Method for identifying staphylococcal exotoxin genes with high level of structural homology with superantigens by multiplex polymerase chain reaction and test system for implementing it

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and microbiology and represents a method for identifying a cluster of antigens coding staphylococcal proteins that are exotoxins. The present method is implemented by performing a single multiple-primer polymerase chain reaction in two reaction mixtures, first of which contains primers to genes coding such staphylococcal proteins, as thermonuclease, beta-glucosidase in the species S.aureus, S.epidermidis, S.haemolyticus, S.lugdunensis, S.saprophyticus, and the second one - to set1, set2, set3, set4, set5 genes coding the exotoxins. That is followed by a comparative analysis of amplified gene fragments prepared in two sample aliquots and a positive control reference according to the identification table. The present invention also discloses a test system for implementing the above method, which contains DNA recovery components, PCR components, and result analysis components. The PCR components contain a 10-merous buffer solution, pH 8.4, deionised sterile water, one positive control reference, Taq polymerase, mixture of four dNTPs, mixture of primers No.1 containing epi-F, epi-R, aur-F, aur-R, hae-F, hae-R, lug-F, lug-R, sap-F, sap-R in a ratio of 1:1:1:1:1:1:1:1:1:1, and a mixture of primers No. 2 containing set1-F, set1-R, set2-F, set2-R, set3-F, set3-R, set4-F, set4-R, set5-F, set5-R in a ratio of 1:1:1:1:1:1:1:1:1:1.

EFFECT: invention enables recovering the cluster of genes coding the staphylococcal proteins, a molecular weight of which makes 25 to 35 kD consisting of almost 200 amino acid residues and having a tertiary structure high-homologous with some staphylococcus superantigens (enterotoxins, TSST-1 toxins) and with pyrogenous streptococcal exotoxin C.

2 cl, 3 tbl, 1 ex

 

The invention relates to Microbiology and can be used in medical Microbiology to identify genes of exotoxins in clinical strains of staphylococci.

This method allows you to identify by PCR analysis of the gene cluster encoding staphylococcal proteins, the molecular weight of which ranges from 25 to 35 kDa, consisting of almost 200 amino acid residues and having a tertiary structure vysokogomogennogo with some superantigen Staphylococcus (enterotoxins, TSST-1 toxin) and streptococcal pyrogenic exotoxin C [2].

Data protein exotoxins of Staphylococcus unlike superantigens characterized by the absence of polyclonal activation of lymphocytes, but is able to induce the production of proinflammatory cytokines by macrophages, but also specifically to interact with Toll-like receptor 2 (TLR2) [3] human immunocompetent cells, such as macrophages. Set also the ability of these proteins to block TLR2 receptor cells [4], to inhibit the binding of serum IgA with receptors on phagocytes, reducing the bactericidal activity of the latter [5, 6], to bind IgG molecules, preventing their interaction with companynum compliment Clq and Feγ receptors on neutrophils [10]. Exotoxins of Staphylococcus is also able to interact with other receptor Bel is ω for molecules P-selectin (P-selectin glycoprotein ligand 1, PSGL-1), thereby inhibiting the interaction of PSGL-1 with P-selectin on the endothelium and platelets [7]. Exotoxins inhibit the proteolytic activity of matrix metalloproteinase 9 (MMP-9) in the tissues affecting the migration of neutrophils [8], are capable to change the chemotaxis of tumor cells [9].

Thus, the exotoxins of Staphylococcus able to disrupt the functioning of the immune mechanisms of elimination of pathogenic and conditionally pathogenic bacteria and can act as additional factors modifying the known understanding of the basic pathogenesis of staphylococcal infections.

Detected genes set1, set2, set3, set4, set5 [2], as a rule, contained in the so-called pathogenic the island of the genome of Staphylococcus and is represented by a cluster of genes. The inventive method is proposed to detect the genes that make up the cluster of 5 genes, following each other set2-set3-setl-set5-set4, between genes are intergenic regions or insertion of nucleotide sequences ranging in size from 339 to 446 BP) [2].

A known method for the identification of toxigenic strains of v. Cholerae O1, determine their biovars and differentiation of strains of biovars El tor circulation of typical and modified by the method of multiplex polymerase chain reaction and test the system for its implementation [1], which is the prototype of the present invention, different is eat, what the research object in this invention are gram-positive microrganism belonging to the genus Staphylococcus spp., and identified on coagulasepositive or coagulasenegative, which has important medicinal value in human pathology.

Thus, in medical Microbiology there is a clear need to develop a highly sensitive, specific and rapid method, genotypic identification ability to ecotoxicology in clinically important strains of staphylococci, secreted from a person and objects for medical purposes, as well as test systems for its implementation, which may be applicable in the practice of modern bacteriological laboratories.

The technical result of the invention is a molecular-genetic identification of a cluster of genes, including genes set1, set2, set3, set4, set5, coding ecotoxicologie proteins in selected culture strains of staphylococci, using the original primers, developed and proposed in the invention.

The technical result is achieved by the method of identification primer-specific sites of genes setl, set2, set3, set4, set5 in DNA staphylococcal strains by the method of multiplex polymerase chain reaction, characterized by the fact that PCR is carried out in two reaction mixtures, each of Kotor is x contains a specially selected combination of primers to genes, encoding such proteins of staphylococci, as thermonuclear, beta-glucosidase, species S.aureus, S.epidermidis, S.haemolyticus, S.lugdunensis tendency of development, the nucleotide sequence of which was drawn from the work of Japanese researchers Shintaro N., Takashi S. et al., 2011 [12], in the first (No. 1), and the original primers specific to the genes set1, set2, set3, set4, set5, with nucleotide sequence proposed in the invention, in the second (No. 2), with the annealing temperature of the primers 59°C for 10 s, when the number of cycles of amplification, equal to 25, with subsequent analysis by comparing the amplified fragments of the genes studied and the control strains. For Staphylococcus strains containing genes exotoxins, characterized by the presence of amplicons of genes set1, set2, set3, set4, set5, identical reference samples of strains. As control samples used DNA isolated from strains of S.aureus MRSA 252, S.aureus RF122, S. epidermidis ADS

The technical result is achieved by means of a test system for identification of genes staphylococcal exotoxins, including components for DNA extraction and components for PCR: 10x PCR buffer solution, pH 8,4; sterile deionized water; one positive control; enzyme Taq polymerase; a mixture of four dNTP; a mixture of primers No. 1, containing (epi-epi F-R, aur-F aur-R, hae-F hae-R, lug-lug F-R, sap-F sap-R) in the ratio 1:1:1:1:1:1:1:1:1:1:1, respectively; a mixture of Prime is ditch No. 2, contains (setl-F, setl-R, set2-F set2-R, setS F set3-R, set4-F, set4-R, set5-F, set5-R) in the ratio 1:1:1:1:1:1:1:1:1:1, respectively, as well as components for the analysis results.

As a positive control were selected DNA samples of strains of S. aureus RF122, S. aureus 252, S. epidermidis ADS, contain genes exotoxins set1, set2, set3, set4, set5, the strains obtained from gisk named after. Tarasevich. Primers for detection of genes exotoxins constructed by the authors using Primer-Blast and vector NT 9.01 on the basis presented in the Genbank nucleotide sequences of genes of S.aureus strain RF122 and are highly specific, primers were synthesized based on the original sequences in CJSC "Synthol", Moscow, Russia.

Sequence of primers (epi-epi F-R, aur-F aur-R, hae-F hae-R, lug-lug F-R, sap-F sap R) for genotypic species identification of staphylococci taken from the work of Japanese researchers Shintaro N., Takashi S. et al., 2011 [12] and were synthesized CJSC "Synthol", Moscow, Russia. The primers and their sequences are listed in table 1.

Table 1
The primers used for species identification of strains
primersequence (5'-3')The PCR product of the t (amplicon), n / aType strain, which corresponds to the PCR product (amplicon)
epi-FTTGTAAACCATTCTGGACCG251S.epidermidis
epi-RATGCGTGAGATACTTCTTCG
aur-FTCGCTTGCTATGATTGTGG359S.aureus
aur-RG CCAATG TTCTACCATAG
hae-FTAGTGGTAGGCGTATTAGCC434S.haemolyticus
hae-RACGATATTTGCCATTCGGTG
lug-FTCCAATGATGGTAACGAGGC695S.lugdunensis
TTTTGCGCCTCGTTTTGTGC
sap-F sap-RTTTTGGATGCGATAGATTGG843Tendency of development
TCTTCAGACTTTTCAAAGGC

The primers used in the present method, to identify genes of exotoxins in strains of staphylococci, are characterized as: set1-F and set1-R primers for gene setl (encoding superantigen-like protein), which provides education fragment size of 576 BP and having direct and reverse sequence: set1-F 5'-TCAGCCAGTAAAAGCAGACGA-3', set1-R 5'-TCACCCATACGGTGTGTTTGT-3'; set2-F and set2-R - primers on the set2 gene (encoding superantigen-like protein), ensuring the formation of the fragment of 330 BP and having direct and reverse sequence: set2-F 5'-AACAGAGGCTCATTCCAGCC-3', set3-R 5'-ATTGGGGCACTGACAACTCC-3'; set3-F and set3-R primers for gene set3 (encoding a superantigen exotoxin-like protein 5)providing education fragment size 147 P.N. and having direct and reverse sequence: set3-F 5'-GCAAAGGTGGCAAGCACTAC-3' set3-R 5'-CGTTGCGATTTTCCGCTTCT-3'; set4-F and set4-R primers for gene set4 (encoding a superantigen exotoxin-like protein), which provides the formation of fragment 201 P.N. and having direct and reverse sequence: set4-F 5'-ACAACAGAGGCCCATTCAGG-3', set4-R 5'-ACGGTACTCATCTCCAGGCA-3'; set5-F and set5-R primers for gene set5 (encoding exotoxin), ensuring the formation of fragment size 78 P.N. and having direct and reverse sequence: set5-F 5'-CGGCATATATAGCGTTGGCG-3', set5-R 5'-TGCAGTCCCGGATGACTTAC-3'.

The primers chosen for the unique sequence of genes set1, set2, set3, set4, set5 in S.aureus genome RF122 and S.aureus MRSA 252 thus, to minimize ver their likely non-specific annealing. The primers tested for the formation of hairpin structures with high melting and formation of dimeric compounds with the same name as primers, two primers each other. The choice of length and GC% of the primers was carried out in accordance with the regime of other annealing of primers included in the kit. The sizes of the resulting fragments were chosen to simplify the accounting process results so that amplificatoare fragments were visually separable from the other.

Experimentally the optimal composition of the reaction mixture for carrying out multiplex polymerase chain reaction, a selected combination of primers, a necessary and sufficient ratio of the components of the reaction mixture and identified the mode of PCR, which is important when conducting PCR analysis.

To confirm the specificity of the primers by PCR was studied 36 clinical Staphylococcus strains, 2 strains of Streptococcus Str. piogenes, 1 strain of Lactobacillus acidophilus isolated from drug Lactobacterin", 1 strain of E. coli. The results of the test strains is presented in table 3.

The inventive test system is divided into 3 sets:

set 1 contains the components for DNA extraction, Packed in six plastic vials containing a solution of 1 (deionized sterile water not containing NAA is EPHA) 1 ml;

set 2 contains all components for PCR, and includes 2 plastic tubes with a mixture No. 1 in 500, ul of (primers, dNTP and water), 2 plastic tubes with a mixture of No. 2 to 500, ál (primers, dNTP and water), 1 plastic tube with 10x buffer, 1 plastic tube containing Taq polymerase, 1 plastic tube with TE buffer, 1 plastic tube containing positive control sample lyophilized DNA strains of S.aureus MRSA 252, S.aureus RF122, S.epidermidis ATCC12228;

set 3 contains components to account for the results of the analysis and includes 1 plastic bottle containing TAE buffer, 2 bottles with agarose for electrophoresis and 1 bottle of buffer for drawing samples.

The test system is designed to determine the method of multiplex polymerase chain reaction genes staphylococcal exotoxins, with high structural homology with superantigens.

The system is designed for 100 definitions, includes 1 control sample.

The inventive method of identification includes the following steps.

a) DNA isolation kit (1).

b) PCR (set of 2).

PCR is carried out in 2 stages (first - genotypic species identification of staphylococci and the second identification of the genes setl-set5) according to the following program:

The 1st phase includes preliminary denaturation of 95°C - 5 min, 30 cycles of 95°C 30 sec, 58°C 30 sec, 72 the C - 70, the final completion of the circuit 72°C - 2 min;

2nd stage, includes a preliminary denaturation of 96°C for 2 min, 25 cycles of 96°C for 10 s, 58,2°C for 10 s, 72°C - 30 s, final completion of the circuit 72°C - 5 minutes

in the Analysis of results (set of 3).

Detection of amplified DNA after PCR carried out by the method of horizontal gelelectrophoresis 1.5% agarose gel. Records of the results of Poland-analysis is performed by comparing the obtained amplicons with the reference sample in accordance with the identification table (table 2).

The method is as follows.

The sample preparation is conducted according to MU 1.3. 2569-09 "Organization of work of the laboratories using methods of nucleic acid amplification when working with material containing microorganisms of I-IV groups of pathogenicity in a biological safety Cabinet class III protective clothing in rubber or latex gloves.

DNA isolation is performed with the use of the kit 1.

Kit for DNA extraction remove from the refrigerator and kept at room temperature.

Extraly DNA from bacteria carried out according to the method prescribed in the work of Zhang K., McClure Jo-Ann et al., 2005 [11]. The Staphylococcus strains grown on solid nutrient media for 18 hours, take a bacteriological loop and resuspended in to 50.0 ál of sterile deionized water, not steriade the nucleases, with the subsequent dilution of this water to a concentration of 2 billion mark. so 1 ml) and heated in a thermostat to 99°C for 10 minutes Then centrifuged at 30,000 g for 1 min Obtained supernatant is transferred into two tubes (aliquots) and used as template for PCR. After execution. in this procedure, the material is considered to be decontaminated.

2. For PCR prepare the required number of microtubes, corresponding to 2 times the number of samples tested, and another two for each reaction mixture: 1 positive control, which take DNA samples of the control strains and 1 negative control (sterile deionized water).

Components kit # 2 remove from the freezer, thawed contents of the test tubes and prepare the reaction mixture for PCR.

To prepare the reaction mix No. 1 mix of 10.0 ál of the mixture 1 containing a combination of primers epi F, epi-R, aur-F, aur-R, hae-F, hae-R lug-F, lug-R, sap-Fi, sap-R ratio 1:1:1:1:1:1:1:1:1:1, the mixture dNTP and deionized water with 5.0 ál 10x PCR buffer, and 0.5 μl Taq polymerase.

To prepare the reaction mixture No. 2 mixed 10,0 ál of mixture No. 2, containing a combination of primers set1-F set1-R, set2-F set2-R, set3-F set3-R, set4-F, set4-R, set5-F, set5-R ratio 1:1:1:1:1:1:1:1:1:1, accordingly, the mixture dNTP and deionized water with 5.0 μl of 10-fold bufera of 0.5 μl Taq polymerase.

In the prepared tubes contribute 10,0 ál samples from the aliquot. In the tube labeled negative control, make 10,0 ál of deionized water, and the tube with the positive control, respectively 10,0 ál of DNA from strains of S.aureus MRSA 252, S.aureus RF122, S.epidermidis ATSS'12228 (control K+).

Amplification of DNA is performed with the use of multichannel programmable thermostat "Terzic" (DNA-Technology, Russia) or use its analogues at the following temperature conditions (on the matrix method of control):

for the 1st stage (the first aliquot of the sample) - pre-denaturation 95°C - 5 min, 25 cycles: 95°C 30 sec, 58°C 30 sec, 72°C - 70 C, the final completion of the circuit 72°C - 2 min;

for the 2nd stage (the second aliquot of the sample) pre-denaturation of 96°C for 2 min; 25 cycles: 9°C - 10 s, 59°C for 10 s, 72°C - 30 s, final extension chain 72°C - 5 minutes

Amplification control samples: K+, negative control, carried out simultaneously with a test aliquot samples in the same apparatus and under the same conditions.

3. To prepare 50 ml of a 1.5% agarose gel to 750 mg of agarose are added 50 ml of TAE buffer, diluted 50 times. The agarose is brought to a boil, cooled to 50°C and poured into a special tray, then set the comb and leave to harden. After polymerization, carefully remove the comb and are transferred Geel is in the chamber for electrophoresis. Then amplificato add 5 μl of buffer for drawing samples, mix using the same tip and bring in the pockets of the gel. The camera is connected to a power supply and set the voltage 12 V/see

Electrophoretic separation was continued for 45 min prior to the passage of the leading dye about 1/3 the length of the track (featured track length - 10 cm), after which the gel is removed from the chamber and placed on a glass of transilluminator with UV 310 nm. The DNA fragments appear as bands of light.

Evaluate the results by comparing the obtained PCR amplicons with the identification table (table 2).

Identifying amplicon size 251 digested mixture No. 1 indicates the presence in the sample of DNA sample S.epidermidis strains, and the presence of amplicon size 575 or 147 is digested in a mixture of No. 2 indicates the presence in the sample of S.epidermidis strains ecotoxicologie containing gene set1 or set3 (S.epidermidis set1+ or set3+). Only the lack of mixture No. 2 amplicons indicates the strain S. epidermidis, not containing gene loci set 1+, set2, +set3+, set4, set5.

Identifying amplicon size 359 digested mixture No. 1 indicates the presence in the sample of DNA sample strain S.aureus, and the presence of amplicons of size 576, 147, 201, 78 digested mixture No. 2 indicates the presence in the sample ecotoxicologie strain of S. aureus containing genes set1, set3, set4, set5 (S.aureus set1+, set3+, set4, set5). Only lack is a journey in a mixture of No. 2 amplicons indicates not ecotoxity strain S. aureus, not containing gene loci set1+, set2, +set3+, set4, set5.

Identifying amplicon size 434 digested mixture No. 1 indicates the presence in the sample of DNA sample strain S.hemolyticus, and the presence of an amplicon size 147 digested mixture No. 2 indicates the presence in the sample ecotoxicologie strain S.hemolyticus containing gene set3 (S.hemolyticus set3+). Only the lack of mixture No. 2 amplicons indicates the strain of S. hemolyticus, not containing gene loci set1+, set2, +set3+, set4, set5.

Identifying amplicon size 695 digested mixture No. 1 indicates the presence in the sample of DNA sample strain S.lugdunensis, and the presence of an amplicon size 330, 147, 78 digested mixture No. 2 indicates the presence in the sample ecotoxicologie strain S.lugdunensis containing genes set2, set3, set5 (S.lugdunensis set2+set3+set5+). Only the lack of mixture No. 2 amplicons indicates the strain S.lugdunensis, not containing gene loci set1+, set2,+set3+, set4, set5.

Identifying amplicon size 843 digested mixture No. 1 indicates the presence in the sample of DNA sample strain S.saprophytics, and the presence of an amplicon size 147, 201, 78 digested mixture No. 2 indicates the presence in the sample ecotoxicologie strain tendency of development, containing genes set3, set4, set5 (tendency of development set2+set3+set5+). Only the lack of mixture No. 2 amplicons indicates the strain of S. saprophyticus, not containing gene loci set1+, set2, +set3+, set4, set5.

The specificity of the proposed method and test system is confirmed on the basis of the States the MOU species such as Str. Piogenes - 2 strain, Lactobacillus acidophilus - 1 strain isolated from drug Lactobacterin", E. coli - 1 strain. The results of PCR testing of these strains were negative: it was not in the mix №1, №2 amplicons, indicating a lack of samples belonging ekzotoksiny strains of staphylococci.

The invention is illustrated by the following example.

Example 1. To determine the effectiveness of the proposed method and test systems investigated 23 clinical strain coagulasepositive staphylococci isolated from samples obtained from the nasal mucosa, skin, external ear, and 13 strains koagulazootricationah staphylococci, isolated from the mucous membrane of the nose, urine, skin, breast milk of patients examined in the laboratory of Microbiology (strains courtesy of the head. lab. Microbiology FBSI NIIEM Lotsasites).

Found that in 5 of 23 (5/23) isolates coagulasepositive strains of staphylococci identified clusters of genes exotoxins, as in the samples from these strains was the amplification of DNA fragments of size 576, 147, 201 and 78 BP in the reaction mixture No. 2, suggesting the presence in their genome the gene cluster containing the exotoxins set1, set3, set4, set5, respectively, koagulazootricationah strains only 1 out of 13 (1/13) strains identified as S. lugdunensis, samples of which the origin Taiwan is Dila amplification of DNA fragments by size 330, 147 digested reaction mixture No. 2, suggesting the presence in their genome the gene cluster containing the exotoxins set2, set3, respectively (table 3).

Table 3
Number of strainsResults species-specific genetic identification (mixture No. 1)Results identification of ecotoxicology (reaction mixture No. 2)
23 strain coagulasepositive Staphylococcus23 sample contained amplificatory DNA fragment size 359 BP - S.aureus5 samples contained amplificative DNA fragments by size 576, 147, 201 and 78 genes set1, set3, set4, set5
13 strains koagulazootricationah Staphylococcus1 - sample contained amplificatory DNA fragment size 695 BP - S.lugdunensisamplification of DNA fragments by size 330, 147 BP - genes set2, set3
4 - sample contained amplificatory DNA fragment size of 843 BP - S.saprophyticsamplification fragments were absent
1 - sample contained amplificatory DNA fragment size 434 BP - S.haemolyticusamplification fragments were absent
7 - Obraztsov contained amplificatory DNA fragment size 251 BP - S.epidermidisamplification fragments were absent
1 strain of Lactobacillus acidophilusDNA fragments not detectedamplification fragments were absent
1 strain E. coliDNA fragments not detectedamplification fragments were absent
2 strains of Streptococcus Str. piogenesDNA fragments not detectedamplification fragments were absent

Thus, the proposed method and multiprimer PCR test system allows you to quickly and reliably identify strains of these species coagulasepositive and koagulazootricationah staphylococci, as S.aureus, S.epidermidis, S.haemolyticus, S.lugdunensis tendency of development, and to determine in their genome a gene cluster set1, set2, set3, set4, set5, encoding proteins with homology to the staphylococcal enterotoxins, TSST-1 toxin and streptococcal pyrogenic ek is toxine C.

Literature

1. RF patent 2458141. A method for the identification of toxigenic strains of v. Cholerae O1, opredeleniya biovars and differentiation of strains of biovars El tor circulation of typical and modified by the method of multiplex polymerase chain reaction and test the system for its implementation // Smirnova N.I., Goryayev A.A., Shubin A.V., Sadnova S. p., Kutyrev V.V., 10.08.2012, bull. No. 22.

2. Rachel J.W., John M.W., .Henderson, et al. Identification of a novel gene cluster encoding Gets exotoxin-like proteins: characterization of the prototypic gene and its protein product, SET1 // Nair Infect Immun. 2000 68(8).

3. Fournier B, D.J. Philpott Recognition of Staphylococcus aureus by the innate immune system // Clin. Environ. Rev. 2005. 18:521-540.

4. Yokoyama R., Itoh, S., Kamoshida G., et al. Gets superantigen-like protein 3 binds to the Toll-like receptor 2 increasing interest among domain and inhibits cytokine production induced by Staphylococcus aureus cell wall component, or lipopeptides in murine macrophages // Infect Immun. 2012 August; 80(8): 2816 - 2825.

5. Bestebroer J, et al. Functional basis for complement evasion by gets superantigen-like 7 // Cell. Environ. 2010. 12:1506-1516.

6. Langley R, et al. The gets superantigen-like protein 7 binds IgA and complement C5 and inhibits IgA-Fca RJ binding and serum killing of bacteria // J. Immunol. 2005. 174:2926-2933.

7. Bestebroer J, et al. Gets superantigen-like 5 binds PSGL-1 and inhibits P-selectin-mediated neutrophil rolling // Blood 2007.109:2936-2943.

8. Itoh S, et al. Gets superantigen-like protein 5 inhibits matrix metalloproteinase 9 from human neutrophils// Infect. Immun. 2010.78:3298-3305.

9. Walenkamp A.M, et al. Gets superantigen-like 10 inhibits CXCL12-induced human tumor cell migration // Neoplasia 2009. 11:333-344.

10. Patel D., Wines B.D., Langley, R.J., et al. Specificity of gets superantigen-like protein 10 toward the human IgGl Fc domain // J. Immunol. 2010. 184:6283-6292.

11. Zhang K, McClure Jo-Ann, Elsaed S., et al. Novel multiplex PCR assay for characterization and concomitant subtyping of Gets cassette chromosome mec Types I to V in methicillin-resistant Staphylococcus aureus // J Clin Environ. 2005; 43(10): 5026-5033.

12. Shintaro H., Takashi, S., Kyoko Kuwahara-Arai, Keiichi H. Rapid and Accurate Identification of Human-Associated Susceptible by Use of Multiplex PCR. Clin Environ. 2011 October; 49(10): 3627-3631.

Table 2
Identification table to account for the results obtained by the patented method of identifying genes staphylococcal exotoxins on the basis of the analysis of samples by multiplex PCR
SampleInterpretation of the analysis sample
an aliquot of 1 (amplicon size, BP)an aliquot of 2 (amplicon size, BP)
25135943469584378201147330576
----- -----To the negative no amplicons
K1+
-------S.epidermidis: ecotoxity strain set1+
-----S.aureus: ecotoxity strain set 1+, set3+set4+set5+
--- -S.aureus: ecotoxity strain set1+, set2+, set3+ set4+ set5+
--------S.hemolyticus: ecotoxity strain set3+
----_S.lugdunensis: ecotoxity strain set2+ set3+ set5+
------Tendency of development ecotoxity strain set3+ set4+ set5+
- -------S lug: not ecotoxity strain
---------Tendency of development: not ecotoxity strain
---------S.epidermidis: not ecotoxity strain
--------S aureus: not ecotoxity piece is mm
---------S.hemolyticus: not ecotoxity strain
---------Tendency of development: not ecotoxity strain

1. The method of identification of a cluster of genes encoding staphylococcal proteins, called superantigen-like exotoxins, characterized in that conduct multiprimer polymerase chain reaction in one step in the two reaction mixtures, each of which contains a specially selected combination of primers to genes coding for such proteins of staphylococci, as thermonuclear, beta-glucosidase in species S.aureus, S.epidermidis, S.haemolyticus, S.lugdunensis tendency of development in the first reaction mixture and to genes set1, set2, set3, set4, set5, encoding protein exotoxins, in the second reaction mixture, with the temperature of annealing of primers at 58° in for 30 s number of cycles of amplification, 25, to the first reaction mixture, and the annealing temperature of the primers 59°C for 10 s when the number of cycles of amplification, equal to 25, for the second reaction mixture, followed by analysis by comparing the amplified fragments of the genes obtained in two aliquot of the sample with a positive control sample in accordance with the identification table 2; for ekzotoksiny Staphylococcus strains are characterized by the presence of amplicons of genes set1, set2, set3, set4, set5, identical to the positive control sample.

2. The test system for implementing the method according to claim 1 method multiprimer polymerase chain reaction, characterized in that it includes components for DNA extraction, components for the NDP, components for analysis of the results, the components for PCR include: 10x buffer solution, pH of 8.4, deionized sterile water, one positive control sample, the enzyme Taq polymerase, a mixture of four dNTP, a mixture of primers No. 1, containing epi-epi F-R, aur-F aur-R, hae-F hae-R, lug-lug F-R, sap-F sap-R ratio 1:1:1:1:1:1:1:1:1:1, respectively; and a mixture of primers No. 2, containing (set1-F set1-R, set2-F set2-R, set3-F set3-R, set4-F, set4-R, set5-F, set5-R) in the ratio 1:1:1:1:1:1:1:1:1:1, respectively, as well as components for analysis of the results.



 

Same patents:

FIELD: chemistry.

SUBSTANCE: claimed solutions deal with a method of generating a starter culture, the starter culture and a fermentation method with an application of the said starter culture. The claimed method of generating the starter culture includes impact on a parent bacterial strain, which contains, at least, a part of the locus CRISPR, with a bacteriophage to obtain a mixture of bacteria, which contains a bacteriophage-resistant variant strain, containing the modified locus CRISPR, which contains, at least, one additional spacer in the said modified locus CRISPR; independent impact on the same parent bacterial strain with the same bacteriophage to obtain the mixture of bacteria, which contains other bacteriophage-resistant variant strain, containing the modified locus CRISPR, which contains, at least, one additional spacer in the said modified locus CRISPR, different from the additional spacer in the first bacteriophage-resistant variant strain, selection of the said bacteriophage-resistant variant strains from the mixtures of bacteria and their separation.

EFFECT: claimed inventions make it possible to obtain bacteriophage-resistant cultures and can be applied in the food industry in manufacturing fermented products.

29 cl, 23 dwg, 20 tbl, 23 ex

FIELD: medicine.

SUBSTANCE: invention relates to the field of molecular biology and virology. Claimed are primers, probes and their sets for amplification and detection of type 52 HPV in a tested sample.

EFFECT: invention can be used for medical purposes for the detection of human papilloma viruses.

11 cl, 8 tbl, 5 ex, 4 dwg

FIELD: biotechnology.

SUBSTANCE: method of detecting stem cancer cells is provided, based on incubation of cell samples with fluorescence dyes and subsequent identification of cancer cells in the ultraviolet light, where during the incubation of cell samples, which is carried out with the fluorescent dye, incorporated covalently into double-stranded DNA fragments, the internalization of extracellular exogenous fragments of double-stranded DNA into the intracellular space of stem cells included in the composition of the sample cells, is provided by incubation of cell samples in the solution of the preparation of the fragmented double-stranded DNA at a ratio of 0.5-1 mcg DNA per 1000000 cells in suspension or on a section of tissue for 60-120 minutes, and identification of cancer cells as stem is carried out in ultraviolet light with a wavelength corresponding to the absorption maximum of the fluorochrome inserted into the molecules of fragments of the double-stranded DNA, and the double-stranded DNA fragments are used as DNA fragments of Alu human repeat, enzymatically labelled by precursor comprising covalently sewn fluorochrome dye, or labelled by direct chemical introduction of fluorochrome.

EFFECT: due to increasing the efficiency of detecting stem cancer cells in the initiating condition the invention can be used in medicine.

2 cl, 11 dwg

FIELD: biotechnology.

SUBSTANCE: characterized primers are complementary to sites of variable segment 2 of genome of bluetongue virus of nucleotype C (serotypes 6, 14 and 21) are used in RT-PCR with electrophoretic detection of amplification products for identification of bluetongue virus of serotypes 6, 14 and 21 and have the following composition (5'-3'): direct: GRAYATGRTGGATATWCCG, reverse: GGCTGCACRTCCAYYGARTC.

EFFECT: invention enables to determine the genetic group of nucleotype C of bluetongue virus in samples of the biological material under study using RT-PCR in a short time.

2 tbl, 1 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology. What is described is a kit of primers for amplifying CFTR gene fragments. There are presented biochip and kit of targets for the biochip. What is described is a method for identifying mutations in CFTR human gene causing mucoviscidosis, involving using the above primers. What is presented is a test system comprising the above primers and biochip.

EFFECT: invention extends the range of facilities used for diagnosing mucoviscidosis enabling fast and specific diagnosing of the respective mutations.

10 cl, 2 dwg, 4 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, more specifically to detecting lung cancer by means of an aptamer and can be used in diagnostics. The aptamers are prepared by selection involving alternating rounds of positive selection of the aptamers to minced human tumour lung tissues sampled from oncological patients after the operation and of negative selection to healthy lung tissues and healthy whole blood to determine a pool of the highest-affinity aptamers to be cloned, sequenced and analysed for a binding specificity to tumour lung cells.

EFFECT: prepared aptamers possess high sensitivity to tumour debris and circulating tumour cells in peripheral blood of the patient suffering lung cancer that enables more effective diagnosis of human lung cancer.

3 cl, 2 dwg, 1 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to medicine and microbiology. What is presented is a method for real-time detection of Beijing genotype mycobacterium tuberculosis by detecting IS6110 element insertion in a locus of dnaA-dnaNgenome differing by the fact that real-time PCR is carried out with the use of two specific primers5`-AGATCAGAGAGTCTCCGGACTCA and 5`-CGCCGGGACTGTATGAGTCT and fluorescence-labelled probe R6G-5`-TGTGCACAGCGACACTCACAGCCA-3`-BHQ2; the result is assessed by recording a fluorescence signal in R6G canal at wavelength 555nm; if a sample contains the DNA of the Beijing genotype mycobacterium tuberculosis strain, an exponential growth of the PCR fluorescence signal when a pure DNA analysed is observed between 10 to 15 cycles, and when cell lysates analysed - between 15 and 20 cycles.

EFFECT: invention can be used for laboratory detection of Beijing genotype mycobacterium tuberculosis.

3 dwg, 2 ex

FIELD: biotechnology.

SUBSTANCE: method of carrying out PCR for efficient identification of allelic variants of Waxy-genes of wheat is described. The method differs from the known ones from the technical level in using the forward primer 4F-c: 5'-CCCCCAAGAGCAACTACCAGT-3'. Also the method of PCR-RFLP for efficient identification of allelic variants of Waxy-genes of wheat is described. The method differs from the known ones from the technical level in that after the step of PCR the procedure of RFLP-analysis is performed with endonuclease cleavage of amplicons by the restriction enzyme AcsI.

EFFECT: development of methods of carrying out PCR and PCR-RFLP for efficient identification of allelic variants of Waxy-genes of wheat.

2 cl, 4 dwg, 2 tbl

FIELD: biotechnology.

SUBSTANCE: primers are used for identification of bluetongue virus of nucleotype B (serotypes 3, 13 and 16) by RT-PCR method.

EFFECT: opportunity to determine the genetic group - nucleotype B of bluetongue virus by RT-PCR method, which enables to reduce significantly the material costs and time of the work on definition of serotypes of bluetongue virus in samples of biological material under study.

2 tbl

FIELD: veterinary medicine.

SUBSTANCE: method of carrying out PCR-RFLP for genotyping cattle on alleles A and K of gene DGAT1, which is different from the nearest prototype [1] in that at the stage of PCR the other sequences of the oligonucleotide primers: DGAT1-1: 5'- CCGCTTGCTCGTAGCTTTCGAAGGTAACGC-3' (SEQ ID NO:1): DGAT1-2: 5'-CCGCTTGCTCGTAGCTTTGGCAGGTAACAA-3' (SEQ ID NO:2): DGAT1-3: 5'-AGGATCCTCACCGCGGTAGGTCAGG-3' (SEQ ID NO:3) are used, and at the stage of RFLP the other restriction endonuclease - TaqI is used, with the generation of the genotype-specific fragments: the genotype AA=82/18 bp, the genotype KK=100 bp and the genotype AA=100/82/18 bp (Figures 1 and 2).

EFFECT: development of an efficient method of genotyping the cattle on DGAT1-gene based on PCR-RFLP analysis.

2 dwg, 2 tbl

FIELD: chemistry.

SUBSTANCE: claimed solutions deal with a method of generating a starter culture, the starter culture and a fermentation method with an application of the said starter culture. The claimed method of generating the starter culture includes impact on a parent bacterial strain, which contains, at least, a part of the locus CRISPR, with a bacteriophage to obtain a mixture of bacteria, which contains a bacteriophage-resistant variant strain, containing the modified locus CRISPR, which contains, at least, one additional spacer in the said modified locus CRISPR; independent impact on the same parent bacterial strain with the same bacteriophage to obtain the mixture of bacteria, which contains other bacteriophage-resistant variant strain, containing the modified locus CRISPR, which contains, at least, one additional spacer in the said modified locus CRISPR, different from the additional spacer in the first bacteriophage-resistant variant strain, selection of the said bacteriophage-resistant variant strains from the mixtures of bacteria and their separation.

EFFECT: claimed inventions make it possible to obtain bacteriophage-resistant cultures and can be applied in the food industry in manufacturing fermented products.

29 cl, 23 dwg, 20 tbl, 23 ex

FIELD: biotechnology.

SUBSTANCE: two suspensions are prepared. Clinical polyantibiotic-resistant strains Escherichia coli are added to an isotonic solution of NaCl to achieve the concentration of 30-40 thousand CFU/ml. Copper nanoparticles are added to the solution of NaCl to achieve the concentration of 0.01-0.05 mg/ml. The suspension of ethylenediaminetetraacetic acid - EDTA is prepared by its dilution in distilled water at the rate of 0.1-0.2:1, respectively. NaOH is added to the prepared suspension to obtain the solution of EDTA with pH=7.6-8. The prepared suspensions are connected with the solution of EDTA in the following ratios by wt %: suspension of copper nanoparticles - 70-85, suspension of microorganisms - 10-20, EDTA - 5.10. It is incubated in the shaker at 100-150 rev/min and a temperature of 36-38°C for 40-60 minutes. The resulting biomass is inoculated on the solid nutrient medium with the volume of 20-25 ml in the amount of 0.1-0.12 ml. It is incubated in the thermostat at a temperature of 36-38°C for 18-24 hours. The sensitivity of E.coli strains to antibiotics is determined.

EFFECT: invention enables to increase the sensitivity of the said bacterial strains to antibiotics gentamicin and ampicillin.

2 tbl, 2 cl, 1 ex

FIELD: biotechnology.

SUBSTANCE: granule of biocatalyst with the cells contained in it of one or more species of Rhodococcus is placed in a well of a 96-well plate, a colorant iodine-nitro-tetrazolium (INT) is added. After the appearance of specific purple staining formazan the optical density of granule is measured using a tablet photometer. In the case of a stained substrate or preliminary presence of the immobilised biocatalyst in the soil the extraction of formazan is carried out with 96% ethanol and the optical density of the extract is measured. The amount of viable Rhodococcus in the granule of the gel is determined using the calibration dependency diagram of the optical density on the number of living cells in suspension as determined by traditional method of plating on solid growth medium. Then, from the granule stained by the colorant of the biocatalyst or from the granule after extraction of the colorant the DNA is isolated and PCR is performed using sets of species-specific primers. The specific position of the immobilised Rhodococcus is determined.

EFFECT: invention enables to reduce the time differentiation of Rhodococcus and to improve the accuracy of the method.

2 cl, 3 tbl, 4 dwg, 4 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. The method comprises collecting soil samples, adding metsulfuron-methyl (MSM) to the sample in a given amount, followed by incubation and determining specific metabolic activity of the saprophytic soil complex by multisubstrate testing and counting the number of colony-forming units on a diluted agarised medium. The level of the detoxification activity is estimated based on the relative increase in specific metabolic activity of the saprophytic microbial community of the soil when MSM in comparison with characteristics of the soil without adding MSM (Kd factor).

EFFECT: improved method.

4 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: group of inventions relates to biotechnology. Claimed is a method of growing colonies of microbial cells on a surface of a porous plate. The method includes supply of a nutrient solution from bottom to top through the porous plate into zones of growth of colonies of the microbial cells on its upper surface, supply of a suspension of the microbial cells onto the upper surface of the porous plate, creation of controlled conditions for the colony growth, performing observation of the colony growth, separation of the grown colonies of the microbial cells from the zones of growth and their transfer into external means of identification. The nutrient solution is supplied into the zones of growth of the colonies of the microbial cells by creation of a pressure difference between the hole input and output. Holes are made in the plate from an anode aluminium oxide orthogonally to its large plane and are topologically coded. The said zones of growth are formed in them in the form of porous membranes. The porous membranes are located at the same level as the upper surface of the plate or with formation of a hollow and do not pass the microbial cells. After supply of the nutritional solution, the suspension of the microbial cells of a specified concentration is supplied onto the upper surface of the plate until their homogenous distribution is achieved. Between the zones of growth on the surface of the plate a film, preventing attachment of the microbial cells, is formed. Separation of the grown microcolonies from the zones of growth is performed by hydroblow. A hydroblow is directed from the side of the input of cylindrical holes of the plate and spreads along them and farther through the pores of the porous membranes with force, which does not destroy the microcolonies but is sufficient for their separation from the growth zones. Also claimed is a device for growing the colonies of the microbial cells by the claimed method.

EFFECT: providing conditions of automation of processes of the nutrient solution supply and processes of separation and transfer of the grown colonies, possibility of integration into miniature portable devices, and application in laboratories on a chip and provision of the device portability.

6 cl, 14 dwg, 4 tbl, 2 ex

FIELD: chemistry.

SUBSTANCE: invention relates to microbiology and can be used in monitoring environmental-microbiological investigation of the quality of sea water to determine the amount of oil-oxidising microorganisms. The method involves preparing a mineral medium - bases containing NH4NO3, K2HPO4, KH2PO4, MgSO4, CaCl2, FeCl2, a concentrated solution, agar and distilled water in a given ratio, followed by addition of an oil product in a given amount, said product being bunker oil. Seeding sea water on the surface of the culture medium and incubating the seed for 3-4 hours enables to detect colonies of oil-oxidising bacteria.

EFFECT: invention increases precision of the method when detecting oil and hydrocarbon oxidising bacteria when carrying out environmental monitoring.

2 tbl, 3 dwg, 5 ex

FIELD: biotechnology.

SUBSTANCE: method of toxicity assessment of products from polymer and textile materials is proposed. The method comprises the use of biosensor based on oxygen electrode, immobilisation of whole cells of bacteria E.coli K-12 on the surface of the oxygen electrode. The immobilisation is carried out using a semipermeable membrane. After immobilisation the respiratory activity of microorganisms is measured in the presence of the sample and standard samples of positive and negative control. Then the toxicity index is calculated and the sample toxicity is evaluated based on the value of the toxicity index.

EFFECT: simplifying assessment of toxicity and improvement of reliability of the results of the sanitary-epidemiological expertise.

2 dwg, 1 tbl, 3 ex

FIELD: biotechnology.

SUBSTANCE: invention is a method of determining the nonspecific resistance of pathogenic microorganisms to antibiotics and the fact of the presence of bacterial biofilms on the basis of measurement of catalytic activity of phosphodiesterases cleaving the cyclic diguanosine monophosphate, with a threshold sensitivity of 50 pg/ml, comprising: 1) isolating the target-phosphodiesterase from lysed bacterial cells; 2) binding of phosphodiesterase with biotin-conjugated antibodies specific for non-catalytic domains of phosphodiesterase; 3) affinity purification of complexes formed by target-phosphodiesterase and biotin-conjugated antibody using paramagnetic particles containing neutravidin or its analogs that bind biotin; 4) interacting of the complexes of phosphodiesterase/biotin-conjugated antibody, immobilised on paramagnetic particles with complexes containing a-di-GMP in the form of G-quadruplex systems with intercalate dye, which is accompanied by decrease in the intensity while destruction of complexes of intercalate dye with c-di-GMP; 5) measurement of decrease of fluorescence upon hydrolysis with c-di-GMP and destruction of complex of c-di-GMP with intercalate dye, followed by quantitative estimation of the phosphodiesterase activity based on calibration curves made using known amounts of the recombinant enzyme of phosphodiesterase identical to the test target; 6) identification of increased level of phosphodiesterase activity detected by the test antibiotic-resistant bacterial strains capable of biofilm formation, as compared with the level of phosphodiesterase activity that can be detected for the control strains of bacteria of the same species not having the antibiotic resistance and the ability to form biofilms.

EFFECT: method enables to determine the nonspecific resistance of pathogenic microorganisms to antibiotics and to establish the fact of the presence of bacterial biofilms.

4 dwg, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to medical microbiology and a method of determining activation of plasminogen with bacteria. The method involves adding protamine sulphate to a prepared supernatant fluid, incubating the obtained mixture, depositing cells by centrifuging, incubating the supernatant fluid with the protamine sulphate, depositing protein and detecting activation of plasminogen with bacteria from the amount of split arginine, content of which is determined by Sakaguchi method from the red colour of the sample.

EFFECT: invention enables to detect activation of plasminogen with bacteria in vitro using protamine.

4 tbl, 4 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. Claimed is container for isolation and identification of microorganism. Container includes upper part, which has wide internal diameter, and lower part, which has capillary tube, middle conic part, connecting said upper and lower parts, and optic window on the bottom and/or on one or more than one wall of container. Optic window is less than 0.1 inch (2.54 mm) thick and is transparent for wavelength of near-infrared, visible and/or ultraviolet light spectrum. Window contains quartz, quartz glass, sapphire, acrylic resin, methacrylate, cyclic olefin copolymer, cycloolefin polymer or any their combination. Capillary tube has internal diameter from 0.01 inch (0.03 mm) to 0.04 inch (1.02 mm).

EFFECT: container ensures isolation of microorganisms, which are free of interfering materials and compatible with fast identification technologies, from hemoculture and other complex samples.

8 cl, 12 dwg, 1 ex

FIELD: agriculture.

SUBSTANCE: invention relates to a method of weed destruction, providing the step of applying the herbicide of PPO-inhibitory type on the cultivated part of the plant, where the said plant is resistant to the said herbicide and expresses the protein with the ability to convert the said herbicide into the herbicide with lower herbicidal activity. The method of evaluation of resistance of the plant cell or the plant to herbicide of PPO-inhibitory type is disclosed, comprising bringing into contact of the herbicide of PPO-inhibitory type with the plant cell or the plant into which DNA is introduced and expressed, which encodes the protein capable to convert the said herbicide into the herbicide with lower herbicidal activity, and also the method of intake of plant cell or plant resistant to the herbicide of PPO-inhibitory type, providing the step of intake of the plant cell or plant based on the aforesaid method for evaluating the stability. Also the plant cell, the plant, the cell culture of plant are disclosed, resistant to herbicide of PPO-inhibitory type, as well as the method of treating the herbicide of PPO-inhibitory type and use of the protein or DNA encoding the said protein for treatment of herbicide of PPO-inhibitory type, where the protein is capable to convert the aforesaid herbicide into the herbicide with lower herbicidal activity.

EFFECT: invention enables to destroy selectively only the weeds on the cultivated part of the plant.

10 cl, 66 dwg, 35 tbl, 75 ex

Up!