Synthetic oligonucleotide primers and their use in method of detection and differentiation of genome of vaccine strain b-82 of myxoma virus of rabbits from field isolates by method of polymerase chain reaction in real time

FIELD: biotechnology.

SUBSTANCE: method of detection and differentiation of a genome of the vaccine strain B-82 of the myxoma virus of rabbits from the field isolates comprises: extraction of the DNA from the biological material, posing a multiplex polymerase chain reaction using synthesised primers complementary to regions of genes M130R and M151R of the myxoma virus of rabbit, and having the following nucleotide composition: MF 5'TGG-AGC-TTT-TCA-AGC-ATT 3', MR 5'ATA-TCT-CGG-CTC-TAG-GGC-GAG 3', MZ 5' [FAM]-AG-CGT-CGG-ACG-TCT-TCG-TT-[RTQ1] 3', VF 5'AGC-CCT-ATA-AAC-CCG-TAG-ACG-AAC 3', VR 5'CAA-GCT-TTT-TTT-TAT-CCT-CGT-CCG 3', VZ 5' [R6G]-TCG-ACG-GTT-TCG-TCC-GCC-TTC-TTG-[BHQ2] 3', DNA amplification of the virus and evaluation of the reaction. The present inventions may be used in veterinary virology for the detection and differentiation of the vaccine strain B-82 of the myxoma virus of rabbits from the field isolates.

EFFECT: increase in accuracy.

2 cl, 6 tbl, 6 ex

 

The invention relates to biotechnology, namely, genetic engineering, and can be used in veterinary Virology for detection and differentiation of the vaccine strain B-82 myxoma virus of rabbits from field isolates.

Myxomatosis - an acute, highly contagious viral disease of rabbits characterized by serous-purulent conjunctivitis, inflammation of the mucous membranes, formation of tumor nodules in the skin and subcutaneous gelatinous edema predominantly in the head, anus and genitals. The myxoma virus of rabbits sensitive as domestic and wild animals, regardless of age [1].

The causative agent of myxomatosis, myxoma virus of rabbits, belongs to the genus Leporipoxvirus of the family Poxviridae. The virus has the shape of a parallelepiped with rounded corners and replicates in the cytoplasm of infected cells. It causes acute and persistent infection that is able to integrate its DNA into the host genome. The genome of the virus presents a double-stranded DNA molecule of about 160 thousand base pairs. The Central part of the genome contains 100 genes that are highly conservative genes of poxviruses, encoding the major structural proteins, also have terminal inverted repeats loci and closed hairpins at each end of the genome [2].

Laboratory�ornago diagnosis of myxomatosis of rabbits in the Russian Federation is based on histological examination of pathological material. At negative result of this study and the absence of characteristic clinical signs using bioassay in rabbits.

To apply specific prevention live attenuated vaccine. Vaccinated animals through contact with field strains can become asymptomatic carriers of the virus and serve as a reservoir of infection. In this regard, when detected in animals of myxoma virus of rabbits there is a need to differentiate vaccine strains from field isolates.

The purpose of this invention is the synthesis of primers for the detection and differentiation of the genome of the vaccine strain B-82 from the field isolates of myxoma virus of rabbits by PCR in real time.

The goal is achieved at the expense of oligonucleotide primers and fluorescent probes complementary to portions of genes M130R and M151R myxoma virus of rabbits and method for the detection and differentiation of the genome of the virus myxoma of rabbits in the samples of organs and blood samples of sick and dead animals and in infected cell culture. Wherein the first conducting nucleic acid (TC) of test material, and then amplification of specific fragments of the genome of the virus myxoma of rabbits.

For separation of TC from the test material using the method of nucleosil, zakluchalos� in the destruction of cell and viral membranes and subsequent binding of NC to the surface of the sorbent.

Obtained NC used for PCR-RV. To ensure specific amplification of fragments of the genome of the virus myxoma of rabbits to the PCR mixture in addition to the matrix, add the oligonucleotide primers and fluorescent probes flanking areas M130R and M151R. The nucleotide composition of the used primers and probes is given below:

MFTGG-AGC-TTT-TCA-AGC-ATT

MRATA-TCT-CGG-CTC-TAG-GGC-GAG
MZ[FAM]-AG-CGT-CGG-ACG-TCT-TCG-TT-[RTQ1]
VFAGC-CCT-ATA-AAC-CCG-TAG-ACG-AAC
VRCAA-GCT-TTT-TTT-TAT-CCT-CGT-CCG
VZ[R6G]-TCG-ACG-GTT-TCG-TCC-GCC-TTC-TTG-[BHQ2]

Temperature conditions for PCR-RV include the following steps: 5 min pre-denaturation at 95°C, 40 amplification cycles (95°C - 15 sec, 58°C 20 sec, 72°C - 20 sec).

PCR with hybridization-fluorescence detection in "real time" performed on the device RotorGene-6000 ("CorbettResearch", Australia) or equivalent. Obtained during the experiments, analyze the data with�OSU software the supplied device.

The technical result of the invention is to increase the degree of specificity and sensitivity, and a reduction in the time of the diagnostic detection and differentiation of the genome of the vaccine strain B-82, of the virus in samples of the investigated biological material.

The essence of the invention consists in that by means of said primers MF and MR and probe MZ performed real-time PCR, which allows to identify the gene as a vaccine strain B-82 and field isolates of myxoma virus of rabbits, using primers VF and VR and probe VZ differentiate the genome of the vaccine strain B-82 from the field isolates of the virus.

The use of different dyes in the synthesis of probes (FAM dye attached to the 5'-end of the probe, complementary to a fragment of the genome of the virus myxoma of rabbits, and the dye R6G - to the 5'-end of the probe, complementary to the genome of the vaccine strains) has enabled the simultaneous detection and differentiation of DNA of the virus through non-overlapping fluorescence spectra and, as a consequence, the detection of fluorescent signals differing from each other by channels: Green channel - for the detection of virus genome in both field and vaccine strains and the Yellow channel is only for DNA vaccine strain B-82.

The essential difference of these primers and probes is that they:

1. the complementary sites of genes M130R and Ml51R myxoma virus of rabbits, and is not complementary to any portions of the genomes of closely related viruses;

2. the presence of fluorescent probes increases the specificity of the reaction and allows the identification and differentiation of DNA vaccine strain B-82 myxoma virus of rabbits in the reaction process. The invention is illustrated by several examples.

Example 1. The calculation of the primary structure of the oligonucleotide primers and probe for detection of the genome of the virus myxoma of rabbits.

Using the program BioEdit 7.0" rectified available in GenBank nucleotide sequence of the region M151R myxoma virus of rabbits. The analysis of sequences within the genome of a virus selected area, which is the most conservative of all analyzed strains and isolates. With the help of the program Oligo 6.0" designed primary structure of oligonucleotide primers MF and MR, flanking the plot M151R myxoma virus of rabbits with a length of 150 BP For detection of amplification products is matched oligonucleotide fluorescently probe MZ is complementary to the inside of the nucleotide sequence amplificative fragment.

The main characteristic of the designed oligonucleotides are presented in table 1.

Table 1
Characterization of the designed oligonucleotide primers and probe complementary to the M151R myxoma virus of rabbits
NameThe composition of the oligonucleotide, 5'-...-3'Length
MFTGG-AGC-TTT-TCA-AGC-ATT18
MRATA-TCT-CGG-CTC-TAG-GGC-GAG21
MZ[FAM]-AG-CGT-CGG-ACG-TCT-TCG-TT-[RTQ1]19

Example 2. The calculation of the primary structure of the oligonucleotide primers and probe for the differentiation of the genome of the vaccine strain B-82 myxoma virus of rabbits from field isolates.

Using the program BioEdit 7.0" rectified available in GenBank nucleotide sequence of the region M130R myxoma virus of rabbits, as well as nucleotide sequences obtained by sequencing of the domestic strains and isolates of the virus. The analysis of sequences within the genome of a virus selected area, which is unique to the vaccine strain B-82 and absent in other strains and field isolates�in, resulting in specific amplification of only the samples containing DNA vaccine strain of the virus. With the help of the program Oligo 6.0" designed primary structure of oligonucleotide primers VF and VR, flanking the plot M130R myxoma virus of rabbits length of 148 BP For detection of amplification products is matched oligonucleotide fluorescently probe VZ is complementary to the inside of the nucleotide sequence amplificative fragment.

The main characteristic of the designed oligonucleotides are presented in table 2.

Table 2
Characterization of the designed oligonucleotide primers and probe complementary to the M151R myxoma virus of rabbits
NameThe composition of the oligonucleotide, 5'-...-3'Length
VFAGC-CCT-ATA-AAC-CCG-TAG-ACG-AAC24
VRCAA-GCT-TTT-TTT-TAT-CCT-CGT-CCG24
VZ[R6G]-TCG-ACG-GTT-TCG-TCC-GCC-TTC-TTG-[BHQ2]24

Example 3. Extra�tion of the DNA of the virus myxoma of rabbits from blood samples bodies and virusdatabases material, obtained by selection of this virus in various sensitive systems (PCs, FEC, CV-1).

In the required number of test tubes of 1.5 milliliters (ml) in N-Noe number of samples (including negative control allocation - OKW) make 500 microliters (ál) lyse solution No. 1 containing guanidine thiocyanate.Then they add 100 µl of the test material (blood, suspension of the virus, 10% suspension of authorities), carefully mix the contents of test tubes and incubated at 56°C for 5 min. Then carry out the centrifugation of the samples for 15 s at 12,000 rpm for deposition of droplets from the walls of the tubes and added to the samples 30-35 ál pre-resuspending sorbent "silica", was incubated at room temperature for 10 minutes, occasionally stirring the mixture. After incubation the tubes were centrifuged 30 sec at 7,0 thousand about. in min, discard the supernatant. Add 500 ál wash buffer thoroughly sorbent was resuspended, centrifuged 30 sec at 7,0 thousand rpm, the supernatant removed. Washed sorbent 75% ethyl alcohol in a volume of 500 μl carefully sorbent was resuspended, centrifuged 30 sec at 13,0 thousand rpm, the supernatant removed and further dried for 10 minutes at a temperature of 56°C. To the residue add 50 ál of elution buffer, re�eshivot and incubated 10 min at 56°C. Centifuges tubes for 1 min at 13,0 thousand rpm, the supernatant transferred into new tubes. The supernatant used as template for RT-PCR..

Example 4. Amplification of specific DNA sections of myxoma virus of rabbits during PCR-RV.

For PCR in a separate test tube prepare General reaction mixture for the required number of samples (N) including negative control selection (OKW), negative control of PCR (QA) and positive control PCR (PC). The amount of mixture for one sample is 20 μl, containing: 5 μl of buffer for Taq polymerase, 5-fold concentration, 0.5 ál of 25 mm MgCl2, 8 ál of water (amount of buffer No. 1), and 0.2 ál of 25 mm deoxyribonucleosides, 10 PM of each primer, 5 PM fluorescent probe (amount to buffer number 2) and 0.2 µl Taq polymerase (20 u/ál). The obtained mixture was stirred, avoiding the formation of foam, and dig up to 20 µl in pre-labeled vials with a capacity of 0.2 ml.

In prepared for PCR tubes were made by 5 mm3DNA using disposable tips with aerosol barrier. In a test tube for positive control (PC) add 5 ál of the PC and into the tube for negative control of PCR (OK) - 5 ál OK.

The tube is then placed in-line amplifier "Rotorgene 6000" (Corbett Research, Australia) with the following temperature regime:

1.Hold temperature95°C - 3 min
2.Cycling/Cycling95°C - 15 sec
58°C - 20 sec
72°C - 20 sec
Cycle repeats/Cycle to repeat - 5 times/time
3.Cycling2/Cyklinowanie95°C - 15 sec
58°C - 20 sec - Detection!
72°C - 20 sec
Cycle repeats/Cycle to repeat 35 times/time

Fluorescence is measured at 58°C on the Green and Yellow channels.

Example 5. Accounting and interpretation of results amplification.

The results are interpreted based on the presence (or absence) of crossing of fluorescence curve with the appropriate level threshold Linyi� (which corresponds to the presence (or absence) of the value of the threshold cycle Ct in the corresponding column in the results table).

5.1 results analysis for the presence of the genome of the virus myxoma of rabbits.

The result is considered reliable only in the case of passing positive and negative controls of amplification and negative control selection (EYE) (table 3).

Table 3
Evaluation of the results of analysis of reference samples
ControlControlled analysis phaseThe Ct value in channel FAM/GREEN
EYEDNA extractionNo value
OKPCRNo value
PCPCR<33

A sample is considered positive for the presence of DNA of the virus myxoma of rabbits, if the Ct value in channel FAM/GREEN is less than 33.

The sample is considered negative if in the channel FAM/GREEN for him, the Ct value is absent.

The results are not subject to the registration:

- The absence of positive signal in the sample with a positive control of PCR (PC) may indicate incorrectly selected the program of amplification and � other errors made during the process of PCR. In this case, it is necessary to conduct PCR again.

- If the Ct value in channel FAM/GREEN exceeds 33, you need to repeat PCR and considered positive in case of repetition of the result.

- The appearance of any Ct value in the results table for a negative control sample (EYE) and for negative control of PCR (OK) channel FAM/GREEN indicates the presence of contamination of reagents or samples. In this case, the analysis results for all samples are considered invalid. Required repeat analysis of all samples, as well as to take measures to identify and eliminate the source of contamination.

5.2 results analysis for the presence of the genome of the vaccine strain In 82 myxoma virus of rabbits.

The result is considered reliable only in the case of passing positive and negative controls of amplification and negative control selection (EYE) (table 4).

Table 4
Evaluation of the results of analysis of reference samples

ControlsControlled analysis phaseThe Ct value on channel HEXYellow
EYEDNA extractionNo value
OKPCRNo value
PCPCR<33

A sample is considered positive for the presence of DNA of the virus myxoma of rabbits, if Ct value via HEX channel/Yellow is less than 33.

The sample is considered negative if the channel HEX/Yellow for the Ct value is absent.

The results are not subject to the registration:

- The absence of positive signal in the sample with a positive control of PCR (PC) may indicate incorrectly selected the program of amplification and other errors made at the stage of PCR. In this case, it is necessary to conduct PCR again.

- If the Ct value in channel HEX/Yellow exceeds 33 requires

repeat PCR and considered positive in case of repetition of the result.

- The appearance of any Ct value in the results table for a negative control sample (EYE) and for negative control of PCR (s) in channel HEX/Yellow indicates the presence of contamination of reagents or samples. In this case, the analysis results for all samples are considered invalid. Required repeat analysis of all samples, as well�e to take measures to identify and eliminate the source of contamination.

The results are not subject to the registration:

- The absence of a positive signal or a signal with a value of Ct channel HEX/Yellow exceeds 33 for each sample, indicates the error at the stage of DNA extraction or production GDR. In this case, it is necessary to carry out the DNA isolation and PCR again.

Example 6. To determine the sensitivity and specificity of RT-PCR. on the basis of synthetic oligonucleotide primers and probes complementary to genes M130R and M151R myxoma virus of rabbits.

The specificity of the method was determined using samples containing DNA of myxoma virus of rabbits, closely related Poxviruses (fibroma virus Sopa and vaccine against sheep pox), and intact samples.

The results of the evaluation of the specificity of RT-PCR. presented in table 5.

Table 5
The results of PCR with primers complementary to the genes M130R and M151R myxoma virus of rabbits
Name of materialsThe result
Virus geneThe genome of the vaccine strain of the virus
Blood from intact rabbit-Blood taken from a rabbit on day 3 after vaccination production strain In 82 myxoma virus of rabbits at a dose of 1000 EID50/cm 3++
Blood taken from a rabbit on the 4th day after vaccination production strain B-82 of the myxoma virus in rabbits in a dose of 1000 EID50/cm 3++
Blood taken from a rabbit on day 5 after vaccination production strain B-82 of the myxoma virus in rabbits in a dose of 1000 EID50/cm 3++
The lyophilized material (CV-1) containing a strain of Mix-98 myxoma virus of rabbits, infectious activity of 4.0 lg EID50/cm 3++
Cultural material (PC), containing the strain B-82 myxoma virus of rabbits, infectious activity of 4.5 lg TCD50/cm 3++
Freeze-dried material containing the strain B-82 myxoma virus of rabbits, infectious activity of 4.1 lg EID50/cm 3++

The lyophilized material containing strain MP myxoma virus of rabbits, infectious activity of 5.0 lg LD50/cm 3+-
Associated vaccine against VGBK and myxomatosis of rabbits++
10% suspension of rabbit skin that is infected with myxoma virus of rabbits, isolate Khabarovsk-09 (field material, Khabarovsk, 2009)+-
10% suspension of rabbit skin that is infected with myxoma virus of rabbits, isolate Smolensk-11 (field material, Smolensk, 2011)+-
10% suspension of rabbit skin that is infected with myxoma virus of rabbits, isolate Ivanovo-12 (field material, Ivanovo, 2012)+-
Intact cell culture FEC--
Intact cell culture RK-13--
Vaccine against sheep pox dry culture (ser. No. 02-13) --
The lyophilized material fibroma virus Sopa, infectious activity of 4.1 lg EID50/cm 3from 17.05.2004--

Thus, a positive result was recorded only in samples containing DNA of myxoma virus of rabbits, confirming the specificity of the developed method.

The sensitivity of the method was determined using a panel of 10-fold dilutions of the culture material containing strain-82 myxoma virus of rabbits with the titer of infectious activity of 4.5 lg TCD50/cm3. As a result of virus DNA found at a dilution of 1:1000, which corresponds to 1.5 lg TCD50/cm3(table 6).

Table 6
The results of determining the sensitivity of the method on the basis of serial tenfold dilutions of the culture virusdatabases material
The material for researchThe result
The source DNA material+
Dissolved in 10 times+
Diluted 100-fold
Diluted 1000 times+
Diluted 10,000 times-
Diluted 100,000 times-
Divorced in 1000000 times-

Sources of information

1. Viral animal diseases / V. N. Syurin, A. J. Samuilenko, B. V. Solovyov, N. In. Fomina. - M.: UNITEMP, 1998. - 928 p.

2. Moss, B. Poxviridae: The viruses and their replication / B. Moss // Fundamental Biology, 4th ed. / D. M. Knipe, and P. M. Howley, Eds. Philadelphia, Lippincott-Raven Publishers, 2001.

1. Synthetic oligonucleotide primers complementary to portions of genes M130R and M151R myxoma virus of rabbits used for the detection and differentiation of the genome of the vaccine strain B-82 from the field isolates of the virus, having the following nucleotide composition:

MF5'TGG-AGC-TTT-TCA-AGC-ATT 3'
MR5'ATA-TCT-CGG-CTC-TAG-GGC-GAG 3'
MZ5' [FAM]-AG-CGT-CGG-ACG-TCT-TCG-TT-[RTQ1] 3'
VF5'AGC-CCT-ATA-AAC-CCG-TAG-ACG-AAC 3'
VR 5'CAA-GCT-TTT-TTT-TAT-CCT-CGT-CCG 3'
VZ5' [R6G]-TCG-ACG-GTT-TCG-TCC-GCC-TTC-TTG-[BHQ2] 3'

2. The method of detection and differentiation of the genome of the vaccine strain B-82 from the field isolates of myxoma virus of rabbits, including the isolation of DNA from biological material, the production of multiplex polymerase chain reaction using synthetic primers, amplification of viral DNA, evaluation of the reaction, characterized in that the primers according to claim 1, and temperature regimes for carrying out a panorama in real-time include the following steps: 1) 5 min pre-denaturation at 95°C; 2) 5 cycles of amplification (95°C - 15 sec, 58°C 20 sec, 72°C - 20 sec), 3) 35 cycles of amplification with detection at the stage of annealing of primers (95°C - 15 sec, 58°C 20 sec, 72°C - 20 sec), the result is considered positive if the Ct on both channels below 33.



 

Same patents:

FIELD: biotechnology.

SUBSTANCE: proposed RNA-aptamer is a 57-unit mixed-type oligonucleotide having the nucleotide sequence GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, where A, G are ribonucleotides, U, C are 2'-desoxy-2'-fluoro-ribonucleotides, has the ability to recognise autoantibodies specific to disseminated sclerosis.

EFFECT: characterised invention binds specifically and highly affine with autoantibodies specific to disseminated sclerosis, and can be used for the diagnostics of disseminated sclerosis.

3 dwg, 2 ex

FIELD: chemistry.

SUBSTANCE: group of inventions relates to the field of biochemistry. Claimed is a device for nucleic acid sampling, application of the device of nucleic acid sampling, a set for nucleic acid amplification, as well as a method of nucleic acid amplification. The device includes a probe for holding the nucleic acid sample and a manipulator, connected to the probe with an account of a possibility of the probe manoeuvring. The probe includes a multitude of probe elements, which are capable of travelling with respect to each other between approximated and mutually remote configurations. Each probe element has a nozzle. When the probe elements move into an approximated configuration, each nozzle is joined with other nozzles to form a composite nozzle. The composite nozzle is capable of contacting with nucleic acid in order to deliver its sample. The method of amplification of nucleic acid from higher eukaryotes includes the contact of the sampling device with a source of nucleic acid from higher eukaryotes, introduction of the sampling device or its part into a reaction vessel to carry out the reaction of nucleic acid amplification without preliminary material processing and realisation of the reaction of nucleic acid amplification.

EFFECT: inventions provide portability, easiness of the application of device for nucleic acid sampling, as well as carrying out the analysis in the short period of time.

43 cl, 27 dwg, 2 tbl, 12 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry, particularly a method of detecting somatic mutations in the PI3K gene, which are responsible for tumour sensitivity to target therapy, using DNA biochip technology. The method includes determining presence of somatic mutations E542K, E545K, Q546K, H1047L and H1047R in the PI3K gene using LNA-blocking multiplex "nested" PCR, subsequent hybridisation of the labelled PCR product in the biochip, recording and interpreting the results.

EFFECT: invention provides rapid and efficient detection of somatic mutations in the PI3K gene, associated with tumour sensitivity to target therapy.

3 cl, 2 dwg, 4 tbl, 4 ex

FIELD: chemistry.

SUBSTANCE: invention relates to the field of molecular genetics, genosystematics and pharmacognosy and is intended for the identification of the species affinity of common heather (Calluna vulgaris (L.) Hull.). Claimed is a set of synthetic oligonucleotides for PCR with the fragment ITS2 of nuclear DNA, including forward and reverse primers and a degradable probe.

EFFECT: set possesses high sensitivity and specificity and makes it possible to carry out the identification of a medicinal plant in a fast and reliable way.

1 dwg, 1 ex

FIELD: biotechnology.

SUBSTANCE: method comprises sequential centrifugation, ultrafiltration and ultracentrifugation of the culture condensed medium. The resulting residue is dissolved in phosphate-saline buffer and re-centrifuged. The resulting residue is dissolved in water. The resulting solution is subjected to electrophoresis in a free flow on the device FFE System. Ultracentrifugation of each of the obtained fractions is carried out. Each fraction is purified from the cell walls of exosomes by filtration and centrifugation. Reaction of reverse transcription is carried out using reverse transcriptase. The reaction is stopped by heating to 95°C for 5 minutes.

EFFECT: invention enables to extract microRNA from biological fluids containing exosomes with high yield.

2 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used to determine a human genotype by polymorphism in matrix metalloproteinase MMP9-1562 C>T (rs3918242) gene. The method is based on the establishment of a melting profile with fluorescence-labelled specific oligonucleotide samples. The method uses an allele-shared pair of primers, fluorescence-labelled allele-specific oligonucleotide samples different for each allele and a general oligonucleotide labelled with a fluorescence extinguisher of the following nucleotide composition: MMP9-1562s CGAAACCAGCCTGGTCAACG; MMP9-1562a TCTGCCTCCCGGGTTCAAGC; MMP9-1562p1 GGCGCACGCCTATAA-FAM; MMP9-1562p2 GGCGCATGCCTATAA-HEX; MMP9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), wherein FAM means the fluorescence extinguisher FAM, HEX means the fluorescence extinguisher HEX, BHQ1 means the dark fluorescence extinguisher attached to 5'-terminal nucleotide. Referring the sample to a homozygote or a heterozygote by the allele is determined by a DNA melting profile shape that is a maximum of the first fluorescence curve derivative.

EFFECT: invention enables providing more reliable and accessible genotyping.

1 dwg

FIELD: medicine.

SUBSTANCE: claimed invention relates to the field of biotechnology, namely to the preliminary estimation of the efficiency of the autologic cell material transplantation to stimulate the growth of blood vessels, and can be applied in medicine. Claimed is a method of the complex estimation of the angiogenic potential of progenitor cells in patients with cardiovascular diseases, tested on mesenchymal stromal cells of the adipose tissue (MSC-AT) of patients with ischemic heart disease and including the measurement of content of mRNA and proteins of basic angiogenic factors, produced by the progenitor cells such as the vascular endothelial growth factor (VEGF), the placental growth factor (PIGF), the hepatocyte growth factor (HGF), angiopoetin-1 and angiogenin, the angiogenic activity of total cell secretion products, as well as the estimation of the ability of the progenitor cells to stimulate the vascularisation of subcutaneous Matrigel implants, introduced to immunodeficient mice. As the screening method used is a simpler and more available but less informative method of express-assessment of the angiogenic properties of the progenitor cells, based on the measurement of the angiogenic activity of the total cell secretion products.

EFFECT: invention makes it possible to carry out testing of the autologic cell material obtained from the patients, including those with ischemic heart disease, before transplantation in order to choose the optimal tactics of cell therapy aimed at the stimulation of the growth of blood vessels.

2 cl, 2 dwg, 4 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: group of inventions relates to field of biotechnology. Method of detecting genome of virus of infectious anaemia in horses includes carrying out polymerase chain reaction, amplification of virus DNA, evaluation of reaction carrying out. If viral RNA is detected, reaction of denaturation and reverse transcription is preliminarily carried out, and detection is carried out by means of RT-PCR in real time in case of detection of INAN virus and PCR in real time in case of detection of pDAN of INAN virus. To realise the method specific primers and DNA-probe are applied. Temperature modes include the following stages: 5 min of preliminary denaturation at 94°C, 5 cycles of amplification without detection (94°C - 10 sec, 56°C - 15 sec, 72°C - 15 sec) and 35 cycles of amplification with detection (94°C - 10 sec, 56°C - 15 sec, 72°C - 15 sec). Interpretation of results is carried out on the basis of presence/absence of crossing of fluorescence curve with threshold line (Threshold).

EFFECT: application of inventions makes it possible to detect RNA and pDAN of INAN virus by means of RT-PCR in real time mode, as well as to increase method specificity and sensitivity.

2 cl, 3 tbl, 1 ex

FIELD: biotechnology.

SUBSTANCE: method is based on single nucleotide polymorphism of genes of toxin-anatoxin systems of type II of superfamilies VapBC, HigAB and MazEF and is characterised in that for identification amplification is carried out with genomic DNA using the set of oligonucleotide primers for 10 genes of toxin-anatoxin systems. PCR products are analysed in agarose gel, the size of the obtained fragment is determined by DNA marker, the target fragments are isolated from the PCR mixture or the agarose gel and they are sequenced in order to detect the respective polymorphisms.

EFFECT: invention enables to carry out fast and accurately genotyping of mycobacteria in PCR mode and can be used for identification of clinically important strains, including with multiple and wide drug resistance, and also with altered virulence in operation with patients.

1 dwg, 3 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: group of inventions relates to multi-channel devices, modified by nanocarriers of aniline-containing polymers. Claimed are: a multi-channel nozzle for the extraction of nucleic acids, proteins, peptides and a method of production of a multi-channel element, included in the composition of the multi-channel nozzle. The nozzle consists of a glass hexagonal multi-channel array, which includes multi-channel elements from a multitude of parallel capillaries. A sorption layer, which consists of one to three polymeric nanolayers, is applied on the internal surface of the capillaries. A multi-channel element is made with a protective framing from several rows of glass rods. The glass hexagonal multi-canal array consists of the laid repeatedly extended single multi-channel elements with the diameter of capillaries from 1 mcm and more, working surface to 500 cm2, volume to 500 mcl. The method of the multi-channel element production includes the assembly of glass tubes into a multi-channel pack, fastening one of its ends in a supply unit grip, heating of the other end in a furnace with the formation of a bulb and extension to a required size. In order to obtain the structures with the diameter of the channel of the order and less than 1 mcm in the process of moulding the repeated extension of the multi-channel elements, preliminarily formed by laying the elements of the hexagonal shape, is realised.

EFFECT: inventions ensure carrying out the express-extraction and purification of both nucleic acids and proteins, peptides, as well as ensure the high reproducibility of results.

5 cl, 6 dwg, 3 tbl, 9 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, virology and immunology. Particularly, the present invention refers to a new avian astrovirus; to antibodies and their fragments targeted to the above new virus; to antigen preparations, proteins and DNA molecules of new avian astrovirus; to vaccines based on the above new virus or to its antigen preparations, protein or DNA; to methods for producing such vaccines and to diagnostic kits. The present invention can be used in veterinary science.

EFFECT: preparing the new avian astrovirus.

11 cl, 5 dwg, 4 tbl, 12 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and virology. What is presented is a method for preparing influenza A or B viruses in a cell culture, and a composition of the cell culture for preparing influenza A or B viruses.

EFFECT: invention provides the serum-free culture medium, avoids the need for the stage of cell culture medium replacement, prepares the influenza viruses with the high live virus recovery and can be used for the active immunisation of individuals and for producing the antibodies for various applications, including passive immunisation and diagnostic immunoassays.

22 cl, 24 dwg, 47 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and virology. What is presented is a method for producing viral-like influenza virus particles (IVP) in a plant or a part thereof. The method involves the expression of a new influenza virus protein HA in plants and purification thereof. The invention also aims at IVPs containing the influenza virus protein HA and herbal lipids. The invention also refers to nucleic acids coding an improved influenza virus HA, as well as to vectors. The IVPs can be used in developing the influenza vaccines or for the treatment of existing vaccines.

EFFECT: presented group of inventions can be used in medicine.

18 cl, 44 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: invention relates to medical virology and deals with an influenza virus strain. The vaccine strain B/60/Massachusetts/2012/10 is a reassortant, obtained by crossing the "wild" virus B/Massachusetts/2/2012 with the cold-adapted temperature-sensitive virus B/USSR/60/69 -attenuation donor. The strain B/60/Massachusetts/2012/10 is deposited in the State Collection of Viruses FSBI D.I.Ivanovsky Scientific Research Institute of Virology Russian Ministry of Health under No 2740, actively reproduces in developing chicken embryos at the optimal temperature of 32°C, is characterised by temperature sensitivity and cold-adaptedness and safety for laboratory animals. Reassortant inherited genes, which code surface antigens of virus hemagglutinin (HA) and neuraminidase (NA), from the epidemic parent virus and remaining six genes, which code internal non-glycosylated proteins, from the attenuation donor.

EFFECT: claimed invention can be applied in practical healthcare for the prevention of influenza morbidity among adults and children.

4 tbl

FIELD: veterinary medicine.

SUBSTANCE: presented subline of cells A4C2/9k is highly sensitive to the ASF virus. The growth medium is used as medium Needle-MEM with 10% blood serum of swine. The inoculating concentration is 80-100 thousand cells/ml. The mitotic index to 2-3 days of cultivation is 25-35. The subline of cells is deposited at the Specialized collection of cell cultures of agricultural and game animals at the All-Russian research institute of experimental veterinary medicine under the number of 87.

EFFECT: invention enables to isolate the African swine fever virus without prior adaptation in reaction of hemadsorption and provides its accumulation in titre.

1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: invention relates to medical virology and deals with a strain of influenza virus. The vaccine strain A/17/Indiana/2011/72 (H3N2v) - reassortant, obtained by crossing of the "wild" virus A/Indiana/10/2011 (H3N2v) with the cold-adapted temperature-sensitive virus A/Leningrad/13 4/17/57 (H2N2) - attenuation donor. The strain A/17/Indiana/2011/72 (H3N2v) is deposited in the State Collection of Viruses FSBI D. I. Ivanovsky Scientific Research Institute of Virology Russian Ministry of Health, under No 2739, actively reproduces in developing chicken embryos at the optimal temperature of 32°C, is characterised by temperature-sensitivity and cold-adaptedness and safety for laboratory animals. Reassortant inherited genes, which code surface antigens of virus hemagglutinin (NA) and neuramindase (NA), from the epidemic parent virus and remaining six genes, which code internal non-glycosylated proteins, from the attenuation donor.

EFFECT: claimed invention can be applied in practical healthcare for the prevention of influenza disease morbidity among adults and children.

4 tbl

FIELD: medicine.

SUBSTANCE: invention refers to medical virology and concerns a vaccinating influenza virus strain. The characterised strain B/60/Wisconsin/2010/125 is a reaccortant produced by crossing the epidemic virus B/Wisconsin/1/2010 with the cold-adapted heat-sensitive virus B/USSR/60/69 that is an attenuation donor. The strain B/60/Wisconsin/2010/125 is characterised by heat-sensitivity and cold-adaptation. The reassortant has inherited genes coding the surface antigens, haemagglutinine (HA) and neuraminidase (NA), from the epidemic virus and rest six genes coding internal non-glycosylated proteins, from the attenuation donor. The strain is deposited in the State Collection of Viruses of Federal State Budgetary Institution D. I. Ivanovskiy Research Institute of Virology, under No. 2723.

EFFECT: invention can be used in practical health care for preventing the influenza rate in adults and children.

1 dwg, 4 tbl

FIELD: medicine.

SUBSTANCE: strain is deposited from pulmonary tissue homogenate of guinea pigs infected by the 7th passage of smallpox virus. The strain is deposited in the State Collection of Agents of Viral Infections and Rickettsial Diseases of State-Financed Research Institution State Scientific Centre of Virology and Biotechnology Vector of Federal Service for Supervision for Consumer Rights Protection and Human Welfare, registration No. V-624. The strain causes an acute lethal infection with the more manifested clinical pattern in guinea pigs 200-300g heavy infected intranasally, thereby modelling smallpox in a human.

EFFECT: strain can be used for studying in vivo the efficacy of the antiviral preparations and assessing the reduction routines of undesired vaccine reactions and complications accompanying primary smallpox vaccination.

3 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention relates to field of biotechnology. Disclosed are methods and technologies of hepatitis C virus neutralisation, as well as antibodies against hepatitis C virus. It is suggested to apply completely human homogeneous antibodies RYB1, RYB2 and RYB3, as well as compositions on their base for prevention and treatment of hepatitis C. Said antibodies are obtained by cultivation by hybrid BIONA-RYB1, BIONA-RYB2 and BIONA-RYB3. Efficiency of antibodies is conditioned by the fact that they bind epitopes, respectively, E1, E2, E3 of protein E2 of hepatitis C virus envelope. Neutralising activity of antibodies on modal system of human cells infection in culture is demonstrated. It is shown that application of claimed group of inventions makes it possible to increase reliability of binding hepatitis C virus by antibodies.

EFFECT: claimed group of inventions can be applied in medicine, pharmaceutical industry and close fields of science and technique.

9 cl, 9 dwg, 8 tbl, 13 ex

FIELD: medicine.

SUBSTANCE: there are presented sets of oligonucleotide probes and primers, a biological microchip and a test system for identifying and typing influenza A and B virus. The characterised test system comprises: set of agents for recovering influenza virus RNA from human biological material; set of agents for performing PCR amplification combined with reverse transcription to form fluorescence labelled influenza virus genome containing the above oligonucleotide primers; set of agents for performing hybridisation of DNA fragments prepared after the amplification on the biochip comprising the elements with the immobilised described oligonucleotide probes; where it is necessary the negative and positive reference samples are provided.

EFFECT: presented inventions provide the more accessible and simple high-specificity and low-cost method.

4 cl, 2 dwg, 2 tbl, 4 ex

FIELD: biotechnology, veterinary medicine.

SUBSTANCE: invention relates to the development of biological preparation for prophylaxis and treatment of colibacillosis (escherichiosis) and for control of carriage of escherichious infections pathogens in animals and poultries also. Also, invention can be used in producing curative fodders and ecologically pure human foodstuffs. Biopreparation for prophylaxis and treatment of escherichiosis in animals and poultries comprises strains of bacteriophages Phagum Escherichia coli Ec022-DEP and/or Phagum Escherichia coli Ec021-DEP, and/or Phagum Escherichia coli Ex0782-DEP, and/or Phagum Escherichia coli Ec0781-DEP, and/or Phagum Escherichia coli EPZ-1-DEP, and/or Phagum Escherichia coli EPZ-2-DEP, and/or Phagum Escherichia coli EG-5-DEP, and/or Phagum Escherichia coli BC-1-DEP, and/or Phagum Escherichia coli M78-DEP, and/or Phagum Escherichia coli Sheksna 2k-DEP taken in the effective amount. The biopreparation comprises also antiseptic, for example, quinosol and a stabilizing agent. Protein (for example, soybean protein), vegetable meal, organic polymer, milk, serum, albumin can be used as a stabilizing agent. Among organic polymers can be used: dextran, polyglucin, starch, polyvinylpyrrolidone. The biopreparation can be dried by lyophilization, granulated and placed in polymeric matrix. The biopreparation has no toxic properties on animals, it shows good hygroscopicity and can be good dispersed in water. The biopreparation can be used in liquid and dry prescription formulations and in different methods of its administrations: both by subcutaneous, intraperitoneal, intramuscular injections and as an aerosol, by administration of phage particles into lung compartments including applying as curative fodder and supplement to fodder, and by applying on surface of cutaneous integuments. Invention provides enhancing the effectiveness of treatment of animals and poultries with gastroenteric infections due to reducing treatment period, expanding spectrum of lytic effect of the biopreparation, resistance to effect of digestive tract enzymes and convenience in using.

EFFECT: valuable veterinary properties of biopreparation.

9 cl, 5 tbl, 7 ex

Up!