Expression plasmid containing dna fragment coding mutein [c245s] of human tissue factor with inseparable c-terminal tag, bacterium e coli producing precursor protein of mutein [c245s] of human tissue factor with inseparable c-terminal tag, method for producing recombinant mutein [c245s] of human tissue factor with inseparable c-terminal tag, recombinant mutein [c245s] of human tissue factor with inseparable c-terminal tag

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used for recombinant production of human tissue factor (hTF). Constructed is a plasmid pHYP-10ETFCS6 having a length of 5,912 b.p. with a physical map presented on Fig. 2, for expression in a bacterium of the genus Escherichia, which is a precursor of the mutant [C245S] hTF containing an inseparable N-terminal leader peptide containing a deca-histidine cluster and an enterokinase identification sequence fused in a frame with a sequence coding the above mutein fused in the frame with the sequence coding the additional inseparable C-terminal peptide containing the deca-histidine cluster. A method for producing the precursor of the mutein[C245S]hTF contains culturing the producing bacterium in a nutrient medium, recovering inclusion bodies, solubilising the precursor protein, performing a metal chelator chromatography in the denaturation environment, re-folding and diafiltration of the protein solution. A method for producing the mature mutein[C245S] hTF involves detecting the N-terminal leader peptide from the above mutein precursor with using enterokinase and recovering the target protein.

EFFECT: invention enables increasing the level of biosynthesis and yield of pro-coagulation active hTF.

9 cl, 5 dwg, 1 tbl, 7 ex

 

Area of technology

The invention relates to biotechnology, namely to the technology of biologically active substances (BAS) methods of genetic engineering, more specifically to methods of obtaining biologically active recombinant tissue factor.

Background art.

Tissue factor (TF) of the person (synonyms: coagulation factor III, thromboplastin, CD142, inactive tissue prothrombinase, apoprotein C-thermostable lipoprotein) is a transmembrane protein that is localized mainly in cells of the subendothelial tissue, providing the initiation of the clotting cascade by activating factor VII.

The formation of the complex TF-factor VII causes a conformational change in the latter, leading to the breakdown of communications Arg-152-Ile, accompanied by the transformation VII in serine protease VIIa. Occurring active complex (VII-TF) by site-specific proteolysis converts the known as a zymogen factor X to the serine proteinase of FHA, which, in turn, converts prothrombin to thrombin. It is shown that the complex of TF-VII able to activate both factor X and factor IX, which ultimately contributes to thrombin generation (Boyle, E. M., Verrier, E. D., et al., 1996).

The structure of TF is a glycoprotein with a mass of 47 kDa, consisting of 263 amino acids, and containing 5 residues qi�theine, forming 2 intramolecular disulfide bonds. The extracellular domain (Ser-1-Glu-219, hereinafter, the numbering of amino acids for the Mature protein) and the surface of the lipid membrane is involved in the formation of the complex with VII; 23-membered transmembrane domain of a TF provides correct orientation of the extracellular domain relative to the membrane; intracellular domain of a TF provides zakalivanie" TF in the membrane and signal transmission in the operation of TF as a transmembrane receptor. Function transmembrane receptor is not associated with the function of cofactor VII, recombinant TF without an intracellular domain shows procoagulation activity.

The extracellular domain of TF contains 4 cysteine residue, forming two disulfide bonds Cys49-Cys57 and Cys186 - Cys-209 (Bach "Initiation of Coagulation by Tissue Factor", CRc Critical Rewiews in Biochemistry, 23(4):339-368 (1988)). It is shown that disulfide bond Cys186-Cys-209 is functionally significant, it was her participation is necessary for the existence of cofactoring functions of tissue factor to factor VII and VIIa (Rehemtulla et al., 1991).

The extracellular domain of TF are glycosylated at three asparagine residues - Asn11, Asn124, Asn137 (Boys et al., 1993). Variations in the composition of N-linked oligosaccharides TF, affect the net charge of the molecule tissue factor, but not affect his drug test etc activity (Verstreeg, Ruf, 2006).

The intracellular domain of both�enables zakalivanie in the membrane due to the hydrophobic interactions of the aliphatic radicals of amino acids and the formation of the sole cysteine residue Cys245 this domain thioether connection with membrane lipids.

Tissue factor is a major component of "thromboplastin reagent" to be used for laboratory diagnosis of abnormalities of the blood coagulation system by the method of the prothrombin test (PT). FRI is one of the most common methods of laboratory diagnostics, running as by screening of the, and, for example, for the control of anticoagulant therapy with warfarin or heparin. During a test to the test sample of blood plasma containing sodium citrate, is added a molar excess of chloride of calcium and thromboplastin reagent, which is a liposome certain structure and anchored them in the FF. The change in clotting time of the plasma relative to the standard sample indicates pathology of hemostasis. The mean clotting times of standard samples of plasma (prothrombin time, PT) and the ratio of the clotting time of the investigated plasma and standard (prothrombin ratio) varies considerably in different test systems and depends primarily on the properties of thromboplastin reagent. To normalize the results, we use the exponent to which you want to build value found IN the international sensitivity index (ISI or ISI). The magnitude of the ISI used in the kits generally lies in the range from 1 to 2. When control� anticoagulant therapy MITCH used thromboplastin reagent should not be above 1.4.

The traditional source of TF to obtain the thromboplastin reagent is a human cadaver brain, human placenta, and brain of rabbits. Because the concentration of TF in these tissues is very small and the composition of natural lipids are not optimal reagents on the basis of natural options have a non-constant TF sensitivity and require strict adherence to the technology of preparation, and are also sensitive to variations in feedstock. In addition, extracts of brain tissue may contain dangerous viruses and prion pathogens, which increases the risk for laboratory personnel. The use of recombinant TF (and controlled mixture of synthetic lipids) allows you to get the best quality reagents.

A number of authors used for the preparation of recombinant human TF transient transfection of cultured cell lines of human A-293 plasmid DNA that encodes a TF (US 5589363), or receipt of the producer strain E. coli carrying the plasmid encoding TF and leader peptide of one of the proteins of Bordetella pertussis (US 6261803); or receipt of the producer strain E. coli carrying the plasmid encoding leader peptide pel In directing the synthesized polypeptide in the periplasmic space of the bacteria that merged with it in the frame of a short peptide comprising the epitope of the monoclonal antibody and the site of recognition of the protease factor XA, and merged with it in RAM�e TF extracellular domain (US 5298599).

The production levels of TF in all of these cases did not exceed 1% of total protein. In addition, there was the probability of significant proteolytic disintegration of recombinant TF in the process of cultivation, extraction and purification.

More perfect way of expression of recombinant TF is the system given in (US 5858724). For expression of recombinant rabbit TF, vysokogomogennogo FFS man, used the vector containing the gene of thioredoxin, fused in frame with the gene TF, and a special strain of E. coli AD494[DE3]. This technology allows to obtain TF in a soluble form in substantial amounts, however, requires special, precisely matched conditions of fermentation, including forced cooling of the fermenter to a temperature of +16°C and a short induction culture at a very low density (1.5 to O. E.), which significantly limits the economic attractiveness of such expression systems, and requires to carry out complex multistep chromatographic purification. In addition, rabbit TF and TF man not completely identical, which introduces certain limitations in the scope of their application.

Relatively easy biotechnological system for obtaining a tissue factor-based strain-producer of yeast R. pastoris GS115/pHILS1 - rRTF (US 6100072). This expression system allows to obtain R�combinatii TF with a deletion of the intracellular domain and adding a small additional C-terminal peptide, including exegetically cluster. The use of such a variant protein enables to perform the cleanup in a single step using metallogenetic chromatography. The drawback of this expression system is the low level of biosynthesis timeframe (no more than 1-2% of total protein), due to the necessity of including recombinant TF in the membrane of the yeast cells in the process of protein biosynthesis.

The closest in technical essence analogue of the present invention is plasmid p6E-tTF and producing strains BL21(DE3)/tTF (RU2426780). This expression system allows to obtain a deletion variant of recombinant TF, comprising the extracellular and transmembrane domains and having contain no cleavable N-terminal leader peptide, containing exegetically cluster. The use of such a variant protein enables to perform the cleanup in a single step using metallogenetic chromatography in denaturing conditions. Among the drawbacks of this expression systems can be distinguished: 1) low level of TF biosynthesis of bacterial cell (100 mg/l of culture - 10% of total cellular protein), caused by the use of natural cDNA containing suboptimal for bacteria the frequency of occurrence of codons; 2) insufficient purity of the protein after purification metallogenetic chromatography, due to the lack of affin�awn one 6-histidinemia cluster to the sorbent; 3) presumably a low yield of renaturation procedure caused by the highly hydrophobic C-terminal segment of the protein that represents the transmembrane domain. In addition, the suitability of the described in this patent options timeframe to obtain the thromboplastin reagent is not installed.

Overall, a significant disadvantage of the above-described examples is the presence of an unpaired cysteine residue at position 245 of tissue factor, which in natural protein forms a thioether bond with membrane lipids. In the allocation of tissue factor from natural sources, this cysteine residue is usually masked by the related lipids, while the recombinant variants of tissue factor he can be in a reduced state, which reduces the protein stability and the potential to lead to disulfide exchange with other cysteine residues and the formation of covalently linked dimers TF, i.e. to a significant reduction in output procedures refolding.

Brief description of the present invention

The technical problem solved by the authors, was the creation of the technology of procoagulation active recombinant tissue factor with the replacement of the remainder of the unpaired cysteine at position 245 of the serine residue [C245S], additional detachable C-con�the energy peptide, detachable additional N-terminal peptide; with a higher level of biosynthesis, high access cleaning, suitable for the production of thromboplastin reagent.

The technical result is achieved by creating technology that includes a new expression plasmid DNA pHYP-10ETFCS6 encoding optimized for expression in a bacterial system synthetic gene tissue factor with replacement [C245S], the creation of producer strain E. coli based on it and the separation technology of recombinant mutein tissue factor, suitable for creating a thromboplastin reagent.

The basis of this decision are developed by the authors expression plasmid pHYP-10ETFCS6, length 5912 p. O. containing a DNA fragment comprising a sequence encoding synthetic contain no cleavable leader peptide with a length of 23 amino acids containing decamethylenebis cluster and the cleavage site by enterokinase, fused in frame with the sequence encoding mutein [C245S] tissue factor and containing at the C-end netsalary peptide length of 13 amino acids, including exegetically cluster. The specified fragment contains optimal for E. coli composition of codons, allowing to increase the level of expression of the heterologous protein due to the efficient broadcast of all amino acids of the polypeptide. Cash�Chiyo contain no cleavable N-terminal and neotemlemaja C-terminal peptides with polyhistidine clusters can more effectively carry out the purification of the polypeptide using metallogenetic chromatography the presence of the intracellular domain of TF, strengthened by neotemlemaja C-terminal peptide containing hydrophilic and charged amino acid residues can effectively carry out refolding protein and its subsequent lipidization and does not affect the expression of drug test etc activity, which leads to a significant increase in the yield of the target protein and the weakening of the thromboplastin reagent based on it.

Mutation [C245S] allows you to denaturiruet tissue factor with a higher output, as the absence of unpaired cysteine decreases the probability of establishment of intermolecular disulfide bonds, i.e., formation of covalent multimers.

The aim of the present invention is the provision of gene-expression plasmids containing the DNA fragment encoding the precursor mutein [C245S] tissue factor that includes a sequence encoding an additional contain no cleavable N-terminal peptide containing decamethylenebis cluster and sequence recognition of enterokinase, fused in frame with the sequence encoding mutein [C245S] tissue factor and merged with it in the box netsalary C-terminal peptide with a length of 13 amino acids, including exegetically cluster, under the control of a promoter functioning in the bacterial cell.

T�activate the aim of the present invention is the provision of the above described expression plasmids, where this plasmid is represented by the plasmid pHYP-10ETFCS6.

Also the aim of the present invention is to provide a bacterium belonging to the genus Escherichia, transformed with the above-described plasmid, the producer of precursor recombinant mutein [C245S] tissue factor with netshareenum the C-terminal peptide, and contain no cleavable N-terminal leader peptide.

Also the aim of the present invention is the provision of the above bacteria, where this bacterium is represented by the strain E. coli BL21[DE3]/pHYP-10ETFCS6.

Also the aim of the present invention is the provision of a predecessor recombinant mutein [C245S] tissue factor with netshareenum the C-terminal peptide comprising exegetically cluster contain no cleavable N-terminal leader, including decamethylenebis cluster, and the sequence of the enterokinase recognition.

Also the aim of the present invention is the provision of a method for producing recombinant mutein [C245S] recombinant tissue factor with netshareenum the C-terminal peptide, and contain no cleavable N-terminal leader peptide, comprising culturing the above described bacteria in a nutrient medium, separation Taurus inclusion, solubilization the precursor protein, metallogeny chromatography in denaturing conditions and re�olding the precursor protein.

Also the aim of the present invention is the provision of the above described method, in which cultivate the strain E. coli BL21[DE3]/pHYP-10ETFCS6.

Also the aim of the present invention is the provision of a method for producing thromboplastin reagent based muteena [C245S] recombinant tissue factor, comprising mixing denaturirovannogo muteena [C245S] recombinant tissue factor with lipids in the presence of detergent and subsequent removal of the detergent by dialysis.

Also the aim of the present invention is the provision of a thromboplastin reagent based muteena [C245S] tissue factor, obtained as described above.

Detailed description of the present invention

For the implementation of the present invention, the main technical challenge was the creation of a method for producing recombinant mutein [C245S] tissue factor using bacteria transformed with the expression plasmid containing the DNA fragment encoding the precursor recombinant mutein [C245S] recombinant tissue factor that includes a sequence encoding contain no cleavable N-terminal additional peptide with a length of 19 amino acids, including decamethylenebis cluster and sequence recognition of enterokinase, and merged with any� in a frame sequence, encoding recombinant mutein [C245S] recombinant tissue factor and netsalary C-terminal peptide with a length of 13 amino acids containing exegetically cluster, under the control of a promoter functioning in the bacterial cell.

The term "expression plasmid" means a plasmid DNA that contains all the necessary genetic elements for expression of the gene embedded in it, such as promoter, terminator. A specific example of the genetic elements necessary for expression of the precursor recombinant mutein [C245S] tissue factor in the composition of the gene expression cassette according to the present invention is, but is not limited to, promoter RNA polymerase of bacteriophage T7.

A DNA fragment, encoding the precursor recombinant mutein [C245S] tissue factor is, for example, a synthetic gene encoding the precursor recombinant mutein [C245S] tissue factor that includes a sequence encoding contain no cleavable N-terminal additional peptide comprising decamethylenebis cluster and sequence recognition of enterokinase, fused in frame with the sequence encoding the recombinant mutein [C245S] tissue factor and netsalary C-terminal exegetically cluster. Specified by fra�ment of DNA can be obtained for example, by PCR (see Example 1, Fig. 1). Also the said DNA fragment can be obtained using cloning technology company Sloning BioTechnology, described in PCT application WO 2005071077.

To ensure effective translation of the cloned gene in E. coli, preferably in the sequence encoding the precursor recombinant mutein [C245S] tissue factor all the rare codons were replaced with synonymous frequently in actively broadcast the genes of the E. coli codons.

The sequence of the LFS gene encoding the precursor mutein [C245S] recombinant tissue factor with detachable C-terminal tag - 10E-TF-CS6 according to the present invention provided in the sequence Listing under the number SEQ ID NO: 1.

Amino acid sequence of the precursor mutein [C245S] recombinant tissue factor with detachable C-terminal tag - 10E-TF-CS6 according to the present invention provided in the sequence Listing under the number SEQ ID NO: 2.

Amino acid sequence of Mature mutein [C245S] recombinant tissue factor with detachable C-terminal tag - TF-CS6 is a sequence number SEQ ID NO: 2 23 without the first amino acid.

DNA fragments that encode essentially the same protein, can be p�obtained, for example, by modifying the nucleotide sequence of the DNA fragment (SEQ ID NO: 1) encoding the precursor recombinant mutein [C245S] tissue factor, for example, by the method of site-directed mutagenesis so that one or more amino acid residues at a specific site will be deleterows, substituted, inserted or added. The DNA fragments, modified as described above can be obtained by using the traditional processing methods with the aim of obtaining mutations. DNA fragments that encode essentially the same protein can be identified by the expression of fragments of DNA having mutation as described above, in the appropriate box and setting the activity of the expressed product.

Tissue factor (synonyms: coagulation factor III, thromboplastin, CD142, inactive tissue prothrombinase, apoprotein C-thermostable lipoprotein) is a transmembrane protein that is localized mainly in cells of the subendothelial tissue, providing the initiation of the clotting cascade by activating factor VII. The structure of TF is a glycoprotein with a mass of 47 kDa, consisting of 263 amino acids and contains 5 cysteine residues forming 2 intramolecular disulfide bonds. In the formation of complex with VII involved only the extracellular domain (Ser-1-Glu-219) and �poverhnosti lipid membrane; 23-membered transmembrane domain of a TF provides correct orientation of the extracellular domain relative to the membrane; intracellular domain of a TF provides zakalivanie" TF in the membrane. Tissue factor is a major component of "thromboplastin reagent" to be used for laboratory diagnosis of pathology of the blood coagulation system by the method of the prothrombin test (PT). FRI is one of the most common methods of laboratory diagnostics, running as by screening of the, and, for example, for the control of anticoagulant therapy with warfarin or heparin. During a test to the test sample of blood plasma containing sodium citrate, is added a molar excess of chloride of calcium and thromboplastin reagent, which is a liposome containing TF. The change in clotting time of the plasma relative to the standard sample indicates pathology of hemostasis. The mean clotting times of standard samples of plasma (prothrombin time, PT) and the ratio of the clotting time of the investigated plasma and standard (prothrombin ratio) varies considerably in different test systems and depends primarily on the properties of thromboplastin reagent. To normalize the results, we use the exponent to which you want to raise a IU�international sensitivity index (ISI or ISI). The magnitude of the ISI used in the kits generally lies in the range from 1 to 2. In the control of anticoagulant therapy MITCH used thromboplastin reagent should not be above 1.4. The key indicator drug test etc activity used for receiving reagent variant TF is the clotting time of normal blood plasma, while MITCH reagent largely determined by the composition of lipid micelles. Thus, the prothrombin time to normal plasma is a key indicator of the functional activity of TF. It is believed that the variant protein has the properties of recombinant tissue factor, suitable for creating a thromboplastin reagent based on it, provided that normal prothrombin time for the specified option TF in the composition of protein-lipid micelles is not more than 25, preferably not more than 18 C.

Gene-expression plasmid according to the present invention contains a DNA fragment encoding the precursor recombinant mutein [C245S] tissue factor that includes a sequence encoding contain no cleavable N-terminal additional peptide with a length of 23 amino acids containing decamethylenebis cluster and sequence recognition of enterokinase, and merged with it in a frame sequence encoding mutein [C245S] tissue factor�ora of humans and netsalary C-terminal peptide with a length of 13 amino acids, containing exegetically cluster, under the control of a promoter functioning in the bacterial cell.

As the recombinant plasmids according to the present invention may be used various plasmids capable of expression in a cell of the recipient, such as the plasmid pBR322, pMW119, pUC19, pET22b, pET28b and the like, but the list of plasmids is not limited thereto.

Concrete option implementation of the present invention are plasmid, which consists of:

1) fragment NheI-HindIII vector pHYP length 5093 p. O., containing the region of the beginning of replication of plasmids pBR322, a sequence encoding aminoglycoside 3'-phosphotransferase, the sequence for segregation stabilize plasmids, promoter RNA polymerase bacteriophage T7; the site of termination of transcription; the sequence encoding the repressor of Lac operon; the sequence encoding the N-terminal decamethylenebis cluster and the C-terminal exegetically the cluster.

2) fragment NheI-HindIII length 819 p. O. encoding mutein [C245S] tissue factor and fused in frame to the sequence of the recognition enterokinase.

The plasmid contains a unique recognition sites of the restriction endonucleases: PsiI (5855), PciI (3542), BglII (1509), NcoI (1404), NheI (1363), PstI (1075), HindIII (544). The structure of the plasmid pHYP-10ETFCS6 shown in Fig. 1.

Using with�established plasmids can be transformed bacterial cells, preferably a bacterium belonging to the genus Escherichia, susceptible to such transformation specified by the plasmid. The choice of a specific cell is not critical, because the methodology and methods of transformation are well known to those skilled in the art. Although depending on the type of cells and culture conditions the received transformant the level of expression of the precursor mutein light chain enterokinase person may vary, the fact that expression of the target protein will be subject to the successful transformation of the cells of the recipient.

"Transformation of cells by plasmid" means the introduction of plasmids into the cell using methods well known to those skilled in the art. Transformation of this plasmid leads to the expression of the gene encoding the protein according to the present invention, and the protein synthesis in the bacterial cell. Methods of transformation include any of the standard methods known to those skilled in the art, for example the method described in Jac A. Nickoloff, Electroporation Protocols for Microorganisms (Methods in Molecular Biology) //Humana Press; 1st edition (August 15, 1995).

According to the present invention, "bacterial cell - producer predecessor muteena tissue factor" means a bacterial cell that has the ability to production and accumulation of precursor mutein t�analogo factor according to the present invention, when a bacterial cell according to the present invention is grown in a specified medium. As used herein, the term "bacterial cell - producer predecessor muteena tissue factor" also means a cell which is capable of accumulating the product of the predecessor muteena tissue factor in the amount of not less than 10 mg/l, more preferably not less than 100 mg/l. Specified predecessor muteena tissue factor accumulates in the specified cell is preferably in the form of Taurus inclusion.

Preferably, the use of bacteria belonging to the genus Escherichia, for transformation of the recombinant plasmid containing the DNA fragment encoding the precursor mutein tissue factor.

The term "bacterium belonging to the genus Escherichia" can mean that the bacterium belongs to the genus Escherichia according to the classification known to a specialist in the field of Microbiology. As an example of a microorganism belonging to the genus Escherichia, there can be mentioned Escherichia coli (E. coli).

The range of bacteria belonging to the genus Escherichia, is not limited in any way, however, for example, bacteria, described in the book Neidhardt, F. C. et al. (Escherichia coli and Salmonella typhimurium, American Society for Microbiology, Washington D.C., 1208, table 1), can be given as examples.

Specific�th example of strain-recipient to obtain producent predecessor muteena tissue factor according to the present invention is, but are not limited to, Escherichia coli strain BL21[DE3].

The Escherichia coli strain BL21[DE3] is characterized by the following cultural-morphological, physiological and biochemical traits and genetic traits.

Cultural and morphological characteristics of strain: gram-negative bacilli, form filaments; on agar medium - large whitish colonies with rough edges. The activity of the strain is determined using densitometry electrophoregram. The strain is stored in the following conditions: Wednesday Lurie-Bertrand, 1% glucose, 10% glycerol. The strain is propagated in the following conditions - environment Lurie-Bertrand, 1% glucose, kanamycin sulfate 30 mg/ml.

The genetic characteristics of the strain. The genotype of the strain - F-ompT gal dcm lon hsdSB(rB-mB-) λ(DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5])

Transformation of Escherichia coli strain BL21[DE3] the plasmid pHYP-10ETFCS6 results in the producer strain BL21[DE3]/pHYP-10ETFCS6, which provides a synthesis of the recombinant protein precursor mutein tissue factor in the amount of 30-70% of the total protein content of cells.

The Escherichia coli strain BL21[DE3]/pHYP-10ETFCS6 encodes a protein precursor 10ETFCS6 consisting of the amino acid sequence mutein [C245S] recombinant tissue factor fused in frame N-terminal peptide with a length of 23 amino acids containing decamethylenebis TC�erased, the cleavage site of enterokinase located immediately before the first amino acid mutein tissue factor and neotemlemaja C-terminal peptide with a length of 13 amino acids containing exegetically the cluster.

A method of producing muteena [C245S] tissue factor according to the present invention includes culturing the above described bacteria in a nutrient medium suitable for the cultivation of these prokaryotic cells, induction of gene promoter predecessor muteena [C245S] tissue factor, separation Taurus inclusion, solubilization the precursor protein, metallogeny chromatography in denaturing conditions and refolding target protein.

A method of obtaining a thromboplastin reagent is mixed denaturirovannogo protein with lipids in the presence of detergent and subsequent removal of the detergent by dialysis.

Features of plasmids and the results of its practical application are shown in the following Figures.

Brief description of Figures:

Figure 1 shows a diagram of the Assembly of the synthetic gene muteena [C245S] tissue factor of oligonucleotide primers and a gene-expression plasmids pHYP-10ETFCS6 and pHYP-MTFCS6. The following notation is used:; TF[C245S] is the product of the polymerase chain reaction encoding mutein [[C245S] tissue �actor person; FLAG-TF[C245S] is the product of the polymerase chain reaction encoding mutein tissue factor c N-terminal leader peptide. The dotted line indicates polymerase chain reaction, solid - restriction and ligation of DNA fragments. Italics indicate the names of the used restriction endonucleases.

Figure 2 shows a map of expression plasmid pHYP-10ETFCS6. The following notation is used: "pBR322ori" region of the beginning of replication of plasmids pBR322; "KanR2" - a sequence that encodes aminoglycoside 3'-phosphotransferase, providing resistance of bacteria to kanamycin; "T7 prom" - the promoter of RNA polymerase bacteriophage T7; "T7term" - a site of termination of transcription; "lacI"- a sequence that encodes the repressor of Lac operon; HS element to ensure segregation of plasmid stability, "p10E-TFCS6 ORF - open reading frame (Aars) polypeptide of the precursor protein mutein [C245S] tissue factor c-detachable C-terminal peptide containing exegetically cluster 6 his, and detachable N-terminal additional peptide "10E", containing decamethylenebis cluster. Arrows indicate direction of transcription of genes in parentheses are the numbers of the first and last nucleotides of the fragments. Figures in italics indicate recognition sites of restriction endonucleases in parentheses are the numbers of nucleotides in the t�ccah cutting.

Figure 3 shows a map of expression plasmid pHYP-MTFCS6. Use symbols similar to Figure 2, and also: "MTF-CS6"- open reading frame (LFS) Oh muteena [C245S] tissue factor c-detachable C-terminal peptide.

Figure 4 shows the èlektroforegramme total protein for two randomly selected colonies of the producer strain BL21[DE3]/pHYP-10ETFCS6 before and after induction. Cultivation in shake flask 2xYT medium, induction with 1 mm IPTG, 37oC, 14 hours. Track 1 - total protein colony 1 before induction, lane 2 - after induction, lane 3 - total protein colony 2 before induction, lane 4 after induction. Track 5 is a marker of molecular weights. The position of the target protein is indicated by an arrow.

Figure 5 shows the èlektroforegramme fractions of the precursor protein 10ETFCS6 when cleaning metallogenetic chromatography in denaturing conditions and subsequent refolding. Restoring conditions for all tracks, except “REF”. Notation: “IB” - solubilized calf inclusion; “FF” - fraction breakthrough, “50-500” - faction of else relevant concentrations of imidazole, in mm; REF - protein 10ETFCS6 after refolding; “M” is a marker of molecular weights. Molecular weight marker bands are indicated in kDa. The position of the target protein is indicated by an arrow.

The present invention will be described in more detail �the like with reference to the following non-limiting the present invention Examples.

Example 1. Plasmid DNA isolation pAL-TF[C245S] and pAL-FLAG-TF[C245S]

For the amino acid sequence mutein [C245S] recombinant tissue factor (SEQ ID NO: 3) was conducted reverse translation in the sequence of DNA nucleotides. He uses codons optimal for expression of this gene in E. coli class b and was also performed optimization of the structure of a gene on secondary structure of mRNA, GC composition, provided no unwanted regulatory elements (e.g. lack of internal binding sites of the ribosome), and the lack of long repeats, palindromes. Index CAI (Codon Adaptation Index), reflecting the efficiency of gene expression in this organism, the obtained sequence was 0.68, which is a good prognostic indicator for industrial suitability is obtained on the basis of the producer strain. The obtained nucleotide sequence with the added restriction fragment length polymorphism sites for subsequent sublimirovanny given in the sequence Listing under the number SEQ ID NO:4.

Synthetic gene muteena [C245S] recombinant tissue factor was collected using a polymerase chain reaction (PCR) with primers AS-TF-F1 - AS-TF-F7 and AS-TF-R1 - AS-TF-R7 (SEQ ID NO:5-16) and AS-TF-F6short (SEQ ID NO:17), sequences of which are shown in Table 1.

Table No. 1. Follower�spine primers

SEQ ID NOName of oligonucleotideSequence(5'-3')
5AS-TF-F6TTACATGTCTGGCACCACTAACACTGTTGCAGCGTACAACCTGACCTGGAAATCCACCAACTTCAAAACGATCCTGGAGTGGG
6AS-TF-F5ACGATCCTGGAGTGGGAACCGAAACCGGTTAACCAGGTTTACACTGTCCAGATCAGCACCAAATCCGGCGATTGGAAATCCAAATGCTTC
7AS-TF-F4GATTGGAAATCCAAATGCTTCTACACGACTGATACTGAGTGCGACCTGACTGACGAAATCGTGAAAGACGTGAAACAGACCTACCTGGCT
8AS-TF-F3AACAGACCTACCTGGCTCGCGTCTTCTCTTATCCGGCAGGTAACGTGGAAAGCACTGGCTCTGCAGGTGAACCGCTGTATGAAAACTCTC
9AS-TF-F2CCGCTGTATGAAAACTCTCCGGAATTCACCCCATACCTGGAAACTAACCTGGGTCAGCCAACTATCCAGTCTTTCGAACAGGTAGGCACC
10AS-TF-F1TCGAACAGGTAGGCACCAAAGTGAACGTTACTGTAGAAGACGAACGTACCCTGGTTCGTCGCAACAACACTTTTCTGTCTCTCCGTGACG
11AS-TF-R1GTTTTGGCGGTTTTTTTGCCAGAAGAGCTGGATTTCCAGTAATACAGCGTATAGATCAGGTCTTTGCCAAAGACGTCACGGAGAGACAGA
12AS-TF-R2GAATCACAGCCTGAACGCTGAAACAGTAGTTCTCACCTTTGTCCACGTCGATCAGGAATTCGTTGGTGTTGGTTTTGGGGTTTTTTTGC
13AS-TF-R3GGAACTCACCTTTCTCCTGACCCATACACTCTACCGGAGAATCAGTGCTTTTGCGGTTTACCGTGCGAGATGGAATCACAGCCTGAACGC
14AS-TF-R4GCTAATCGCCAGAATGATCACCAGAATGATAACTACGAACACGACAGCGCCGATAATGTAAAAGATTTCACGGAACTCACCTTTCTCCTG
15AS-TF-R5AGCTTGGAAACGTTCAGTGGGGAGTTCTCTTTCCAAGACTGACCAACACCCGCTTTACGAGATTTATGCAGGCTAATCGCCAGAATGATC
16AS-TF-R6TTAAGCTTGGAAACGTTCAGT
17AS-TF-F6shortTTACATGTCTGGCACCACTAACA

PCR was performed on thermocycler tertsik MC2 ("DNA-technology", Russia). Preparative reactions were carried out in a volume of 50 µl. Preparing the incubation mixture of the following composition: 1x buffer thermostable DNA polymerase; 10 PM of each primer oligonucleotide; 2 mm each deoxyribonucleotides; 2 units of thermostable DNA polymerase. On top of this mixture was layered with 50 μl of mineral oil and amplification were according to the scheme: 1 cycle - denaturation - 94°C, 3 min; 25 cycles denaturation 94°C, 30 s, annealing 62°C, 30 s, capacity circuit 72°C, 120 s; 1 cycle - capacity circuit 72°C, 10 min. PCR Products were isolated from 1% agarose gel, using a set of reagents "Wizard SV Gel and PCR Clean-Up System" ("Promga", USA) according to the manufacturer's Protocol, and then was ligated into the T vector PAL-TA (Evrogen, Russia) using DNA ligase of phage T4 and standard buffer solution ("Fermentas", Lithuania). Ligation conducted in a volume of 10 µl at a molar ratio of vector and insert 1:10, for 2-20 hours at room temperature. Received ligase mixture transformed cells of E. coli strain DH5α, with genotype F - φ80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17 (rk- mk+) phoA supE44 λ - thi-1 gyrA96 relA1. To do this, 200 µl frozen suspensions of E. coli cells was added 5 μl of ligase mixture, incubated on ice for 20 minutes for adsorption of the plasmid DNA was heated to 42°C for 45 seconds and incubated on ice for 5 minutes. After which was added 800 μl of nutrient broth SOB and incubated at 37°C for 60 minutes. Then the suspension was transferred to Petri dishes with solid agar medium containing ampicillin at a concentration of 100 μg/1 ml of agar, and placed in an incubator for 18 hours at 37 C. colonies of E. coli, selected by blue-white screening, were analyzed by PCR from clones with primers T7prom (SEQ ID NO:18) and SP6 (SEQ ID NO:19). The selected clones was increased in 5 ml of nutrient broth 2xYT-Amp and conducted isolation of plasmid DNA by a set of reagents "Wizard Plus SV Minipreps" ("Promega", USA) according to the manufacturer's Protocol, the primary nucleotide sequence was confirmed by PCR-�of avenirovna with primers T7prom (SEQ ID NO:18) and SP6 (SEQ ID NO:19).

To obtain the plasmid pAL-FLAG-TF[C245S], PCR was performed with primers AS-TF-R6 (SEQ ID NO: 16) and AS-TF-F6NheTag (SEQ ID NO: 20) using as template the plasmid pAL-TF[C245S], with the formation of a PCR product containing the region encoding N-terminal tag and restriction fragment length polymorphism sites for subsequent sublimirovanny. The sequence of the PCR product corresponds to SEQ ID NO: 4, where the first 7 nucleotides is replaced by the sequence SEQ ID NO:21.

PCR, cloning into the vector PAL-TA and analysis clones were as described above.

Example 2. Obtaining gene-expression plasmids pHYP-MTFCS6 and pHYP-10ETFCS6

To obtain pHYP-MTFCS6 donor plasmid pAL-TF[C245S] was restrictively the endonucleases PciI and HindIII. To obtain pHYP-10ETFCS6 donor plasmid pAL-FLAG-TF[C245S] was restrictively the endonucleases NheI and HindIII. The reaction products were separated in 1% agarose gel and extracted using a reagent kit Wizard SV Gel&PCR Clean-Up System according to the method the manufacturer of the donor fragment to obtain gene-expression plasmids.

Recipient plasmid pHYP (p0, Fig. 2) were digested sequentially each of the endonucleases NcoI and HindIII to obtain pHYP-MTFCS6, or NheI and HindIII to obtain pHYP-10ETFCS6. First, aliquots of plasmid were incubated for 2 hours at 37°C with each of the restriction enzymes, was controlled by electrophoresis in agarose gel the full linearization of the plasmid, then added a second restriction enzyme and incubated for another 2 hours. �ATEM samples were pooled, enzymes inactivated by heating at 65°C for 20 minutes and spent dephosphorylation by alkaline phosphatase ("Fermentas", Lithuania) according to the manufacturer's Protocol. Alkaline phosphatase is inactivated by heating to 85°C for 20 minutes. Restrizione and dephosphorylated plasmid was perioadei 3 volumes of ethanol, centrifuged for 10 minutes at speed 13200 rpm at room temperature, the precipitate was washed with 70% alcohol, dissolved in water and used for the production of ligation reaction in a working concentration of 10-2µg/µl. Reaction ligation of purified donor and recipient fragments plasmids and transformation of the ligat cells of E. coli strain DH5α were as described in example 1. E. coli colonies were analyzed by PCR from clones with primers T7prom (SEQ ID NO:18) and T7t (SEQ ID NO:22). The selected clones was increased in 5 ml of nutrient broth hot-Kan, conducted isolation of plasmid DNA kit Wizard Plus SV Minipreps". The nucleotide sequence was verified by using PCR-sequencing with primers T7prom (SEQ ID NO:18) and T7t (SEQ ID NO:22).

As a result of sequencing found that in the resulting plasmid preparations pHYP-MTFCS6 and pHYP-10ETFCS6 not contain mutations in the insert, that is correct coded sequence of the gene. Card designs are shown in Fig.2 and Fig.3, respectively.

Example 3. Receipt of the producer strain E. coli BL2[DE3]/pHYP-10ETFCS6, assessing the productivity of the producer strain and localization of the target protein.

To obtain strain-producer muteena [C245S] tissue factor structure obtained in example 2, was used to transform competent cells of Escherichia coli BL21(DE3) (genotype F - ompT hsdSB(r-m-) gal dcm (DE3)) and perform the selection of clones that retain the level of biosynthesis of recombinant polypeptide after induction not less than 30% of total cellular protein for at least four consecutive passages. To obtain E. coli strain BL21[DE3]/pHYP-10ETFCS6 - the product of the precursor protein mutein [C245S] tissue factor in human cells of the strain E. coli BL21[DE3] transformed gene expression by plasmid pHYP-10ETFCS6. Transformants of E. coli BL21[DE3] were sown on agar environment hot with the addition of kanamycin to 30 μg/ml and glucose to 2%, was performed to induce the expression of a target gene for five randomly selected colonies of transformants with the typical phenotype of the colonies. Clones were grown in nutrient broth with kanamycin 30 μg/ml and glucose to 2% for 6-7 hours, inoculable a new batch of nutrient medium in a ratio of 1:100, raising the culture until reaching an optical density of 2 O. E., induced isopropylthio-β-D-galactoside (IPTG) and cultured for another 16 h. After cultivation, the precipitate of cells was separated C�stripperwear, cells were resuspended in a solution of 10 mm Tris-HCl, 2 mm EDTA-Na, 0.1% Triton-X100, 10 μg/ml of lysozyme in the ratio of 10 ml per 1 g of cell paste, withstood the suspension for 30 min on ice and carried out the destruction of the cells by ultrasonic disperser to the disappearance of the apparent viscosity of the suspension. Taking samples for electrophoretic analysis, shared in them soluble and insoluble protein fraction by centrifugation in a microcentrifuge, additionally the precipitate was resuspended in the same solution and precipitated by centrifugation. The results of electrophoretic analysis of total protein for two colonies of strain BL21[DE3]/pHYP-10ETFCS6 shown in Fig.4.

Electrophoretic mobility of the target protein corresponds to the design value. According to the gel electrophoresis of protein fractions (data not shown), the target protein is almost completely localized in the insoluble fraction proteins, i.e. is in the form of Taurus inclusion".

Example 4. Isolation and purification of denatured recombinant mutein [C245S] tissue factor.

Producing strains BL21[DE3]/pHYP-10ETFCS6 were sown from the Museum loop debilitating stroke on a Petri dish with LB agar containing 30 μg/ml kanamycin and 1% glucose, raising 14 hours at 37°C. One single colony of the strain was transferred into 5 ml of LB liquid medium containing 30 μg/ml �annamycin and 1% glucose, and raised on rocking for 14 hours at 37°C. the Contents were inoculable 250 ml 2xYT medium containing 30 μg/ml kanamycin and 0.1% glucose, raised on a rocking chair for 3.5 hours at 37°C, collected samples of bacterial suspension for analysis, IPTG was added to final concentration of 1 mm and was raised for 3-15 hours

The precipitate of cells was separated by centrifugation, were resuspended in 20 ml of solution A (50 mm Tris-HCl, pH of 7.4, 2 mm EDTA), lysozyme was added to 0.1 mg/ml and Triton X100 0.1%, incubated for 30 min on ice. Carried out the destruction of cells and genomic DNA by means of an ultrasonic disperser heartbeats for 10 s before the disappearance of the increased viscosity of the suspension. The precipitate was separated by centrifugation for 10 min at 20000 rpm, the Precipitate was resuspended in solution A, was added to the detergent NP-40 to 1%, precipitate was separated by centrifugation as above. The precipitate was resuspended in solution A, was added NaCl to 500 mm, the precipitate was separated. The residue purified Taurus inclusion was resuspended in a solution of 50 mm Tris-HCl pH=7.4 and the precipitate was separated by centrifugation for 10 min at 20000 rpm. the resulting formulation is enriched Taurus inclusion was stored at -70°C.

To conduct solubilization of the target protein to the precipitate Taurus inclusion was added a solution of B (8 M urea, 50 mm Tris-HCl, 50 mm beta-mercaptoethanol, pH=9.5) is in a ratio of 10 ml per 1 g of sieges�and. The suspension is incubated under stirring for 2 hours at +37°C, separated not soluble cell debris by centrifugation for 10 min at 20000 rpm. Supernatant was diluted 5 times with a solution (8 M urea, 50 mm sodium phosphate, 500 mm sodium chloride, pH=8,0) to reduce the final concentration of beta-mercaptoethanol, the precipitate was separated by centrifugation for 10 min at 20,000 rpm and the supernatant was applied on a column with sorbent Chelating Sepharose Fast Flow (GE Healthcare,USA), contains chelated Nickel ions and balanced solution B. then washed the column with the solution G (8 M urea, 50 mm sodium phosphate, 500 mm sodium chloride, pH 7.0) and solution D (8 M urea, 50 mm sodium phosphate, 500 mm sodium chloride, 50 mm imidazole, pH=7.0) was to stabilize the baseline. Was suirable purified protein solutions with a concentration of imidazole in 100, 200 and 500 mm. The eluate containing the purified protein precursor 10ETFCS6, concentrated by ultrafiltration to a final total protein concentration of 20 mg/ml and desalted, the resulting solution was stored in frozen form. The polypeptide was purified in denaturing conditions to the share of visible impurities less than 5% by densitometry electrophoregram (Fig.5).

Example 5. The renaturation of recombinant mutein [C245S] tissue factor.

For refolding to unfrozen solution of denatured 10ETFCS6 to�alali RTI to a concentration of 10 mm and incubated at 37°C for 2 hours. Then the protein was diluted with buffer solution to refolding (50 mm TRIS, pH=8,8, 2 mm EDTA, 2 mm reduced glutathione, 0.2 mm oxidized glutathione, 2 M urea, 10 mm octylglucoside) in a ratio of 1:40 and incubated at room temperature for 12-16 h. the precipitate was Separated by centrifugation and used the resulting solution to lipidization tissue factor.

Example 6. Getting thromboplastin reagent based on recombinant mutein [C245S] tissue factor.

The mixing of the solution denaturirovannogo protein 10ETF6 with lipids was performed in HBS solution containing 10 mm HEPES pH=7,0, 140 mm NaCl, 0.1% NaN3. Hitch solid mixture of phosphatidylserine and phosphatidylcholine composition 70:30 M:M (Avanti Polar Lipids, USA) was dissolved in HBS, further comprising 20 mm of octylglucoside, the final total concentration of lipids 80 g/l Mixed solution of protein 10ETFCS6, solution of lipids and HBS solution with the addition of octylglucoside to 10 mm to a final concentration of monomer 10ETFCS6 20 µg/ml of lipid - 0.8 g/L. the resulting mixture was incubated 2 h at 37°C under stirring, then carried out the removal of detergent by dialysis against HBS solution for 48 h with a change delisous solution every 12 hours

The emulsion obtained liposomes containing recombinant tissue factor was used as the thromboplastin reagent� in determining the “prothrombin time” (PT). The main indicator of the functional activity of tissue factor clotting time normalized citrated blood plasma while adding to it a thromboplastin reagent and calcium ions. For received drug lepidosirenidae protein 10ETFCS6 clotting time was 13.4 with a clotting time of plasma from the control thromboplastin reagent on the basis of natural tissue factor - 16,9 with clotting time of plasma with a control reagent containing only liposomes, more than 200°C. the Measurements were carried out using a semi-automatic coagulometer ThromboScreen 400c (Pacific Hemostasis, USA) and reagents produced by NPO “Rena” (Russia). Received denaturirovannyj protein 10ETFCS6 suitable for the manufacture of thromboplastin reagent.

Example 7. Comparison of drug test etc activity of thromboplastin reagent derived from recombinant mutein [C245S] tissue factor with protestirovanny and reprezentirovanii N-terminal leader peptide and N-terminal methionine residue.

Obtained in examples 4-5 peeled and denaturirovannyj protein-precursor mutein [C245S] tissue factor 10ETFCS6 concentrated to 2 mg/ml by ultrafiltration, made CaCl2to 5 mm, added enterokinase (“Sigma”, USA) in a molar ratio of 1:1000 and led to the elimination of N-terminal peptide in techenie h at room temperature. The passage of the reaction was monitored using LTOs-page, the degree of splitting was more than 90%. Blocked the activity of enterokinase addition of EDTA-Na to 10 mm, separated the free peptide 10E by ultrafiltration on a membrane with pores of 10 kDa. Thus obtained the drug is Mature protein TFCS6 containing the extracellular domain of tissue factor without additional amino acids, was used to obtain thromboplastin reagent, as described in Example 6.

To obtain E. coli strain BL21[DE3]/pHYP-MTFCS6 - the product of the precursor protein mutein [C245S] tissue factor c N-terminal methionine residue cells of the strain E. coli BL21[DE3] transformed gene expression by plasmid pHYP-MTFCS6 analogously to example 3. The sequence of the LFS gene encoding the Oh-mutein [C245S] recombinant tissue factor with detachable C-terminal peptide - MTFCS6, is a sequence number SEQ ID NO: 1 lacking nucleotides 4-69. Amino acid sequence of Oh-muteena [C245S] recombinant tissue factor with detachable C-terminal tag MTFCS6 is a sequence number SEQ ID NO: 2, lacking the amino acids 2-23. The selection and the renaturation of the protein MTFCS6 carried out as indicated in examples 4 and 5.

The obtained protein preparations TFCS6 and MTFCS6 was lipidsoluble as described in Example 6, and measured “prothrombin time” for the obtained variants thromboplastin reagent. It was determined that the prothrombin time normalized to the plasma has no significant differences for all three variants of thromboplastin reagent, and is 13-14 S.

The results showed that the use to encode the LFS for optimal E. coli codons can increase the expression level of heterologous protein due to the efficient broadcast of all amino acids of the polypeptide. The presence contain no cleavable N-terminal and neotemlemaja C-terminal peptides with polyhistidine clusters can effectively carry out the chromatographic purification of a murine protein in denaturing conditions by metallogenetic chromatography. The presence of mutations [C245S] allows to carry out the procedure of refolding cleared for the precursor protein with a high yield. This order of stages allows you to get fully cleaned and denaturirovannyj product using a single chromatographic purification step. The presence of elongated through neotemlemaja C-terminal peptide of the intracellular domain in addition to metallogenetic cleaning allows refolding target protein with high yield. N-terminal peptide can be separated in the processing enterokinase (“Sigma”, USA), with specific procoagulant�community activity lepidosirenidae protein is not changed. The combination of these advantages allows you to reduce the price of a thromboplastin reagent is a protein-based 10ETFCS6 by reducing the cost of obtaining the solution denaturirovannogo recombinant tissue factor.

The advantages of the proposed strain E. coli BL21[DE3] consist in the use of bacteria to the phenotype of Lon, OmpT, which eliminates the possibility of proteolytic cleavage of the synthesized de novo muteena tissue factor and contamination secreted protein the most active protease of E. coli. Integrated into the genome of strain-recipient gene RNA polymerase bacteriophage T7 under the control of the lacUV5 promoter using T7-lac promoter and T7 terminator in the plasmid leads to rapid and efficient production of the protein. Another General advantage of the use of strain, expression vector and strategies biosynthesis is the ability to conduct induction without changing the temperature of cultivation. Another advantage is the possibility of obtaining muteena tissue factor containing contaminant proteins partners, without further chromatographic purification.

Although the invention is described in detail with reference to Examples, for the specialist in this field of technology it is obvious that can be done various changes and produced equivalent replacement, and such modifications and �ameny not beyond the scope of this invention.

1. Plasmid pHYP-10ETFCS6 length 5912 p. O. with the physical map shown in Fig. 2, for expression in bacteria belonging to the genus Escherichia, the predecessor muteena [C245S] tissue factor containing contain no cleavable N-terminal leader peptide, containing decamethylenebis cluster and sequence recognition of enterokinase, fused in frame with the sequence encoding the specified mutein, fused in frame with the sequence encoding the additional netsalary C-terminal peptide containing exegetically cluster, essentially, in the following sequence consisting of:
- the site of initiation of replication, pBR322 ori;
- gene repressor of Lac operon;
- the promoter of RNA polymerase bacteriophage T7;
- the area represented in the sequence Listing under the number SEQ ID NO: 1 encoding the N-terminal leader peptide, characterized decamethylenebis cluster and sequence recognition of enterokinase, fused in frame with a sequence optimized for expression in the specified bacteria the codons encoding mutein [C245S] tissue factor fused in frame with the sequence encoding the additional netsalary C-terminal peptide, characterized exegetically cluster;
- phase termination of transcription of bacteriophage T7;
- fragment of vapor�to give effect to the segregation stability of plasmids; and
- gene of resistance to kanamycin.

2. Plasmid according to claim 1, characterized in that the precursor mutein [C245S] tissue factor is a protein, the sequence of which is shown in the sequence Listing under the number SEQ ID NO: 2.

3. The bacterium belonging to the genus Escherichia, transformed with the plasmid according to claim 1, producer predecessor muteena [C245S] tissue factor, the sequence of which is shown in the sequence Listing under the number SEQ ID NO: 2 containing contain no cleavable N-terminal leader peptide, containing decamethylenebis cluster and sequence recognition of enterokinase, fused in frame with the sequence encoding the specified mutein, fused in frame with the sequence encoding the additional netsalary C-terminal peptide containing exegetically the cluster.

4. The bacterium according to claim 3, characterized in that this bacterium is the bacterium E. coli BL21[DE3]/pHYP-10ETFCS6.

5. A method of producing recombinant predecessor muteena [C245S] tissue factor, the sequence of which is shown in the sequence Listing under the number SEQ ID NO: 2 containing contain no cleavable N-terminal leader peptide, containing decamethylenebis cluster and sequence recognition of enterokinase, fused in frame with the sequence encoding the indicated�this mutein, fused in frame with the sequence encoding the additional netsalary C-terminal peptide containing exegetically cluster, comprising cultivating the bacterium according to claim 3 in a culture medium, separation Taurus inclusion, solubilization the precursor protein, metallogeny chromatography in denaturing conditions, refolding and diafiltration of protein solution.

6. A method according to claim 5, characterized in that cultured with the bacterium E. coli BL21 [DE3]/pHYP-10ETFCS6.

7. Predecessor muteena [C245S] tissue factor, the sequence of which is shown in the sequence Listing under the number SEQ ID NO: 2 containing contain no cleavable N-terminal leader peptide, containing decamethylenebis cluster and sequence recognition of enterokinase, fused in frame with the sequence encoding the specified mutein, fused in frame with the sequence encoding the additional netsalary C-terminal peptide containing exegetically cluster, obtained by the method according to claim 5.

8. A method of producing Mature mutein [C245S] tissue factor, the sequence of which is shown in the sequence Listing under the number SEQ ID NO: 2 without the first 23 amino acids containing netsalary C-terminal peptide containing exegetically cluster, which includes office N-terminal leader peptide from the end�of Annika specified according to claim muteena 7 using enterokinase and the target Mature mutein [C245S] tissue factor.

9. Mature mutein [C245S] tissue factor, the sequence of which is shown in the sequence Listing under the number SEQ ID NO: 2 without the first 23 amino acids containing netsalary C-terminal peptide containing exegetically cluster, obtained by the method according to claim 8.



 

Same patents:

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology. What is presented is a method for preparing a recombinant protein of type III interferon-like factor (ILF III) of the producing strain E. coli. The inclusion bodies E. coli are washed and dissolved with using 2% aqueous γ-cyclodextrin. That is followed by the sequential Ni-Sepharose, Q-Sepharose and SP-Sepharose chromatographic procedures. Refolding of a target protein is performed with using a mixture of cysteamine and cystamine at pH 10.5. The Amberchrome Profile XT20, Amberchrome Profile HPR10 and Kromasil 300-5C18 chromatographic procedures are sequentially performed.

EFFECT: invention enables optimising the ILF III purification environment at the stage of washing and dissolving the inclusion bodies Ecoli and provides 12% target protein yield.

3 dwg, 4 ex

FIELD: biotechnology.

SUBSTANCE: nutrient medium comprises a solid and a liquid phase. The solid phase of the nutrient medium comprises a hydrolyzate of pancreatic fish flour, the growth stimulator of hemophilic microorganisms, sodium chloride, yeast extract, glucose, agar, potassium tellurite - 2% solution and distilled water at a given ratio of the components. The liquid phase comprises the hydrolyzate of pancreatic fish flour, enzymatic peptone, yeast extract, glucose, agar, sodium chloride, potassium tellurite - 2% solution, blood serum of cattle and distilled water at a given ratio of the components.

EFFECT: invention enables to increase the inhibitory properties of the nutrient medium relating to microbes-associants of staphylococci.

4 tbl, 3 ex

FIELD: biotechnology.

SUBSTANCE: strain of micromycete Aspergillus foetidus 379-K-5-1 is proposed, producing a complex of pectinases, β-glucanase, xylanase, cellulase, chitinase, mannanase and protease for the destruction of polysaccharides of a plant and microbial material. The strain is deposited in the Departmental collection of useful microorganisms for agricultural purposes of the Russian Academy of Agricultural Science (RCAM) of the State Scientific Institution of the Russian National Research Institute for Agricultural Microbiology under the registration number of RCAM 01136. The advantage of the new strain is to obtain the more active complex of enzymes catalyzing the hydrolysis of polysaccharides, as well as endopolygalacturonase and pectinesterase. The strain Aspergillus foetidus RCAM 01136 is produced using efficient methods of selection and mutagenesis using UV irradiation and nitrosoguanidine from the known strain.

EFFECT: invention enables to expand the range of the enzymes obtained, used for the destruction of polysaccharides.

2 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: group of inventions refers to the strain Lactobacillus rhamnosus CNCM I-3690 and to a dairy food product containing the above strain. The presented strain possesses the mannose-specific adhesive properties. The strain possesses the antimicrobial properties in relation to, e.g. Escherichia coli, Salmonella enteritidis and Lysteria monocytogenes.

EFFECT: strain possesses the immunomodulatory properties, particularly possesses an ability to inhibit an inflammatory reaction of HT-29 epithelial cells.

2 cl, 2 dwg, 5 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: inventions relates to the field of biotechnology. A composition and a method for controlling the number of molluscs of the class Gastropoda and Bivalvia are claimed. The composition contains piliferolide A or 11-hydroxy-12-ene-octadecanoic acid, originating from Pseudomonas fluorescens ATCC 55799 of a suspension of its cells in the amount, effective for the regulation of the number of molluscs, and clayey mineral. The clayey mineral represents kaolinite, smectite, attapulgite or any their combination. The method of regulating the number of molluscs includes the introduction of one or more than one clayey mineral and piliferolide A or 11-hydroxy-12-ene-octadecanoic acid in the place, where control over the number of molluscs is desirable. The clayey mineral is taken in the quantity, effective for increasing the effectiveness of piliferolide A or 11-hydroxy-12-ene-octadecanoic acid by at least 20%. The presence of the clayey mineral enhances the molluscocidal effect of piliferolide A or 11-hydroxy-12-ene-octadecanoic acid.

EFFECT: inventions make it possible to increase the efficiency of chemical and biological control over the number of molluscs in open water bodies, power stations and stations for drinking water treatment under cold water conditions.

4 cl, 5 dwg, 6 tbl, 6 ex

FIELD: chemistry.

SUBSTANCE: group of inventions relates to field of biotechnology. Claimed are strains of Cryptococcus flavescens 3C NRRL Y-50378 and Cryptococcus flavescens 4C NRRL Y-50379 for suppression and control of fusariosis of grains, possessing resistance to prothioconazole. In order to suppress fusariosis strain Cryptococcus flavescens 3C NRRL Y-50378 or strain Cryptococcus flavescens 4C NRRL Y-50379, or combination of said strains is introduced in cereal ear in amount, sufficient for reduction of fusariosis level in comparison with the level, observed for untreated control. Composition for suppression of fusariosis of cereals, including strain Cryptococcus flavescens 3C NRRL Y-50378 or strain Cryptococcus flavescens 4C NRRL Y-50379, or combination of said strains, and agriculturally acceptable carrier, is also claimed.

EFFECT: claimed strains of Cryptococcus flavescens are effective antagonists of F graminearum.

10 cl, 3 tbl, 1 ex

FIELD: food industry.

SUBSTANCE: invention relates to dairy industry, in particular, to the cultured milk product preparation method. For cultured milk product manufacture defatted cow milk (after pasteurisation and cooling) is fermented by way of addition of a suspension of Bacillus subtilis TNP-3 DEP and Bacillus subtilis TNP-5 DEP bacteria strains, taken at equitable ratios, in 1%-sodium chloride solution at a concentration of 5 bln CFU/ml; the produced mass is ripened at a temperature of 38-42°C during 6-8 hours till acidity is equal to 100-120°T, kneaded during 30 minutes, dispensed and delivered for ageing.

EFFECT: method allows to manufacture a new cultured milk product with usage of bacteria strains possessing not only antagonistic activity but also a complex of fermentative activities.

4 tbl

FIELD: chemistry.

SUBSTANCE: group of inventions relates to biotechnology. Methods consist in the application of a lipolytic enzyme, possessing the glycolipase activity, isolated from Corynebacterium and containing at least one motif GDSX, where X represents a hydrophobic amino acid residue, or the GANDY block, containing the amino acid motif GGNDA or GGNDL, or HPT block. The said enzyme contains the amino acid sequence SEQ ID NO:8 or an amino acid sequence, which is at least 70% identical to it, or is coded by the nucleotide sequence SEQ ID NO:9 or a nucleotide sequence, which is at least 70% identical to it, and which codes the said lipolytic enzyme. When applied in the said methods, lipolytic enzymes from Corynebacterium possess the considerable galactolipid-hydrolysing activity and/or considerable acyltransferase activity with respect to galactolipid.

EFFECT: claimed are: a method of obtaining lysoglycolipid, a method of conversion of glycolipids and a method of obtaining food product.

21 cl, 17 dwg, 4 tbl, 12 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and medicine and concerns a pharmaceutical composition. The presented composition contains a recombinant lysozyme of FMV P. aeruginosa bacteriophage, ethylene diamine tetraacetate and TrisHCl in the following proportions, wt %: Lysozyme 0.001; TrisHCl 0.68; ethylene diamine tetraacetate 0.049; water - the rest.

EFFECT: characterised invention can be used for treating the infections caused by Pseudomonas aeruginosa and possesses immediate action and no side effects.

4 tbl, 1 ex

FIELD: biotechnology.

SUBSTANCE: microbial suspension is placed to the sterile Petri dishes prepared for inoculation in with nutrient broth and two agar plates. The Petri dishes with inoculations are incubated at 37°C. After incubation, the plates with the grown biofilm are removed from the culture liquid, are washed with sterile distilled water from planktonic cells and dried in a thermostat. Angles of moistening are measured in 3 and 9 hours. According to the changes in the edge angle of moistening, the specific rate of biofilm formation is determined. At that the specific rate of biofilm formation is calculated by the formula: μb=1t2t1ln(θ1θ2), where µb is specific rate of biofilm formation, h-1; t1 and t2 is incubation duration, h (3 and 9 hours); θ1,2 is edge angles of moistening (°), measured after incubation for 3 and 9 hours.

EFFECT: invention enables to speed up and simplify the process of quantitative evaluation of microbial biofilm formation and to increase sensitivity of the method.

3 tbl

FIELD: chemistry.

SUBSTANCE: group of inventions relates to versions of a method for microbiological synthesis of hybrid protein E7-HSP70. Synthesis of protein E7(6)-HSP70, E7(11)-HSP70, E7(16)-HSP70 or E7(18)-HSP70 is carried out by cultivating the respective yeast strain Saccharomyces cerevisiae VKPM Y-3919, yeast strain Saccharomyces cerevisiae VKPM Y-3853, yeast strain Saccharomyces cerevisiae VKPM Y-4057 or yeast strain Saccharomyces cerevisiae VKPM Y-4058 in suitable conditions in a medium containing saccharose as a carbon source. The cultivation process is carried out in two phases. The first phase is carried out at 25-26°C and initial saccharose concentration of 25-30 g/l. Upon achieving saccharose concentration in the medium of 15 mg/l, the second phase of the cultivation process is carried out, where temperature is lowered and kept not higher than 23°C, pH is kept at 5.7-5.9, and saccharose concentration is maintained via exponential replenishment at 15 mg/l.

EFFECT: group of inventions enables to obtain the end product in amount of not less than 550 mg/l and enables to carry out the cultivation process for not more than 65 hours.

4 cl, 12 dwg, 4 ex

FIELD: biotechnologies.

SUBSTANCE: invention proposes a constructed plasmid for expression in a cell of a Chinese hamster, in the following sequence, which mainly contains the following elements: pUC plasmid replication beginning region; an open reading frame (ORF) of beta-lactamase providing immunity to ampicillin; procaryotic gene promoter bla; a section of terminal repetition of Epstein-Barr virus of a human being; a functional gene promoter of elongation factor 1 alpha of the Chinese hamster, 5' non-translated region of this gene and a non-transcribed region flanking this gene, coding Kozak sequence for cap-dependent initiation of translation; ORF of the gene of subunit 1 of complex of 2,3-epoxyreductase of vitamin K (VKORC1) of the Chinese hamster with stop codon; a functional terminator and a signal of polyadenilation of the gene of elongation factor 1 alpha of the Chinese hamster, 3' non-translated region of this gene and a non-transcribed region flanking this gene; a promoter of early genes of virus SV40; gene of immunity to a selective agent; and a polyadenilation signal and terminator of virus SV40. Cells of the Chinese hamster - producer of protein with Gla-domain are transformed by the obtained plasmid, which are used in a method of recombinant obtainment of proteins with Gla-domain.

EFFECT: invention allows increasing productivity of the above cells owing to increasing activity of native VKORC1.

12 cl, 12 dwg, 2 tbl, 8 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to the field of biotechnology, namely to novel analogues of insulin and can be used in medicine. The said insulin analogue is characterised by one of the following structures: Arg(A0), His(A8), Gly(A21), Arg(B31), Arg(B32)-NH2-insulin; His(A8), Gly(A21), Arg(B31), Arg(B32)-NH2-insulin; Arg(A0), Glu(A15), His(A8), Gly(A21), Arg(B31), Arg(B32)-NH2-insulin. The invention also relates to a method of obtaining the said analogue, a pharmaceutical composition and a medication, including its application for treatment of diabetes mellitus.

EFFECT: invention makes it possible to obtain the insulin analogue, characterized by the delayed release and steady and longer action, for instance, in comparison with human insulin or glargine insulin.

18 cl, 2 dwg, 24 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, namely to leukolectins, and can be used in medicine. What is prepared is the polypeptide leukolectin characterised by SEQ ID NO:1-8. The recombinant preparation is ensured by using a nucleic acid coding it and integrated into an expression vector which is used to transform a host cell. Testing absence-presence or determining an amount of the polypeptide leukolectin are ensured by using an antibody or an antigen-binding fragment of a variable region of the above antibody which is specifically bound to the polypeptide leukolectin. The polypeptide leukolectin or the nucleic acid coding it are used as ingredients of a pharmaceutical composition in therapy of pathological disorders of skin and mucous membranes.

EFFECT: invention enables treating or preventing autoimmune disorders of skin, inflammatory diseases of skin or mucous membrane, or injured skin in an animal effectively.

16 cl, 19 dwg, 3 tbl, 12 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, more specifically to modified von Willebrand factor (VWF), and can be used in medicine. A recombinant method is used to preparing modified VWF fused in C-terminal of its primary translation product with N-terminal of albumin by the linker SSGGSGGSGGSGGSGGSGGSGGSGGSGGSGS. The prepared modified VWF is used as a part of the pharmaceutical composition for treating or preventing coagulation failure.

EFFECT: invention enables preparing the modified VWF which maintains its ability to N-terminal dimerisation and C-terminal multimerisation with a prolonged half-period of functional blood plasma occurrence as compared to the half-period of functional VWF occurrence.

17 cl, 5 dwg, 4 tbl, 11 ex

FIELD: chemistry.

SUBSTANCE: group of inventions relates to biochemistry. Disclosed is L-fucose α1→6 specific lectin, which is extracted from a basidiomycete or an ascomycete or an ascomycete, characterised by peak molecular weight of about 4500 m/z, determined via MALDI-TOF mass spectrometry analysis. The novel L-fucose α1→6 specific lectin has high affinity for a L-fucose α1→6 sugar chain, represented by an association constant of 1.0×104 M-1 or higher (at 25°C), and has an association constant of 1.0×103 M-1 or lower (at 25°C) with high-mannose sugar chains and/or glucolipids which do not contain an L-fucose α1→6 sugar chain. In one version, the disclosed L-fucose α1→6 specific lectin is a protein or a peptide which consists of an amino acid sequence selected from SEQ ID NO:2-6. The L-fucose α1→6 specific lectin is used for specific detection of a L-fucose α1→6 sugar chain and effective purification of the L-fucose α1→6 sugar chain or a sugar chain which does not contain L-fucose α1→6.

EFFECT: obtaining L-fucose α1→6 specific lectin.

16 cl, 38 dwg, 8 tbl, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to immunology and biotechnology. There are presented versions of nucleic acids each of which codes a heavy-chain amino acid sequence of immunoglobulin IgG1. The above chain contains glycine-lysine dipeptide coded by ggaaaa, ggcaaa or gggaaa codon at the C terminal of the CH3 domain. There are described: a plasmid coding a heavy chain of immunoglobulin; version cells providing immunoglobulin IgG1 expression; a method for producing immunoglobulin in mammalian cells; a method for improving immunoglobulin expression in the mammalian cells; - using the versions of a nucleic acid.

EFFECT: using the invention provides preventing the by-product expression of weight 80 kDa that can find application in producing immunoglubulins.

18 cl, 7 dwg, 3 tbl, 6 ex

FIELD: biotechnology.

SUBSTANCE: application of yeast strain Komagataella pastoris RNCIM Y-727 as the recipient to construction of producers of target protein is characterised, optionally comprising introduction of mutations into it, providing the use of auxotrophic selective markers.

EFFECT: solution can be applied in preparation of recombinant proteins without the use of methanol as inductor of gene expression.

8 dwg, 4 tbl, 10 ex

FIELD: biotechnology.

SUBSTANCE: nucleotide sequences are formed, encoding the hybrid proteins EPO-TR 1.6, EPO-TR 4 and EPO-TR 6. Protein EPO-TR 1.6 is recombinant human erythropoietin fused with a fragment TR 1.6 of the human protein MUC1. Protein EPO-TR 4 is recombinant human erythropoietin fused with a fragment TR 4 of the human protein MUC1. The hybrid protein EPO-TR 6 is recombinant human erythropoietin fused with a fragment TR 6 of the human protein MUC1. Hybrid proteins are produced by the roller cultivation in the suitable conditions the modified mammalian cell line CHO containing a nucleotide sequence encoding the protein with subsequent isolation of the hybrid protein from the culture fluid.

EFFECT: invention enables to produce the hybrid recombinant human erythropoietin having the prolonged action.

4 cl, 4 dwg, 7 tbl, 9 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to field of biotechnology, namely to muteins of human tear lipocalin, and can be used in medicine. Mutein of human tear lipocalin (hTLc) has identifiable affinity of binding with human receptor Met (c-Met) receptor tyrosine kinase, or its domain, or fragment of human c-Met. Mutein contains from 6 to 18 amino acid substitutions relative to amino acid sequence of mature lipocalin of human tear liquid (SWISSPROT DATABANK ENTRY P31025; SEQ ID NO:36), selected from group, consisting of Arg 26→Thr, Val, Pro, Ser, Gly; Glu 27→Gln, Gly, Val, Ser; Phe 28→Met, Asp; Pro 29→Leu, Ile, Ala, Trp; Glu 30→Leu, Gly, Arg, Phe; Met 31→Ser; Asn 32→Leu, Arg, Val, Gln; Leu 33→Tyr, Val, Ile, Thr, Phe; Glu 34→Val, Arg, Ala; Leu 56→Asn; Ile 57→Gln; Ser 58→Ile, Val; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp and Lys 108→Gly. Mutein can also additionally contain the following substitutions: Cys 61→Ser; Cys 101→Ser; Cys 153→Ser; Arg 111→Pro; Lys 114→Trp; Thr 37→Ser; Met 39→Ile, Leu; Asn 48→Ser; Lys 52→Thr, Met; Met 55→Leu; Lys 65→Arg, Leu; Ala 79→Leu, Ser; Ala 86→Thr; Ile 89→Ser, Gln, Thr, His; Thr 40→Cys; Glu 73→Cys; Arg 90→Cys; Asp 95→Cys; Lys 121→Cys; Asn 123→Cys and Glu 131→Cys.

EFFECT: invention makes it possible to efficiently treat pathological disorders, which involve pathway HGF/c-Met, as well as to perform identification of human c-Met in sample.

40 cl, 16 dwg, 9 tbl, 25 ex

FIELD: chemistry.

SUBSTANCE: claimed inventions deal with an isolated polynucleotide, coding a polypeptide, involved in biosynthesis of pyripyropene A, a vector and a host cell, including such a polypeptide, and methods of obtaining pyripyropene A precursors, including the host cell cultivation. The claimed polynucleotide codes the polypeptide, possessing any one or more of the activities - polyketide synthase, prenyltransferase, hydroxylase, acetyltransferase or adenylate synthase.

EFFECT: claimed inventions make it possible to synthesise pyripyropene A, which is an insecticidal agent, and can be used in the formation of plant resistance to pest insects.

16 cl, 11 dwg, 1 tbl, 11 ex

Up!