N-acetyl-l-cysteine for treatment of endometriosis

FIELD: medicine.

SUBSTANCE: invention relates to a method of treating a mammal with endometriosis. The claimed method includes the pulse or interrupted peroral introduction of an N-acetyl-L-cysteine-containing pharmaceutical composition for 3-5 successive days with the following 2-4-day break or for 1-3 successive days with the following 1-2-day break, for at least a two-month time period. N-acetyl-L-cysteine in the said method is introduced in a dose, constituting from 20 to 90 mg/kg/day.

EFFECT: claimed method provides the more significant effect with respect to endometriosis symptoms in comparison with the traditional daily introduction of N-acetyl-L-cycteine.

11 cl, 7 dwg, 2 tbl, 3 ex

 

Field of the INVENTION

The present invention relates to pharmaceutical compositions containing N-acetyl-L-cysteine, useful in the treatment of endometriosis and indications associated with endometriosis.

PRIOR art

Endometriosis is the third leading cause of gynecologic hospitalization in the United States, affecting approximately 14 million women in Europe. Widely used, the incidence of endometriosis include 5-10% of all women of reproductive age and 30-40% of all women with infertility problems. It is a disease characterized by the presence outside the uterus of tissue that is histologically identical to endometrium, that is the membrane that lines the inside of the uterus of a mammal. This abnormally located tissue develops into growths or lesions (also called implants or nodular thickening), which respond to the menstrual cycle in the same way as the endometrial tissue of the uterus: each month the tissue builds up, breaks down and sloughs. While menstrual blood flows from the uterus, the blood and tissue sloughed from endometrial growths has no way to drain out. This leads to internal bleeding, separation of the blood vessels and tissues from damage and after�following chronic inflammation.

The two most common symptoms of endometriosis are pain and infertility. Symptoms may include: dysmenorrhoea, the pain before or after menstrual periods, pain during or after sex; chronic pelvic pain or pain the lower back and intestines; heavy menstrual periods or spotting and bleeding between periods; painful bowel movements or painful urination during menstrual periods; infertility.

The cause of endometriosis is currently unknown, and there have been several theories to justify ectopic migration and implantation of endometrial cells. Recent data establish a link between the occurrence of endometriosis and altered state of the tissue of its origin: when compared with eutopic endometrium. In this area strengthens the confidence that uncontrolled migration, implantation and growth of endometrium arise from disorders in when compared with eutopic endometrial cells.

Currently there is no cure for endometriosis. There are many treatment options, and there are ways to minimize the symptoms caused by this condition. With the exception of the use of analgesics for pain management, treatment of endometriosis is mainly associated with suppression of ovarian function in the secretion of estrogen, and because e�CSOs hormonal treatments of various subjects, until the induction of menopause in the most severe cases. surgery is used to remove endometrium, adhesions, peritoneal implants and deep lesions, localized in rectovaginal a bulkhead or in other places (i.e. in the bladder, intestine), and for pain relief. However, relapses occur after therapeutic and after surgical treatment. Young women with endometriosis often face difficult decisions about their future reproduction. Hormonal treatment designed to suppress ovarian function, associated with pregnancy.

N-acetyl-L-cysteine (below referred to as NAC) is a well known medicine that is used mainly as a mucolytic agent and in the treatment of paracetamol poisoning. In recent years he has also been recognized as having other useful properties, such as anti-inflammatory and antiproliferative effect, and has been proposed for the treatment of various disorders and symptoms, such as schizophrenia, diabetes and cancer.

In previous studies investigating molecular mechanisms underlying endometriosis and associated with it was assumed that the increased rate of cell proliferation in endometriosis can be induced by oxidative stress in the e�Demetriades tissue, caused by free radicals or ROS (reactive oxygen species - ROS-reactive oxygen species). Thus, it was assumed that new therapeutic strategies for endometriosis can be based on the antioxidants and acceptors ROS, such as NAC.

PRIOR art

Charlotte Ngo et al. suggested (The American Journal of Pathology (2009), Vol.175, No.I, pages 225-234) that oxidative stress can induce or enhance the proliferation of endometrial cells in endometriosis. Therefore, for the treatment of endometriosis have been proposed antioxidants such as NAC. Studies on primary cell lines of patients with endometriosis, as well as in a mouse model with the implanted endometrial tissue of human origin showed that NAC cancelled the signs of oxidative stress, and increased proliferation in the respective models. Thus, it was assumed that antioxidants such as NAC, can be used as a safe and effective treatment of endometriosis.

Nastaran Foyouzi et al. also proposed (Fertility and Sterility (2004), Vol.82, Suppl. 3, pages 1019-1022) that antioxidants such as NAC can be used to treat endometriosis. The article describes a study in vitro, where cells isolated from healthy subjects and patients with endometriosis were treated with other antioxidant such as NAC. All antioxidants ingabire�Ali proliferation of endometrial stromal cells.

In the studies of Yan Wo and Sun-Wei Guo (Gynecologic and Obstetric Investigation (2006), Vol.62, No. 4, pages 193-205; European Journal of Obstetrics & Gynecology and Reproductive Biology, (2008), Vol.137, pages 198-203); US patent application 2007/0287676 A1) studied the effect of NAC on the proliferation and cell cycle arrest in the immortal endometrial stromal cells and compared with other agents proposed for the treatment of endometriosis. It has been shown that NAC affects both proliferation and cell cycle arrest, although not as pronounced as inhibitors distanceinmiles.

In the study S.'estany et al. (Journal of reproductive Immunology (2007), Vol.75, pages 1-10) it was shown that the antioxidant activity of NAC and other antioxidant agents in relation to endometrial cells in culture improved the viability of oxidized cells by preventing cell cytotoxicity induced H2O2.

Other related prior art includes US 2003/0190381 A1, WO 2004/096206 A2, US 6239137 B1, US 2003/0119875 A1, US 2004/0014672 A1 and WO 2005/048822 A2.

Other prior art describing the molecular action of NAC in the treatment of cancer, includes T. Parasassi, et. al. (Cell Death and Differentiation (2005), Vol.12, No. 10, pages 1285-1296); E. K. Krasnowska et. al. (Free Radicals Biology and Medicine 2008, 45(11): 1566-72) and A. C. Gustafsson et. al. (BMC Cancer(2005), 5:75).

The OBJECTIVE of the INVENTION

Clinical results of treatment of NAC with endometriosis, according to the authors of the invention, b�l is defined in the prior art, also was not offered an effective regimen for the treatment of endometriosis or the use of NAC for the treatment of indications associated with endometriosis.

Therefore, the main goal of the present invention is to offer a solution to the problem of obtaining pharmaceutical compositions containing N-acetyl-L-cysteine (NAC), for the treatment of endometriosis and indications associated with endometriosis, in humans and mammals. One aspect of this goal is the offer of a pharmaceutical composition containing N-acetyl-L-cysteine (NAC), for use in effective regimen for the treatment of endometriosis and the symptoms associated with endometriosis, in mammals, including humans.

A BRIEF SUMMARY of the INVENTION

It was assumed that NAC can be used in new therapeutic strategies for endometriosis on the basis of its use as an antioxidant and acceptor ROS. The authors of the present description shows that NAC induces molecular and cellular changes that not only inhibits proliferation, but also induces the differentiation of diseased tissue relative to normal tissue.

This information led the authors of the present invention to offer a new destination NAC in the treatment of endometriosis and indications associated with endometriosis, the patient, representing a human or MLC�animal feed. In addition? offered interval effective doses of NAC in the treatment of endometriosis. In one embodiment of the present invention, the prescribed mode of treatment can be used, for example, to control the frequency and intensity of pain symptoms (dysmenorrhea, dyspareunia, and noncyclic chronic pelvic pain), to reduce the size of endometriotic lesions eventually until their disappearance, to reduce recurrence after surgery and/or to improve fertilization. Side effects of this treatment are virtually absent and, in particular, this treatment does not prevent pregnancy.

The present invention provides a pharmaceutical composition comprising N-acetyl-L-cysteine for use in the treatment of a mammal, including man with endometriosis, where the composition is intended for pulsed or intermittent oral administration, during a time period of two months or more, N-acetyl-L-cysteine at a dose, of from 20 to 90 mg/kg/day per day, when administered.

In one embodiment of the invention proposed pharmaceutical composition comprising N-acetyl-L-cysteine, for the above application, where the composition is intended for administration during 3-5 consecutive days, followed 2-4 days break. In yet another embodiment, a pharmaceutical composition comprising N-AC�Teal-L-cysteine, intended for introduction within 1-3 consecutive days, followed by 1-2 day break.

In one embodiment of the invention proposed pharmaceutical composition comprising N-acetyl-L-cysteine, for the above application, where the composition is intended for the introduction of N-acetyl-L-cysteine at a dose, of from 30 to 60 mg/kg/day to day administration. In yet another embodiment, a pharmaceutical composition intended for the introduction of N-acetyl-L-cysteine at a dose, of 30 to 45 mg/kg/day to day administration.

In one embodiment of the invention proposed pharmaceutical composition comprising N-acetyl-L-cysteine, for the application described above, where the pharmaceutical composition is protected from light. In yet another embodiment of the pharmaceutical composition is a water-soluble tablet. In yet another embodiment the pharmaceutical composition comprises sodium bicarbonate. In one embodiment the pharmaceutical composition is a drug with a slow release and/or a drug to protect the stomach.

In one embodiment of the invention proposed pharmaceutical composition comprising N-acetyl-L-cysteine for use in the treatment of pain caused by endometriosis. In yet another embodiment of the pharmaceutical composition is intended for use in the treatment of infertility caused�wow endometriosis. In yet another embodiment of the pharmaceutical composition is intended for application in the preliminary treatment of mammals with endometriosis before laparoscopy or surgery. In one embodiment the pharmaceutical composition is intended for use in the treatment of mammals with endometriosis after a laparoscopy or surgery, to prevent recurrence.

In one aspect, the invention provides a method of treatment of a mammal with endometriosis involving the oral administration of pharmaceutical compositions containing N-acetyl-L-cysteine, to the specified mammal in a pulsed or intermittent stages over a period of two months or more, N-acetyl-L-cysteine in a dose ranges from 20 to 90 mg/kg/day per day when administered. In one embodiment of the method the pharmaceutical composition is administered for 3-5 consecutive days, followed 2-4 days break. In yet another embodiment the pharmaceutical composition is administered within 1-3 consecutive days, followed by 1-2 day break.

In one embodiment of the method, the dose of N-acetyl-L-cysteine ranges from 30 to 60 mg/kg/day to day administration. In yet another embodiment of the method, the dose of N-acetyl-L-cysteine ranges from 30 to 45 mg/kg/day to day administration.

In one embodiment a method for treating pain caused by endometriosis�M. In other embodiments the method is designed for the treatment of infertility caused by endometriosis, pre-treatment of mammals with endometriosis before laparoscopy or surgery or for treatment after laparoscopy or surgery, to prevent recurrence of endometriotic lesions.

BRIEF DESCRIPTION of GRAPHIC MATERIALS

The present invention will be explained in more detail in the following description, with reference to the accompanying graphic materials, where:

Fig.1 shows the inhibitory effect of NAC on the growth of endometriotic lesions in mice, as demonstrated in example 1. The average total mass of control (n=10) and NAC-treated (n=10) animals within 21 days after implantation, with the standard error. The significance of p<0,05. In the boxes above the histogram reproduced the typical pattern of endometrium to control (A) and NAC treatment (B). Stripe: 1cm;

Fig.2A shows a typical gels of semi-quantitative RT-PCR (polymerase chain reaction in real time), as demonstrated in example 1. Fig.2B shows a reduced expression of COX-2 and MMP-9 in the cysts NAC-treated mice, as demonstrated in example 1. The value of semi-quantitative RT-PCR, averaged for 5 control and 5 NAC-treated mice with standard error;

Fig.3 shows the movement of E-cadherin in the cysts NAC-treated �ISA, as demonstrated in example 1. A typical image of immunoablative E-cadherin in endometrioma from control (A and b) and NAC-treated mice (C and D). In the control samples can be observed diffuse brown staining throughout the cytoplasm of epithelial cells, while in NAC-treated samples the staining clearly limited to the cell-cell. The increase of the original 40H;

Fig.4 shows weak staining of Cox-2 in the cysts NAC-treated animals, as demonstrated in example 1. A typical image of immunohistochemical staining of cysts control mice (A-C) and NAC-treated mice (D-F). In the control samples revealed a marked presence of brown staining in several areas, while it can barely be detected in NAC-treated samples. The increase of the original 40H;

Fig.5 shows weak staining of Ki-67 in the cysts NAC-treated animals, as demonstrated in example 1. A typical image of immunohistochemical staining of cysts control mice (A-C) and NAC-treated mice (D-F). Arrows point to stained, proliferating cells. The increase of the original 40H;

Fig.6 shows a schematic view of prior art showing several mechanisms operating when proliferate�their cells, for example, cancer cells treated with NAC. These mechanisms are limited to terminal differentiation of the cells. Examples of the present description also shows that at least some of these effects also occur if the NAC, according to the present invention, used for the treatment of endometriosis;

Fig.7 shows the results of a preliminary clinical study performed a total of 64 women, 33 NAC treated and 31 untreated control. Change the size of the cysts after three months of treatment with NAC was measured using ultrasound in the form of maximum diameter. Fig.7A shows the change of the size of cysts in absolute numbers in treated patients and controls. Fig.7B shows the same comparison in the form of changes in percent.

DETAILED description of the INVENTION

NAC in General

N-acetyl-L-cysteine (NAC) is a well-known low-molecular pharmaceutical drug with the chemical formula

NAC

Properties of NAC are mainly associated with its thiol group, which makes it effective in most biochemical pathways that involve tripeptinon (GSH), present in all human tissues in relatively high concentrations, even above 10 mm. Cysteine really�situated among three amino acids, containing GSH, so NAC is considered a precursor of GSH with his deacetylating cysteine. NAC has been used and is still widely used as a mucolytic agent, when the mode of action generally refers to the redox destruction of sensitive disulfide bridges of cysteine in proteins of mucus. In fact, NAC is involved in complex redox cycle thiol groups, where there are several enzymes. Indeed, the exceptional physiological importance is the cycle of formation and destruction of disulfide, a common mechanism by which regulates the activity of the protein and cell signaling. Enzymes, such as proteinconcentrated and tyrosine kinase inhibitors, for example, play a key role in the control of cell cycle, cell proliferation and differentiation, and many of them are regulated by the redox state of their cysteines.

In General, although the detailed mechanisms of action have not been completely elucidated, NAC, apparently, affects all biochemical pathways involving GSH. Enzymes and proteins whose activity is modulated by GSH, operate in multiple processes, either directly or through a network of transmission paths of signals. In this situation, NAC may act similarly to GSH, or may be even more effective, h�m GSH.

GSH, for example, usually forms conjugates with reactive metabolites formed by paracetamol and promote detoxification. However, when you take an overdose of paracetamol, GSH is depleted, and the metabolites of paracetamol are beginning to interact with cellular proteins, ultimately leading to cell death. In the treatment of fulminant hepatic failure after paracetamol poisoning NAC acts instead of GSH in the detoxification of metabolites of paracetamol. I believe that NAC virtually no unwanted side effects also indicate that high-dose NAC, which are used in the treatment of paracetamol poisoning - presumably about 40 g/day for a patient weighing 70 kg.

Unlike the Tripeptide GSH, which can disintegrate in the stomach, simple NAC molecule diffuses freely in almost all tissues and cells. Pharmacokinetic studies NAC has determined a peak plasma concentration that can be reached in approximately one hour, with a half-life of about three hours. Complete clearance occurs between six and twelve hours.

NAC as antiproliferative, differentiating agent

Recently, the inventors have discovered that N-acetyl-L-cysteine (NAC) has significant antiproliferative effects on cancer cells of epithelial origin guarantee / warranty international�of - same origin, and endometrial cells (Cell Death and Differentiation 2005, 12(10): 1285-1296). Although cancer and endometriosis are mostly unrelated diseases, they share some common properties, which ultimately led the inventors to the idea that NAC may also be useful in the treatment of endometriosis. In particular, endometriosis, almost as much as cancer is a proliferative disease, although other unknown underlying molecular mechanism and etiology. Observations received for cancer, will be presented in this description of the invention as a prerequisite for the effects of NAC and as a likely mode of action also with endometriosis.

NAC used to stop cell proliferation and induce differentiation into two cell lines of adenocarcinoma and in normal primary keratinocytes cells, all cells of epithelial origin. In these systems, the differentiation was characterized morphologically, biochemically, and through analysis of gene expression (analysis of gene expression is widely reported in BMC Cancer 2005, 5: 75).

In cancer research the antiproliferative effect of NAC was not associated with cell death or toxicity, but, instead, a consequence of the activation of the path physiological differentiation, which can be regarded as the normalization of cleto�'s functions in relation to the tissue of origin.

In addition to reduced proliferation also changed the morphology of NAC-treated cancer cells. In vitro, epithelial cells in active proliferation exhibit irregular morphology of mesenchymal morphology and often multicellular form several layers. In contrast, when cells are undergoing the process of differentiation to the structure and function of their target tissues, they stop proliferation, their morphology becomes a regular polygon, each cell is sometimes thicker, and they form a monolayer adherent cells. This process is accompanied by increased connections cell-cell and cell-substrate in accordance with a shift from proliferating mesenchymal to adhesive, less mobile and differentiated phenotype.

In General, a complex series of metabolic changes were detected after addition of NAC to the cancer cells, all of which was to stop uncontrolled cell proliferation and induces their terminal differentiation, as depicted in the diagram shown in Fig.6.

Especially NAC treatment induced a significant increase in adhesion complexes, cell-cell and cell-substratum.Uncontrolled proliferation can be attributed to the state when the cells have lost contact inhibition and its ability to respond to differentiation signals.Cells entering the path of differentiation, showing a marked increase in complexes of the compounds of cell-cell, and this process is also generally pointed to as contact inhibition. Some data indicate that signals the cells to enter the end point of differentiation give rise to the components themselves intercellular complexes. These compounds are also through the distribution of signals between cells.

Migratory cells such as endometrial cells of endometriosis, should in addition to a reduced amount of adhesive complexes, to have and to secrete sufficient amounts of active matrix metalloproteinases, enzymes that are intended to damage the extracellular matrix, to permit migration through the extracellular matrix.Interestingly, in this model, epithelial cancers, NAC was found to inhibits this enzyme, allowing to assume that cell migration was delayed. Also example 1 this description really shows that NAC when used according to the present invention for the treatment of endometriosis inhibits expression of matrix metalloproteinase 9 (MMP-9). This suggests that NAC can inhibit cellular migration both from when compared with eutopic endometrium to new implants (prevention of recurrences) and in endometrioid�th tissue (preventing further losses).

Known effect of NAC was also relevant to its anti-inflammatory effect, the reason for adding it to the family of nonsteroidal anti-inflammatory drugs (NSAID). The gene expression profile NAC-treated cells indeed showed inhibition of cyclooxygenase-2 (COX-2), induction of the gene which is associated with inflammatory reactions. Also, this effect of NAC was confirmed by endometrial tissue in example 1 of this specification, suggesting that NAC may also ease the symptoms associated with inflammation in endometriosis.

As an example, the ability of NAC to modulate signal transduction in cells through redox sensitive status cysteines, studied the enzyme - preceptory tyrosine kinase C-Src in in vitro models of carcinoma cells of the colon (CACO-2) cells and ovarian carcinoma (OVCAR-3) (Free Radicals Biology and Medicine 2008, 45(11): 1566-72). c-Src is involved in switching the proliferation/differentiation and is active in the Assembly/disassembly of related complexes and cytoskeletal organization. This kinase is activated and sverkhekspressiya in a number of human cancers, particularly carcinoma of the colon and ovaries. Notable international efforts to develop drugs really are directed at finding specific inhibitors of c-Src. Instead, would�about detected, that through simple treatment of adenocarcinoma cells with NAC you can achieve the goal is the suppression of c-Src by a mechanism related to the redox transitions in sensitive cysteine residues in c-Src is able to "turn off" this kinase, to bring her endolysosomes, where it is stored or destroyed. Thus, NAC, induced terminal differentiation in adenocarcinoma cells, was associated with the suppression of c-Src. It should be noted that the activity of this kinase is important during the decidual phase of the cycle endometrial cells, thus allowing to assume the involvement of its deregulation in disease (Endocrine Journal, 2008, 55(5): 795-810).

NAC and endometriosis

As explained in the previous section, it was assumed that NAC could be used in new therapeutic strategies for endometriosis, on the basis of its use as an antioxidant and acceptor ROS. In studies of epithelial cancer, as described above, the authors present invention found that NAC had some useful effects than effects such as antioxidant and acceptor ROS on cells of epithelial cancer, and that such effects could also be useful in the treatment of endometrial cells in case of endometrial cells respond similar�m. In particular, it was expected that the antiproliferative and differentiating effects of NAC found in cancer, can also occur when using NAC in the treatment of endometriosis.

He believed that if NAC has the following molecular effects observed in cancer, also in endometrial tissue, it could be useful for the treatment of endometriosis;

1) increase connections cell-cell and cell-substrate in accordance with a shift from a proliferative to a differentiated phenotype;

2) reducing the expression of matrix metalloproteinases associated with decreased cell migration;

3) reducing the expression of cyclooxygenase-2 (COX-2) associated with a reduced inflammatory response;

4) modulate the activity of c-Src to regulate endometrial cycle proliferation/deciduation and to provide for a possible pregnancy.

Therefore, it was hypothesized that NAC can provide the following physiological effects endometriosis:

1) decrease endometrial cell proliferation;

2) reduction of local chronic inflammation and thus relieve the associated pain;

3) normalization of the tissue source, when compared with eutopic endometrium, through a more regular cycle of proliferation-differentiation;

4) reduced the number�tvo ectopic endometrial cells associated with reduced cell motility due to a reduction of tissue metalloproteinases and reduced compounds cell-cell and cell-substratum;

5) reorganization of the conformation of the estrogen receptor through re-Assembly of disulfide bridges in the relevant cysteine residues.

In General, all the estimated results confirmed either directly or indirectly through the response of patients in a clinical study and by histological analysis of biopsies or in animal models, at the level of morphology, histology, biochemistry and molecular biology.

In particular, the inventors found that NAC really reduces the expression of cyclooxygenase-2 (COX-2) and matrix metalloproteinase 9 (MMP-9) in endometrial tissue. They also demonstrate that NAC induces relocalization E-cadherin from the cytoplasm into endometrial tissue in the intercellular connections in the tissue treated with NAC. This indicates an increase of intercellular connections, which is consistent with a decrease in cell proliferation. Indeed, other effects, such as increased expression of P21 and decreased expression of Ki-67, also indicate that NAC treatment endometriosis leads to reduced cell proliferation. The inventors also demonstrate that these molecular effe�you NAC-treatment of endometriosis reduce the size of endometriotic lesions, to alleviate the pain and to the desired pregnancy. The advantage of using NAC for the treatment of endometriosis or indications associated with endometriosis, is that you do not want to use commonly used hormonal treatment for endometriosis, which suppress ovarian function. The use of NAC, thus, relatively increases the likelihood of these patients to become pregnant. Treatment with NAC prior to surgery also led to more correct and compact endometriomas that are more easily removed, and caused very little bleeding during the laparoscopy.

Regimen

From the study of NAC treatment on cell lines of adenocarcinoma and primary normal cells keratinocytes (Cell Death and Differentiation 2005, 12(10): 1285-1296), it was concluded that the effective dose of NAC for the induction of antiproliferative-differentiating effect was varied and depended on the cell type. Thus, the origin of the tissue dictates the effective concentration of NAC, which requires that there was a complete block of proliferation must be defined for each tissue. In addition, the dose of NAC was also correlated with the malignancy of cells. In more detail, while normal cells required a low dose to stop proliferation and start differentiation, carcinoma cells with a characteristic adverse was prognathochromis higher concentration of NAC.

For the purpose of the present invention, the NAC regimen for the treatment of endometriosis in a mammal, including man, developed on the basis of the following criteria:

1) the dosage of NAC per day, which is consistent with other modern clinical treatments and is considered to have no unwanted side effects;

2) dose, which is considered high enough to meet the demand of abnormally proliferating cells to put them on the path of differentiation;

3) given the described reduction of NAC in plasma after prolonged treatment (Pendyala L, Creaven PJ. Cancer Epidemiol Biomarkers Prev. 1995; 4:245-51), a break in treatment for about half of each week was considered as an optimum biological response in the treatment for two months or longer.

The composition of the present invention containing NAC for the treatment of endometriosis or indications associated with endometriosis, according to one embodiment of the subject introduction in a dose of from about 20 to 90 mg/kg/day. The lower limit is based on twice the dose used for mucolytic actions, that is known that it has physiological effects. The upper limit is based on the observation that higher doses, as found to cause stomach problems in many patients. In yet another embodiment of the present invention.�Oia contains NAC to dose approximately 30-60 mg/kg/day. It is shown that the lower limit of effective endometriosis, and it is known that the upper limit has virtually no side effects. In yet another embodiment of the present invention, the composition comprises NAC for administration at a dose of about 30-45 mg/kg/day. Unexpectedly, it was shown that this low dosage is effective for endometriosis.

In one embodiment the composition is to be administered in the period of time, which is two months or more, or preferably three months or more. To prevent the decrease in the level of NAC in plasma after prolonged treatment, you can enter NAC in prescribed dosage intermittent manner, i.e. according to an intermittent regimen/treatment. Intermittent introduction or treatment means the treatment is interrupted for periods, i.e. that the pharmaceutical composition is administered over some period of time, e.g. several days, followed by a break in the introduction, when the pharmaceutical composition is not administered for some period of time, for example within a few days. Intermittent treatment may be regular, for example treatment for a fixed number of days or weeks followed by a break during a fixed number of days or weeks. Examples include repetitive schemes with treatment within 4 su�OK followed by a break for 3 days each week or treatment for 2 weeks followed by a break of 1 week. The special case of regular intermittent treatment is a pulsed treatment, that is, regular treatment and the duration of the break, such as the introduction every second day or for a period of two days followed by two days of break, and so on. Also possible schemes are irregular intermittent treatment, which repeat regularly or have a more complex scheme, which is repeated, for example, depending on response to treatment. In various illustrative embodiments of the present invention, the prescribed dose of NAC administered for 3-5 consecutive days, followed 2-4 days break, or administered for 1-3 consecutive days, followed by 1-2 day break.

In one embodiment, with reference to body weight about 60 kg, the dose of NAC is in the range from 1.2 to 5.4 g/day, preferably from 1.8 to 3.6 g/day. This dose can be divided into two or more, preferably three or four, daily introducing either one or two doses (e.g., pills) each, where each dose may contain, for example, 0.15 to 2.7 g NAC or preferably 0.6-1.2 g NAC. Treatment includes the introduction of the above doses of pulsed or intermittently, for example every second day or for three to four consecutive days every week�, with a break from four to three days, respectively. Minimum total duration of treatment leaves from two months, with no maximum duration. For patients with other masses, such as subjects with weight above or below this, the daily dose should be adjusted accordingly.

In one embodiment of the present invention pharmaceutical composition for the treatment of endometriosis or endometriosis related symptoms, contains NAC at a dose of 150-5400 mg for injection two or more injections per day during a period of at least 2 months, such as at least 3 months. In a preferred embodiment of the present invention the pharmaceutical composition comprises NAC at a dose of 230-3600 mg for injection two or more injections per day during a period of at least 2 months, such as at least 3 months. Treatment includes the introduction of the above doses of pulsed or intermittently, for example every second day or for three to four consecutive days every week with a break from four to three days, respectively.

The pharmaceutical composition

Pharmaceutical composition according to the present invention may be prepared in a manner which is in itself known to those skilled in the pharmaceutical field. The composition may contain an effective amount�about NAC in accordance with the invention, and a suitable carrier or excipient, which serves as a delivery vehicle or medium for the active ingredient. Such carriers or excipient known in the art and include solid substances, such as citric acid, sodium citrate, sodium carbonate (acid) plus flavoring. Pharmaceutical composition is preferably adapted for oral administration. Such compositions can be administered in different forms, at present preferably in the form of tablets. There might also be other forms, such as capsules, suppositories, solutions, suspensions, syrups or the like.

The invention requires rigorous evaluation of pharmaceutical quality of the drug NAC to obtain the effective dose. Therefore, you should use the brands or certified generic drugs. NAC is not a stable molecule, its active thiol residue can be easily oxidized by oxygen, light and other radiation, so that the effective dose may not be achieved. The drug, thus, preferably protected from light, soluble pills, and sodium bicarbonate, which contributes to the partial removal of oxygen from water during dissolution.

It was observed that high doses of NAC may cause abdominal pain. To overcome this you can offer NAC in combination with at�the ITA of the stomach, appropriate to prevent the release/NAC solubility in the stomach. Such compositions are well known in the art and can be used in the present invention. For example, you can use the tablet coatings which are resistant to the fluids of the stomach and allow drug release only in the intestine after passing through the stomach. Commonly used compositions include polymers, such as cellulose derivatives, copolymers of complex aminoethers methacrylate. The coating protects the tablet core from being destroyed in the acidic environment of the stomach through the use of pH sensitive polymer that swells or solubilities after passing through the stomach in response to increasing pH, with drug release.

Another option is to decrease the dose of NAC that enters the blood stream at the same time. The introduction of NAC three times or more a day can be difficult for the patient. Despite this, repeated administration may be desirable to achieve an almost constant concentration of NAC in the serum. To overcome these problems, the introduction of one or two times a day, for example morning and night, it may be easier for the patient. One option is the offer of NAC in combination with slow release (also called �medlennym release or adjustable release). This composition makes possible the introduction of higher doses with longer intervals, as they are able to reduce the rate of diffusion and capture of NAC in the bloodstream. Then, the dose is distributed in the blood for a long time in small amounts, for example for 12+12 hours in the case of regimens twice a day. Many different technologies and compositions for sustained release has long been known in the art and can be used in the present invention. In such technologies the active substance, for example, encapsulate in a shell or matrix which is insoluble or less soluble in the liquid environment of the body where it is administered. Composition having a combined effect of slow release and protection of the stomach are also possible and can be used in the present invention.

Application/medical conditions of the present invention

It is shown that the present invention has useful properties in many aspects associated with endometriosis, and can be used to treat endometriosis and to treat a variety of indications associated with endometriosis. Under the treatment of various indications associated with endometriosis, see, for example, treatment for the relief of symptoms such as pain and inflammation; treatment of glauberite the likelihood of pregnancy; a preliminary treatment prior to surgery to facilitate removal of endometriotic lesions and to improve the result of the operation; treatment after surgery to prevent recurrence of lesions; and preventive treatment in the case of a proven, evaluated risk factors or the presence of hereditary endometriosis.

It has been shown that NAC, according to the present invention, reduces the size of the lesion and returns proliferative tissue to a more differentiated, normal tissue. Thus, in one embodiment of the present invention the pharmaceutical composition comprises NAC for the treatment of endometriosis with the aim of reducing is ultimately up to their disappearance - of endometrium, adhesions, peritoneal implants and deep lesions, localized in rectovaginal a bulkhead or in other places.

It was also shown that NAC, according to the present invention, reduces the symptoms of pain caused by endometriosis. Thus, in another embodiment of the present invention the pharmaceutical composition comprises NAC for the relief of pain associated with endometriosis.

In yet another embodiment of the present invention the pharmaceutical composition comprises NAC to stimulate desired pregnancy in a patient with endometriosis.

In yet another embodiment of the present invention, the pharmaceutical�I composition comprises NAC pre-treatment before laparoscopy or surgery in cases of endometriosis, to facilitate removal of the mass, reducing the bleeding, to make the fabric become more compact/less fragile.

In yet another embodiment of the present invention the pharmaceutical composition comprises NAC to prevent recurrence after laparoscopic or surgery.

In yet another embodiment of the present invention the pharmaceutical composition comprises NAC for use in the case of a proven, evaluated the risk factors for prevention of endometriosis due to hereditary disease.

EXAMPLES

Hereinafter the invention will be further described and illustrated by the following examples. It should be noted, however, that these examples should not be construed as limiting the invention in any way.

Example 1. The effect of NAC in a mouse model of endometriosis

Materials and methods

Substances. Unless specified, all chemicals were from Sigma-Aldrich, Milan, Italy.

Animals. 36 female BALB/C mice aged 6-8 weeks were purchased from Charles River Italia (Calco, Italy). Food in the form of pellets (enriched standard diet; Mucedola, Milan, Italy) and water were provided, as much as you want. Animals were kept in a cycle of light/dark 16/8 hours under controlled conditions. Before any invasive procedure mice were anestesiologi by intraperitoneal injection of 0.4 ml of saline containing 2.5% AV�rtina.

Induction of endometriosis. Induction of endometriosis was performed following the method described in Somigliana et al, Hum Reprod 1999 Dec;14(12):2944-50. Surgical intervention was performed in clean conditions. Briefly, uterine horns syngeneic mice was removed through a small midline incision in the abdomen just below the navel and placed in a Petri dish containing phosphate-saline buffer solution (PBS). Endometrial fragments received minor fragmentation of the uterine horns using a razor blade. Fragments suspended in 0.6 ml PBS and quickly inoculable in the peritoneal cavity of mice-recipients in the ratio of one donor to two recipients. Mice with induced endometriosis were randomly divided into two groups of 12 mice each: control and NAC treatment.

Treatment NAC. A day after implantation endometrium of mice from the treatment groups were subjected to the probe power with 100 ál of 10 mg/ml of the NAC solution in water. The control group received only water. The introduction of NAC continued daily for 21 days. Considering the average body weight of the mouse to 22.5±0,7, dose NAC 1 mg/mouse corresponds to 44 mg/kg/day. There were no signs of toxicity when administered dose based on body weight is unchanged at the end of treatment in relation to eating, grooming, or levels of activity compared to the controls. At the end of treatment, the mice were killed by CME�t his cervical vertebrae.

The collection of endometrium. At the end of treatment, animals were sacrificed and endometriotic lesions carefully excised from the surrounding tissue, were evaluated by their total mass and number. The cysts were either immediately fixed in 10% formalin or frozen in liquid nitrogen and stored at -80°C.

Histology and immunohistochemistry. Fixed in formalin, the samples were poured paraffin and tissue sections (5 µm) were stained using hematoxylin-eosin. All microscope slides were evaluated by an experienced pathologist, who was flying blind with regard to the study, and histological diagnosis of endometriosis was based on the morphological identification of endometrial glandular tissue and stroma.

For immunohistochemistry slices were deparaffinization and rehydratable fine ethanol. For antigen retrieval the sections were treated with microwave for 6 min in 0.1 M citrate buffer (pH 6.0) and the activity of endogenous peroxidase was blocked by incubation for 20 min in 3% mixture of H2O2/methanol. The sections were washed in a mixture of PBS/Tritonx-100, was immersed for 15 min in 1% mixture of PBS-bovine serum albumin (BSA) to block nonspecific binding sites and then incubated with the selected primary antibody diluted in 1% PBS-BSA. For immunological analysis of cyclooxygenase (COX)-2 (rabbit mouse to policles�national, Cayman Chemical, Milan, Italy), Ki-67 (rabbit-to-human polyclonal, Monosan Xtra, DBA Italia, Segrate, Italy) and E-cadherin (BD Biosciences, Milan, Italy) incubation was performed over night at 4°C and the dilution represented 1:100, 1:600, 1:200 respectively. Immunohistochemical staining continued using DAKO Cytomation LSAB2 System-HRP (Dako Italia, Milan, Italy), and the sites of antibody binding were visualized with a solution strept rabbit against human polyclonal antibody avidin-Biotin peroxidase complex, using diaminobenzidine as Chromogen. Sections were contrast stained with hematoxylin, dehydrated, placed in canadian balsam and then examined using a Leica microscope. Quantification of expression of Ki-67 was performed in blind fashion by two independent observers; each observer counted at least 200 cells in 10 randomly selected fields for each sample and the labeling index of Ki-67 was expressed in percent.

The RNA extraction, semi-quantitative RT-PCR (polymerase chain reaction with reverse transcription and qRT-PCR (quantitative RT-PCR). Total RNA was isolated by lysis of frozen endometrial cysts with a TissueLyser (QIAGEN, Milan, Italy), using the reagent Trizol (Invitrogen, Milan, Italy) according to the manufacturer's instructions. One microgram total RNA from each sample processed with�Tivoli 1 U DNase I (Invitrogen) and transcribed with 200 U reverse transcriptase Superscript III (Invitrogen), using 250 ng random primers in a 20 µl final volume. The same cDNA product obtained from each sample was used for subsequent PCR amplification with sets of primers obtained for the target genes. Constitutive gene 18S RNA was used as internal control. Samples of the negative control consisted of the reaction mixture and primers without cDNA-matrix. Primer sequences (table 1) was created using the software Primer-BLAST, available online at: http://www.ncdi.nlm.nih.gov/

First, we calculated the ratio between the sample and constitutive gene by simultaneous amplification of gene-specific mRNA and 18S RNA in the same reaction tube. Because the procedure was not successful for all samples is probably due to the relatively small number of specific transcripts and, thus, the preferred amplification of 18S mRNA to prevent quantitative inaccuracies originating from konkurentah effects, target genes and 18S cDNA created in the same RT reaction, were amplified in separate tubes. To document the amplification in the exponential interval and created a graph of amplification for RNA 18S and chose the corresponding number of cycles. Semiquantitative PCR was performed in a reaction volume of 25 µl with 1 µl of cDNA, 2 mm MgCl 2, 0.2 mm dNTP, 0.5 µm of each primer and 1.25 U polymerase Hotstart Taq (QIAGEN). PCR amplification was performed using iCycler (Bio-Rad, Milan, Italy). Then the electrophoretic PCR products were separated on 1.5% agarose gel and stained with ethidium bromide. The levels of target mRNA was assessed by densitometric scanning and normalized against 18S loaded controls. Densitometric analyses of the PCR products was performed using software for image processing Quantity One (VersaDOC, Bio-Rad).

Table 1
The sequence of primers use for semi-quantitative qRT-PCR
Target mRNAPrimersSequenceAnnealing (30 seconds)The number of cyclesThe PCR product (base pairs)
18S RNA NR_003278.1direct returnCGCGGTTCTATTTTGTTGGT60°C18-24219
AGTCGGCATCGTTTATGGTC
�OH-2
NM_011198.3
direct returnCCCCCACAGTCAAAGACACT60°C35196
AGTTGCTCATCACCCCACTC
MMP-9 NM_013599.2direct returnTGAATCAGCTGGCTTTTGTG60°C35242
GTGGATAGCTCGGTGGTGTT
P21 (cdknla) NM_007669.4direct returnTCCACAGCGATATCCAGACA60°C35196
ACGAAGTCAAAGTTCCACCG

Results

The treatment effect of NAC on the growth of endometriotic lesions. Twenty one days after the induction of endometriosis of all experimental mice were sacrificed and their endometriomas were removed and collected. Of the 12 control mice, one died and one did not develop endometriomas. Of the 12 mice treated with NAC, the two did not develop endometriomas. Morphologically ectopic lesions were large, cystic and vascularized: they consisted of filled �EKASTU cysts which were either white, red or occasionally brown in color, and preferably localized on the peritoneum of the abdominal-pelvic cavity. In the insets of Fig.1.1 the authors of this invention show a typical image of the cysts from control (A) and NAC-treated (B) animals. On average, a significant decrease in weight was observed in the treatment group (n=10) versus controls (n=10) (Fig.1).

NAC reduces the expression of COX-2 and MMP-9 and off proliferation. Analysis of RT-PCR showed that, relative to the cysts from control mice (n=5), NAC treatment (n=5) induced a significant decrease in the levels of COX-2 (-32%) and MMP-9 (-34%) mRNA, with a significance of p<0.01, normalized to 18S expression (Fig.2A and b). Gene P21, usually expressed only when the cycle of cell proliferation is blocked, never expressively 5 controls, although he expressively in 3 of 5 study NAC-treated samples (a typical example in Fig.2A).

NAC launches relocalization E-cadherin. Immunohistochemical detection of E-cadherin was positive in 100% of studied cases. Tagging was restricted to glandular epithelial cells, while no sample was represented by stromal staining. At the cellular level in the cysts control mice, the inventors found that the staining of E-cadherin was diffused throughout the cell� the cytoplasm, while cysts in NAC-treated mice E-cadherin is mainly found along the intercellular junctions (Fig.3). E-cadherin is part mnogovekovogo adhesion complex, so its increased presence on the borders of the cells indicates increased intercellular adhesion. In addition and in accordance with the expression of P21, as described above, this movement is consistent with the loss of proliferative behavior of the cells switched to terminal differentiation (Conacci-Sorrell et al, J. Clin. Invest. 2002, 109: 987-991; Parasassi et al, Cell Death Differ. 2005, 12: 1285-1296).

The NAC treatment reduces the amount of Cox-2 in endometrioma. Immunohistochemical detection associated with inflammation of the protein Cox-2 showed that in relation to the cysts from control mice, the samples collected from NAC-treated mice showed very weak staining, which in some cases was completely absent (Fig.4).

NAC reduces the number of proliferating cells. The Ki-67 antigen (Ki-67) is a classic marker of cell proliferation, resting in the resting phase of the cell for which there is no expression of Ki-67. When used for staining of cysts control mice it was possible to detect several labeled cells (arrows in panels A-C in Fig.5). Instead, very few labeled cells were found in the cysts NAC-obra�tannich mice (arrows in panels D-F in Fig.5). Statistical evaluation performed on 8 animals in each group (10 images/200 murine cells), provided a 54% reduction in proliferating cells (table II).

Table II
The labeling index for Ki-67 with standard error. Significance: p<0.01
Control (n=8x5)NAC-treated (n=8x5)
1,88±0,28of 0.87+0.11 a

Discussion

Animal model of endometriosis was effective in the induction of ectopic endometrial implants. Only in one animal in the control and two in the NAC-treated group did not have endometrium.

In line with expectations, the mass is proportional to the size of the cysts was lower in NAC-treated mice. This may explain the antiproliferative effect of NAC (Parasassi et al, Cell Death Differ. 2005, 12: 1285-1296), which is widely illustrated in this description, the analysis of gene expression and immunohistochemistry. Really P21, a gene expressed only in differentiated, nonproliferative cells, was observed in 60% of NAC-treated animals, while it is not expressively in the controls. In contrast, the Ki-67 protein, which is expressed only in prolif�ryuushi cells, showed a 54% reduction in NAC-treated relative to control mice.

Relevant proteins with endometriosis, such as MMP-9 (Collette et al., Hum Reprod 2006; 21:3059-3067) and Cox-2 (Carli et al, Endocrinology 2009; 150: 3128-3137), showed a decrease after treatment with NAC. MMP-9 is considered to be essential for cell movement and invasive behavior, while Cox-2 is an exemplary enzyme associated with inflammation. Both related gene showed a decrease of about 30% after treatment with NAC. Additionally, the amount of Cox-2 was also studied using histochemical staining in the cysts, and the results demonstrated relevant weakening when painting.

On the basis of a widely accepted view that considers cytoplasmic E-cadherin as a marker of the proliferative behavior of the cells, while the presence in the intercellular adhesion complex, opposite, and is considered as a marker, and as an inducer of differentiation, the inventors also studied the localization of E-cadherin cysts in the control and NAC-treated mice. The results are in perfect agreement with previous data obtained by the authors of the invention in the adenocarcinoma cells (Parasassi et al., Cell Death Differ. 2005,12: 1285-1296), indicating the movement of E-cadherin from the cell cytoplasm to the borders of the cells after treatment with NAC. This Association �-cadherin adhesion complex is also in agreement with less movable, less invasive behavior of cells.

In conclusion, in all the relations of NAC may represent the optimal treatment of endometriosis. When you transfer for the treatment of women, this drug has the significant advantage of actually having side effects compared with the magnitude of adverse effects with hormonal treatment. Therefore, NAC can be used to reduce the size of cysts, reduce the local inflammation and associated chronic pain and to reduce the recurrence after surgery. This last point is due to reduced proliferation and reduced cell motility.

Example 2. Preliminary clinical study of the action of NAC in the treatment of endometriosis.

The purpose of the study. This pilot clinical study was designed to treat women with endometriosis by applying NAC instead of other treatments. The only possible additional treatment were analgesics for pain relief when necessary.

Inclusion criteria patients. Women with an initial diagnosis of endometriosis based on the pain and confirmation of the disease by ultrasound of the ovaries, and the patients with recurrence of pain and/or ovarian endometriomas after laparoscopic treatment were included in this study.

Before treatment was measured� the intensity of pain using a 10-point visual analog scale (VAS) and the characteristics of endometrium ovaries through razvlekavshego ultrasound. During NAC treatment other treatments were excluded, except to the analgesic to treat pain as needed.

Patients. From February 2008 until July 2010 64 women with a mean age 35±7 years (±SD) diagnosed with ovarian endometriosis were included in the study, 33 of them received treatment NAC (mean age: 37±6 years), while 31 did not follow the NAC, or any other treatment and considered as control cases (mean age: 33±8 years). All of them attended one or more cysts in one or both ovaries.

Treatment. Prescribed dose of NAC was close to that used in the study of animals, 30 mg/kg/day. In practice, for the average body weight of 60 kg, for all registered patients were prescribed three oral dose of 600 mg of NAC three times a day for three consecutive days every week with a four day break. The result was 1.8 g of NAC per day, 5.4 g per week and 21.6 g per month. These precise treatments were based on the following considerations: 1) the dose of 1.8 g of NAC per day is in agreement with other modern clinical treatments and is considered to have no unwanted side effects; 2) the pharmacokinetic parameters NAC, three daily doses of 0.6 mg are approaching an almost constant level in the plasma without discomfortable patients during complex treatment; 3) officially registered the decrease in the level of NAC in plasma after prolonged treatment (Pendyala L, Creaven PJ. Cancer Epidemiol Biomarkers Prev. 1995; 4:245-51), stop the treatment for about half of each week provides optimal biological response in long-term care, for example from two to six months or longer.

Control. The intensity of pain symptoms (VAS pain scale) and the size of endometrioma of the ovary: a clinical and US examination) was assessed after the first three months of treatment. If necessary, after 3 months was performed laparoscopic treatment.

Results

Data after the first three months of the control period are described below.

Change the size of the cysts (unchanged, increased or decreased) after three months of treatment with NAC, which was measured using ultrasound as the maximum diameter shown in Fig.7A (the absolute number of cysts) and Fig.7B (the percentage of cysts). In the figures shows a comparison of the cysts in patients treated with NAC and the cyst the untreated controls. In percent (Fig.7B) reducing the size of the cysts was observed in 38% of cases, whereas in controls only less than 10% of cases showed spontaneous reduction. Given the reduction in the size of endometrium, few (21 of 33) of patients have decided to cancel or postpone planned laparoscopy.

Pain after treatment with NAC �also changed. Pain was assessed before and after three months of treatment, on a 10-point visual analog scale (VAS), where zero represented no pain and 10 points represented the strongest conceivable pain. The intensity of symptoms was classified as no (0), mild (1-4), moderate (5-7) or severe (8-10). Treated NAC patients reported less pain on average from 7.6±0.3 to 5,1±0,8 (p<0.01) after three months of treatment.

Not had any reports of harmful side effects.

Although the inventors did not assess and wished whether patients pregnancy, and therefore cannot characterize the statistical significance of the obtained data, the authors of this invention have also reported three cases of pregnancy, obviously impossible with currently used therapies for endometriosis is aimed at the suppression of ovarian function.

A remarkable observation was described by an experienced surgeon, laparoscopy after treatment of the NAC endometrioma was more regular and more compact and easily removable, therefore associated with a significant decrease in bleeding during the laparoscopy.

In another case a knot at rectovaginal partition disappeared, which indicates the effectiveness of NAC outside endometrium ovaries.

Example 3. A pulsed, intermittent and daily NAC treatment on experi�mental induced endometriosis: vaginal hypersensitivity in rats as a signal of pain - a pilot study

Materials and methods

Animals. Used 16 adults unfertilized female rats Sprague-Dawley. They weighed 200-230 g at the beginning of the study and were kept separately in a room with controlled temperature in plastic cages covered with litter. Rats had free access to water and rat feed and were kept in a 12-hour cycle of light/dark with the light comes on at 07:00. Reproductive status (pretechka, heat, politicka and diestrus) was determined by means of daily implementation of vaginal washing.

Experimental model and pre-surgical training. Before induction of endometriosis in rats trained to perform avoidance reactions to stop the expansion of the vagina, produce an inflatable latex balloon. Small nonduty latex balloon connected to a thin catheter is lubricated prior to insertion into the middle of the vaginal canal. Inflating a balloon with different volumes of air stretched the vaginal canal. The pressure produced by each tie rod volume was measured for control by means of the pressure sensor to a small amount. Apparatus for testing consisted of a small cylindrical chamber made of organic glass, created for the maintenance of rats so as to prevent her from turning. Opening the back castically allowed to connect the catheter, attached to the vaginal stimulator with a stimulating device. The photosensitive element determines the position of the rat in the chamber. If the rat stretches, as part of avoidance reactions, the light beam is interrupted and the effect stopped. The rats were allowed to adapt to the camera test by placing them in the chamber for 15 min daily for 5 days. Then the rats during the training sessions, accustomed to mechanical avoidance reactions to reduce the stretching of the vagina, which included pulling the rat's head to interrupt the light beam. All rats studied avoidance reaction for 4 sessions. After training started test session.

The testing sessions were performed 3 times per week, not the following day in a row. Each test session consisted of a series of controlled tests of avoidance. Each trial consisted of a rapid inflation of the balloon (1 ml) to a fixed volume, which was kept ever before the exercise of the rat avoidance reactions or for 15 seconds, and the balloon quickly blew off. Different amounts of expansion, including the control volume (0.01 ml), was injected three times each in random order. The maximum timeout period of 15 seconds was considered a lack of response.

Time-to-response and avoidance reactions were measured as a function of volume expansion for each session, as described in Cason AM, et al (Horm ehav. (2003), Vol.44, pages 123-31). The shorter was the time to response and the smaller the volume, giving the answer, the stronger was the avoidance response in rats. For each rat avoidance reactions, and pressure/volume for all sessions the rats (at least 12 sessions) were combined and calculated mean values. In all four experimental groups (see below) found that initial avoidance reactions to the stretching of the vagina before surgery for endometriosis were very similar.

Induction of endometriosis. Endometriosis in rats can be experimentally induced by autotransplantation pieces of the uterus. Surgery for endometriosis was performed following the Protocol originally developed by Vernon and Wilson 1985 (Fertility and Sterility, 1985, Vol.44, pages 684-694). Rats distrust was anestesiologi, was placed on a heating pad-pad to maintain body temperature and perform the operation. Performed an incision in the middle line of the abdomen to open the womb. Four pieces of the uterine horn were sewn around alternative cascade mesenteric arteries that nourish the caudal portion of the small intestine. The postoperative recovery was smooth, and regular estrus cyclicity resumed in all rats within one week.

The NAC treatment.

All rats were treated with NAC at a dose of 60 mg/kg/day (when applicable, in the day� injection) or placebo for 8 weeks after surgery. Rats were divided in four experimental groups:

The first group received pulsed NAC treatment, which means treatment through the day.

The second group received intermittent treatment of NAC, i.e. daily treatment for 5 days and 2 days of rest (i.e. 2 days without treatment).

The third group received daily treatment with NAC.

The fourth group received a sham treatment, i.e. treatment with placebo.

Avoidance reactions to stop vaginal stretching, as described above, were evaluated after 8 weeks.

Results

The results show that after surgery on the uterus in rats was induced vaginal hyperalgesia (hypersensitivity to pain).

Determined an avoidance response (i.e., the time to response and number of responses within 15 seconds when a certain amount of tension compared with the control group) and vaginal pressure for different amounts of stretching of the vaginal canal. Shows the results for four different experimental groups (values for group sham treatment were used as initial values).

The relative decrease in avoidance reactions in 0.5 ml volume of stretching relative to the imaginary group of treatment were as follows:

1. For the group of pulse NAC treatment: reducing avoidance reactions by 32%;

2. For the intermittent group NAC treatment: reduction of the reaction and�downhill at 28%;

3. For the group daily NAC treatment: reducing avoidance reactions by 18%.

It is noteworthy that the results thus show that reducing the pain effect induced by NAC treatment, was more prominent in the group of pulse treatment and in the group of intermittent treatment, compared with the group who received daily treatment.

1. A method of treating a mammal with endometriosis, including pulsed or intermittent oral administration for 3-5 consecutive days, followed 2-4 days break or for 1-3 consecutive days, followed by 1-2 day break, pharmaceutical compositions containing N-acetyl-L-cysteine, during the period of time at least two months, where N-acetyl-L-cysteine is administered in a dose, of from 20 to 90 mg/kg/day to day administration.

2. A method according to claim 1, wherein the N-acetyl-L-cysteine is administered in a dose, of from 30 to 60 mg/kg/day to day administration.

3. A method according to claim 2, where N-acetyl-L-cysteine is administered in a dose, of 30 to 45 mg/kg/day to day administration.

4. A method according to claim 1, wherein the pharmaceutical composition containing N-acetyl-L-cysteine, protected from light.

5. A method according to claim 1, wherein the pharmaceutical composition containing N-acetyl-L-cysteine, is a water-soluble tablet.

6. A method according to claim 1, wherein the pharmaceutical composition containing the N-L-cysteine, contains sodium bicarbonate.

7. A method according to claim 1, wherein the pharmaceutical composition containing N-acetyl-L-cysteine, tablet comprises a polymer coating on the basis of cellulose derivatives or of copolymers of complex aminoethers methacrylate, which provides drug release in the intestine.

8. A method according to claim 1, which is used in the treatment of pain caused by endometriosis.

9. A method according to claim 1, which is used in the treatment of infertility caused by endometriosis.

10. A method according to claim 1, which is used in the preliminary treatment of mammals with endometriosis before laparoscopy or surgery.

11. A method according to claim 1, which is used in the treatment after laparoscopy or surgery to prevent recurrence of endometriotic lesions.



 

Same patents:

FIELD: veterinary medicine.

SUBSTANCE: method comprises intramuscular administration in the body of the medicinal drug of antioxidant action prior to anticipated calving twice. The first administration is performed 50÷60 days before. The second administration is carried out 15÷20 days prior to anticipated calving. The medicinal drug is used as immunofan which is administered in a dose of 4÷5 ml per animal.

EFFECT: invention is highly effective for prevention of postpartum inflammatory diseases of uterus and mammary gland.

3 tbl, 1 ex

FIELD: veterinary medicine.

SUBSTANCE: method comprises intramuscular administration of the tylosin-containing preparation at a dose of 0.05 ml/kg body weight once a day for 3-4 days in all forms of mastitis. The tylosin-containing preparation is used as the preparation of the following composition, wt %: colistin sulphate - 4.0-6.0; tylosin base - 4.0-6.0; benzyl alcohol - 4.0; water for injection - 15.0; 1,2-propylene glycol - 100.0%.

EFFECT: use of the claimed invention enables to improve the therapeutic efficacy of treatment of mastitis.

3 tbl, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: group of inventions refers to medicine and concerns a stable composition of nanostructured Sildenafil inhibiting cyclic guanosine monophosphate (cGMP) specific phosphodiesterase type 5 (PDEV) containing a nanostructured Sildenafil base or its pharmaceutically acceptable salts having an average particle size of less than approximately 500nm, a stabilising agent, wherein the composition is prepared in a microfluidics-based continuous-flow tank reactor, and the composition possesses a semi-amorphous structure. The group of inventions also concerns a method for preparing the composition of nanostructured Sildenafil; using the above composition for preparing the pharmaceutical composition for treating male or female sexual dysfunction and pulmonary arterial hypertension.

EFFECT: group of inventions provides the improved solubility of the composition.

8 cl, 11 ex, 14 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to compounds of structural formula (I), which can be used for treating diseases mediated by an androgen receptor. In formula (I), R1 means (C2-6)alkyl, (C1-6)alkyloxy, -S(O)m-(C1-6)alkyl, (C1-6)fluoroalkyl, CN or halogen, R2 and R3 are identical or different and mean a hydrogen atom or (C1-9)alkyl, R4, R5, R6, R7 are identical or different and mean a hydrogen or halogen, X means CH or N, Y means either a nitrogen atom, or a carbon atom substituted by (C1-6)alkyl, (C1-6)alkyloxy, (C1-6)fluoroalkyl, a hydrogen atom or halogen; m is equal to 0, 1 or 2.

EFFECT: invention refers to using the compounds for preparing a therapeutic agent for preventing and/or treating hirsutism, androgenetic alopecia, hypertrichosis, atopic dermatitis, disordered sebaceous gland, such as hyperseborrhea, acne, greasy skin or seborrheic dermatitis.

8 cl, 2 tbl, 26 ex

FIELD: veterinary medicine.

SUBSTANCE: method comprises intravaginal administration of probiotic preparation "Giprolam" (Lactobacillus fermentum 44/1 and Lactococcus lactis subsp. Lactis 574). "Giprolam" is administered for 5-7 days prior to calving daily at a dose of 100 cm3.

EFFECT: use of the claimed invention promotes to maintain the amount of lactobacilli and bifidobacteria at the physiological level, prevents the colonisation of the genital tract with potentially pathogenic microflora and prevents the occurrence of postpartum infections.

6 tbl, 2 ex

FIELD: veterinary medicine.

SUBSTANCE: method comprises the combined use of the tissue preparation on the 1, 3 and 5 days of treatment, and 15% solution of ASD-2f on tetrahydrovit at a dose of 10 ml intramuscularly on the 2, 4 and 6 days of treatment. The tissue preparation is used as biogenic stimulator aminoseleton which is administered subcutaneously into the upper third of the neck in increasing dose of 40-45-50 ml.

EFFECT: method is highly effective for treatment of subclinical mastitis in lactating cows.

3 tbl, 1 ex

FIELD: veterinary medicine.

SUBSTANCE: chemotherapeutic agent is used as N,N-dimethylamino-propylamides of fatty acids of the formula 1 which are used in the form of salts with pharmacologically acceptable acids.

EFFECT: use of the claimed invention is highly effective for treatment of animals with postpartum endometritis.

4 tbl, 2 ex

FIELD: veterinary medicine.

SUBSTANCE: method comprises the use of chemotherapeutic agents. The chemotherapeutic agent is used as N,N-dimethylamino-propylamides of fatty acids of the formula 1 which are used in the form of salts with pharmacologically acceptable acids.

EFFECT: use of the claimed invention is highly effective for treatment of endometritis in animals.

4 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: group of inventions refers to medicine and medical equipment, namely to obstetrics and gynaecology, and can be used for the local treatment of inflammatory diseases of the uterine cavity. The method is implemented by inserting a waveguide of a presented device in a protection enclosure into the uterine cavity. A taper base of a narrow portion of the enclosure leans on an external orifice of the cervical uterus to prevent accidental perforation of the uterus. An infusion system regulator is used to set the spray supply of a therapeutic solution into an irrigation canal of the ultrasonic device. Thereafter ultrasonic vibrations are generated, and the uterine cavity is treated with the sounded therapeutic solution. The exposure length is 3-5 minutes at the ultrasonic vibration frequency of 25 kHz, infusion rate approximately 100-150 ml/min. The total infusion volume is not less than 300 ml. The ultrasonic treatment enables providing the continuous outflow of the uterine discharge. The device comprises an US generator, an acoustic assembly, the waveguide with the protection enclosure, the infusion system for the therapeutic solution supply. The acoustic assembly and waveguide comprises the irrigation canal. A working tip of the waveguide represents a short cylinder having a diameter greater than the rest portion. The irrigation canal of the waveguide has a diameter of 2 mm. The protection metal thin-wall enclosure has a crimped distal end and drain holes and represents two cylindrical elements of various diameters connected by a taper junction with milled grooves arranged so that to enable the fluid access to the working tip cylinder, the length of which makes no more than 3 mm.

EFFECT: inventions provide the effective cleansing of the uterine cavity from infected and necrotised tissues with improved comfort and safety of the procedure with using no endoscopic equipment, cervical dilation manipulations and uterine pre-probing.

2 cl, 3 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: invention refers to veterinary science, particularly to an agent for treating and preventing endometritis in animals. The substance of the invention consists as follows. Novocaine 0.5 g is dissolved in distilled water 1 l, and the following preparations are dissolved in a solution of Novocaine 250 mg: powdered metronidazole 4.0 g is dissolved in Novocaine 250 ml; powdered ciprofloxacin 2.0 g is dissolved in Novocaine 250 ml; powdered Doxycycline 1.0 g is dissolved in Novocaine 250 ml; powdered tavegil 2.5 g is dissolved in Novocaine 250 ml; all the ingredients are combined to prepare the agent in an amount of 1 litre for treating and preventing endometritis in animals.

EFFECT: invention provides the pronounced anti-inflammatory and antimicrobial effect of a broad spectrum of action combined with reducing the body response to histamine, relieving smooth muscle spasm and reducing capillary penetration.

5 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely to traumatology and orthopaedics, and can be used for treating proximal humeral injuries. That is ensured by three-staged complex therapeutic actions. At the first stage, setting of fracture and reduction of humeral head dislocation is followed by immobilising an extremity by continuous twenty-four hour brace fixation of the proximal humerus with Desault's bandage for the period of 4 weeks. From the first therapeutic day, the patient does daily 30-minute therapeutic exercises, including isometric, static and ideomotor exercises to strengthen his/her arm muscles and to improve the circulation. That is combined with a complex reparative drug therapy. At the first stage, the anti-inflammatory preparation Arthrofoon is administered orally, while vasodilators improving nicotinic acid, trental or complamin microcirculation are injected intramuscularly daily for 10 days. The enzymatic preparations Wobenzyme or Flogenzyme are also administered in a dose of 3 tablets three times a day for 3-4 weeks. The second stage starting two weeks after the beginning of the treatment involves electric stimulation (ES) by exposing the collar and shoulder muscles from the involved side for 30 minutes to electric signals generated by an electric myostimulation device. The ES procedure requires the patient to perform 15-minute active motions by a healthy arm, and for the following 15 minutes the patient is expected to tense and relax alternatively the muscles from involved side. The therapeutic exercises are also done. The drug treatment regimen of the second stage implies administering the preparations Calcemin or Calcemin Advance for six months. That is combined with 10 daily intramuscular injections of the preparation Milgamma 2 ml. At the third stage 4 weeks after the beginning of the treatment, control X-ray imaging is followed by removing the brace. Accompanied by the reparative drug therapy continued, the complex therapeutic actions provide local injection therapy in number of 8-10 daily procedures. The biologically active reflex areas nearby the involved joint are pre-exposed to focused red laser light, and the mixed preparations Alflutop, or other chondroprotector, vitamin B12, Contrykal or Lidase, Lidocaine are injected in the same areas. Two weeks after the brace has been taken off, the patient keeps doing the therapeutic exercises twice a week continuously. The drug therapy and local injections are repeated six months later. The brace is further required for the following year if the patient is supposed to bear occupational or sports physical loads.

EFFECT: method provides faster recovery of the extremity functionality, prevents posttraumatic degenerative process in the humeral joint, recurred dislocation formation, humeral instability and contractures by optimising the humeral para-articular tissue health, improving the quality of bone tissues, first of all, of the subchondral plate and humeral head.

2 cl, 1 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: composition has an action of the central nervous system; it is presented in the form of a solution, contains glycine, glycerol, a preserving agent and water. The invention also concerns a therapeutic agent and a biologically active addition based on the above composition.

EFFECT: group of inventions provides high bioavailability as the composition is presented in the liquid and ease of dosing.

12 cl, 2 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: water soluble composition consists of L-arginine and dihydromeletin in specified molar ratio. Method of obtaining water-soluble pharmaceutical composition consists in the following: mechanical activation of mixture L-arginine and dihydromeletin hydrate in argon atmosphere is carried out.

EFFECT: composition possesses high water solubility and higher biological activity.

3 cl, 2 ex

FIELD: medicine.

SUBSTANCE: invention refers to a pharmaceutical composition with anti-ischemic and antioxidant activity in the form of tablets or capsules, and a method for preparing it. The composition contains 4-((3-oxo-3-ethoxypropanoyl)amino)benzoic acid in an amount of 40 to 80 wt %, an amino-containing compound and pharmaceutically acceptable excipients. The amino-containing compound is specified in a group of trometamol, methyl glucamine and L-lysine; 1 mole of 4-((3-oxo-3-ethoxypropanoyl)amino)benzoic acid is accounted for 0.05 to 0.25 mole of the above amino-containing compound. The composition also contains lactose, microcrystalline cellulose, calcium stearate and other pharmaceutically acceptable excipients. According to the method for preparing the composition, taking 4-((3-oxo-3-ethoxypropanoyl)amino)benzoic acid and amino-containing compound in molar ratio 1:0.05 to 1:0.25, pre-mixing, moisturising with a aqueous or alcohol solution of a binding agent, adding pharmaceutically acceptable excipients in such an amount to provide the content of 4-((3-oxo-3-ethoxypropanoyl)amino)benzoic acid from 40 to 80 wt %, granulating the mixture, drying and producing tablets or capsules according to the known technique.

EFFECT: implementing the above application.

6 cl, 7 tbl, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: group of inventions refers to oral care compositions containing a basic amino acid or its salt. The presented oral care composition promoting the dentine defect closure in the oral cavity contains arginine in the free form or in the form of a salt, and an abrasive substance representing synthetic amorphous silica and containing small particle fractures making at least approximately 5% of total weight of the composition, wherein the particles of the small particle fracture having d50 from 3 to 4 mcm. What is also presented is a method of treating sensitive teeth in the oral cavity involving using the oral treatment with this composition, as well as using arginine as a part of the oral care composition and for producing a therapeutic agent, wherein the above composition and agent contain the above abrasive material containing the small particle fracture.

EFFECT: group of inventions provide the effective dentin defect closure in the patient's oral cavity.

8 cl, 1 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: method involves administering a combination of pharmacological agents into a laboratory animal after simulating osteoporosis by a bilateral ovariectomy and osteoporotic femoral fracture in female Wistar rats. This agents represent a combination of L-arginine 200mg/kg and losartan 6mg/kg, which is intragastrically administered daily into a laboratory animal once a day with underlying stimulating osteoporosis for eight weeks, and in fractures- with underlying simulating osteoporosis for twelve weeks.

EFFECT: using the declared invention provides the synergetic action and positive effect on the bone microcirculation in osteoporosis and in an osteotylus in osteoporotic fractures.

1 ex

FIELD: medicine.

SUBSTANCE: method involves simulating osteoporosis in female Wistar rats by a bilateral ovariectomy, and osteoporotic fractures, performing a pharmacological correction of pathological conditions by a combination of L-arginine 200mg/kg and enalapril 0.5mg/kg administered intragastrically daily, as a single dose once a day.

EFFECT: using the declared invention provides the synergetic action consisting in the positive effect on the bone microcirculation in osteoporosis and in an osteotylus in osteoporotic fractures.

1 ex

FIELD: medicine.

SUBSTANCE: invention relates to field of medicine and is intended for impact on microcirculation in bone tissue in case of experimental osteoporosis and fractures at its background. Method includes introduction of combination of pharmacological preparations to animal after modelling osteoporosis by means of bilateral ovariectomy and osteoporotic fractures of hip bone in female rats of Wistar line. As such preparations used is combination of L-norvalin in dose 10 mg/kg and rosuvastatin in dose 0.86 mg/kg, which is introduced to laboratory animal daily intragastrically one time per day at the background of osteoporosis modelling during eight weeks, and in case of fractures at the background of osteoporosis modelling during twelve weeks.

EFFECT: application of claimed invention results in synergism in positive impact on indices of microcirculation in bone tissue in case of osteoporosis and in bone callus in case of osteoporotic fractures.

1 ex

FIELD: medicine.

SUBSTANCE: invention relates to field of medicine and is intended for impact on microcirculation in bone tissue in case of experimental osteoporosis and fractures at its background. Method includes modelling osteoporosis in female rats of Wistar line by bilateral ovariectomy and osteoporotic fractures and pharmacological correction of pathological states with L-norvalin in dose 10 mg/kg intragastrically, daily, one time per day.

EFFECT: application of claimed invention makes it possible to prevent negative dynamics of indices of microcirculation in bone tissue in case of osteoporosis and in bone callus in case of osteoporotic fractures.

1 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to the pharmaceutical industry and represents an ophthalmic solution containing riboflavin and vitamin E for the UV-A rays protection of the internal structures of an eyeball and for treating keratoconus by transepithelial crosslinking.

EFFECT: invention provides extending the range of products for the UV-A rays protection of the internal structures of the eyeball and for treating keratoconus by transepithelial crosslinking.

9 cl, 10 dwg

FIELD: medicine, cardiology.

SUBSTANCE: the suggested method should be performed at the background of medicinal therapy with preparations out of statins group, tevetene, polyoxidonium and conducting seances of plasmapheresis by removing 800 ml plasma twice weekly with N 5 due to additional intramuscular injection of immunophan 0.005%-1.0 with N 10 and fluimucyl 300 mg intravenously daily with N 5-10, total course of therapy lasts for 2 mo. The method provides modulation of leukocytic functional activity, moreover, due to altered cytokine profile and, thus, through disintegration of protein-lipid complexes participating in the development of atherosclerotic platelets.

EFFECT: higher efficiency of therapy.

3 ex

Up!