Method of predicting development of terminal stage in patients with chronic myeloleukaemia

FIELD: medicine.

SUBSTANCE: invention relates to medicine, namely to method of predicting development of terminal stages in patients with chronic myeloleukaemia. Essence of method consists in the fact that activity of two degydrogenases - glycerol-3-phosphatedehydrogenase (G3PDH) and lactatedehydrogenases (LDG) is determined in lymphocytes of peripheral blood of chronic leukaemia patients in open stage. In case of combination of G3PDH in the range from 0 to 0.02 mcE and activity of LDG in the range from 0.04 to 5.02 mcE development of terminal stage is predicted.

EFFECT: application of claimed invention makes it possible to diagnose progress of disease, correct plan and tactics of treating given category of patients and improve results of their rehabilitation in due time.

 

The invention relates to medicine, namely to Hematology and Oncology, and can be used in the diagnosis of patients with chronic leukemia

Today, the share of chronic leukemia the incidence of hematological malignancies is increasing steadily. Among this category of patients most of are patients with chronic myeloid leukemia. Relatively benign tumor in advanced stage of the disease at some unpredictable stage turns into a tumor poliklonovuû, malignant, and the process enters the terminal stage. The appearance of the terminal stage is accompanied by a blastic crisis and rebirth in acute leukemia or other conditions, and refractory to chemotherapy and is ultimately a poor prognosis in patients with chronic leukemia.

The known method of differential diagnosis of the expanded and terminal stages of chronic leukemia, comprising determining the content of free and bound water in the blood plasma of the patient [1]. If the value of the hydration factor of the plasma is less than 6.75 to diagnose a deployed stage, and a value of the coefficient that is greater than the 6.75 - terminal stage of chronic leukemia. The known method does not take into account the peculiarities of cellular reactions and mechanisms in the development of cancer, especially �gunning antitumor immunity, what is important in the progression of hematological malignancy.

As a prototype adopted a method of predicting the course of chronic leukemia by allocating from venous blood lymphocytes [2, 3, 4]. The method includes the implementation of the reaction of the natural cytotoxicity of lymphocytes against target cells K-562 stage deployed the clinical manifestations and determination of the percentage of specific lysis of target cells. When you save it within the parameters of natural cytotoxicity ratios for the respective cells-effectors and target cells, which is characteristic for this stage of the disease, predict a favorable course of the disease, and at significantly reduced - an unfavorable course (end-stage). The known method is time-consuming, does not take into account spare capacity stimulated lymphocytes.

The object of the invention is the creation of informative method of predicting the development of end-stage patients with chronic myeloid leukemia.

The task is achieved by the fact that patients in the advanced stages of chronic myeloid leukemia in peripheral blood lymphocytes determine the activity of the two dehydrogenases - glycerol-3-phosphate dehydrogenase (GPDH) and lactate dehydrogenase (LDH). When combined activity GFDG in the range from 0 to 0.02 MKE and LDH activity in the range of from 0.04 to 5,02 MKE Bo�, predict the development of intelligent terminal stage.

The threshold values of activity GPDH and LDH obtained empirically based on the comparison of the activity values of the studied dehydrogenases and data for the development of the terminal phase in patients with chronic myelogenous leukemia received during subsequent monitoring of the clinical condition of patients in the advanced stage of the disease. End-stage diagnosed by the development of blast crisis.

The development of chronic leukemia is a complex process reflecting the interaction of the body with the tumor. Currently there is no doubt the fact that the earliest signs of violations should be sought at the cell level, where begins the formation of the response to oncovista. Cells exercising antitumor immunological surveillance are the lymphocytes. Changes in intracellular metabolism lead to dysfunction of cells and insolvency antitumor protection body in General. The most informative indicators of the intracellular metabolism are dehydrogenase. This allows you to use them as indicators of metabolic status of lymphocytes in patients with chronic leukemia in predicting the terminal stage.

Glycerol-3-phosphatedehydrogenase (GFDG) characterizes the intensity of the transfer of products whether�LiDE catabolism on the redox reaction of glycolysis. The reduction of this reaction leads to inhibition of glycolysis in the cell.

Lactate dehydrogenase (LDH) characterizes the intensity of glycolysis and the concentration of intermediation for the tricarboxylic acid cycle, responsible for the energy processes in the cell.

The method is as follows.

In a patient with a diagnosis of extensive stage chronic myeloid leukemia" take venous blood from the cubital vein free current in heparinized tubes. Isolated lymphocytes by centrifugation on a density gradient ficoll-verografin according to the standard procedure A. Boyum. Calculate the concentration of lymphocytes, for example in the camera Goryaeva. The purity of the output of lymphocytes should be at least 97%. Use 1 million cells to determine the activity GPDH and LDH one of the known methods, such as bioluminescence [5]. For this purpose a suspension of the selected lymphocytes containing cells at a concentration of 1.0 million/ml, destroy by osmotic lysis with the addition of distilled water (1:5 by volume) and 1.0 to 2.0 mm dithiothreitol. Then determine the activity of dehydrogenases. For this, 150 μl of the incubation mixture containing the appropriate substrate and cofactor, make a 50 µl suspension of destroyed cells. Specific concentrations of substrates and cofactors, as well as pH of the medium to define fer�clients, presented in the table.

After incubation of the studied samples at 37°C for 30 minutes to 200 μl of the incubation mixture is added 50 μl of flavinmononukleochida (FMN) in a concentration of 1.5×1015M, 50 µl of 0.0005% myristic aldehyde, and 10 ál of enzyme systems NADPH:FMN oxidoreductase-luciferase (all reagents bioluminescent system is diluted in 0.1 M K+, Na+-phosphate buffer with pH 7.0). After mixing bioluminescent reagents and incubation of the sample with bioluminescence, for example the brand "BLM-M", measure the illumination. Given that the cells have a certain number of substrates for different metabolic reactions, including those catalyzed by the studied enzymes, define the parameters, conventionally called "substrate background of enzymes". Definition carried out under the same conditions as for the above dehydrogenases, but in the incubation mixture instead of the corresponding substrate contribute the buffer. In the measurement result of the illumination on bioluminescence get the relative activity values of the studied enzymes. To obtain the absolute value of the activity build a graph of the intensity of bioluminescence from NADPH concentration (calibration curve). To do this, 200 µl of a standard solution of NADPH in the range of 10-9-10-4M EIT�Yat in the cuvette bioluminescence, containing FMN, ministerului aldehyde and NADPH: Flexitarianism-luciferase in the concentrations specified above, after which produce a measurement of the intensity of bioluminescence. The activity of dehydrogenases is calculated by the formula:

where A is the activity of dehydrogenase, E 104lymphocytes (1E=1 μmol/min);

Δ[C] is the difference of concentrations of NADPH in the samples of "enzyme" and "background of the enzyme", µmol;

V - volume of sample, ml;

T - incubation time, min.

The development of the terminal phase in patients with chronic myeloid leukemia predicts if the value of the activity GFDG are in the range of 0-0. 02 the MCA, and the values in the activity of LDH in the range of 0.04-5,02 the ua.

Clinical example 1. Patient N., 60 years old, was admitted to inpatient treatment in the Hematology Department KKB №1, Krasnoyarsk with a diagnosis of chronic myelogenous leukemia, extensive stage. The patient was admitted for chemotherapy. At admission the patient's condition moderate, concerned about fatigue. The survey claimed method. Enzyme activity in blood lymphocytes was as follows:

GFDG: 0.01 µa (range of values: 0-0,02 MKE)

LDH: 4,47 MKE (in the interval of values of 0.04-5,02 MKE)

The levels of enzyme activity is reduced. According to the invention, the patient predicts the development of end-stage chronic�wow myeloid leukemia.

A day later in the hemogram - blast crisis, myeloblasts 3%, anemia, thrombocytopenia, diagnosed with terminal cancer and scheduled chemotherapy program induction of remission of acute myeloid leukemia.

Clinical example 2. Patient M., aged 57, was admitted to inpatient treatment in the Hematology Department KKB №1, Krasnoyarsk with a diagnosis of chronic myelogenous leukemia, extensive stage. At admission the patient's state of moderate severity, concerns expressed weakness, fatigue.

The survey claimed method.

Enzyme activity in blood lymphocytes was as follows:

GFDG: 1,17 MKE (outside the interval of values: 0-0,02 MKE)

LDH: 14,9 MKE (outside the value range: 0,04-5,02 MKE)

According to the invention, the results of determining the activity GPDH and LDH the development of end-stage did not predict the patient's detailed phase chronic myeloid leukemia. In the hemogram of the patient there are no blasts, which confirmed the diagnosis of advanced stage. The patient was prescribed planned course of chemotherapy.

This method has been tested on 44 patients with chronic myeloid leukemia treated at the Hematology Department of Regional clinical hospital №1, Krasnoyarsk. Activity GPDH and LDH in blood lymphocytes was determined using a bioluminescent method. 24 Volnyansk myeloid leukemia development was predicted terminal stage of the disease, which was later confirmed by additional methods. In 2 patients the prognosis is not matched. Thus, it may be a coincidence predict 96% of the observed patients.

The technical result from implementation of the proposed method:

- improving the accuracy of forecasting of development of the terminal phase in patients with chronic myeloid leukemia by evaluating the characteristics of the metabolism of cells of the immune system;

- reducing the duration of the study;

- the possibility of early diagnosis of terminal stage of chronic leukemia;

- expanding Arsenal of tools to predict the occurrence of the terminal phase in patients with chronic myeloid leukemia.

Thus, the proposed highly sensitive informative method allows to diagnose the disease progress, adjusting the plan and tactics of treatment of this category of patients and to improve the results of rehabilitation.

Sources of information

1. Patent No. 2098821 (RU). Differential diagnosis method deployed and terminal stages of chronic leukemia / Lytvynov V. A. /. Applicant and patentee: Smolensk state medical Academy. Application 95121015/14; Appl. 30.11.1995; publ. 10.12.1997.

2. AC NO. 1750369 (SU). A method of predicting the course of chronic leukemia. Application 4661262/30-14, bull. No. 9227.

3 Patent No. 2052200 (RU). Method of assessing the severity of leukemic process / Gusev S. A., Volkova T. G. /. Applicant and patentee: Kyiv Institute of improvement of doctors of the MOH of Ukraine. Application 5054705/14; Appl. 10.07.1992; publ. 10.01.1996.

4. Patent No. 2069858 (RU). A method of predicting the course of leukemia / Gusev S. A., Myasnikov, V. G., Klimenko L. N. /. Applicants and patent owners: Gusev S. A., Myasnikov, V. G., Klimenko L. N. Application 5027086/14; Appl. 25.12.1991; publ. 27.11.1996.

5. Savchenko A. A., L. N. Suntsova. Highly sensitive determination of the activity of dehydrogenases in lymphocytes of human peripheral blood bioluminescent method / lab. case. 1989. No. 11. P. 23-25.

A method of predicting the development of end-stage patients with chronic myeloid leukemia by examining blood, characterized in that in patients in the advanced stages of chronic myeloid leukemia in peripheral blood lymphocytes determine the activity of the two dehydrogenases - glycerol-3-phosphate dehydrogenase (GPDH) and lactate dehydrogenase (LDH), and when combined activity GFDG in the range from 0 to 0.02 MKE and LDH activity in the range of from 0.04 to 5,02 the ICA predict the development of end-stage.



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention refers to microbiology, namely to a method for the microbiological examination of a native smear from a tongue root mucosa. The substance of the method consists in the fact that a wooden spatula is used to sample biomaterial 0.5 ml by deep scraping from the mucous membrane at the boundary of the posterior one-third of the tongue dorsum and root; two smears are prepared on two slides, 1.5-2.0 cm2 in area; the smears are dried out for 20 minutes and fixed by flame heat of an alcohol lamp continuously for 5-6 seconds, Gram-stained by a complicated differential method, microscoped with immersion with the use of a ×100 objective lens; at least 10 visual fields are inspected on each slide taking into account quantitative and qualitative characteristics of microorganisms, cells and nuclei of the epithelium.

EFFECT: invention enables the more precise examination of the native smear of the tongue.

4 dwg, 1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: method involves patient's blood analysis on the first day following ST elevation myocardial infarction for insulinemia, glycemia, free fatty acids (FFAs), retinol-binding protein, tumour necrosis factor and ghrelin; the measured values are used to calculate linear classification discriminator function (LCDF1-c) by formula: LCDF1-c=-3.877+0.095Adp+0.246Grl-0.025IL-6-0.053TNF, wherein ADP is the adiponectin concentration, Grl is the ghrelin level, IL-6 is the interleukin 6 concentration, while TNF is tumour necrosis factor, a probable risk of insulin resistance is stated if LSDF1 is less than a cluster separation point of 0.4545 and approaching a centroid line of -0.561 as close as possible.

EFFECT: more reliable early hospital diagnosis of potential insulin resistance in the patients suffered ST elevation myocardial infarction.

2 ex, 2 dwg, 2 tbl

FIELD: medicine.

SUBSTANCE: invention describes a diagnostic technique for nutritional insufficiency accompanying ulcerative colitis by immunoassay, wherein blood serum is analysed to measure the soluble adhesion molecules sICAM-1, sICAM-2 and sICAM-3; a mild degree of nutritional insufficiency is characterised by the blood lymphocyte level of 1,500-1,800·109/l, while the sICAM-1 level is 13.4-24.7 ng/ml, the sICAM-2 level is 8.1-17 ng/ml, and the sICAM-3 level is 4.4-19 ng/ml; the IgG level is 650-500 mg/l; a moderate level of nutritional insufficiency is accompanied by the blood lymphocyte level making 900-1,490·109/l, and the sICAM-1 level is 25-37.8 ng/ml; the sICAM-2 level is 17.1-23.9 ng/ml, and the sICAM-3 level is 19.5-30.8 ng/ml, the IgG level is 950-1,400 mg/l; a severe degree of nutritional insufficiency is accompanied by the blood lymphocyte level of 890·109/l and less, the sICAM-1 level is 38-63 ng/ml; the sICAM-2 level is 24-29 ng/ml and the sICAM-3 level is 30.9-42.3 ng/ml; the IgG level is 1,500-1,800 mg/l.

EFFECT: more accurate diagnosis of nutritional insufficiency accompanying ulcerative colitis.

3 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely to a method for predicting the clinical course of sarcoidosis. Substance of the method consists in analysing biopsy material of a middle lobe of the right lung. What is involved is an immunohistochemical analysis in at least 5 visual fields at magnification ×400 to measure an average myofibroblast count in the interalveolar interstitial tissue. If the derived value is more than 50, the unfavourable outcome of sarcoidosis is predicted; the value of 15 and less average myofibroblast count, the favourable outcome of sarcoidosis is predicted.

EFFECT: using the declared method enables the early prediction and detection of the group of patients not requiring a great number of additional examinations.

2 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used to determine a human genotype by polymorphism in matrix metalloproteinase MMP9-1562 C>T (rs3918242) gene. The method is based on the establishment of a melting profile with fluorescence-labelled specific oligonucleotide samples. The method uses an allele-shared pair of primers, fluorescence-labelled allele-specific oligonucleotide samples different for each allele and a general oligonucleotide labelled with a fluorescence extinguisher of the following nucleotide composition: MMP9-1562s CGAAACCAGCCTGGTCAACG; MMP9-1562a TCTGCCTCCCGGGTTCAAGC; MMP9-1562p1 GGCGCACGCCTATAA-FAM; MMP9-1562p2 GGCGCATGCCTATAA-HEX; MMP9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), wherein FAM means the fluorescence extinguisher FAM, HEX means the fluorescence extinguisher HEX, BHQ1 means the dark fluorescence extinguisher attached to 5'-terminal nucleotide. Referring the sample to a homozygote or a heterozygote by the allele is determined by a DNA melting profile shape that is a maximum of the first fluorescence curve derivative.

EFFECT: invention enables providing more reliable and accessible genotyping.

1 dwg

FIELD: medicine.

SUBSTANCE: sodium/iodine symporter expression on a tumour cell membrane is measured in a tumour material taken by fine-needle aspiration biopsy, and if the measured expression is less than 1%, surgery is supposed to be added with the central lymph node dissection. The sodium/iodine symporter expression on the tumour cell membrane is determined by flow cytometry.

EFFECT: on the ground of the preoperative determination of the sodium/iodine symporter expression on the tumour cell membrane, the method enables establishing the extent of surgery for high-differentiated thyroid carcinoma, papillary and follicular, reliably.

2 cl, 2 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: invention relates to a method of predicting a high risk of formation of adeno-tonsillar system chronic pathology in recurrent respiratory infection children (RRI). The level of interleukin -17 and MMP-9 in saliva is determined, and if the level of interleukin-17 is higher than 5 pg/mg and MMP-9 level is higher than 10 ng/ml, a high risk of formation of adeno-tonsillar system chronic pathology in RRI children is predicted.

EFFECT: application of the claimed method makes it possible to determine the high risk of formation of adeno-tonsillar system chronic pathology in RRI children in due time and to carry out early preventive procedures, aimed at the prevention of the above.

4 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: newborn's umbilical blood serum agmatine is measured by capillary electrophoresis; the measured concentration of 0.038 mg/ml or more enables predicting convulsive conditions.

EFFECT: invention enables predicting convulsive conditions in newborns suffering perinatal injuries of the central nervous system and prescribing the timely pathogenetic therapy.

3 ex

FIELD: medicine.

SUBSTANCE: substance of the method consists in determining the concentrations of neuron-specific enolase (NSE) and vascular endothelial growth factor (VEGF) in umbilical blood serum and peripheral blood serum, the concentrations of brain-derived neurotrophic factor (BDNF) in peripheral blood serum on the 7th day of birth; that is followed by calculating a prognostic index (PI) by formula: PI=0.033×X1+0.016×X2-0.36×X3+0.002×X4+0.00054×X5-4.0, wherein X1 is the NSE concentration in umbilical blood (mcg/l); X2 is the VEGF concentration in umbilical blood (ng/ml); X3 is the NSE concentration in peripheral blood on the 7th day of life (mcg/l); X4 is the VEGF concentration in peripheral blood on the 7th day of life (ng/ml); X5 is the BDNF concentration in peripheral blood on the 7th day of life (ng/ml); Const=-4.0. If PI is less than 0, a low risk of ICP is stated. If PI is more than 0, a high risk of the given pathology is predicted.

EFFECT: method enables increasing the effectiveness of predicting infantile cerebral paralysis in the premature newborns with extremely low birth weight.

2 ex

FIELD: biotechnology.

SUBSTANCE: fecal sample of a patient is kept at 96% absolute alcohol for 30-60 min in the ratio of alcohol and feces of 1:1, centrifuged for 15-20 minutes, then the fecal sample is treated with 1% solution of sodium deoxycholate in a ratio of 1:1 for 30-60 minutes, centrifuged, the supernatant is removed, then the primary inoculation of precipitation in the medium with addition of 1% lactose and 0.5-1.0 mM arabinose is carried out, incubated in anaerobic culture apparatus for 24-48 hours, the grown colonies are applied to the standard discs impregnated with the chromogenic substrate - ortho nitrophenyl-β-D-galactosidase. When appearance of bright yellow colour of the disc the toxigenic strains of Clostridium difficile are diagnosed.

EFFECT: use of the claimed method enables to diagnose toxigenic strains of Clostridium difficile with high sensitivity and specificity, simplicity and accessibility.

3 ex

FIELD: medicine, hepatology.

SUBSTANCE: one should detect the level of hepato-specific enzymes (HSE) in blood plasma, such as: urokinase (UK), histidase (HIS), fructose-1-phosphataldolase (F-1-P), serine dehydratase (L-SD), threonine dehydratase (L-TD) and products of lipid peroxidation (LP), such as: dienic conjugates (DC), malonic dialdehyde (MDA). Moreover, one should detect the state of inspecific immunity parameters, such as: immunoregulatory index (IRI) as the ratio of T-helpers and T-suppressors, circulating immune complexes (CIC). Additionally, one should evaluate the state of regional circulation by applying rheohepatography (RHG), the system of microhemocirculation with the help of conjunctival biomicroscopy (CB) to detect intravascular index (II). In case of increased UK, HIS levels up to 0.5 mcM/ml/h, F-1-P, L-SD, L-Td, LP products, CIC by 1.5 times, higher IRI up to 2 at the norm being 1.0-1.5, altered values of regional circulation, increased II up to 2 points at the norm being 1 point, not more one should diagnose light degree of process flow. At increased level of UK, HIS up to 0.75 mcM/ml/h, F-1-P, L-SD, L-TD, LP products, CIC by 1.5-2 times, increased IRI up to 2.5, altered values of regional circulation, increased II up to 3-4 points one should diagnose average degree of process flow. At increased level of UK, HIS being above 0.75 mcM/ml/h, F-1-P, L-SD, L-TD, LP products, CIC by 2 and more times, increased IRI being above 2.5, altered values of regional circulation, increased II up to 5 points and more one should diagnose severe degree of process flow.

EFFECT: higher accuracy of diagnostics.

3 ex

FIELD: medicine, infectology, hepatology.

SUBSTANCE: in hepatic bioptate one should detect products of lipid peroxidation (LP), such as: dienic conjugates (DC), activity of antioxidant enzymes, such as: catalase (CAT)and superoxide dismutase (SOD). One should calculate by the following formula: C = DC/(SOD x CAT)x100, where DC - the content of dienic conjugates, SOD - activity of superoxide dismutase, CAT - activity of catalase. At coefficient (C) values being above 65 one should predict high possibility for appearance of cirrhosis, at 46-645 - moderate possibility and at 14-45 -low possibility for appearance of cirrhosis.

EFFECT: higher accuracy of prediction.

3 ex

FIELD: medicine, clinical toxicology.

SUBSTANCE: at patient's hospitalization one should gather the data of clinical and laboratory values: on the type of chemical substance, patient's age, data of clinical survey and laboratory values: body temperature, the presence or absence of dysphonia, oliguria being below 30 ml/h, hemoglobinuria, erythrocytic hemolysis, exotoxic shock, glucose level in blood, fibrinogen and creatinine concentration in blood serum, general bilirubin, prothrombin index (PTI), Ph-plasma, the state of blood clotting system. The state of every sign should be evaluated in points to be then summed up and at exceeding the sum of points being above "+20" one should predict unfavorable result. At the sum of "-13" prediction should be stated upon as favorable and at "-13" up to "+20" - prediction is considered to be doubtful.

EFFECT: higher accuracy of prediction.

2 ex, 3 tbl

FIELD: medicine, juvenile clinical nephrology.

SUBSTANCE: disease duration in case of obstructive pyelonephritis should be detected by two ways: either by detecting the value of NADPH-diaphorase activity, as the marker of nitroxide synthase activity in different renal department and comparing it to established norm, or by detecting clinico-laboratory values, such as: hemoglobin, leukocytes, eosinophils, urea, beta-lipoproteides, lymphocytes, neutrophils, the level of glomerular filtration, that of canalicular reabsorption, urinary specific weight, daily excretion of oxalates, arterial pressure, and estimating their deviation against average statistical values by taking into account a child's age.

EFFECT: higher efficiency of detection.

7 dwg, 1 ex, 6 tbl

FIELD: clinical medicine, pulmonology.

SUBSTANCE: one should carry out complex estimation of interleukin-1β) concentration in blood, saliva, bronchoalveolar liquid. Moreover, one should detect distribution coefficient (DC) for IL-1β as the ratio of IL-1β blood content to IL-1β salivary content. At increased IL-1β blood content by 10 times and more, by 2 times in saliva, unchanged level of bronchoalveolar IL-1β, at DC for IL-1β being above 1.0 one should predict bronchial obstruction. The method enables to conduct diagnostics of the above-mentioned disease at its earlier stages.

EFFECT: higher efficiency of prediction.

2 tbl

FIELD: medicine, diagnostics.

SUBSTANCE: the present innovation deals with genetic trials, with diagnostic field of oncological diseases due to analyzing DNA by altered status of gene methylation that take part in intracellular regulation of division, differentiating, apoptosis and detoxication processes. One should measure the status of methylation in three genes: p16, E-cadherine and GSTP1 in any human biological samples taken out of blood plasma, urine, lymph nodes, tumor tissue, inter-tissue liquid, ascitic liquid, blood cells and buccal epithelium and other; one should analyze DNA in which modified genes of tumor origin or their components are present that contain defective genes, moreover, analysis should be performed due to extracting and purifying DNA out of biological samples followed by bisulfite treatment of this DNA for modifying unprotected cytosine foundations at keeping 5-methyl cytosine being a protected cytosine foundation followed by PCR assay of bisulfite-treated and bisulfite-untreated genes under investigation and at detecting alterations obtained according to electrophoretic result of PCR amplificates, due to detecting the difference in the number and electrophoretic mobility of corresponding fractions at comparing with control methylated and unmethylated samples containing normal and hypermethylated forms of genes one should diagnose oncological diseases. The method provides higher reliability in detecting tumors, detection of remained tumor cells after operation.

EFFECT: higher efficiency of therapy.

1 cl, 3 dwg, 4 ex

FIELD: medicine, gastroenterology.

SUBSTANCE: one should carry out diagnostic studying, moreover, on the 5th -6th d against the onset of exacerbation in case of gastric and duodenal ulcerous disease one should detect the content serotonin, histamine and acetylcholine in blood, then during 2-3 wk one should conduct medicinal therapy to detect serotonin, histamine and acetylcholine level in blood again and at serotonin content being by 2-3 times above the norm, histamine - by 1.15-1.4 times above the norm and acetylcholine - by 20-45% being below the norm one should predict the flow of gastric and duodenal ulcerous disease as a non-scarring ulcer.

EFFECT: higher accuracy of prediction.

3 ex

FIELD: medicine.

SUBSTANCE: method involves taking blood from ulnar vein (systemic blood circulation) and from large vein of the injured extremity proximal with respect to lesion focus (regional blood circulation). Spontaneous NST-test value is determined and difference is calculated in systemic and regional blood circulation as regional-to-systemic difference. The difference value is used for predicting clinical course of pyo-inflammatory disease in extremities.

EFFECT: high accuracy of diagnosis.

4 cl, 2 tbl

FIELD: medicine, gastroenterology.

SUBSTANCE: one should introduce biologically active substance, moreover, in patient's blood serum one should detect the content of acetyl choline and choline esterase activity followed by 2-h-long intragastric pH-metry at loading with biologically active substance as warm 40-45%-honey water solution at 35-40 C, and at increased content of acetyl choline being above 1.0 mM/l, choline esterase being above 0.5 mM/l/30 min and pH level being 6.0-6.9 it is possible to consider apitherapy to be useful for treating ulcerous duodenal disease.

EFFECT: higher efficiency and accuracy of detection.

3 ex

FIELD: medicine, gastroenterology.

SUBSTANCE: it has been suggested a new method to detect pharmacological sensitivity to preparations as acidosuppressors. After the intake of the preparation a patient should undergo fibrogastroduodenoscopy 3 h later, then, through endoscopic catheter one should introduce 0.3%-Congo red solution intragastrically and the test is considered to be positive at keeping red color that indicates good sensitivity to the given preparation, and in case of dark-blue or black color the test is considered to be negative that indicates resistance to this preparation. The suggested innovation widens the number of diagnostic techniques of mentioned indication.

EFFECT: higher efficiency of diagnostics.

2 ex

Up!