following composition; 1/40 volume of 2.0 M TEAA solution is added to 20-fold diluted 25% ammonia solution; the cartridges are washed with 2 ml of water, 2 ml of 2% aqueous trifluoroacetic acid solution and 4 ml deionised water; the purified oligodeoxyribonucleotide is removed from the cartridges by washing the cartridges with 2 ml of a mixture of 95% ethyl alcohol with 25% ammonia solution; the purified oligodeoxyribonucleotide is separated from the solution by placing a test-tube with the solution of purified oligodeoxyribonucleotide into a concentrator, evaporating the solution for 10 hours at temperature of 60°C.

EFFECT: efficient method of purifying oligodeoxyribonucleotides with high output and high degree of purification from silicic acid derivatives suitable for large-scale synthesis.

3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology, specifically to a reagent for preventing at least one false start in polymerase chain reaction (PCR) amplification, a method of preventing at least one false start in PCR amplification and sets which include said reagent. The reagent is used in PCR which is carried out in the presence of 1.25 units of thermally stable DNA polymerase per 25 mcl of the reaction mixture with concentration of not more than 650 nM. The reagent is a non-extending DNA polymerase oligonucleotide, having a barrel-loop structure and is not a hybridisation probe for said amplified DNA product. The barrel has a length greater than six nucleotides, is stabilised at the end far from the loop by non-fluorescent substances selected from: fluorescence extinguisher and a nucleotide analogue which facilitates a tighter connection between oligonucleotides in the barrel than a DNA-DNA hybrid. The melting point of the barrel (Tm) is below 94°C. The loop is an oligonucleotide and/or carbon linker.

EFFECT: invention enables to prevent false start (unintentional hybridisation) in amplifications and analyses using PCR.

20 cl, 25 dwg, 3 tbl, 14 ex

FIELD: chemistry.

SUBSTANCE: invention relates to field of biotechnology, namely to method and set for determining presence or absence of mutation in gene PIK3CA. Method includes mixing sample of nucleic acid, which contains at least fragment of gene P1K3CA, containing at least one mutation, selected from E542K, E545K, H1047R and H1047L, with polynucleotide primer, which consists of SEQ ID NO:5, SEQ ID NO:14, SEQ ID NO:21 or SEQ ID NO:28, where mixture also contains second primer, and second primer corresponds to area of fragment of sequence PIK3CA, located lower than area, which is complementary to polynucleotide, and carrying out PCR of the mixture. Hybridisation of polynucleotide with sample of nucleic acid is detected, where hybridisation indicates presence of mutation. Set includes at least two primers, where first primer consists of SEQ ID NO:5, SEQ ID NO:14, SEQ ID NO:21 or SEQ ID NO:28, and second primer corresponds to area of fragment of sequence PIK3CA, located lower than area, which is complementary to polynucleotide.

EFFECT: claimed invention makes it possible to efficiently detect mutations in fragments of gene PIK3CA, which includes at least one mutation, selected from E542K, E545K, H1047R and H1047L.

4 cl, 1 dwg, 4 tbl, 4 ex

FIELD: chemistry.

SUBSTANCE: flexible monomer contains a skeleton monomer unit of an oligonucleotide or an oligonucleotide analogue which can be linked to two cyclic ring systems by an alkylenediol and a linker. The ring systems are linked to each other by a conjugator. The flexible monomer can be adapted for incorporation into an oligonucleotide. The method of producing the oligonucleotide involves embedding the flexible monomer during oligonucleotide synthesis, said flexible monomer increasing base-stacking and being adapted for incorporation into the oligonucleotide. The oligonucleotide may contain one or more flexible monomers which increase base-stacking.

EFFECT: increasing base-stacking.

12 cl, 6 dwg, 4 tbl, 10 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, particularly a polypeptide and its homodimer which possess agonist activity with respect to a growth hormone receptor, a nucleic acid molecule coding them, a vector which involves said nucleic acid, a cell of expression of said polypeptide, a pharmaceutical composition and a method with the use of said polypeptides for treating growth hormone deficiency. The polypeptide has an amino acid sequence presented in SEQ ID NO: 11 or 12. The homodimer consists of two polypeptides consisting of SEQ ID NO: 11 or 12. The nucleic acid molecule consists of a nucleic acid sequence presented in SEQ ID NO: 4. The pharmaceutical composition to be used in treating growth hormone deficiency contains said polypeptide or homodimer and an excipient or a carrier. The method of treating growth hormone deficiency involves introducing an effective amount of said polypeptide or homodimer.

EFFECT: invention provides creating the polypeptide which possess agonist activity on growth hormone receptor, and it is effective in treating growth hormone deficiency.

17 cl, 9 dwg, 1 tbl, 1 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biological chemistry and can be used to determine compounds bound with a biological target. A compound which contains a functional component and a coding oligonucleotide is synthesised. The synthesis method involves binding an additional structure fragment to the starting functional component and enzyme doping of the starting oligonucleotide with an additional oligonucleotide. The oligonucleotide is double-stranded, is bound with the functional component by each of its chains and defines its structure. This synthesis method is employed in the method of producing a library of compounds, wherein the structure of the functional component is defined by the coding oligonucleotide. The library of compounds is used in the method of searching for compounds bound with a biological target.

EFFECT: invention widens the range of chemical reactions used to build molecules in the presence of a chemically non-modified oligonucleotide label, with high accuracy of introducing oligonucleotide labels into chemical structures and obtain libraries containing multiple copies of each member.

118 cl, 14 dwg, 7 tbl, 10 ex

FIELD: medicine.

SUBSTANCE: invention refers to a method for estimating clinical effectiveness of human bladder cancer by real-time PCR and to a kit for implementation thereof. The presented invention may be used in medicine. The method involves patient's urine and blood sampling. RNA is recovered, cDNA is synthesised on an RNA matrix. The cDNA ATP6V1C1 concentration is rated in a reference gene. It is followed by quantitative PCR amplification of an ATP6V1C1 gene fragment. The clinical effectiveness is estimated by quantification of the amplified fragment of cDNA ATP6V1C1 for a sampled biomaterial; the clinical effectiveness is shown by decrease of the post-therapeutic urine and/or blood mRNA level of the ATP6V1C1 gene in 3 times and more as compared to the pre-therapeutic urine and/or blood mRNA level. A kit to be used in the method for estimating the clinical effectiveness of bladder cancer by real-time PCR includes primers with the sequence SEQ ID NO: 1 and 2 with molar ratio 1:1.

EFFECT: invention enables high-reliability diagnosing of bladder cancer, including at the early stage of progressing neoplastic aberration.

2 cl, 4 dwg, 4 tbl, 5 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention described immunomodulatory compounds of oligonucleotides individually providing unique profiles of cytokines and chemokines by relation as TLR agonists. The TLP9 agonists aim at modulation of immune responses mediated by Toll-like receptor (TLR). There are also described a composition containing an immunomodulatory compound and a physiologically acceptable carrier and enables producing an immune response in a patient, a method for producing the immune response in the patient with the use of the immunomodulatory compound, methods of therapeutic and preventive treatment in the patient in need of modulation of the immune response, particularly in cancer, autoimmune and inflammatory disorders, an infectious disease, allergy, asthma and other diseases. The immunomodulatory compounds may be used in a combination with other therapeutic agents and chemotherapeutic compounds used in specific diseases or disorders.

EFFECT: compounds under the invention create such specific modulations of the immune response different from modulations created by non-methylated dinucleotides CpG.

9 cl, 35 dwg, 2 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: method involves administering intravenously a suspension of allogenic mesenchymal stem cells at 1.5×106 per 100 g of the animal's body weight in a physiological solution 2 ml. Animals' mortality has made 27% in the primary group, and 94% in the reference group.

EFFECT: method of treating infectious peritonitis experimentally opens up new possibilities for using the cell techniques for reducing the rate of patient's death caused by peritonitis.

11 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: invention relates to the field of biotechnology, in particular to the lentiviral delivery of apoptin into tumour cells, and can be used in medicine. The method includes obtaining a lentiviral construct, expressing modified apoptin, fused with a sectretory signal of lactotransferrin and a transduction signal (ST-CTP-apoptin), with the further obtaining of recombinant lentiviral particles, defective by replication and carrying the modified apoptin, which are later introduced into T-lymphocytes (TILs), obtained in the surgical ablation of the tumour or in the process of obtaining a biopsy, possessing the ability to penetrate into tumour cells. After that, obtained TILs are autotransplanted to the said patient.

EFFECT: invention makes it possible to increase the ability of apoptin to penetrate into tumour cells and produce an oncolytic effect with respect to all the tumour cells.

2 dwg, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to the field of biotechnology, namely to obtaining oligopeptide compounds, containing a motive, interacting with a proliferating cell nuclear antigen (PCNA) and can be used in medicine. The oligopeptide compound consists of 14-70 amino acids and contains. a PCNA-interacting motive, representing [K/R]-[F/Y/W]-[L/I/V/A]-[L/I/V/A]-[K/R], at least one signal sequence of nuclear localisation and at least one signal sequence of penetration into a cell, with the PCNA-interacting motive being located towards an N-end relative to the signal sequence.

EFFECT: invention makes it possible to carry out the efficient treatment of hyperproliferative disorders by the application of the oligopeptide compound in cyctostatic therapy or in radiotherapy as a sensitising substance.

34 cl, 6 dwg, 4 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: claimed invention relates to the field of biotechnology, namely to the preliminary estimation of the efficiency of the autologic cell material transplantation to stimulate the growth of blood vessels, and can be applied in medicine. Claimed is a method of the complex estimation of the angiogenic potential of progenitor cells in patients with cardiovascular diseases, tested on mesenchymal stromal cells of the adipose tissue (MSC-AT) of patients with ischemic heart disease and including the measurement of content of mRNA and proteins of basic angiogenic factors, produced by the progenitor cells such as the vascular endothelial growth factor (VEGF), the placental growth factor (PIGF), the hepatocyte growth factor (HGF), angiopoetin-1 and angiogenin, the angiogenic activity of total cell secretion products, as well as the estimation of the ability of the progenitor cells to stimulate the vascularisation of subcutaneous Matrigel implants, introduced to immunodeficient mice. As the screening method used is a simpler and more available but less informative method of express-assessment of the angiogenic properties of the progenitor cells, based on the measurement of the angiogenic activity of the total cell secretion products.

EFFECT: invention makes it possible to carry out testing of the autologic cell material obtained from the patients, including those with ischemic heart disease, before transplantation in order to choose the optimal tactics of cell therapy aimed at the stimulation of the growth of blood vessels.

2 cl, 2 dwg, 4 tbl, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to chemical-pharmaceutical industry and represents a method for reducing extracellular matrix producing cells in lungs or suppressing an increase of the extracellular matrix producing cells in lungs, involving administering into an individual a composition containing (i) a carrier containing retinoid as a targeting agent, and (ii) a pro-drug specified in a group consisting of siRNA, RNA enzyme, anti-sense nucleic acid and DNA/RNA chimeric polynucleotide, which is targeted on HSP47, and vectors expressing said siRNA, RNA enzyme, anti-sense nucleic acid and/or DNA/RNA chimeric polynucleotide.

EFFECT: invention provides using retinoic acid as a targeting agent for the drug delivery to the extracellular matrix producing cells in the lungs.

8 cl, 6 dwg, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, specifically to compositions for inducing angiogenesis in tissues, and can be used in medicine. The method provides transforming the strain E. coli TOP10 by the pCMV-VEGF165 plasmid, culturing the strain in an environment acceptable for the biomass collection followed by separating the superhelical pCMV-VEGF165 plasmid that is followed by the pCMV-VEGF165 plasmid lyophilisation, which is conducted in the necessary presence in the lyophilised solution of a cryoprotectant, a pH stabiliser, an antioxidant and other substances enabling producing normal saline for injections with the pure plasmid concentration of 0.1 to 10 mg/ml and pH 7.0 to 9.0 and providing t the superhelical form of the pCMV-VEGF165 plasmid storage retention. The method of treating an individual's tissue and/or organ ischemia consists in administering an effective amount of the prepared pharmaceutical composition intramuscularly into the individual.

EFFECT: invention enables preparing the therapeutically applicable pharmaceutical composition of the pCMV-VEGF165 plasmid DNA with preserving properties of the main substance at long-term storage at +2-+8°C.

3 cl, 2 dwg, 4 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, in particular to tumour-specific promoters, and can be used in the anti-cancer therapy. There are constructed the broad-spectrum tumour-specific promoters providing the therapeutic gene expression inside a cancer cell. The invention also involves expression cassettes, expression vectors, pharmaceutical compositions, methods of treating cancer and using the expression cassettes and vectors.

EFFECT: promoters of the present invention provide a high expression level of the operatively linked therapeutic gene in the cancer cells of different origin, wherein the normal cell expression is absent or low.

29 cl, 19 dwg, 4 tbl, 20 ex

FIELD: chemistry.

SUBSTANCE: claimed invention relates to biotechnology and represents molecular conjugates, capable of binding with nucleic acids (DNA or RNA) for their delivery into cells of mammals, expressing transferring receptors. The said molecular conjugates consist of a polycationic sequence, represented by a modified signal of nuclear localisation of the virus SV40 T-antigen, and a ligand. One of two sequences HAIYPRH or THRPPMWSPVWP is used as ligands of cell receptors. Complexes of the molecular conjugate and nucleic acid are used for obtaining medications for genetic therapy or diagnostics of various diseases. To obtain the said complexes solutions of nucleic acid and the molecular conjugate are poured together with a ratio of charges in the reaction medium from 1:0.63 and lower and used for complex formation of solutions with ionic power less than 300 mM.

EFFECT: claimed invention makes it possible to increase the efficiency of delivering genetic constructions into cells.

12 cl, 8 dwg, 1 tbl, 1 ex

FIELD: biotechnology.

SUBSTANCE: method comprises scaling of diploid cells of line M-20 from cryobank of Institute of Poliomyelitis and Viral Encephalitis n.a. MP Chumakov of RAMS from the ampoule of the seed cell bank of 7 passage with obtaining the working cell bank of 16 passage. At that the cells of 20-33 passages, suitable for use in therapeutic and/or diagnostic purposes are produced by culturing in a nutrient medium containing 10% of human fibrinolytic active plasma (FAP), comprising platelet-derived growth factor PDGF in a concentration of from 155 to 342 pg/ml.

EFFECT: invention enables to increase proliferative activity of human fibroblast diploid cells.

2 cl, 2 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to molecular biology and genetic engineering. What is presented is a RNAi molecule for suppressing the thymidilate synthase expression by the action of RNAi, containing a double-stranded RNA domain consisting of a sense chain consisting of a nucleotide sequence presented by SEQ ID NO: 1 hybridised with an anti-sense chain hybridized in the demanding conditions with the sense chain.

EFFECT: molecule can substantially potentiate the antineoplastic action of 5-FU-antineoplastic agent for which reason it can be used in medicine as a part of the antineoplastic therapy.

15 cl, 2 dwg, 3 ex

FIELD: biotechnology, veterinary science.

SUBSTANCE: invention relates to therapeutic vector used in therapy of infectious diseases in cats that comprises at least one foreign nucleic acid each of that (a) encodes protein taken among the group consisting of feline protein CD28 represented in SEQ ID NO:8 or its immunogenic moiety; feline protein CD80 represented in SEQ ID NO:2 or 3, or its immunogenic moiety; feline protein CD86 represented in SEQ ID NO:6 or its immunogenic moiety, or feline protein CTLA-4 represented in SEQ ID NO:10 or its immunogenic moiety; and (b) nucleic acid that is able to be expressed in insertion of vector in the corresponding host. Indicated therapeutic vector is used in effective dose as component of vaccine against infectious diseases in cats for their immunization and in methods for enhancement or inhibition of immune response in cats and reducing or eradication of tumor in cats. Invention provides stimulating the activation and proliferation of T cells and to enhance effectiveness of control of infectious diseases in cats.

EFFECT: valuable biological properties of recombinant virus.

41 cl, 13 dwg

Up!