Recombinant factor viii, possessing higher stability

FIELD: chemistry.

SUBSTANCE: invention relates to the field of biochemistry, in particular to recombinant factor VIII, which contains one or more mutations, resulting in an increased stability of both the factor VIII and factor VIIIa, as well as to a pharmaceutical composition for treating haemophilia containing it. Also described is a molecule of nucleic acid, coding the said recombinant factor VIII, and an expression vector and host-cells, containing the said molecule of nucleic acid. The invention also relates to a method of obtaining the said factor VIII, as well as to its application in the method of treating haemophilia A in an animal.

EFFECT: invention makes it possible to obtain a biologically active factor VIII with an increased stability.

50 cl, 12 dwg, 5 tbl, 9 ex

 

Description

The present application claims priority under provisional patent application U.S. No. 60/984518, filed November 1, 2007, and provisional application for U.S. patent No. 60/991304, filed November 30, 2007, the contents of which are fully incorporated into the present application by reference.

The present invention was created with government support under grants HL 76213 and HL 38199 National Institute of health. The government has certain rights to this invention.

The LEVEL of TECHNOLOGY

Hemophilia A, the most common disease among serious hereditary disorders associated with blood coagulation disorders, caused by a deficiency or defect of the protein of blood plasma factor VIII. Today hemophilia incurable, and treatment consists of replacement therapy with the use of drugs of (purified) plasma or recombinant protein.

Factor VIII circulates in the blood in the form of ecovalence associated dependent on metal ions of heterodimer. In the form of such protofactory protein contains a heavy chain (HC, heavy chain), including domains A1(a1)A2(a2)B, and the light chain (LC, light chain), including domains (a3)A3C1C2, where lowercase letters indicate a short (~30-40 residues) areas that are rich in acidic residues (see Fay, “Activation of Factor VIII and Mechanisms of Cofactor Action,” Blood Rev.18:1-15 (2004)). Factor VIII asset is regulated at the proteolytic cleavage in the areas of contact domains A1A2, A2B and A3A3 catalyzed by thrombin or factor Xa. The product of this reaction, factor VIIIa, is heterodimer, including subunit, denoted as A1, A2 and A3C1C2, which functions as a cofactor for the serine-proteases factor IXa in membraneactive conversion zymogen factor X in the serine protease, factor Xa (see Fay, “Activation of Factor VIII and Mechanisms of Cofactor Action,” BloodRev.18:1-15 (2004)).

Studies using the reconstruction showed that the heterodimeric structure of factor VIII is supported both by electrostatic and hydrophobic interactions (Fay, “Reconstitution of Human Factor VIII from Isolated Subunits,” Arch Biochem Biophys.262:525-531 (1988); Ansong et al., “Factor VIII A1 Domain Residues 97-105 Represent a Light Chain-interactive Site,” Biochemistry. 45:13140-13149 (2006), and nutricare affinity is enhanced when the binding of factor VIII to factor a background of Villebranda (Fay, “Reconstitution of Human Factor VIII from Isolated Subunits,” Arch Biochem Biophys.262:525-531 (1988); Kaufman et al., “Regulation of Factor VIII Expression and Activity by von Willebrand's Factor,” Thromb Haemost.82:201-208 (1999)). Metal ions also contribute to the affinity within the circuit and parameters of activity (Wakabayashi et al., “Metal Ion-independent Association of Factor VIII Subunits and the Roles of Calcium and Copper Ions for Cofactor Activity and Inter-subunit Affinity,” Biochemistry 40:10293-10300 (2001)). To purchase active conformation of factor VIII needed calcium. In studies using mutagenesis of the calcium-binding site was l kalitan in the segment, rich in acidic residues within the A1 domain (amino acid residues 110-126), and within this area were identified specific residues that are important for the coordination of ions (Wakabayashi et al., “Residues 110-126 in the A1 Domain of Factor VIII Contain a Ca2+Binding Site Required for Cofactor Activity,” J Biol Chem. 279:12677-12684 (2004)). Recent studies using x-ray diffraction analysis of intermediate resolution (Shen et al., “The Tertiary Structure and Domain Organization of Coagulation Factor VIII,” Blood 111:1240-1247 (2008)) confirmed the presence of this calcium-binding site, and also suggest the presence of a second potential site within the A2 domain. The structure analysis also showed binding to two sites for copper ions 1st type within the domains A1 and A3. Held earlier functional studies showed that copper ions contribute to the Association of the heavy and light chains with the formation of the dimer, increasing nutricare affinity several times at physiological pH values (Fay et al., “Human Factor VIIIa Subunit Structure: Reconstruction of Factor VIIIa from the Isolated A1/A3-C1-C2 Dimer and A2 Subunit,” JBiolChem. 266:8957-8962 (1991); Wakabayashi et al., “pH-dependent Association of Factor VIII Chains: Enhancement of Affinity at Physiological pH by Cu2+,” Biochim Biophys Acta. 1764:1094-1101 (2006); Ansong et al., “Factor VIII A3 Domain Residues 1954-1961 Represent an A1 Domain-Interactive Site,” Biochemistry 44:8850-8857 (2005)).

The instability of factor VIIIa due to weak electrostatic interactions between the A2 subunit and what iMER A1/A3C1C2 (Fay et al., “Human Factor VIIIa Subunit Structure: Reconstruction of Factor VIIIa from the Isolated A1/A3-C1-C2 Dimer and A2 Subunit,J Biol Chem. 266:8957-8962 (1991); Lollar et al., “pH-dependent Denaturation of Thrombin-activated Porcine Factor VIII,”J BiolChem. 265:1688-1692 (1990)) and leads to decreased activity of factor Haza (factor Xase activity) (Lollar et al., “Coagulant Properties of Hybrid Human/Porcine Factor VIII Molecules,” J Biol Chem. 267:23652-23657 (1992); Fay et al., “Model for the Factor VIIIa-dependent Decay of the Intrinsic Factor Xase: Role of Subunit Dissociation and Factor IXa-catalyzed Proteolysis,” J Biol Chem.271:6027-6032 (1996)). Data regarding the Association subunit A2 in factor VIIIa, limited, and, apparently, residues in both domains A1 and A3 helps keep the specified subunit. It was shown that several point mutations in the factor VIII facilitate the dissociation of the A2 compared with the wild type, and these residues are localized either in the contact area of the domains A1-A2 (Pipe et al., “Mild Hemophilia A Caused by Increased Rate of Factor VIII A2 Subunit Dissociation: Evidence for Nonproteolytic Inactivation of Factor VIIIain vivo,” Blood 93:176-183 (1999); Pipe et al., “Hemophilia A Mutations Associated with 1-stage/2-stage Activity base currency by the difference Disrupt Protein-protein Interactions within the Triplicated A Domains of Thrombin-activated Factor VIIIa,” Blood 97:685-691 (2001)), or in the contact area of the domain A2-A3 (Hakeos et al., “Hemophilia A Mutations within the Factor VIII A2-A3 Subunit Interface Destabilize Factor VIIIa and Cause One-stage/Two-stage Activity base currency by the difference,” Thromb Haemost.88:781-787 (2002)). Such a mutant form of factor VIII demonstrate the differences in the results of single-stage and two-stage analysis (Duncan et al., “Familial base currency by the difference Between the One-stage and Two-stage Factor VIII Methods in a Subgroup of Patients wth Haemophilia A,” Br J Haematol.87:846-848 (1994); Rudzki et al., “Mutations in a Subgroup of Patients with Mild Haemophilia A and A Familial base currency by the difference Between the One-stage and Two-stage Factor VIII:C Methods,” Br J Haematol. 94:400-406 (1996)), with a significant decrease in activity values determined through further analysis, due to increasing the rate of dissociation of the a subunit A2.

The study of A domain of factor VIII in the model, based on homology to ceruloplasmin (Pemberton et al., “A Molecular Model for the Triplicated A Domains of Human Factor VIII Based on the Crystal Structure of Human Ceruloplasmin,” Blood 89:2413-2421 (1997), suggest the presence of extensive areas of contact between the A2 domain and the domains A1 and A3 with numerous potential contacts involved in binding interactions.

The problem of stabilization of factor VIIIa is of considerable interest, since a more stable form of the protein is the best remedy for the treatment of hemophilia A, potentially requiring less material costs for treatment of the patient (Fay et al., “Mutating Factor VIII: Lessons from Structure to Function,” Blood Reviews 19:15-27 (2005)). In this regard, have been described preparations of factor VIII, which was used in the form of recombinant protein with mutations that prevent the dissociation of the subunit A2 due to the introduction of new covalent bonds between A2 and other domains of factor VIII (Pipe et al., “Characterization of a Genetically Engineered Inactivation-resistant Coagulation Factor VIIIa,”Proc Natl Acad Sci USA94:11851-11856 (1997); Gale et al., “An Engineered Interdomain Disulfide Bond Stabiizes Human Blood Coagulation Factor VIIIa,” J. Thromb. Haemostasis 1:1966-1971 (2003)). However, after it was shown that such mutations may be undesirable in the factor VIII used for therapeutic purposes, since they essentially eliminate the negative ways of regulation. This can cause prothrombotic conditions that can cause harm. Thus, it is necessary to increase the stability of both factor VIII and factor VIIIa by reducing to a minimum the likelihood of prothrombotic States.

The present invention is directed to overcoming these and other disadvantages known in the art.

BRIEF description of the INVENTION

In the first aspect of the present invention relates to recombinant factor VIII, which contains one or more mutations that increase the stability of both factor VIII and factor VIIIa.

Preferably, one or more mutation is a substitution of one or more charged amino acid residues on the hydrophobic amino acid residue in one or both areas of contact domains A1A2 or A2A3. Particularly preferred recombinant factor VIII according to the present invention includes replacement of residue Glu287 factor VIII wild type, the replacement of a residue Asp302 factor VIII wild type, the replacement of a residue Asp519 factor VIII wild type, the replacement of a residue Glu665 factor VIII wild type, replacement is the STATCOM Glu1984 factor VIII wild-type, or a combination of these substitutions.

The second aspect of the present invention relates to pharmaceutical compositions containing the recombinant factor VIII according to the first aspect of the present invention.

The third aspect of the present invention relates to an isolated nucleic acid molecule that encodes a recombinant factor VIII according to the first aspect of the present invention. In this aspect of the present invention also includes systems for expression of recombinant DNA containing a DNA molecule encoding the recombinant factor VIII according to the present invention, and recombinant cell host containing a DNA molecule and/or a system for recombinant expression.

A fourth aspect of the present invention relates to a method for preparation of recombinant factor VIII, comprising: growing a host cell according to the third aspect of the present invention under conditions in which a host cell expresses the recombinant factor VIII; and selection of recombinant factor VIII.

The fifth aspect of the present invention relates to a method for treatment of hemophilia A in animals. This treatment includes: introduction to the animal suffering from hemophilia A, an effective amount of recombinant factor VIII according to the first aspect of the present invention, while the animal is observed EF the objective blood clotting after injury of blood vessels.

The present invention shows that the number of charged residues in the contact regions of the A1A2 domains and A2A3 not involved in the formation of hydrogen bonds, but on the contrary these balances can destabilize the structure of factor VIII and/or may contribute to the dissociation of the a subunit A2 after activation protofactory factor VIII. As shown in the attached Examples, such replacement of charged residues on the hydrophobic residues to increase the internal hydrophobic region and reduce internal hydrophilic region increases the affinity for binding within the domain. Indicators of stability was assessed by the activity of variants of factor VIII at elevated temperature and dynamics of the reduction of the activity of factor VIIIa, due to the dissociation of subunit A2. The results of this research showed that the number of mutations increases stability, which is consistent with the elimination of destabilizing forces, likely due to the deepening of charge in the contact region of the A2 domain. Such stable variants of factor VIII and activated cofactor VIIIa will allow you to obtain the tool for the treatment of hemophilia A with improved characteristics.

BRIEF DESCRIPTION of FIGURES

Figure 1 is a graph illustrating the activity of mutant forms of factor VIII, relative to the activity of factor VIII wild-type (WT), assessment is nnow using a single-stage analysis coagulating activity (black bars) and two-stage chromogenic analysis of the formation of factor Xa (grey columns). The activity of wild-type and mutant forms of factor VIII were evaluated as described in the Examples. Error bars correspond to standard deviation values calculated from three independent measurements.

In figures 2A-B shows the decrease in (loss) activity of factor VIII wild type and its mutant forms and factor VIIIa, respectively. In figure 2A the factor VIII (4 nm) were incubated at 55°C, and at specified time points were collected aliquots and explored by analyzing the formation of factor Xa, as described in the Examples. Presents the results for wild-type (dotted line, white circles), R282A (white triangles), S524A (white squares), N684A (white diamonds), R531A (black circles), S650A (black triangles), E287A (black squares) and D302A (black diamonds). In Figure 2B thrombin-activated factor VIIIa (4 nm) in the presence of 40 nm factor IXa were incubated at 23°C, were selected aliquots at the indicated time points and evaluated the activity by analyzing the formation of factor Xa, as described in the Examples. Presents the results for wild-type (dotted line, white circles), R282A (white triangles), S524A (white squares), Y1792F (white diamonds), N684A (black circles), Y1786F (black triangles), R531A (black squares), E287A (black diamonds) and D302A (gray circles). The results for the selected variants with rapid loss of activity is shown enlarged to the scale of the company code in the box in Figure 2B.

In figures 3A-B shows the results of electrophoresis of the LTO-SDS page (polyacrylamide gel electrophoresis (SDS page) in the presence of sodium dodecyl sulfate (LTOs)and Western blot analysis of factor VIII wild-type and mutant forms of factor VIII. Figure 3A shows the results of electrophoresis of the LTO-page in 8% polyacrylamide gel of purified proteins, mutant forms of factor VIII and factor VIII wild-type (0,77 g), stained with GelCode. Figure 3B presents purified factor VIII proteins of wild type and mutant forms (0,34 g), separated by electrophoresis in 8% polyacrylamide gel, transferred to PVDF membrane (polyvinylidene fluoride) and detected using labeled with Biotin antibodies R8B12. Bands were visualized using chemifluorescence, as described in the accompanying Examples. Wild type (lane 1), Glu272Ala (lane 2), Glu272Val (lane 3), Asp519Ala (lane 4), Asp519Val (track 5), Glu665Ala (track 6), Glu665Val (track 7), Glu1984Ala (lane 8) and Glu1984Val (track 9). MW, molecular weight marker: sFVIII, single-chain form of factor VIII: HC, heavy chain: LC, light chain. The observed stoichiometric ratio of single-stranded form and heterodimer factor VIII in wild-type and mutant forms of factor VIII amounted to 0.96 (wild type, WT), 0,64 (Glu272Ala), 0,92 (Glu272Val), 0,74 (Asp519Ala), 0,8 (Asp519Val), 0,64 (Glu665Ala), 0,63 (Glu665Val), 0,91 (Glue1984Ala) and 0.5 (Glu1984Val).

Figures 4A-D illustrate specific activity is Otantik forms of factor VIII relative to the activity of factor VIII wild-type and the results of the analysis of the formation of thrombin. Figure 4A presents the activity values determined using a single-stage analysis coagulating activity (gray columns) and two-stage chromogenic analysis of the formation of factor Xa (black columns), as described in the accompanying Examples. In Figures 4B-C presents thrombogram protein factor VIII. Wild type (dashed line), Glu272Ala (white squares), Glu272Val (black squares), Asp519Ala (white circles), Asp519Val (black circles), Glu665Ala (white triangles), Glu665Val (black triangles), Glu1984Ala (white diamonds) and Glu1984Val (black diamonds). Figure 4D presents the parameter values obtained in the analysis of the formation of thrombin. Analysis of the formation of thrombin were performed as described in the accompanying Examples. On thrombogram presents the average values of three replicates. The parameter value is expressed in units (%) relative to wild type. The actual values for the wild type was 7.5±0.5 min (lag period), 13,7±0,3 min (peak), 157,3±14,7 nm (peak value), 979,8±37,9 nm/min (endogenous thrombin potential Epte (ETP)). Shows the lag-period (where there's no shading columns), peak time (grey columns), the value of the peak (black columns) and Epte (shaded columns). Error bars correspond to standard deviation values calculated from three independent measurements.

Figures 5A-B illustrate the reduction Akti the activity of factor VIII wild-type and mutant forms of factor VIII. Factor VIII (4 nm) were incubated at different temperatures (52-60°C) and at specified time points were selected aliquots and determined in their activity by analyzing the formation of factor Xa, as described in the accompanying Examples. Data were approximatively using non-linear regression analysis using the least squares method and calculated the loss rate of activity. Each point corresponds to the average value obtained from three independent measurements. Results are shown for wild-type WT (dashed line, crosses), Glu272Ala (white squares), Glu272Val (black squares), Asp519Ala (white circles), Asp519Val (black circles), Glu665Ala (white triangles), Glu665Val (black triangles), Glu1984Ala (white diamonds), Glu1984Val (black diamonds) and a full-length factor VIII Kogenate (gray circles). Figure 5A shows the characteristic curves of reduced activity for factor VIII after incubation at 55°C. Figure 5B presents graphs illustrating the speed reduction for factor VIII at different temperatures. The inset in Figure 5B is an enlarged area of the graph of the reduction in the temperature range of 52-55°C.

Figure 6 is a graph illustrating the reduction in the activity of factor VIII in plasma at 37°C. Factor VIII (1 nm) were incubated at 37°C in the plasma, devoid of factor VIII, and at specified time points were selected aliquots and examined them with the help of the single-stage analysis coagulating activity, as described in the accompanying Examples. Presents the results for wild-type (WT) (dashed line, crosses), Asp519Ala (white circles), Asp519Val (black circles), Glu665Ala (white triangles), Glu665Val (black triangles), Glu1984Ala (white diamonds), and Glu1984Val (black diamonds). Data were approximatively using non-linear regression analysis using the least squares method; each point corresponds to the average value of three independent measurements.

Figures 7A-B are graphs illustrating the reduction in the activity of factor VIIIa wild-type (WT) and mutant forms in the absence or in the presence of factor IXa. Figure 7A shows the thrombin-activated factor VIIIa (4 nm), which were incubated at 23°C. was Selected aliquots at the indicated time points and determined in their activity by analyzing the formation of factor Xa, as described in the accompanying Examples. Figure 7B shows the decrease in activity of factor VIIIa wild-type and mutant forms of factor VIIIa in the presence of factor IXa. Factor VIII (4 nm) was activated with thrombin in the presence of 40 nm factor IXa. At these time points were selected aliquots and determined in their activity by analyzing the formation of factor Xa, as described in the accompanying Examples. Presents the results for wild-type (dashed line, crosses), Glu272Ala (white squares), Glu272Val (black squares), Asp51Ala (white circles), Asp519Val (black circles), Glu665Ala (white triangles), Glu665Val (black triangles), Glu1984Ala (white diamonds) and Glu1984Val (black diamonds). Data were approximatively using non-linear regression analysis using the least squares method; each point corresponds to the average value of three independent measurements.

Figure 8 is a graph illustrating the specific activity forms of factor VIII with two or three combined mutations, in which the remains of Asp519, Glu665 and/or Glu1984 replaced with Ala or Val. Activity values were determined using one-stage analysis coagulating activity (gray columns) and two-stage chromogenic analysis of the formation of factor Xa (black columns), as described in the Examples. Error bars correspond to standard deviation values calculated from three independent measurements.

Figure 9 is a graph illustrating the speed reduction activity for factor VIII wild-type and mutant forms of factor VIII with two or three combined mutations, in which the remains of Asp519, Glu665 and/or Glu1984 replaced with Ala or Val. Conducted experiments to determine the reduction of the activity of factor VIII and estimated speed reduction using nonlinear regression analysis using the least squares method, as described in the Examples. Grey columns show C is achene speed relative to the single mutants with the best results (see Example 5, Figure 5A), calculated by dividing by the speed value with the best score (lowest). For example, the relative speed values compared to single mutant with best indicator for the double mutant D519AE665A equal to the value of the rate of fall for D519AE665A divided by the rate of fall for D519A. Black columns represent the actual values of the speed parameter reduction, presented in the form of ×10.

Figure 10 is a graph illustrating the speed of decrease of the activity of factor VIIIa wild-type and mutant forms of factor VIII with two or three combined mutations, in which the remains of Asp519, Glu665 and Glu1984 replaced with Ala or Val. Measurements of the reduction of the activity of factor VIIIa after incubation of 1.5 nm factor VIIIa in the absence of factor IXa, and speed reduction was estimated using nonlinear regression analysis using the least squares method, as described in the Examples. Grey columns indicate the relative speed of the two single mutants with the best results (see Example 7, Figure 7A), and calculated as described in the notes to Figure 9. Black columns represent the actual values of the speed parameter reduction, presented in the form of ×10.

Figures 11A-B illustrate the results of the analysis of the formation of thrombin using a combination mutants. Figure 11A presents the Tr is mogamma protein factor VIII. Analysis of the formation of thrombin were performed as described in the Examples. The final concentration of reagents was 0.2 nm (factor VIII), a 0.5 PM (RTF), 4 μm (phospholipid vesicles PSPCPE), 433 μm (fluorogenic substrate), 13,3 mm CalCl2and 105 nm (reference marker of thrombin). Presents the results for wild-type (dotted line), D519AE665V (white circles), D519VE665V (black circles), D519VE1984A (white triangles) and D519VE665VE1984A (black triangles). Figure 11B presents the parameter values obtained in the analysis of the formation of thrombin. On thrombogram presents the average values of three replicates. The parameter values are expressed in values (%) relative to wild type. The actual values for the wild type was 8.5±0,4 min (lag period), 21,3±0,6 min (peak), 58,5±15,6 nm (peak value), 883,6±199,8 nm/min (ECPS). The lag-period (white columns), peak time (grey columns), the value of the peak (black columns) and Epte (shaded columns). Error bars correspond to standard deviation values calculated from three independent measurements.

In Figures 12A-C shows the values of the specific activity and speed reduction activity for factor VIII and factor VIIIa relative to wild-type to mutant containing Ala or Val instead residues Asp519, Glu665 and/or Glu1984 in combination with a mutation Glu113Ala. Figure 12A presents specific the activity for the combined mutants compared with wild type, measured using a single-stage analysis coagulating activity (gray columns) and two-stage chromogenic analysis of the formation of factor Xa (black columns), as described in the Examples. Error bars correspond to standard deviation values calculated from three independent measurements. Figure 12B shows the results of the analysis of the reduction of the activity of factor VIII at 55°C; speed reduction was estimated using nonlinear regression analysis using the least squares method, as described in the Examples. Figure 12C shows the results of measurements of the reduction of the activity of factor VIIIa after incubation of 1.5 nm factor VIIIa in the absence of factor IXa; speed reduction was estimated using nonlinear regression analysis using the least squares method, as described in the Examples.

DETAILED description of the INVENTION

The present invention relates to recombinant factor VIII, which contains one or more mutations that lead to increased stability of factor VIII and factor VIIIa.

Recombinant factor VIII according to the present invention can be obtained by modifying the amino acid sequence of the factor VIII wild-type or mutant form of factor VIII modified in any other way to change other properties of factor VIII, such as antigenicity, while p is luismi in the bloodstream, secretion of the protein, the affinity for factor IXa and/iofactory X, the modified sites inactivating cleavage of factor VIII immunogenicity, retention, etc.

Suitable factor VIII wild type, which can be modified according to the present invention, can be obtained from various animals, including, without limitation, mammals such as man (see, for example, the access number in GenBank AAA52484 (amino acid sequence) and K01740 (nucleotide sequence); and the access number in GenBank CAD97566 (amino acid sequence) and AX746360 (nucleotide sequence)included in the present application by reference in full), rats (see, for example,the access number in GenBank AAQ21580 (amino acid sequence) and AY362193 (nucleotide sequence)included in the present application by reference in full), mouse (see, for example,the access number in GenBank AAA37385 (amino acid sequence) and L05573 (nucleotide sequence)included in the present application by reference in full), Guinea pigs, dogs (see, for example,the access number in GenBank AAB87412 (amino acid sequence) and AF016234 (nucleotide sequence); and the access number in GenBank AAC05384 (amino acid sequence) and AF049489 (nucleotide sequence)included in the present application by ssy is key in full), cats, monkeys, chimpanzees (see,for example,the access number in GenBank XP_529212 (amino acid sequence) and XM_529212 (nucleotide sequence)included in the present application by reference in full), orangutans, cows, horses, sheep, pigs (see,for example,,the access number in GenBank NP_999332 (amino acid sequence) and NM_214167 (nucleotide sequence)included in the present application by reference in full), goats, rabbits and chickens. These and other sequences is also available in electronic form on the website Haemophilia A Mutation, Structure, Test and Resource Site (HAMSTeRS), which also presents an alignment of the amino acid sequence of proteins of factor VIII, human, pig, mouse, and dog. Thus, conservatism and homology between proteins of factor VIII mammals are well known.

As an example of a nucleotide sequence of cDNA (complementary DNA) for the factor and putative amino acid sequence shown below in SEQ ID No. 1 and 2, respectively. The human factor VIII is synthesized as single-chain protein of about 300 kDa with internal homology sequence comprising the sequence of "domains" NH2-A1-A2-B-A3-C1-C2-COOH. In the factor VIII molecule "domain" when used in this application is a continuous posledovatelnostyakh, which has a specific amino acid sequence and sites of proteolytic cleavage by thrombin. Unless otherwise specified, the domain of the factor VIII include the following amino acid residues in the sequence alignment with the amino acid sequence of human factor VIII (SEQ ID no: 2):

A1, residues Ala1-Arg372;

A2, residues Ser373-Arg740;

B, residues Ser741-Arg1648;

A3, residues Ser1690-Ile2032;

C1, residues Arg2033-Asn2172; and

C2, residues Ser2173-Tyr2332.

The sequence A3-C1-C2 includes residues Ser1690-Tyr2332. The remaining sequence, residues Glu1649-Arg1689usually considered as activating peptide to the light chain of factor VIII. Factor VIII is activated as a result of proteolysis by thrombin or factor Xa, which causes its dissociation from von Willebrand factor, with the formation of factor VIIIa, perform the function of proco-agulant. The biological function of factor VIIIa is to strengthen the catalytic efficiency of factor IXa in relation to the activation of factor X to values several orders of magnitude. Activated thrombin factor VIIIa is heterodimer A1/A2/A3-C1-C2 with a molecular mass of 160 kDa, which forms a complex with factor IXa and factor X on the surface of platelets or monocytes. The term"Partial domain" in the context of this application represents a contiguous sequence of amino acids, forming part of the domain.

The gene encoding human factor VIII wild-type, has the following nucleotide sequence represented in SEQ ID no:1

gccaccagaagatactacctgggtgcagtggaactgtcatgggactatatgcaaagtgatctcggtgagctgcctgtggacgcaagatttcctcctagagtgccaaaatcttttccattcaacacctcagtcgtgtacaaaaagactctgtttgtagaattcacggatcaccttttcaacatcgctaagccaaggccaccctggatgggtctgctaggtcctaccatccaggctgaggtttatgatacagtggtcattacacttaagaacatggcttcccatcctgtcagtcttcatgctgttggtgtatcctactggaaagcttctgagggagctgaatatgatgatcagaccagtcaaagggagaaagaagatgataaagtcttccctggtggaagccatacatatgtctggcaggtcctgaaagagaatggtccaatggcctctgacccactgtgccttacctactcatatctttctcatgtggacctggtaaaagacttgaattcaggcctcattggagccctactagtatgtagagaagggagtctggccaaggaaaagacacagaccttgcacaaatttatactactttttgctgtatttgatgaagggaaaagttggcactcagaaacaaagaactccttgatgcaggatagggatgctgcatctgctcgggcctggcctaaaatgcacacagtcaatggttatgtaaacaggtctctgccaggtctgattggatgccacaggaaatcagtctattggcatgtgattggaatgggcaccactcctgaagtgcactcaatattcctcgaaggtcacacatttcttgtgaggaaccatcgccaggcgtccttggaaatctcgccaataactttccttactgctcaaacactcttgatggaccttggacagtttctactgttttgtcatatctcttcccaccaacatgatggcatggaagcttatgtcaaagtagacagctgtccagaggaaccccaactacgaatgaaaaataatgaagaagcggaagactatgatgatgatcttactgattctgaaatggatgtggtcaggtttgatgatgacaactctccttcctttatccaaattcgctcagttgccaagaagcatcctaaaacttgggtacattacattgctgctgaagaggaggactgggactatgctcccttagtcctcgcccccgatgacagaagttataaaagtcaatatttgaacaatggccctcagcggattggtaggaagtacaaaaaagtccgatttatggcatacacagatgaaacctttaagactcgtgaagctattcagcatgaatcaggaatcttgggacctttactttatggggaagttggagacacactgttgattatatttaagaatcaagcaagcagaccatataacatctaccctcacggaatcactgatgtccgtcctttgtattcaaggagattaccaaaaggtgtaaaacatttgaaggattttccaattctgccaggagaaatattcaaatataaatggacagtgactgtagaagatgggccaactaaatcagatcctcggtgcctgacccgctattactctagtttcgttaatatggagagagatctagcttcaggactcattggccctctcctcatctgctacaaagaatctgtagatcaaagaggaaaccagataatgtcagacaagaggaatgtcatcctgttttctgtatttgatgagaaccgaagctggtacctcacagagaatatacaacgctttctccccaatccagctggagtgcagcttgaggatccagagttccaagcctccaacatcatgcacagcatcaatggctatgtttttgatagtttgcagttgtcagtttgtttgcatgaggtggcatactggtacattctaagcattggagcacagactgacttcctttctgtcttcttctctggatataccttcaaacacaaaatggtctatgaagacacactcaccctattcccattctcaggagaaactgtcttcatgtcgatggaaaacccaggtctatggattctggggtgccacaactcagactttcggaacagaggctgaccgccttactgaaggtttctagttgtgacaagaacactggtgattattacgaggacagttatgaagatatttcagcatacttgctgagtaaaaacaatgccattgaaccaagaagcttctcccagaattcaagacaccctagcactaggcaaaagcaatttaatgccaccacaattccagaaaatgacatagagaagactgacccttggtttgcacacagaacacctatgcctaaaatacaaaatgtctcctctagtgatttgttgatgctcttgcgacagagtcctactccacatgggctatccttatctgatctccaagaagccaaatatgagactttttctgatgatccatcacctggagcaatagacagtaataacagcctgtctgaaatgacacacttcaggccacagctccatcacagtggggacatggtatttacccctgagtcaggcctccaattaagattaaatgagaaactggggacaactgcagcaacagagttgaagaaacttgatttcaaagtttctagtacatcaaataatctgatttcaacaattccatcagacaatttggcagcaggtactgataatacaagttccttaggacccccaagtatgccagttcattatgatagtcaattagataccactctatttggcaaaaagtcatctccccttactgagtctggtggacctctgagcttgagtgaagaaaataatgattcaaagttgttagaatcaggtttaatgaatagccaagaaagttcatggggaaaaaatgtatcgtcaacagagagtggtaggttatttaaagggaaaagagctcatggacctgctttgttgactaaagataatgccttattcaaagttagcatctctttgttaaagacaaacaaaacttccaataattcagcaactaatagaaagactcacattgatggcccatcattattaattgagaatagtccatcagtctggcaaaatatattagaaagtgacactgagtttaaaaaagtgacacctttgattcatgacagaatgcttatggacaaaaatgctacagctttgaggctaaatcatatgtcaaataaaactacttcatcaaaaaacatggaaatggtccaacagaaaaaagagggccccattccaccagatgcacaaaatccagatatgtcgttctttaagatgctattcttgccagaatcagcaaggtggatacaaaggactcatggaaagaactctctgaactctgggcaaggccccagtccaaagcaattagtatccttaggaccagaaaaatctgtggaaggtcagaatttcttgtctgagaaaaacaaagtggtagtaggaaagggtgaatttacaaaggacgtaggactcaaagagatggtttttccaagcagcagaaacctatttcttactaacttggataatttacatgaaaataatacacacaatcaagaaaaaaaaattcaggaagaaatagaaaagaaggaaacattaatccaagagaatgtagttttgcctcagatacatacagtgactggcactaagaatttcatgaagaaccttttcttactgagcactaggcaaaatgtagaaggttcatatgacggggcatatgctccagtacttcaagattttaggtcattaaatgattcaacaaatagaacaaagaaacacacagctcatttctcaaaaaaaggggaggaagaaaacttggaaggcttgggaaatcaaaccaagcaaattgtagagaaatatgcatgcaccacaaggatatctcctaatacaagccagcagaattttgtcacgcaacgtagtaagagagctttgaaacaattcagactcccactagaagaaacagaacttgaaaaaaggataattgtggatgacacctcaacccagtggtccaaaaacatgaaacatttgaccccgagcaccctcacacagatagactacaatgagaaggagaaaggggccattactcagtctcccttatcagattgccttacgaggagtcatagcatccctcaagcaaatagatctccattacccattgcaaaggtatcatcatttccatctattagacctatatatctgaccagggtcctattccaagacaactcttctcatcttccagcagcatcttatagaaagaaagattctggggtccaagaaagcagtcatttcttacaaggagccaaaaaaaataacctttctttagccattctaaccttggagatgactggtgatcaaagagaggttggctccctggggacaagtgccacaaattcagtcacatacaagaaagttgagaacactgttctcccgaaaccagacttgcccaaaacatctggcaaagttgaattgcttccaaaagttcacatttatcagaaggacctattccctacggaaactagcaatgggtctcctggccatctggatctcgtggaagggagccttcttcagggaacagagggagcgattaagtggaatgaagcaaacagacctggaaaagttccctttctgagagtagcaacagaaagctctgcaaagactccctccaagctattggatcctcttgcttgggataaccactatggtactcagataccaaaagaagagtggaaatcccaagagaagtcaccagaaaaaacagcttttaagaaaaaggataccattttgtccctgaacgcttgtgaaagcaatcatgcaatagcagcaataaatgagggacaaaataagcccgaaatagaagtcacctgggcaaagcaaggtaggactgaaaggctgtgctctcaaaacccaccagtcttgaaacgccatcaacgggaaataactcgtactactcttcagtcagatcaagaggaaattgactatgatgataccatatcagttgaaatgaagaaggaagattttgacatttatgatgaggatgaaaatcagagcccccgcagctttcaaaagaaaacacgacactattttattgctgcagtggagaggctctgggattatgggatgagtagctccccacatgttctaagaaacagggctcagagtggcagtgtccctcagttcaagaaagttgttttccaggaatttactgatggctcctttactcagcccttataccgtggagaactaaatgaacatttgggactcctggggccatatataagagcagaagttgaagataatatcatggtaactttcagaaatcaggcctctcgtccctattccttctattctagccttatttcttatgaggaagatcagaggcaaggagcagaacctagaaaaaactttgtcaagcctaatgaaaccaaaacttacttttggaaagtgcaacatcatatggcacccactaaagatgagtttgactgcaaagcctgggcttatttctctgatgttgacctggaaaaagatgtgcactcaggcctgattggaccccttctggtctgccacactaacacactgaaccctgctcatgggagacaagtgacagtacaggaatttgctctgtttttcaccatctttgatgagaccaaaagctggtacttcactgaaaatatggaaagaaactgcagggctccctgcaatatccagatggaagatcccacttttaaagagaattatcgcttccatgcaatcaatggctacataatggatacactacctggcttagtaatggctcaggatcaaaggattcgatggtatctgctcagcatgggcagcaatgaaaacatccattctattcatttcagtggacatgtgttcactgtacgaaaaaaagaggagtataaaatggcactgtacaatctctatccaggtgtttttgagacagtggaaatgttaccatccaaagctggaatttggcgggtggaatgccttattggcgagcatctacatgctgggatgagcacactttttctggtgtacagcaataagtgtcagactcccctgggaatggcttctggacacattagagattttcagattacagcttcaggacaatatggacagtgggccccaaagctggccagacttcattattccggatcaatcaatgcctggagcaccaaggagcccttttcttggatcaaggtggatctgttggcaccaatgattattcacggcatcaagacccagggtgcccgtcagaagttctccagcctctacatctctcagtttatcatcatgtatagtcttgatgggaagaagtggcagacttatcgaggaaattccactggaaccttaatggtcttctttggcaatgtggattcatctgggataaaacacaatatttttaaccctccaattattgctcgatacatccgtttgcacccaactcattatagcattcgcagcactcttcgcatggagttgatgggctgtgatttaaatagttgcagcatgccattgggaatggagagtaaagcaatatcagatgcacagattactgcttcatcctactttaccaatatgtttgccacctggtctccttcaaaagctcgacttcacctccaagggaggagtaatgcctggagacctcaggtgaataatccaaaagagtggctgcaagtggacttccagaagacaatgaaagtcacaggagtaactactcagggagtaaaatctctgcttaccagcatgtatgtgaaggagttcctcatctccagcagtcaagatggccatcagtggactctcttttttcagaatggcaaagtaaaggtttttcagggaaatcaagactccttcacacctgtggtgaactctctagacccaccgttactgactcgctaccttcgaattcacccccagagttgggtgcaccagattgccctgaggatggaggttctgggctgcgaggcacaggacctctactga

Human factor VIII wild-type encoded by SEQ ID no:1, has the following amino acid sequence presented in SEQ ID no:2:

ATRRYYLGAVELSWDYMQSDLGELPVDARFPPRVPKSFPFNTSVVYKKTLFVEFTVHLFNIAKPRPPWMGLLGPTIQAEVYDTVVITLKNMASHPVSLHAVGVSYWKASEGAEYDDQTSQREKEDDKVFPGGSHTYVWQVLKENGPMASDPLCLTYSYLSHVDLVKDLNSGLIGALLVCREGSLAKEKTQTLHKFILLFAVFDEGKSWHSETKNSLMQDRDAASARAWPKMHTVNGYVNRSLPGLIGCHRKSVYWHVIGMGTTPEVHSIFLEGHTFLVRNHRQASLEISPITFLTAQTLLMDLGQFLLFCHISSHQHDGMEAYVKVDSCPEEPQLRMKNNEEAEDYDDDLTDSEMDVVRFDDDNSPSFIQIRSVAKKHPKTWVHYIAAEEEDWDYAPLVLAPDDRSYKSQYLNNGPQRIGRKYKKVRFMAYTDETFKTREAIQHESGILGPLLYGEVGDTLLIIFKNQASRPYNIYPHGITDVRPLYSRRLPKGVKHLKDFPILPGEIFKYKWTVTVEDGPTKSDPRCLTRYYSSFVNMERDLASGLIGPLLICYKESVDQRGNQIMSDKRNVILFSVFDENRSWYLTENIQRFLPNPAGVQLEDPEFQASNIMHSINGYVFDSLQLSVCLHEVAYWYILSIGAQTDFLSVFFSGYTFKHKMVYEDTLTLFPFSGETVFMSMENPGLWILGCHNSDFRNRGMTALLKVSSCDKNTGDYYEDSYEDISAYLLSKNNAIEPRSFSQNSRHPSTRQKQFNATTIPENDIEKTDPWFAHRTPMPKIQNVSSSDLLMLLRQSPTPHGLSLSDLQEAKYETFSDDPSPGAIDSNNSLSEMTHFRPQLHHSGDMVFTPESGLQLRLNEKLGTTAATELKKLDFKVSSTSNNLISTIPSDNLAAGTDNTSSLGPPSMPVHYDSQLDTTLFGKKSSPLTESGGPLSLSEENNDSKLLESGLMNSQESSWGKNVSSTESGRLFKGKRAHGPALLTKDNALFKVSISLLKTNKTSNNSATNRKTHIDGPSLLIENSPSVWQNILESDTEFKKVTPLIHDRMLMDKNATALRLNHMSNKTTSSKNMEMVQQKKEGPIPPDAQNPDMSFFKMLFLPESARWIQRTHGKNSLNSGQGPSPKQLVSLGPEKSVEGQNFLSEKNKVVVGKGEFTKDVGLKEMVFPSSRNLFLTNLDNLHENNTHNQEKKIQEEIEKKETLIQENVVLPQIHTVTGTKNFMKNLFLLSTRQNVEGSYEGAYAPVLQDFRSLNDSTNRTKKHTAHFSKKGEEENLEGLGNQTKQIVEKYACTTRISPNTSQQNFVTQRSKRALKQFRLPLEETELEKRIIVDDTSTQWSKNMKHLTPSTLTQIDYNEKEKGAITQSPLSDCLTRSHSIPQANRSPLPIAKVSSFPSIRPIYLTRVLFQDNSSHLPAASYRKKDSGVQESSHFLQGAKKNNLSLAILTLEMTGDQREVGSLGTSATNSVTYKKVENTVLPKPDLPKTSGKVELLPKVHIYQKDLFPTETSNGSPGHLDLVEGSLLQGTEGAIKWNEANRPGKVPFLRVATESSAKTPSKLLDPLAWDNHYGTQIPKEEWKSQEKSPEKTAFKKKDTILSLNACESNHAIAAINEGQNKPEIEVTWAKQGRTERLCSQNPPVLKRHQREITRTTLQSDQEEIDYDDTISVEMKKEDFDIYDEDENQSPRSFQKKTRHYFIAAVERLWDYGMSSSPHVLRNRAQSGSVPQFKKVVFQEFTDGSFTQPLYRGELNEHLGLLGPYIRAEVEDNIMVTFRNQASRPYSFYSSLISYEEDQRQGAEPRKNFVKPNETKTYFWKVQHHMAPTKDEFDCKAWAYFSDVDLEKDVHSGLIGPLLVCHTNTLNPAHGRQVTVQEFALFFTIFDETKSWYFTENMERNCRAPCNIQMEDPTFKENYRFHAINGYIMDTLPGLVMAQDQRIRWYLLSMGSNENIHSIHFSGHVFTVRKKEEYKMALYNLYPGVFETVEMLPSKAGIWRVECLIGEHLHAGMSTLFLVYSNKCQTPLGMASGHIRDFQITASGQYGQWAPKLARLHYSGSINAWSTKEPFSWIKVDLLAPMIIHGIKTQGARQKFSSLYISQFIIMSLDGKKWQTYRGNSTGTLMVFFGNVDSSGIKHNIFNPPIIARYIRLHPTHYSIRSTLRMELMGCDLNSCSMPLGMESKAISDAQITASSYFTNMFATWSPSKARLHLQGRSNAWRPQVNNPKEWLQVDFQKTMKVTGVTTQGVKSLLTSMYVKEFLISSSQDGHQWTLFFQNGKVKVFQGNQDSFTPVVNSLDPPLLTRYLRIHPQSWVHQIALRMEVLGCEAQDLY

In the above sequence, some charged residues are in bold and are underlined, including Glu287, Asp302, Asp519, Glu665 and Glu1984.

Recombinant factor VIII according to the present invention is characterized by the replacement of one or more charged amino acid residues on the hydrophobic amino acid residue in one or both areas of contact domains A1A2 or A2A3. Preferably the substituted charged residue is either a residue Glu or Asp, which is not involved in the formation of hydrogen bonds between domains A1A2 or A2A3. Hydrophobic amino acid residue, which replaces the charged residue may be any residue of Ala, Val, Ile, Leu, Met, Phe or Trp. Particularly preferred recombinant factor VIII according to the present invention includes replacement of residue Glu287 factor VIII wild type, the replacement of a residue Asp302 factor VIII wild type, the replacement of a residue Asp519 factor VIII wild type, the replacement of a residue Glu665 factor VIII wild type, the replacement of a residue Glu1984 factor VIII wild type or a combination of these substitutions. Replacement D302A, E287A, E665A, E665V, D519A, D519V, E1984A and E1984V are preferred for the preparation of recombinant factor VIII having increased stability of both factor VIII and factor VIIIa. Preferred combinations of such substitutions include, without limitation, the double mutants D519AE665V, D519VE65V and D519VE1984A, and triple mutants D519AE665VE1984A and D519VE665VE1984A. It is assumed that the increased stability of such mutant forms is achieved through stabilization of intra-domain region of factor VIII, as well as reducing the dissociation of the a subunit A2 from A1/A3C1C2, in comparison with factor VIIIa wild-type.

The appropriate sequence of a mutant form of factor VIII that can be modified according to the present invention, may also include any previously known or subsequently identified sequence of factor VIII with modified properties in relation to various characteristics, including, without limitation, antigenicity, the half-life in blood flow, secretion of the protein, the affinity for factor IXa and/or factor X, the modified sites inactivating cleavage of factor VIII, the stability of the activated form of factor VIII immunogenicity and shelf life.

One example of a suitable mutant factor VIII that can be modified according to the present invention is a factor VIII having a modified calcium-binding site, preferably at residue 113 in SEQ ID no: 2. Examples of mutants of this type are described in published patent application U.S. No. 10/581471, the authors Fay and others, incorporated into the present application by reference in full. Preferably, the mutant residue 113 so the e is modified in accordance with one or more mutations described above (e.g., positions 287, 302, 519, 665, and/or 1984), with the aim of increasing stability/increase the specific activity of the protein factor VIII. Examples of proteins of factor VIII with high stability/high specific activity include, without limitation, proteins with a combined replacement E113AD519A, E113AD519V, E113AE665A, E113AE665V or E113AE1984V.

A second example of a suitable mutant factor VIII that can be modified according to the present invention, is a stripped B-domain of factor VIII containing amino acid residues 1-740 and 1690-2332 in SEQ ID no: 2 (see,for example,U.S. patent No. 6458563, author Lollar, incorporated into the present application by reference in full).

In one embodiment, the implementation devoid of B-domain of recombinant factor VIII according to the present invention, the B-domain is replaced by a section of the linker DNA, and at least one codon replaced by a codon coding for amino acid residue having the same charge as the appropriate balance of factor VIII pigs (see, for example, the publication of the patent application U.S. No. 2004/0197875, Hauser et al., incorporated into the present application by reference in full).

In another embodiment, the implementation devoid of B-domain of recombinant factor VIII according to the present invention, the modified mutant factor VIII is encoded by the nucleotide sequence, the soda is containing insertions shortened sequence of intron 1 of the factor IX by one or more customers (see, for example,U.S. patent No. 6800461, author Negrier and U.S. Patent No. 6780614, author Negrier, each of which is incorporated into the present application by reference in full). Such recombinant factor VIII can be used to achieve more efficient production of recombinant factor VIIIin vitroand in the vector to transfer in gene therapy (see, for example,,U.S. patent No. 6800461, Negrier, incorporated into the present application by reference in full). In one of the examples of this variant implementation of the recombinant factor VIII can be encoded nucleotide sequence containing the insertion of a shorter sequence of intron 1 of the factor IX in two sites and having a promoter suitable to run the expression in hematopoietic cell lines, and in particular, in platelets (see, for example, U.S. Patent No. 6780614, author Negrier, incorporated into the present application by reference in full).

Regardless of outcomes, devoid of B-domain of factor VIII preferably contains one or more mutations described above (e.g., at positions 287, 302, 519, 665, and/or 1984). Proteins recombinant factor VIII obtained according to the Examples presented in this application, deprived of the B-domain.

A third example of a suitable mutant factor VIII that can be modified according to the present invention, the performance is to place a chimeric factor VIII human/animal, containing one or more amino acid residues from the sequence of the protein of the animal as a substitute (replacement) amino acid residues in the protein sequence of the person responsible for the antigenicity of human factor VIII. In particular, substitution at amino acid residue of the protein sequence of the animal (e.g. pig) may include, without limitation, one or more of the following: R484A, R488G, P485A, L486S, Y487L, Y487A, S488A, S488L, R489A, R489S, R490G, L491S, P492L, P492A, K493A, G494S, V495A, K496M, H497L, L498S, K499M, D500A, F501A, P502L, I503M, L504M, P505A, G506A, E507G, I508M, I508A, M2199I, F2200L, L2252F, V2223A, and K2227E/or L2251 (U.S. Patent No. 5859204, Lollar, U.S. Patent No. 6770744, author Lollar, and publication of an application for U.S. Patent No. 2003/0166536, author Lollar, each of which is incorporated into the present application by reference in full). Preferably, the recombinant chimeric factor VIII contains one or more of the mutations described above (e.g., at positions 287, 302, 519, 665, and/or 1984).

The fourth example of a suitable mutant factor VIII that can be modified according to the present invention is a factor VIII, which has a higher affinity for factor IXa (see, for example,Fay et al., “Factor VIIIa A2 Subunit Residues 558-565 Represent a Factor IXa Interactive Site,” J. Biol. Chem. 269(32):20522-7 (1994); Bajaj et al., “Factor IXa: Factor VIIIa Interaction. Helix 330-338 of Factor IXa Interacts with Residues 558-565 and Spatially Adjacent Regions of the A2 Subunit of Factor VIIIa,” J. Biol. Chem. 276(19):16302-9 (2001); and Lenting et al., “The Sequnce Glu1811-Lys1818 of Human Blood Coagulation Factor VIII Comprises a Binding Site for Activated Factor IX,” J. Biol. Chem. 271(4):1935-40 (1996), each of the sources included in the present application by reference in full) and/or factor X (see, e.g., Lapan et al., “Localization of a Factor X Interactive Site in the A1 Subunit of Factor VIIIa,” J. Biol. Chem. 272:2082-88 (1997), incorporated into the present application by reference in full). Preferably, the factor VIII with increased affinity contains one or more of the mutations described above (e.g., at positions 287, 302, 519, 665, and/or 1984).

The fifth example of a suitable mutant factor VIII that can be modified according to the present invention is a factor VIII modified in order to enhance secretion of factor VIII (see, for example, Swaroop et al., “Mutagenesis of a Potential Immunoglobulin-Binding Protein-Binding Site Enhances Secretion of Coagulation Factor VIII,” J. Biol. Chem. 272(39):24121-4 (1997), incorporated into the present application by reference in full). Preferably the mutant factor VIII, characterized by increased secretion, contains one or more of the mutations listed above (for example, at positions 287, 302, 519, 665, and/or 1984).

The sixth example of a suitable mutant factor VIII that can be modified according to the present invention is a factor VIII with increased half-life in the bloodstream. This modification can be carried out using various approaches, including, without limitation, due to the GSP the mix of interactions with heparansulfate (Sarafanov et al., “Cell Surface Heparan Sulfate addition proteoglycans Participate in Factor VIII Catabolism Mediated by Low Density Lipoprotein Receptor-Related Protein,” J. Biol. Chem. 276(15):11970-9 (2001), incorporated into the present application by reference in full), and/or protein-related receptor low density lipoprotein (“LRP”) (Georges tarbouriech et al., “Role of the Low Density Lipoprotein-Related Protein Receptor in Mediation of Factor VIII Catabolism,” J. Biol. Chem. 274(53):37685-92 (1999); and Lenting et al., “The Light Chain of Factor VIII Comprises a Binding Site for Low Density Lipoprotein Receptor-Related Protein,” J. Biol. Chem. 274(34):23734-9 (1999), each of these sources is incorporated into the present application by reference in full). Preferably, the mutant factor VIII with increased half-life contains one or more of the mutations described above (e.g., at positions 287, 302, 519, 665, and/or 1984).

The seventh example of a suitable mutant factor VIII that can be modified according to the present invention is a modified factor VIII is encoded by a nucleotide sequence modified in such a way that the specified sequence encodes amino acids forming well-known existing epitopes, receiving a recognizable sequence for glycosylation sites at asparagine residues (see, for example, U.S. Patent No. 6759216, author Lollar, incorporated into the present application by reference in full). Mutant factor VIII in this example can be applied to obtain modificirovannogo factor VIII, which is not recognizable any abscopal existing antibodies (factor VIII with low antigenicity) and which reduces the likelihood of developing inhibitory antibodies (factor VIII with low immunogenicity). In a particular implementation of this example, the modified factor VIII contains a mutation, leading to the emergence of a consensus amino acid sequence for N-linked glycosylation. An example of such a consensus sequence is N-X-S/T, where N is asparagine, X is any amino acid, and S/T denotes serine or threonine (see U.S. Patent No. 6759216, author Lollar, incorporated into the present application by reference in full). Preferably containing a glycosylation site modified factor VIII contains one or more of the mutations described above (e.g., at positions 287, 302, 519, 665, and/or 1984).

The eighth example of a suitable mutant factor VIII that can be modified according to the present invention is a modified factor VIII, representing the factor VIII protagonizada activity, containing various mutations (see, for example, the publication of the Patent application U.S. No. 2004/0092442, the authors Kaufman and others, incorporated into the present application by reference in full). One example of this variant implementation of the present invention relates to mo is inficirovannye factor VIII, which has been modified with the aim of (i) the deletion of the binding site with von Willebrand factor, (ii) adding mutations at Arg 740 and (iii) adding a spacer elements amino acid sequence between domains A2 and A3, while the spacer elements specified the amino acid sequence has a length sufficient so that when activating protein factor VIII protagonizada activity was heterodimers (see publication of the Patent application U.S. No. 2004/0092442, the authors Kaufman and others, incorporated into the present application by reference in full). Preferably the factor VIII protagonizada activity also modified so that it contains one or more of the mutations described above (e.g., at positions 287, 302, 519, 665, and/or 1984).

In addition, the mutant factor VIII can be modified to improve various characteristics, representing the benefits associated with recombinant coagulation factors in General (see, for example, the work of Georges tarbouriech et al., “The Future of Recombinant Coagulation Factors,”J. Thrombosis and Haemostasis1:922-930 (2003), incorporated into the present application by reference in full).

Recombinant factor VIII according to the present invention can be modified by any charged residue, which destabilizes the contact area of the A1A2 domains or A2A3 (including provisions 287, 302, 519, 665, or 1984), and mo is the changes can be derived factor VIII, devoid of B-domain, chimeric, having a modified calcium-binding sites that enhance the activity of factor VIIIa (e.g., at position 113)with the modified sites inactivating cleavage, which has a higher affinity for factor IXa and/or factor X, with increased secretion with increased half-life in the bloodstream, or having a modified glycosylation sites; or with at least one of these modifications in addition to the one or more modifications of charged residues, including the modified calcium-binding site, which improves the activity of the recombinant factor VIII. Some examples of proteins recombinant factor VIII deprived of B-domain, with increased specific activity, high stability, as described in the Examples.

Recombinant factor VIII is preferably get in almost pure form. In a specific embodiment, the implementation of almost pure recombinant factor VIII purified at least about 80%, more preferably at least 90%, most preferably at least 95%. Almost pure recombinant factor VIII can be obtained using standard methods, well known in the art. As a rule, almost pure recombinant factor VIII is secreted into the nutrient medium for the growth of the rivers is minantly host cells. Alternatively, almost pure recombinant factor VIII is produced but not secreted into the nutrient medium. In such cases, the allocation of nearly pure recombinant factor VIII cell-hosts carrying the recombinant plasmid, multiply, are lysed by ultrasonic treatment, heating or chemical treatment, and the homogenate was centrifuged to remove cellular debris. Then the supernatant precipitated with ammonium sulfate. The fraction containing almost pure recombinant factor VIII, powerhaul gel filtration on columns with dextran or polyacrylamide suitable size for the separation of recombinant factor VIII. If necessary, the protein fraction (containing almost pure recombinant factor VIII) may be further purified by high performance liquid chromatography (HPLC).

Another aspect of the present invention relates to an isolated nucleic acid molecule which encodes a recombinant factor VIII according to the present invention. An isolated nucleic acid molecule encoding a recombinant factor VIII can be either RNA or DNA.

In one embodiment, the implementation of the present invention, the isolated nucleic acid molecule can have a nucleotide sequence which, coding mutation at position 113, which increases the specific activity of factor VIII, with a modification in the form of one or more of the substitutions of charged residues (e.g., at positions 287, 302, 519, 665, 1984 and/or 332-340 in SEQ ID no: 2).

In another implementation of the present invention, the isolated nucleic acid molecule can have a nucleotide sequence encoding devoid of B-domain of factor VIII above-described type with a modification in the form of one or more of the substitutions of charged residues (e.g., at positions 287, 302, 519, 665, and/or 1984 in SEQ ID no:2).

In another implementation of the present invention, the isolated nucleic acid molecule can have a nucleotide sequence encoding a chimeric human/porcine protein of the type indicated above, with modification as one or more substitutions of charged residues (e.g., at positions 287, 302, 519, 665, and/or 1984 in SEQ ID no:2).

In another implementation of the present invention, the isolated nucleic acid molecule can have a nucleotide sequence encoding factor VIII, in which sites of inactivation have been modified, as described above, with the additional modification in the form of one or more of the substitutions of charged residues (e.g., at positions 287, 302, 519, 665, and/or 1984 in SEQ ID no:2).

In yet another implementation of the present invention isolated the fair molecule nucleic acid can have a nucleotide sequence that encoding the factor VIII with increased affinity for factor IXa and/or factor X, with the additional modification in the form of one or more of the substitutions of charged residues (e.g., at positions 287, 302, 519, 665, and/or 1984 in SEQ ID no:2).

In the following implementation of the present invention, the isolated nucleic acid molecule can have a nucleotide sequence encoding factor VIII, in which the affinity for various binding proteins serum modified to increase its half-life in the bloodstream, with the additional modification in the form of one or more of the substitutions of charged residues (e.g., at positions 287, 302, 519, 665, and/or 1984 in SEQ ID no:2).

In the following implementation of the present invention, the isolated nucleic acid molecule can have a nucleotide sequence encoding factor VIII, characterized by increased secretion in the culture, with the additional modification in the form of one or more of the substitutions of charged residues (e.g., at positions 287, 302, 519, 665, and/or 1984 in SEQ ID no:2).

In the following implementation of the present invention, the isolated nucleic acid molecule can have a nucleotide sequence encoding a factor VIII containing one or more non-natural site of glycosylation, with the additional modification in the form of one or more of the substitutions of charged residues (such as the er, at positions 287, 302, 519, 665, and/or 1984 in SEQ ID no:2).

In another implementation, the isolated nucleic acid molecule encodes a recombinant factor VIII modified by any one or more charged residues, as described above, and also modified and the modifications having any two or more characteristics: modifications devoid of B-domain, modifying chimeric, having changed sites inactivating cleavage, modified to increase the affinity for factor IXa and/or factor X, modified to enhance its secretion is modified to increase the time of its half-life in the bloodstream, modified for the purpose of making one or more non-natural glycosylation site and modified within the calcium-binding site (for example, at position 113) so that the specific activity of the recombinant factor VIII is improved.

Another aspect of the present invention relates to a system for the expression of recombinant DNA, which comprises an isolated DNA molecule according to the present invention, this expression system encodes the recombinant factor VIII. In one implementation options of the DNA molecule is in sense orientation relative to the promoter.

Another aspect of the crust is asego invention relates to a cell-master, containing an isolated nucleic acid molecule encoding the recombinant factor VIII according to the present invention. In a specific embodiment, the implementation of a host cell can contain an isolated nucleic acid molecule in the form of a DNA molecule either in the form of stable plasmids or stable insertions or integrate into the genome of the host cell. In another embodiment, the implementation of a host cell may contain the DNA molecule in the system for the expression. Suitable cell host may represent, without limitation, cells of animals (e.g., cells of the kidneys of hamsters (“BHK”), cells of bacteria (for example,E. coli), insect cells (e.g., Sf9 cells), cells of fungi, yeast cells (e.g.,SaccharomycesorSchizosaccharomyces), plant cells (e.g. cellsArabidopsisor tobacco), or algal cells.

System for expression of recombinant DNA and cell-hosts can be obtained using various methods well-known in this area, as discussed below in more detail.

A DNA molecule encoding a recombinant factor VIII according to the present invention can be introduced into cells using standard methods of work with recombinant DNA. In General, this process involves the introduction of DNA molecules in a system for the expression, in relation to which the DNA molecule I is is heterologous (i.e., normal is not present in this system). Heterologous DNA molecule is introduced into the system for the expression or vector in the sense orientation and correct reading frame. The vector contains the necessary elements for the transcription and translation of the input sequence that encodes a protein. Thus, one embodiment of implementation of the present invention provides a DNA construct containing the isolated nucleic acid according to the present invention, functionally associated with the 5'promoter and 3'regulatory segment (for example, a transcription terminator)capable of transcription and expression of the encoded recombinant factor VIII according to the present invention in the cells of the host or organisms hosts.

As for recombinant system for expression according to the present invention, a vector for expression, containing a DNA molecule encoding the recombinant factor VIII according to the present invention, can be obtained using techniques standard in this area. The nucleic acid molecules according to the present invention can be incorporated into any of the many available vectors using reagents that are well known in this field. When designing a DNA vector for expression in a bacterial plasmid can be normal built in or enter the us by substitution of different DNA sequences. You can apply any suitable plasmid, characterized by the presence of bacterial replication system, marker, which allows for selection in bacteria, and, as a rule, one or more unique, appropriately located sites for the restriction. The method of selection of the vector depends on the preferred methods of transformation and host-target for transformation.

For expression of the sequence (sequence)that encodes a recombinant factor VIII, it is possible to apply different systems of the host-vector. First of all, the vector system must be compatible with the cells of the host. System host-vector include, but are not limited to the above: bacteria transformed with the DNA of the bacteriophage, plasmid DNA or kosmidou DNA; microorganisms such as yeast containing yeast vectors; mammalian cell infected with the virus (e.g. vaccinia virus, adenovirus, adeno-associated virus and the like); insect cells infected with virus (e.g. baculovirus); and plant cells infected by bacteria (for example,Agrobacterium). The expression elements of these vectors vary in strength (efficiency) and specificity. Depending on the system the host-vector can be used to implement any number under Odesa elements of transcription and translation.

When receiving recombinant method protein or factor VIII polypeptide (or fragment, or variant) Express in a recombinant cell host, usually but not exclusively in eukaryotic cells.

Suitable vectors for the implementation of the present invention include, but are not limited to the above, the following viral vectors such as the system based on the vector lambda gt11, gtWES.tB, Charon 4, and plasmid vectors such as pCMV, pBR322, pBR325, pACYC177, pACYC184, pUC8, pUC9, pUC18, pUC19, pLG339, pR290, pKC37, pKC101, SV 40, pBluescript II SK +/- or KS +/- (see “Stratagene Cloning Systems” Catalog (1993)), pQE, pIH821, pGEX, pET series (see Studier et al, “Use of T7 RNA Polymerase to Direct Expression of Cloned Genes,”Methods in Enzymology185:60-89 (1990), incorporated into the present application by reference in full), and any derivatives of these vectors. In the present invention can use any suitable for genetic transformation vectors currently known or that will be described later.

Recombinant molecules can be introduced in the cell by transformation, in particular, transduction, conjugation, mobilization, or electroporation. The DNA sequence of a clone in the vector using standard methods cloning, known in this area, as described in the manual Maniatis et al., Molecular Cloning:A Laboratory Manual, Cold Springs Harbor, N.Y.: Cold Springs Laboratory, (1982), included in nastoyaschuyuyu by reference in full.

U.S. patent No. 4237224, issued to Cohen and Boyer, incorporated into the present application by reference in full, describes the obtaining of expression systems in the form of recombinant plasmids using splitting using restricted and ligation with DNA ligase. These recombinant plasmids are then introduced by means of transformation and replicate in the culture of single-celled organisms, including prokaryotic organisms and eukaryotic cells grown in tissue culture.

Many levels of gene expression (e.g. transcription of DNA and translation of messenger RNA (mRNA)) are controlled by different genetic signals and event processing.

Transcription of DNA depends on the presence of a promoter, which is a DNA sequence that determines the binding of RNA polymerase and thus stimulates the synthesis of mRNA. The DNA sequence of a eukaryotic promoters are different from sequences of prokaryotic promoters. In addition, eukaryotic promoters and accompanying genetic signals may not be recognized or may not function in prokaryotic systems, and Vice versa, prokaryotic promoters are not recognized and do not function in eukaryotic cells.

Similarly, translation of mRNA in prokaryotes depends on the presence matched the existing prokaryotic signal, which differ from those in eukaryotes. For efficient translation of mRNA in prokaryotes, it is necessary for mRNA binding site of the ribosome, called the Shine-dalgarno sequence (Shine-Dalgarno, SD"). This sequence is a short nucleotide sequence of mRNA that is localized before the start-codon, usually AUG, encoding aminobenzoyl methionine of the protein. The SD sequence complementary to the 3'-end of 16S rRNA (ribosomal RNA) and, as suggested, stimulates binding of mRNA to ribosomes due to the formation of a duplex with rRNA, which makes it possible to correct positioning of the ribosome. The review is devoted to the optimization of gene expression, see Roberts and Lauer,Methods in Enzymology68:473 (1979), incorporated into the present application by reference in full.

Promoters vary in their "strength" (i.e., ability to stimulate transcription). For the expression of cloned gene in General it is desirable to use strong promoters in order to achieve a high level of transcription and, hence, gene expression. Depending on the system host cells, you can apply any of a number of suitable promoters. For example, when cloning in cellsEscherichia coliin its bacteriophages, or plasmids, to achieve a high level of transcription of the connecting segments of DNA mo is but to apply the promoters, such as the promoter of phage T7,lacthe promoter,trpthe promoter,recA promoter, ribosomal RNA promoter, the promoters of PRand PLcoliphage lambda and others, including but not limited to the above,lacUV5,ompF,bla,lppand others Besides, to ensure transcription of the inserted gene can be applied hybrid promotertrp-lacUV5 (tacor other promotersE. coliobtained through recombinant DNA technology or other methods of constructing DNA.

Bacterial strains of host cells and vectors for expression can be selected such that suppress the activity of the promoter in the absence of a specific inducer. In specific cases, the addition of specific inducers is necessary for efficient transcription of the integrated DNA. For example,lacthe operon is activated by the addition of lactose or IPTG (isopropylthio-beta-D-galactoside). Other operons, such astrp,proand so on, are controlled by a variety of other regulators.

For efficient transcription and translation of the gene in prokaryotic cells also require specific signals for initiation. Such signals for transcription and translation can have different "power", estimated by the number genespecific messenger RNA and protein synthesized, respectively. The vector for expression of the DNA containing the second promoter, may also contain any combination of signals for initiation of transcription and/or translation with different "powers". For example, for efficient broadcast in the cells ofE. coliyou must have a SD sequence at a distance of 7-9 bases from the 5'end to the initiating codon (ATG”), representing the binding site of the ribosome. Thus, it is possible to use any combination of SD-ATG, which can be used by the ribosomes of the host cell. Such combinations include, but are not limited to the above, the combination of SD-ATG genecroor geneNcoliphage lambda, or from genes E, D, C, B or A tryptophan operonE. coli. In addition, you can apply any combination of SD-ATG obtained using recombinant DNA technology or other methods, including the incorporation of synthetic nucleotides.

In one embodiment, the implementation of the nucleic acid molecule according to the present invention is inserted into a suitable vector in sense orientation, such that the open reading frame is properly oriented for the expression of the encoded protein under the control of a selected promoter. This process involves the injection of suitable regulatory elements in the design of vector DNA. Such items include untranslated region vector used promoters, and 5'- and 3'-noncoding region, which is simtastic host cellular proteins for transcription and translation. Such elements may have different strength and specificity. Depending on the vector system and host cell can be applied any number of suitable elements for transcription and translation, including constitutive and inducible (adjustable) promoters.

The constitutive promoter is a promoter controlling gene expression during development and functioning of the body.

The inducible promoter is a promoter capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to the action of the inductor. In the absence of inducer, DNA sequences or genes will not be transcribed.

Design DNA according to the present invention may also include functional 3'-regulatory region, selected from the sequences that are capable of providing correct transcription termination and polyadenylation of mRNA for expression in the selected cell hosts, functionally related DNA molecule that encodes a selected protein.

The selected vector, a promoter and a suitable 3'regulatory region can be legirovanyh together with obtaining DNA constructs according to the present invention using well known techniques of molecular cloning, as described in the Roux is the management Sambrook et al., Molecular Cloning:A LaboratoryManual, Second Edition,,Cold Spring Harbor Press, NY (1989), and Ausubel, F. M. et al. Current Protocols in Molecular Biology, New York, N.Y: John Wiley & Sons (1989), incorporated into the present application by reference in full.

As noted, one of the alternatives to the use of prokaryotic host cells is the use of eukaryotic host cells, such as mammalian cells, which can also be used to obtain the recombinant method of recombinant factor VIII according to the present invention. Mammalian cells suitable for implementing the present invention, include, among other things: COS cells (e.g., ATCC No. CRL 1650 or 1651), BHK (e.g., ATCC No. CRL 6281), CHO (e.g., ATCC No. CCL 61), HeLa (e.g., ATCC No. CCL 2), 293 (ATCC No. 1573), CHOP and NS-1 cells.

Suitable expression vectors for the implementation of the expression in mammalian cells generally include a promoter, and a sequence controlling transcription and translation, known in this area. Common promoters include promoters of SV40, MMTV, metallothionein-1, adenovirus Ela, CMV, pretani the promoter, the promoter and enhancer of the heavy chain of immunoglobulin and RSV-LTR.

The DNA structure according to the present invention ready for insertion into the cell host. Accordingly, another aspect of the present invention relates to a method of gaining the recombinant cells. Essentially, this method is carried out by transforming a host cell with DNA constructs according to the present invention under conditions effective for transcription of the DNA molecule in the cell host. Recombinant molecules can be introduced into cells via transformation, in particular, transduction, conjugation, mobilization, or electroporation.

Whereas the recombinant DNA technology discussed in this application, another aspect of the present invention relates to a method for preparation of recombinant factor VIII according to the present invention. This method comprises the cultivation of host cells according to the present invention under conditions in which a host cell expresses the recombinant factor VIII. Then carry out the selection of recombinant factor VIII. In one embodiment of the invention the cell-master growin vitroin the medium. In the private implementation, a suitable nutrient medium may include, without limitation, a nutrient medium containing the factor a background of Villebranda (in this application is labeled "FFV"). In the specified case the implementation of a host cell can contain a transgene encoding FFV, or FPV can be introduced into the nutrient medium as an additive. Contained in a nutrient medium FFV allows recombina Tomo factor VIII expressed at a higher level. After secretion of recombinant factor VIII in a nutrient medium, it can be isolated from the culture medium using methods well known to experts in the field of recombinant DNA, and proteins (including those described in this application). In another variant implementation of the method of preparation of recombinant factor VIII according to the present invention further includes the destruction of the host cell before secretion of recombinant factor VIII. In the specified case the implementation of the recombinant factor VIII is isolated from the decay products of the cells.

Modifications to provisions 287, 302, 519, 665, and/or 1984 are particularly preferred because they cause increased stability of both factor VIII and factor VIIIa. This increased stability is important in relation to time-life in the bloodstream of factor VIII and activity of factor VIIIa in blood coagulation. In addition, this property is significant in terms of increasing output suitable for application of factor VIII in the treatment process and obtain preparations of protein for therapeutic use.

Using the expression vector for transformationin vivofor the purpose of inducing the expression of factor VIII in the target cells, it is possible to apply the promoters of varying strength depending on the required increase in the level of expression. Specialist in the area and can easily choose a suitable mammalian promoters based on their strength as a promoter. Alternatively, you can apply inducible promoter to regulate the necessary level of expression or suppression of the expression of factor VIII. The person skilled in the art can easily choose suitable inducible promoters mammals known in this field. Finally, it can be selected tissue-specific promoters mammals to limit the actions of any system transformation to a specific tissue. Tissue-specific promoters are known in this field can be selected on the basis of the processed tissue or cell type.

Another aspect of the present invention relates to a method of treatment of the animal blood diseases such as hemophilia, in particular hemophilia A. This method includes the introduction of an animal suffering from hemophilia A, an effective amount of recombinant factor VIII according to the present invention, while the animal is observed for effective blood clotting after injury of the vessel. A suitable effective amount of recombinant factor VIII may include, without limitation, from about 10 to about 50 units/kg of body weight of the animal. The animal can be any mammal, but preferred is human, rat, mouse, Guinea pig, dog, cat, monkey, chimpanzee, orangutan, cow, horse, sheep, pig, goat or rabbit.

Recombinant factor VIII according to the present invention can be used to treat uncontrolled bleeding due to deficiency of factor VIII (e.g., intraarticular, intracranial or gastrointestinal hemorrhage) in hemophilia patients with and without inhibitory antibodies and in patients with acquired deficiency of factor VIII, due to the development of inhibitory antibodies. In a specific implementation recombinant factor VIII, directly or in the form of pharmaceutical compositions (iein combination with stabilizers, means of delivery and/or media), is administered to the patient intravenously according to the procedure used for infusion of factor VIII human or animal.

Alternatively or in addition, recombinant factor VIII can be introduced through the introduction of vector-based virus, such as adeno-associated virus (see publication Gnatenko et al., Br. J. Haematol.104:27-36 (1999), incorporated into the present application by reference in full), or by transplantation of cells, which are the result of manipulations by the methods of genetic engineering produce recombinant factor VIII, as a rule, by the insertion of the device containing the specified cell. Such transplantation usually involves the use of recombinant human dermal fibroblasts obtained from POM is using a non-viral approach (see the publication of Roth et al., New Engl. J. Med. 344:1735-1742 (2001), incorporated into the present application by reference in full).

Therapeutic doses of recombinant factor VIII, which should be introduced to a patient in need of such treatment vary depending on the severity of the disease associated with deficiency of factor VIII. Typically, dose adjust in accordance with the frequency, duration, and activity units in accordance with the severity and duration of the attack of bleeding in the individual patient. Accordingly, recombinant factor VIII is included in the pharmaceutically acceptable carrier, a delivery vehicle or stabilizer in sufficient quantity for delivery to the patient a therapeutically effective amount of protein to stop bleeding, defined using standard tests coagulating activity.

Factor VIII is generally defined as a substance present in normal blood plasma that corrects the violation of coagulation in plasma derived from individuals with hemophilia A. the Coagulating activity ofin vitrofactor VIII purified and partially purified form is used to calculate the dose of recombinant factor VIII for administration to patients, coagulating activity is a reliable indicator of activity recovery of blood plasma of patients and correction of violations the response to bleeding in vivo. Has not been shown discrepancies between the standard analysis of new molecules of factor VIIIin vitroand their behavior in the model infusion dogs or sick people, according to Lusher et al., New Engl. J. Med.328:453-459 (1993); Pittman et al., Blood 79:389-397 (1992); and Brinkhous et al., Proc. Natl. Acad. Sci.82:8752-8755 (1985), each of which is incorporated into the present application by reference in full.

Usually the required level of activity of factor VIII in plasma, which must be achieved in patients following the introduction of recombinant factor VIII, 30-100% of the normal level. In one embodiment, the implementation of the present invention the introduction of therapeutic recombinant factor VIII is carried out intravenously with preferred doses range from about 5 to 50 units/kg of body weight, and in particular, in the range of 10-50 units/kg of body weight, in particular at doses of 20-40 units/kg body weight; at this frequency interval is in the range from 8 to 24 hours (in severe cases of hemophilia); and duration of treatment in days is in the range from 1 to 10 days to resolve the bleeding. See.for example, the work of Roberts and Jones “Hemophilia and Related Conditions--Congenital Deficiencies of Prothrombin (Factor II, Factor V, and Factors VII to XII),” Ch. 153, 1453-1474, 1460, in Hematology, Williams, W. J., et al., ed. (1990), incorporated into the present application by reference in full. Patients with inhibitors may, in order to removethese different amounts of recombinant factor VIII regarding factor VIII previous form. For example, patients may need a smaller amount of recombinant factor VIII because of its higher specific activity compared to factor VIII wild-type and reduced its reactivity of antibodies. When the treatment of the human or obtained from plasma factor VIII, the amount of injected therapeutic recombinant factor VIII is determined using a single-stage analysis of coagulation factor VIII, and in some cases, the restoration of thein vivodetermine, by measuring the factor VIII in the plasma of patients after the infusion. You must understand that for each particular subject, specific dosage regimen should be adjusted over time according to the individual need and the professional judgment of the person making the introduction or watching the introduction of the compositions, and that the concentration ranges specified in this application, are given only as examples and do not limit the scope or practice of the realization of the stated recombinant factor VIII.

Treatment can take the form of single or periodic intravenous recombinant factor VIII, or continuous injection for a long period of time if necessary. Alternatively, therapeutic rekombinantnymi VIII can be administered subcutaneously or orally with the help of liposomes single or multiple doses during different time intervals.

Recombinant factor VIII can also be used to treat uncontrolled bleeding due to deficiency of factor VIII in hemophilia patients who have developed antibodies to human factor VIII.

In this application, it was shown that the recombinant factor VIII according to the present invention may differ in specific activity of factor VIII wild type. Protein factor VIII having increased protagonizada activity compared to factor VIII wild type, successfully applied for the treatment of hemophilia because of the deficiency of factor VIII required lower doses. This not only reduces medical costs for the patient and for the insurer, but also reduces the likelihood of immune response to factor VIII (as you enter fewer antigen).

EXAMPLES

The following examples are presented to illustrate variants of realization of the present invention, but they in no way limit its scope.

Materials and methods

Reagents

Recombinant factor VIII (KogenateTM) was kindly provided as a gift to Dr. Lisa Regan, Corporation Bayer Corporation (Berkeley, CA). Phospholipid vesicles containing 20% phosphatidylcholine (PC), 40% phosphatidylethanolamine (PV) and 40% phosphatidylserine (PS), were obtained using octylglucoside is Yes, as described earlier (see publication Mimms et al., “Phospholipid Vesicle Formation and Transmembrane Protein Incorporation Using Octyl Glucoside,” Biochemistry 20:833-840 (1981), incorporated into the present application by reference in full). Reagents α-thrombin, factor VIIa, factor Ixaβ, factor X and factor Xa (Enzyme Research Laboratories, South Bend, IN), hirudin and phospholipids (DiaPharma, West Chester, OH), chromogenic Xa substrate, Pefachrome Xa (Pefa-5523, CH3OCO-D-CHA-Gly-Arg-pNA·AcOH; Centerchem Inc. Norwalk CT), recombinant tissue factor human (RTF), Innovin (Dade Behring, Newark, DE), fluorogenic substrate, Z-Gly-Gly-Arg-AMC (Calbiochem, San Diego, CA) and the calibration marker of thrombin (Diagnostica Stago, Parsippany, NJ) were purchased from the indicated suppliers.

Construction, expression and purification of factor VIII wild type and its variants

Mutant forms with replacement by Ala (D27, H281, R282, E287, D302, S313, H317, T522, S524, R531, N538, E540, S650, S654, D666, E683, N684, S695, D696, S1791, D1795, Q1820, E1829, S1949, N1950 and R1966); Phe (Y476, Y664, Y1786, and Y1792); Ala and Val (charged residues E272, D519, E665 and E1984); and factor VIII wild type, were individually designed in the form devoid of B-domain of factor VIII, devoid of residues Gln744-Ser1637 in the B-domain (see publication Doering et al., “Expression and Characterization of Recombinant Murine Factor VIII,” ThrombHaemost. 88:450-458 (2002), incorporated into the present application by reference in full). Design for cloning and expression were kindly provided by Dr. Pete Lollar and John Healey. Forms of recombinant factor VIII wild-type is its variants stably expressed in the cells, baby hamster kidney (BHK, Baby hamster kidney) and was purified as described previously (see publication Wakabayashi et al., “Residues 110-126 in the A1 Domain of Factor VIII Contain a Ca2+Binding Site Required for Cofactor Activity,” J Biol Chem. 279:12677-12684 (2004), incorporated into the present application by reference in full). After transfection significant differences in the amount of secretion of factor VIII among the options were not observed. The protein yield for options ranged from >10 to ~100 µg of two 750 cm2flasks with culture, the degree of purity varied from ~85% to >95% as estimated using LTO-PAG. The main contaminants preparations of factor VIII was albumin, and at the concentrations at which he was present in the preparations of factor VIII, it had no effect on the stability of the activity. The concentration of factor VIII were determined using enzyme-linked immunosorbent assay (solid phase ELISA), and the activity of factor VIII was determined using the single-stage analysis coagulating activity and two-stage chromogenic analysis of the formation of factor Xa, as described below.

LTO-page and Western blotting

Protein factor VIII (0,77 mcg for staining the gel and 0.34 µg for Western blot) were subjected to electrophoresis in 8% polyacrylamide gel at constant voltage (100 V). Gels were stained with dye Gelcode Blue (Thermo Scientific, Rockford, IL) or transferred to a membrane made of polyvinylidene fluoride and revealed through the Yu biotinylated antibodies to A2 (R8B12, Green Mountain Antibodies, Burlington, VT), followed by incubation with conjugated with peroxidase-streptavidin (Calbiochem, San Diego, CA). Carried out the reaction with chemifluorescence substrate (substrate ECF, GE Healthcare, Piscataway, NJ) and analyzed the fluorescence signal using the analyzer images phosphoimager (Storm 860, GE Healthcare). Quantitative assessment of the intensity for the single-chain form of factor VIII (170 kDa) and heavy chain (SC, 90 kDa) was performed using the software ImageQuant (GE Healthcare) and expected relationship value.

Solid-phase ELISA

Solid-phase sandwich ELISA was performed to assess protein concentrations of factor VIII, as described previously (see publication Wakabayashi et al., “A Glu113Ala Mutation within a Factor VIII Ca2+-Binding Site Enhances Cofactor Interactions in Factor Xase,” Biochemistry 44:10298-10304 (2005), incorporated into the present application by reference in full), using as a standard of purified commercial recombinant factor VIII (Kogenate, Bayer Corporation). For detection of factor VIII used anti-C2 antibody (ESH-8, American Diagnostica Inc., Stamford, CT) and biotinylated antibodies R8B12 for determination of factor VIII.

Single-stage analysis coagulating activity

Single-stage analysis coagulating activity was carried out using the substrate of plasma-chemical method devoid of factor VIII (article Over, “ Methodology of the One-stage Assay of Factor VIII (VIII:C),” Scand J Hamatol Suppl. 41:13-24 (1984), incorporated into the present application by reference in full), which was analyzed using the instrument for the analysis of coagulation Diagnostica Stago. Plasma incubated with APTT reagent (General Diagnostics) for 6 min at 37oC, after which the cell was added to the diluted factor VIII. After 1 min the mixture was reconciliable, determine the clotting time of blood and compared with the standard pooled normal plasma.

Two-stage chromogenic analysis of the formation of factor Xa

The rate of conversion of factor X into factor Xa controlled in a purified system (see Lollar et al., “Factor VIII and Factor VIIIa,” Methods Enzymol. 222:128-143 (1993), incorporated into the present application by reference in full) according to a previously described method (see Wakabayashi et al., “Metal Ion-independent Association of Factor VIII Subunits and the Roles of Calcium and Copper Ions for Cofactor Activity and Inter-subunit Affinity,” Biochemistry 40:10293-10300 (2001); Wakabayashi et al., Ca2+Binding to Both the Heavy and Light Chains of Factor VIII Is Required for Cofactor Activity,” Biochemistry 41:8485-8492 (2002), each of which is incorporated into the present application by reference in full). Factor VIII (1 nm) in buffer containing 20 mm N-[2-hydroxyethyl]piperazine-N'-[2-econsultancy acid] (HEPES), pH of 7.2, 0.1 M NaCl, 0.01% of Tween 20, 0.01% BSA, 5 mm CaCl2and 10 μm vesicles PSPCPE (Buffer A), activated with 20 nm α-thrombin for 1 min the Reaction was stopped by addition of hirudin (10 u/ml), and the resulting factor VIIIa reacted with factor IXa (40 nm) for 1 min was Added factor X (300 nm) to initiate the reaction, which was suppressed after 1 min by adding 50 mm EDTA. The resulting factor Xa was determined after reaction with the chromogenic substrate Pefachrome Xa (final concentration of 0.46 mm). All reactions were carried out at 23°C.

Analysis of the formation of thrombin

The amount of thrombin generated in the plasma was estimated using the calibrated automated tomographie (see Hemker et al., “Calibrated Automated Thrombin Generation Measurement in Clotting Plasma,” Pathophysiol Haemost Thromb. 33:4-15 (2003); Hemker et al., Calibrated Automated Thrombin Generation Measurement in Clotting Plasma,” Pathophysiol HaemostThromb. 33:4-15 (2003); Hemker et al., “Thrombin Generation in Plasma: Its Assessment via the Endogenous Thrombin Potential,” Thromb Haemost.74:134-138 (1995), each of which is incorporated into the present application by reference in full). In 96-hole tablet was mixed with 80 µl of plasma, devoid of factor VIII (<1% residual activity, depleted platelets)taken from patients with severe hemophilia a with no inhibitor to factor VIII (George King Bio-Medical, Overl Park, KS) with samples of factor VIII (20 µl; 6 nm) in buffer HEPES-BSA (20 mm HEPES, pH of 7.35, 0.15 M NaCl, 6% BSA)containing 3 PM RTF (the concentration of the original solution RTF was determined by analyzing the formation of factor Xa with using known concentrations of factor VIIa), vesicles PSPCPE (24 μm) or 20 μl kalibrovochnoj the marker of thrombin (630 nm), and the reaction was immediately initiated by mixing 20 μl fluorogenic substrate (2.5 mm Z-Gly-Gly-Arg-AMC) in the buffer HEPES-BSA containing 0.1 M CaCl2. All reagents pre-heated at 37°C. the Final concentration of reagents were: 1 nm factor VIII (unless otherwise noted), 0,5 gr RTF, 4 μm vesicles PSPCPE, 433 μm fluorogenic substrate, 13,3 mm CalCl2and 105 nm calibration marker of thrombin. The development of fluorescence signal at 37°C was observed at intervals of 8 seconds using spectrofluorimetry for microplates (Spetramax Gemini, Molecular Devices, Sunnyvale, CA) using a set of filters of 355 nm (excitation)/460 nm (emission). Fluorescent signals were corrected taking into account the reference signal from the samples of the calibration marker of thrombin (see Hemker et al., “Calibrated Automated Thrombin Generation Measurement in Clotting Plasma,” Pathophysiol Haemost Thromb. 33:4-15 (2003), incorporated into the present application by reference in full) and the actual formation of thrombin in nm was calculated as described previously (Hemker et al., “Thrombin Generation in Plasma: Its Assessment via the Endogenous Thrombin Potential,” Thromb Haemost.74:134-138 (1995), incorporated into the present application by reference in full).

The activity of factor VIII at elevated temperatures

Factor VIII wild-type or variants of factor VIII (4 nm) in buffer A were incubated at 52-60°C. was Selected aliquots at the indicated time points and determine the residual activity of factor VIII using a two-stage chromogenic analysis of the formation of factor Xa.

The dependence of the changes of the activity of factor VIIIa from time

Factor VIII wild type and its mutant forms (4 nm) in A buffer containing 10 μm vesicle PSPCPE, activated with 20 nm thrombin for 1 min at 23°C. the Reaction is immediately inhibited by hirudin (10 units/ml), collected aliquots at the indicated time points and activities were determined using analysis of formation of factor Xa after addition of factor IXa (40 nm) and factor X (300 nm). To measure loss of activity carried out in the presence of factor IXa, factor IXa (40 nm) was added to the reaction before the addition of thrombin.

Stability of factor VIII in plasma is

Factor VIII wild-type or variant (1 nm) was added to the plasma, devoid of factor VIII (<1% residual activity)obtained from patients with severe hemophilia a with no inhibitors of factor VIII (George King Bio-Medical). In plasma was added to 0.02% NaN3to prevent the growth of microorganisms, and the samples were incubated at 37°C. were Selected aliquots at the indicated time points and determined the residual activity using single-stage analysis coagulating activity.

Data analysis

The values of the activity of factor VIIIa as a function of time correlated with the curve with a single exponential decay using non-linear regression analysis using the least squares method with application of equations

A=A0×e-kt

whereArepresents the residual activity of factor VIIIa (nm/min/nm factor VIII),A0- the initial activity,k- estimated rate constant,trepresents the time (minutes) reaction of factor VIII or at elevated temperature (for experiments on determination of loss of activity of factor VIII), or after suppression of activation by thrombin (to assess the loss of the activity of factor VIIIa). Analysis using non-linear regression using the least squares method was performed using Kaleidagraph (Synergy, Reading, PA). Comparison of mean values was performed usingt-test t-test. The structure of the model A-domain of factor VIII (see Pemberton et al., “A Molecular Model for the Triplicated A Domains of Human Factor VIII Based on the Crystal Structure of Human Ceruloplasmin,” Blood 89:2413-2421 (1997), incorporated into the present application by reference in full) was analyzed using applications Swiss PDB Viewer for the identification of charged residues located in the region of the A2 domain and is characterized by low ability to interact through hydrogen bonds on the basis of the threshold value >to 2.8 Å separating the polar atoms of complementary domains (see Weiner et al., “A New Force Field for Molecular MechanicalSimulation of Nucleic Acids Proteins,” J Am Chem Soc. 106:765-784 (1984), incorporated into the present application by reference in full).

Example 1: activity Values for mutant forms of factor VIII mutations affecting the interaction through hydrogen bonds

Binding interactions are involved in the domain A2 of factor VIII, remain poorly understood, although represent a major mechanism of regulation cofactors activity. Based on the homology model of factor VIII (see Pemberton et al., “A Molecular Model for the Triplicated A Domains of Human Factor VIII Based on the Crystal Structure of Human Ceruloplasmin,” Blood 89:2413-2421 (1997), incorporated into the present application by reference in full) helped to identify many potential hydrogen bond linking residues in the A2 domain with residues in the domains A1 or A3. Using the criterion of spatial separation, constituting <a 2.8 Å between atoms donors and acceptors of hydrogen (see Weiner et al., “A New Force Field for Molecular Mechanical Simulation of Nucleic Acids Proteins,” J AmChem Soc. 106:765-784 (1984), incorporated into the present application by reference in full), was identified thirty residues with side-chain atoms, which may be involved in the formation of hydrogen bonds with atoms of A complementary domain (seeTable 1, below). Approximately half of the identified residues, the side chain atoms loc is gales near or spanning carbonyl oxygen, or amide hydrogen atoms, while the remaining showed a possible interaction between neighboring side chains. The target remains in the A-domain of factor VIII were individually changed to Ala, with the exception of Tyr residues that were substituted with Phe, and forms with the appropriate tochkovymi mutations stably expressed in the form devoid of B-domain of factor VIII.

The activity of factor VIII was evaluated for purified proteins using a single-stage analysis coagulating activity and (two) analysis of the formation of factor Xa. The results obtained in the single-stage analysis (Figure 1) showed that 9 of the 30 point mutations showed <50% activity relative to factor VIII wild type. Five of these variants showed a discrepancy of results in single stage/two-stage analysis (>a 1.5-fold difference), while three mutant (S524A, H281A and E287A) showed a decrease only in the two-stage analysis. The decrease in activity values for mutations in multiple target remains consistent with the contribution of these side chains in the structural stability of factor VIII and/or factor VIIIa.

Table 1
Amino acid residues capable of forming hydrogen bonds
The remainder (atom)DomainPair balance
(atom)
DomainDistance (Å)
D27 (Oδ)A1N538 (Hδ)A22,16
H281 (Nδ)A1S524 (Hγ)A22,12
R282 (Hή)A1G520 (COa)A22,02
E287 (Hε)A1P672 (CO)A21,79
D302 (Hδ)A1D482 (CO)A21,98

S313 (Hγ)A1G643 (CO)A21,87
H317 (Nδ)A1 E540 (Hε)A22,78
Y476 (Hή)A2E272 (CO)A11,62
T522 (Oγ)A2R282 (NHb)A12,39
S524 (Hγ)A2H281 (Nδ)A12,12
R531 (Hή)A2R282 (CO)A12,33
N538 (Hδ)A2D27 (Oδ)A12,16
E540 (Hε)A2H317 (Nδ)A12,78
S650 (Hγ)A2P1980 (CO)A31,54
S654 (Hγ) A2Y1786 (Oή)A31,65
Y664 (Hή)A2H1822 (CO)A31,94
D666 (Oδ)A2L1789 (NH)A31,93
E683 (Oε,Hε)A2Q1820 (Hε,Oε)A32,58, 1,72
N684 (Oε)A2S1791 (Hγ)A31,76
S695 (Hγ)A2L1843 (CO)A32,03
D696 (Hδ)A2S1949 (Oγ), N1950 (NH)A31,99, 2,21
Y1786 (Oή)A3S654 (Hγ)A2 1,65
S1791 (Hγ)A3N684 (Oε)A21,76
Y1792 (Hή)A3S654 (CO)A22,27
D1795 (Oδ)A3L687 (NH)A21,99
Q1820 (OεHε)A3E683 (HεOε)A21,72, 2,58
E1829 (OεHε)A3Y664 (NH, CO)A22,15, 1,95
S1949 (Oγ)A3D696 (Hδ)A21,99
N1950 (Hδ)A3T646 (CO)A22,39
R1966 (Hή1,Hή2)A3 K661 (CO)A22,79, 2,01
aSpanning atom of the carbonyl oxygen.
bSpanning atom of the amide hydrogen.

Example 2: thermostability of the variants of factor VIII

To assess thermal stability of protofactory wild-type and variants used a temperature of 55°C on the basis of the results of the analysis on the inactivation of factor VIII, as described in an earlier study (see Ansong et al., “Factor VIII A3 Domain Residues 1954-1961 Represent an A1 Domain-Interactive Site,” Biochemistry 44:8850-8857 (2005), incorporated into the present application by reference in full). During this reaction, the factor VIII were incubated for a specified period of time at an elevated temperature, after which the reaction mixture is immediately cooled to room temperature, the factor VIII is reacted with thrombin, and explored it cofactor activity by analyzing the formation of factor Xa. Determined the loss rate of activity of factor VIII by heat treatment, on the basis of residual cofactors functions, as described in Methods. Figure 2A presents the results for variants, demonstrating greater and lesser sensitivity to heat treatment compared to wild type.

Table 2 (below) summarizes the results obtained from the analysis of thermal stability of factor VIII for 30 variants. In General, data on activity a good fit to the curve with a single exponential decay with correlation coefficients in most cases >0,98. A number of mutations had a favorable effect in relation to replacement of amino acids (21 showed <2-fold differences in the rate of loss of activity), several residues, including Arg282 (A1 domain), and the remains of Ser524, Asn684 and Ser650 of domain A2 showed a ~5- - ~20-fold increase in the rate of loss of activity of factor VIII, which shows the important role of these residues in maintaining the stability of factor VIII. In addition, options R282A and N684A showed significantly reduced values of specific activity that indicates that these point mutations affect parameters such as activity and stability. At the same time, replacement E287 and D302 to Ala resulted in a decrease in the rate of loss of activity of factor VIII at elevated temperatures. This is a noticeable increase in stability of the protein by mutation is consistent with the fact that these acidic side chains destabilize intradomain interaction cofactor wild-type.

Table 2
Speed reduction activity and the activity values of factor VIII and VIIIa
The rate of decrease of activity (min-1)Specific activity
Factor VIIIFactor VIIIa
FIXa (+)aFIXa (-)b
Single-stage
analysis
Dogsto-Penaty
analysis
wild type0,0473 (1,00c)0,0113 (1,00)0,0631 (1,00)4,77d(1,00)44,5e(1,00)
R282A0,9646 (20,4)0,4708 (41,7)0,6738 (10,7)0,95 (0,20)1,77 (0,04)
S524A0,4332 (9,16)0,4554 (40,4)0,4416 (7,00)4,20 (0,88)1,02 (0,02)
N684A0,4002 (8,46)0,4096 (36,3)1,1837 (18,8)0,41 (0,09)2,15 (0,05)
R531A0,2448 (5,18)0,0758 (6,72) 2,62 (0,55)24,0 (0,54)
S650A0,1395 (2,95)0,0317 (2,81)to 4.41 (0,93)45,5 (1,02)
Y664F0,1173 (2,48)0,0148 (1,31)the 5.25 (1,10)47,4 (1,07)
H281A0,1170 (2,47)0,0450 (3,99)3,70 (0,78)21,1 (0,47)
Y1786F0,1138 (2,41)0,2361 (20,9)1,0740 (17,0)1,43 (0,30)6,21 (0,14)

D696A0,0889 (1,88)0,0118 (1,05)4,82 (1,01)45,0 (1,01)
S313A0,0770 (1,63)0,0210 (1,86)4,34 (0,91) 36,5 (0,82)
E683A0,0743 (1,57)0,0263 (2,33)1,00 (0,21)15,8 (0,36)
D1795A0,0697 (1,47)0,0238 (2,11)3,82 (0,80)32,5 (0,73)
E540A0,0691 (1,46)0,0091 (0,81)4,40 (0,92)37,9 (0,85)
R1966A0,0682 (1,44)0,0163 (1,44)3,74 (0,78)36,6 (0,82)
D666A0,0646 (1,37)0,0545 (a 4.83)2,47 (0,52)17,5 (0,39)
N538A0,0630 (1,33)0,0144 (1,28)4,00 (0,84)35,7 (0,80)
H317A0,0629 (1,33)0,0145 (1,28) 3,83 (0,80)30,8 (0,69)
N1950A0,0618 (1,31)0,0195 (1,73)3.46 in (0,72)25,7 (0,58)
S654A0,0599 (1,27)0,0145 (1,28)5,02 (1,05)45,2 (1,02)
T522A0,0596 (1,26)0,0270 (2,39)0,83 (0,18)24,5 (0,55)
S1791A0,0595 (1,26)0,0208 (1,85)to 3.73 (0,78)28,9 (0,65)
Y1792F0,0577 (1,22)0,4335 (38,4)0,7237 (11,5)1,41 (0,30)3,42 (0,08)
Y476F0,0579 (1,22)0,0139 (1,23)4,57 (0,96)41,8 (0,94)
S1949A 0,0573 (1,21)0,0129 (1,14)3,17 (0,66)28,6 (0,64)
S695A0,0524 (1,11)0,0085 (0.75 in)5,15 (1,08)45,4 (1,02)

D27A0,0489 (1,03)0,0089 (0,79)4,53 (0,95)40,1 (0,90)
Q1820A0,0480 (1,01)0,0114 (1,01)4,91 (1,03)44,0 (0,99)
E287A0,0367 (0,78)0,0088 (0,78)2,86 (0,60)16,4 (0,37)
D302A0,0369 (0,78)0,0049 (0,43)5,38 (1,03)49,0 (1,10)
A mutant form of factor VIII are listed in order of decreasing IC is rosty loss of the activity of factor VIII. Standard deviations for values of the loss rate of activity was estimated based on the alignment by the method of least squares, and they are within ~10% from the average.
aExperiments on determination of loss of activity carried out in the presence of factor IXa.
bExperiments on determination of loss of activity carried out in the absence of factor IXa.
cValues in parentheses correspond to values in relation to the wild type.
dEd./ug.
enm formed of factor Xa /min/nm factor VIII.

Example 3: Rate of loss of activity of factor VIIIa

The activity of factor VIIIa is labile due to the dissociation of the a subunit A2 (see Fay et al., “Human Factor VIIIa Subunit Structure: Reconstruction of Factor VIIIa from the Isolated A1/A3-C1-C2 Dimer and A2 Subunit,”J Biol Chem. 266:8957-8962 (1991); Lollar et al., “pH-dependent Denaturation of Thrombin-activated Porcine Factor VIII,”J Biol Chem. 265:1688-1692 (1990), each of which is incorporated into the present application by reference in full). The results of the earlier studies showed that the accession of factor IXa and phospholipid vesicles to factor VIIIa with the formation of the complex Haza reduces the lability of the cofactor (see Lollar et al., “Stabilization of Thrombin-activated Porcine Factor VIII:C by Factor IXa Phospholipid,” Blood 63:1303-1308 (1984); Lamphear et al., “Factor IXa Enhances Reconstitution of Factor VIIIa from Isolated A2 Subunit and A1/A3-C1-C2 Dimer,” J. Biol. Chem. 267:3725-3730 (1992), included in asteasu application by reference in full) due to partial stabilization of the subunit A2 within factor Haza (see the work of Fay et al., “Model for the Factor VIIIa-dependent Decay of the Intrinsic Factor Xase: Role of Subunit Dissociation and Factor IXa-catalyzed Proteolysis,”J Biol Chem.271:6027-6032 (1996), incorporated into the present application by reference in full). This approach was recently used to study the rate of loss of activity of mutant forms of factor VIIIa E1829A (see Wakabayashi et al., “A3 Domain Residue Glu1829 Contributes to A2 Subunit Retention in Factor VIIIa,”J. Thromb. Haemost.5:996-1001(2007), incorporated into the present application by reference in full), since loss of activity for this variant of factor VIIIa, in the absence of factor IXa, and membranes happened too quickly for accurate measurement. Similarly, this approach was used to estimate the rate of loss of activity of factor VIIIa for a number of the options described in this Example. Factor VIII (4 nm) were incubated with a molar excess of factor IXa (40 nm) and phospholipid vesicles, quickly activated by thrombin and then measured the temporal dynamics of activity factor Haza at the 23oC. the Rate of loss of activity of factor Haza correlated with the dissociation of subunits A2, and the data were approximatively using the curve is a single exponential decay. Given the high values ofKdaffinity subunit A2 within factor VIIIa (144 nm) and a low concentration of factor VIIIa (4 nm)used in the reactions, the effect of reassociation, dissocial and subunit A2 is negligible, that suggests the possibility of using a simple single exponential function in this regression analysis.

The results are shown in Figure 2B, which shows the data for the variants with the most pronounced changes, as well as variants with positive changes in response to the mutation. Seven variants showed significant (>5-fold) increase in the rate of loss of activity of factor VIIIa in comparison with the wild type (table 2). Such mutations include R282A, S524A, N684A, E1829A, Y1786F, D666A and Y1792F. The values of the activity of factor VIII for these options is measured using a two-stage analysis were significantly lower than the values determined using the single-stage analysis (Figure 1), which is consistent with the fact that mutations lead to a significant increase in the rate of dissociation of the a subunit A2. In addition, some of these mutations (including R282A, N684A and Y1792F) showed generally low specific activity in the single-stage analysis. As in the case of mutant forms of factor VIII, which is characterized by the same inconsistencies of the results of the two methods of analysis, activity, defined as a single-stage analysis was also reduced (see Pipe et al., “Mild Hemophilia A Caused by Increased Rate of Factor VIII A2 Subunit Dissociation: Evidence for Nonproteolytic Inactivation of Factor VIIIain vivo,” Blood 93:176-183 (1999); Pipe et al., “Hemophilia A Mutations Associated with 1-stage/2-stage Activity iscrepancy Disrupt Protein-protein Interactions within the Triplicated A Domains of Thrombin-activated Factor VIIIa,” Blood 97:685-691 (2001); Hakeos et al., “Hemophilia A Mutations within the Factor VIII A2-A3 Subunit Interface Destabilize Factor VIIIa and Cause One-stage/Two-stage Activity base currency by the difference,” Thromb Haemost.88:781-787 (2002), each of which is incorporated into the present application by reference in full), which may reflect a direct effect of the rate of dissociation of the A2 on the determination of the activity of factor VIII.

In contrast, options E287A and D302A having greater thermal stability compared to factor VIII wild-type, also showed increased stability of factor VIIIa, as evidenced by the decrease in the rate of loss of cofactor activity after activation by thrombin. The results for option D302A were more pronounced and showed a ~2-fold decrease in the rate of loss of cofactor activity, relative to factor VIIIa wild type, while maintaining ~90% of initial activity after 40 minutes This observation is consistent with the fact that mutations mainly affect the conformation of the contact area between domains in protofactory.

Collectively, the results of Examples 1-3 were able to determine the contribution of various residues in the interaction between subunit (domain A2 of factor VIII in the form of protofactory and cofactor, with selected residues contribute a disproportionate contribution to the stability of the protein. Although the observed effects of mutations in the target remains for the most part were either positive or neg is Linyi, mutations in two acidic residues of the A1 domain, D302 and E287, caused a modest increase in stability as a form of protofactory and active cofactor form. Relative activity E287 was somewhat reduced compared with the wild type, whereas the activity values for option D302 were indistinguishable from the wild-type protein, suggesting that the latter mutation is a mutation with purchase options (gain-of-function mutation). These results indicate that some destabilization may be due to the "deepening" (negative) charge on the contact area and/or increased stability in the case when the side chains of these residues are hydrophobic.

Example 4: Identification of additional target residues and receiving point mutations in the provisions Glu272, Asp519, Glu665 and Glu1984

Based on the results of the preceding Examples, were also investigated replace other charged residues. Using models based on homology with tseruplazmina (see Pemberton et al., “A Molecular Model for the Triplicated A Domains of Human Factor VIII Based on the Crystal Structure of Human Ceruloplasmin,” Blood 89:2413-2421 (1997), incorporated into the present application by reference in full), in the A-domain of factor VIII were identified four charged residue (Glu272, Asp519, Glu665 and Glu1984). As it turned out, these four remainder are in depth the areas of contact of the domain A2 or A1 domain (Glu272 and Asp519), or A3 domain (Glu665 and Glu1984), but, apparently, does not contribute to the formation of hydrogen bonds, as evidenced by their spatial separation >to 2.8 Å with potential partners for the formation of ties. These residues were changed to either Ala or Val to resolve the charge, and to provide potential hydrophobic interactions with similar side chains of other "in-depth" residues. Variants of factor VIII were obtained in the form devoid of B-domain of factor VIII, stably expressed in cell lines BHK.

Factor VIII expressed in the form of a mixture of single-stranded and heterodimeric forms. The degree of purification of the proteins ranged from ~85% to >95% according to the results of the LTO-page (Figure 3A). To quantify the stoichiometric composition of single-stranded and heterodimeric forms used Western blotting using antibodies against the A2 domain (Figure 3B). This value was approximately the same for wild type and several below and variabelnoe for variants of factor VIII.

Purified proteins used for the analysis of specific activity using both single-stage and two-stage analysis (Figure 4A) and parameters of the formation of thrombin (Figure 4B-D). All options, except Glu272Ala, was characterized by a specific activity that constitutes at least 80% of that of the wild type, what it suggests, the remaining mutations were not practically influence cofactor function of factor VIII. The results of the analysis of the formation of thrombin, conducted at low concentration RTF (0,5 gr) and physiological concentrations (1 nm), factor VIII, consistent with the values of the specific activity. The values of the parameters shown in Figure 4D indicates that the magnitude of the peak and Epte for Glu272Ala reduced relative to wild type, while all other parameter values for the remaining options were within the range of >80 - 110% of the values for the wild type.

Example 5: thermostability of the variants of factor VIII Glu272, Asp519, Glu665 and Glu1984

Purified proteins, mutant forms of factor VIII analyzed for stability at elevated temperatures on the basis of the speed loss of activity. Factor VIII (4 nm) were incubated at 52-60oC and at the indicated time points were selected aliquots were cooled to room temperature, the reaction with thrombin and estimated residual cofactor activity using analysis of formation of factor Xa, as described in "Materials and methods". The results presented in Figure 5A, illustrate the temporal dynamics of the loss of the activity of factor VIII wild-type and variants at 55°C. This temperature was selected based on the results of earlier studies (see Ansong et al., “Facor VIII A1 Domain Residues 97-105 Represent a Light Chain-interactive Site,” Biochemistry 45:13140-13149 (2006), incorporated into the present application by reference in full), showing an almost complete loss of activity within 1 h for factor VIII wild type. Protein wild type showed a 50% loss of activity after ~15 minutes, it Was shown that variants Glu272Ala and Glu272Val was characterized by reduced stability, as evidenced by the somewhat more rapid loss of activity, and this property may be associated with reduced specific activity observed when mutations in these sites. On the other hand, replacement by Ala, and Val at positions Asp519, Glu665 and Glu1984 all showed high stability at elevated temperatures, with variants carrying mutations in the two previously mentioned sites, retained 50% activity after ~20-25 min, whereas the variants with mutations in the latter sites, this level of activity was maintained through the >30 minutes Comparing values of the loss rate of activity of the approximating curve (table 1, below) indicates that thermal stability of factor VIII was higher in ~2 times for variants Glu1984 compared with the wild type while replacing Val was slightly preferable to replacement by Ala.

The results of the analysis in the temperature range (Figure 5B) indicate that variants with Ala, and Val at Asp519, Glu665 and Glu1984 consistently demonstrated a decrease in the rate of loss of the asset is awns up to 2 times in comparison with the wild type in all analyzed temperatures. However, the presence of both single-stranded and heterodimeric forms in several varying ratios can affect the result of the loss rate of activity, if one form is characterized by a higher stability. In control experiments using factor VIII Kogenate that essentially all presented in the form of heterodimer (see Wakabayashi et al., “Metal Ion-independent Association of Factor VIII Subunits and the Roles of Calcium and Copper Ions for Cofactor Activity and Inter-subunit Affinity,” Biochemistry 40:10293-10300 (2001), incorporated into the present application by reference in full), the loss rate of activity in ~2 times higher than the values for the wild type (Figure 5B), which is consistent with the fact that the heterodimeric form is characterized by a lower resistance to high temperatures than single-chain factor VIII. Thus, the measured rate of loss of activity, apparently due to heterogeneity, comprising different ratios of single-stranded and double-stranded forms, in various forms of factor VIII. However, provided that all options are characterized by a lower share of single-chain factor VIII compared with the wild type (see Figure 5B), the data obtained indicate that the values of the loss rate of activity for these options to underestimate the increase in stability between mutants and wild type.

Table 3
The rate of loss of activity of factor VIII and VIIIa
The decreased activity of factor VIIIThe decreased activity of factor VIIIa
thermal stability at 55°C
(min-1)
Stability in plasma
(h-1)
in the absence of factor Ixa
(min-1)
in the presence of factor Ixa
(min-1)
wild type0,0471* (1,00)0,0178 (1,00)0,0836 (1,00)0,0154 (1,00)
E272A0,0542 (1,15)N.A.†0,1638 (1,95)0,0163 (1,06)
E272V0,0602 (1,28)N.A.0,2271 (2,72)0,0159 (1,03)
D519A0,0336 (0,71)‡0,0066 (0,37)‡0,0556 (0,66)‡0,0063 (0,41)‡
D519V/td> 0,0262 (0,56)‡0,0184 (1,03)0,0642 (0,77)‡0,0068 (0,44)‡
E665A0,0359 (0,76)‡0,0149 (0,84)§0,0520 (0,62)‡0,0078 (0,51)‡
E665V0,0309 (0,66)‡0,0047 (0,26)‡0,0160 (0,19)‡0,0052 (0,34)‡
E1984A0,0240 (0,51)‡0,0080 (0,45)‡0,0241 (0,29)‡0,0027 (0,18)‡
E1984V0,0211 (0,45)‡0,0078 (0,44)‡0,0217 (0,26)‡0,0019 (0,13)‡
Standard deviations for values of the loss rate of activity was estimated based on the alignment by the method of least squares, and they are within ~10% from the average when assessing thermal stability and the measurement of the rate of loss of activity of factor VIIIa, and within ~15% from the average when assessing the stability of the plasma. Values in parentheses correspond to values in relation to on the who type. To denote the amino acid one-letter code is used: E (Glu), D (Asp), A (Ala) and V (Val).
† not determined.
p<0,001 compared to the speed value for the wild type (t-student test).
§p<0.05 compared with the value of speed for the wild type (t-student test).

Example 6: the Stability of factor VIII in plasma at 37°C

To investigate the effects of mutations on the stability of factor VIII in a more native conditions, proteins at concentrations close to physiological values (1 nm)were incubated in plasma (antikoagulyantnoe) deficiency of factor VIII obtained from patients suffering from hemophilia A, devoid of activity, inhibitory factor VIII, at 37°C for up to 4 days. The residual activity of factor VIII was assessed daily using a single-stage analysis coagulating activity. The activity of factor VIII wild type was reduced to ~50% after 2 days, as well as the option Asp519Val, then alternatively Glu665Ala showed moderate (~15%) reduction in the rate of loss of activity (Figure 6 and table 3). However, the activity values for options Asp519Ala, Glu665Val and both options Glu1984 was>50% of the initial value on day 4. The results obtained in experiments with incubation in plasma, largely consistent with the results of the experiments with incubation at elevated temperature, when this option Glu665Val and both Glu1984 variants showed increased stability when two conditions of the reaction, as evidenced by the preservation of function. Although both Asp519 showed high stability at elevated temperatures, only the variant with Ala was characterized by improved stability when assayed in the plasma.

Example 7: the loss Rate of activity options Glu272, Asp519, Glu665 and Glu1984 factor VIIIa

The above results indicate that the mutations associated with the replacement of the "depth" of charged residues on the hydrophobic residues, in General, contribute to the increased stability of the protein factor VIII. Due to the fact that these mutations are in the area of contact of the domain A2 with A1 or A3 or are close to it, it has been suggested that these mutations have a positive impact on the lability factor VIIIa, reducing the rate of dissociation of the subunit A2. The rate of loss of activity of factor VIIIa caused by such a mechanism were analyzed using two methods of analysis. In the first case, the factor VIII wild type and variants were activated with thrombin, and at specified time points was determined by the remaining cofactor activity after addition of factor IXa and factor X, and evaluate the rate of formation of factor Xa. In the second case described above, the method and what she was modified and included the addition of factor IXa before activating factor VIII, what made possible the immediate formation of factor Haza. It was shown that the inclusion of factor VIIIa complex factor Haza partially stabilizes cofactor activity, reducing the rate of loss of activity up to 10 times due to the mechanism associated with the accession of factor IXa to the subunits A2 and A3C1C2 with Hazeu (see Fay et al., “Model for the Factor VIIIa-dependent Decay of the Intrinsic Factor Xase: Role of Subunit Dissociation and Factor IXa-catalyzed Proteolysis,” J Biol Chem.271:6027-6032 (1996), incorporated into the present application by reference in full).

The results obtained in the absence or in the presence of added factor IXa shown in Figures 7A and 7B, respectively. In the absence of factor IXa factor VIIIa wild type was characterized by a 50% loss of activity after ~8 min (Figure 7A), whereas this level of activity was maintained for ~40 min in the case when the activation of factor VIII was added factor IXa (Figure 7B). Values of the loss rate of activity is presented in Table 3, and the results indicated >5-fold stabilization cofactors activity during the formation of the X factor-the basics. The options study showed that form as Glu272Ala and Val were characterized by 2 - and 3-fold increase in speed loss of activity, respectively, in the absence of factor IXa compared with control wild-type. These results indicate weakened the om affinity between the subunits in each of these mutations, that, perhaps, is the loss of binding interactions with a relatively low affinity with the participation of the acidic side chain. In the presence of factor IXa rate of loss of activity for the two options are essentially not different from values for the wild type, indicating that the inclusion of the factor IXa contributed to the elimination of any negative impacts, caused by mutations in the specified residue.

Mutations in three other sites (Asp519, Glu665 and Glu1984) led to reduced speed loss of the activity of factor VIIIa, the degree of this reduction varied depending on what the balance was changed, and in one case from which the residue has been replaced. Mutations in Asp519 caused a ~30% decrease in the rate of loss of activity, in a similar way as for variants with Ala and Val, in the absence of factor IXa. The loss rate of activity for these options was reduced in >2 times in the presence of factor IXa, suggesting the presence of a synergistic effect between mutation and stabilizing effect of the binding of the enzyme. While option Glu665Ala was characterized by values similar to the two options Asp519, option Glu665Val showed 5-fold and 3-fold decrease in the rate of loss of activity in the absence and in the presence of factor IXa, respectively, which allows feels the ü, that change on a larger hydrophobic residue leads to more effective interactions with neighboring residues held subunit A2. Finally, both Glu1984 showed a ~4-fold reduction in the loss of activity of factor VIIIa in comparison with the wild type in the absence of factor IXa and 5-8-fold lower in the presence of factor IXa. The significance of this increase in stability is observed in Figure 7B, showing the preservation of >90% of the activity of factor VIIIa after 40 min in the X factor-the basics, including any of the options Glu1984. The similarity of the characteristics of the options Glu1984 with Ala or Val indicates that both balance well tolerated, possibly, the presence of Val leads to a somewhat greater affinity between the subunits. In General, the results indicate a significant increase in the stability of the factor VIIIa due to more effective retention subunit A2, caused by the selective substitution of charged residues on the hydrophobic residues.

Discussion of Examples 1-7

The above Examples show that the selected replacement of charged residues on the hydrophobic residues at the sites, which were supposed to constitute the contact area of the A2 domain, in General, leads to an increase, albeit varying, stability of factor VIII. Such stability was evaluated by maintaining the activity during avicennae temperature, and also to reduce the rate of dissociation of the subunit A2 in the cofactor.

Upon initial analysis in Examples 1-3 for mutational analysis were selected 30 residues localized in the area of contact of the domain A2 of factor VIII based on the spatial explode <a 2.8 Å, which potentially can participate in the formation of hydrogen bonds. 30 charged/polar residues were replaced by Ala mutagenesis (or Phe for Tyr residues), was carried out by stable expression of recombinant protein was estimated rate of loss of activity. Fourteen of the 30 analysed residues showed >2-fold increase in the rate of loss of activity of factor VIII at 55°C and/or the rate of loss of activity of factor VIIIa, relative to wild type, which indicates that many residues in the regions of contact domains A1A2 and A2A3 essential for the stabilization of factor VIII. It is interesting to note that the two analyzed acidic residue, Asp302 and Glu287, when they are changed to Ala caused a modest (<2-fold) increase in the stability of the protein in the form of protofactory and active cofactors form. Both of these acidic residues conserved in factor VIII, human, dog, pig, mouse, rabbit, rat and bat. These initial results suggest that such acidic side chains were not important for stabilizat and interactions through hydrogen bonds, but rather had a somewhat negative impact on the structure of factor VIII according to the analysis of functional stability.

Based on these initial studies, it was investigated whether the formation of additional hydrophobic interaction to the "purchase options" (gain of function). Four acidic residue, studied in Examples 4-7, the conservative factor VIII human, dog, pig, mouse, rabbit and a bat, while in the factor rats instead Glu665 contains Ala, and instead Glu1984 - Thr (see Swiss Institute of Bioinformatics, analysis of on-line UniProtKB/Swiss-Prot Release 55.5 and UniProtKB/TrEMBL version 38.5 (2008), is incorporated into the present application by reference in full). The results of Examples 4-7 show that three of these residues, Asp519, Glu665 and Glu1984, with replacement by Ala and/or Val, contribute to increased stability of the protein. Only one of the acidic residues analyzed in Examples 4-7, when the mutation had a negative effect on the activity factor. Replacement Glu272 on Ala ensured low specific activity of factor VIII with low formation of thrombin; replace as Ala and Val caused a moderate decrease in thermal stability and 2-3-fold increase in the rate of dissociation of the a subunit A2 in cofactors form compared with the wild type. On the basis of these observations it is assumed, is that Glu272 really involved in the binding interaction (interactions with neighboring residues, and subsequent mutation on this website disrupt these interactions. This finding is consistent with the results presented in the database hemophilia A Hemophilia A database (Kemball-Cook et al., “The Factor VIII Structure and Mutation Resource Site: HAMSTeRS version 4,” Nucleic Acids Res.26:216-219 (1998); Kemball-Cook (MRC Clinical Sciences Centre), Haemophilia A Mutation Database (accessed July 2, 2008), is incorporated into the present application by reference in full), according to which Lys (handling charge) or Gly (small side chain in position 272 causes moderate/weak phenotype with reduced antigenicity of factor VIII. The latter observation is consistent with the fact that mutations cause increased instability in the plasma. However, it was not observed significant effects of these mutations on the expression level in the cell culture in the case of mutations at this site to be replaced with Ala or Val. In contrast, in the database not listed mutations on the provisions Asp519, Glu665 and Glu1984.

Proteins usually undergo laying in such a way that the charged or polar groups remain facing the solvent, whereas the hydrophobic groups remain "in-depth" (see Pace et al., “Forces Contributing to the Conformational Stability of Proteins,”FASEB J. 10:75-83 (1996), incorporated into the present application by reference in full). Thus, on the basis of the phenotype of mutations "purchasing options" (gain-of - function) when replacing residues Gu287, Asp302, Asp519, Glu665 and Glu1984 on hydrophobic residue, it is assumed that these charged residues remain inside the contact region of the A2 domain. In addition, the results indicate that these residues are not involved in electrostatic binding interactions and possibly destabilize the protein structure of wild-type and/or interaction between the subunits.

Since mutagenesis using either Ala or Val leads to a hydrophobic residue (instead of charged acidic residues), it is expected that the replacement by Ala or Val must stabilize other hydrophobic contacts in the contact area. In addition, the side chain of Val greater than that of Ala, so the comparison of the effects on the activity of factor after replacing in this site could help to understand what is laying residues and the size (volume) of this website. For example, replacing Glu1984 on any of these residues leads to similar results, indicating that both rest in this website do not have any adverse effect; because Glu665Val showed a 3-fold decrease in the rate of loss of activity of factor VIIIa compared to Glu665Ala, it can be assumed that the side chain of Val with a large amount more suitable (has a greater positive effect on the structure) for the proposed hydrophobic binding pocket".

In General, the results of Examples 1-7 is largely sposobstvovali understanding of the structure of the A-domain of factor VIII, which had previously been limited to models built by homology with the structure of ceruloplasmin with high resolution (see Pemberton et al., “A Molecular Model for the Triplicated A Domains of Human Factor VIII Based on the Crystal Structure of Human Ceruloplasmin,” Blood 89:2413-2421 (1997), incorporated into the present application by reference in full) and the recently described structure with an intermediate resolution of 3.75 Å) of human factor VIII (see Shen et al., “The Tertiary Structure and Domain Organization of Coagulation Factor VIII,” Blood 111:1240-1247 (2008), is incorporated into the present application by reference in full). Despite the fact that the latter structure does not allow to detect the presence of hydrogen bonds (<a 2.8 Å), the study authors noted that the A domains of factor VIII can "impose" on the corresponding domains of ceruloplasmin with a high degree of accuracy.

Despite the fact that the model of ceruloplasmin assumes that Asp302 and Glu287 can participate in the formation of hydrogen bonds, stability studies in Examples 1-3 indicate that this is unlikely. Instead, it can be assumed that such acidic side chains immersed inside a hydrophobic environment. On the contrary, the results of Examples 4-7 confirm the assumption that Glu272 probably involved in the formation of hydrogen bonds in the contact area of the A2 domain, because the loss of this charge reduces the stability of factor VIII (VIIIa). Three OST is provided an acidic residue, studied in Examples 4-7, in all probability, "embedded" inside the contact area, as was predicted by the model, because near the carboxyl groups of these residues is not localized polar atoms of the neighboring residue on the complementary domain. More precisely, it was shown that these groups are located closer to the hydrophobic groups. For example, the model predicts that the oxygen of the carboxyl group oAsp519 and the carbon of a methyl group Thr275 are at a distance of ~4.2V Å, oxygen carboxyl group Glu665 and the carbon of a methyl group Val1982 separated ~of 8.1 Å, and the oxygen of the carboxylic group Glu1984 and the carbon of a methyl group Val663 separated ~6,2 Å.

Variants of factor VIII, which is characterized by high stability and low loss rate cofactors activity, represent a positive qualitative characteristics for therapeutic drugs. These properties will increase the yield of active protein in the process of cleaning and preparing a therapeutic agent that causes the generally higher values of specific activity. Such substances may also have a longer half-life in the bloodstream relative to wild type (seeFigure 6), while avoiding various cellular mechanisms of elimination. Previously described two variants of factor VIII, which cfactory active the industry was stable due to the speed reduction/exclusion of dissociation of subunit A2. In both cases, with mutations was carried out by the covalent cross-linking of A2 domain with other domains of the molecule. In one case, was obtained resistant to inactivation of factor VIII by cross-linking of the A2 domain with section B-domain adjacent domains to A3C1C2 and deprived of the site of cleavage by thrombin, which would have caused the Department or the A2 domain or fragment of the B-domain after activation protofactory (see Pipe et al., “Characterization of a Genetically Engineered Inactivation-resistant Coagulation Factor VIIIa,”Proc Natl Acad Sci U S A94:11851-11856 (1997), incorporated into the present application by reference in full). In the second case, the selected residues in the domains A3 and A2, located in the immediate vicinity, were replaced with Cys residues forming disulfide bonds between the two domains, so that A2 could remain covalently associated with A3 after activation by thrombin (see Gale et al., “An Engineered Interdomain Disulfide Bond Stabilizes Human Blood Coagulation Factor VIIIa,”JThromb Haemost. 1:1966-1971 (2003); Radtke et al., “Disulfide Bond-stabilized Factor VIII has Prolonged Factor VIIIa Activity and Improved Potency in Whole Blood Clotting Assays,”JThromb Haemost.5:102-108 (2007), each of which is incorporated into the present application by reference in full). The latter mutants also showed increased activity in the analysis of the formation of thrombin, although the reaction conditions in these studies included subphysiologic (<0.5 nm) concentration of factor VIII.

P the results, presented in Examples 1-7 using physiological levels of concentrations of factor VIII (1 nm), showed small differences between wild type and variants, characterized by a higher stability, although the option of Glu272Ala showed reduced values in the formation of thrombin, which is consistent with its low specific activity. The no observed significant differences for variants with higher stability may be due to differences in the reaction conditions and/or the fact that such mutations do not provide covalent joining of the A2 domain and the loss rate of activity of factor VIIIa sufficiently reduced.

The results presented in Examples 1-7 demonstrate that a reduction of speed of inactivation of the cofactor can be achieved by a single point mutation leading to the replacement of the acidic residues in hydrophobic. In each of these cases, these mutations are located in areas of contact with altered residues likely to be submerged inside, and not converted to the surface, and do not affect covalent interactions within the protein. Based on preliminary results, cfactory form options Glu1984Val and Glu1984Ala and cofactor wild-type are characterized by similar speeds inactivation according to the analysis of ka is elizaryeva activated protein C cleavage at Arg336 and Arg562 (see work Varfaj et al., “Residues Surrounding Arg336 and Arg562 Contribute to the Disparate Rates of Proteolysis of Factor VIIIa Catalyzed by Activated Protein C,” J. Biol. Chem. 282(28):20264-72 (2007), incorporated into the present application by reference in full). This confirms the assumption that suppression of the activity of these variants with increased stability also passes through the path-mediated protein C, similar to the cofactor of the wild type. Thus, stable variants of the present invention are devoid of the problems associated with resistant to inactivation mutants described above.

Example 8: evaluation of the stability of variants of factor VIII with two and three substitutions

To determine whether additive or synergistic effects to further increase the stability of factor VIII (VIIIa), were obtained mutants with combinations of point mutations described in the preceding Examples, using the methods described in section "Materials and methods". In particular, we have obtained a double and a triple combination mutants containing substitutions at Ala or Val on the remaining Asp519, Glu665, and Glu1984. Such combined mutants include (amino acids are designated by single-letter code): D519AE665A, D519AE665V, D519AE1984A, D519AE1984V, D519VE665V, D519VE1984A, D519VE1984V, E665AE1984A, E665AE1984V, E665VE1984A, E665VE1984V, D519AE665VE1984A, D519VE665VE1984A, D519VE665VE1984V. Factor VIII D519VE665A was excluded from the analysis, because this mutant showed the typical characteristics in solid-phase ELISA and Western blot analysis.

To obtain triple mutants mutation D519A or D519V combined with either E665VE1984A or E665VE1984V. Other combinations were excluded because double mutants E665AE1984A and E665AE1984V did not show an increase in the stability of either factor VIII or factor VIIIa, in comparison with each of the single mutations. Results for D519AE665VE1984V were excluded from the analysis for the same reason as for D519VE665A.

The first group of new mutants (Group A) with a combination of mutation (Ala or Val) Asp519 and mutation or Glu665 or Glu1984, maintained normal values of specific activity (>80% activity of the wild type (wild type), Figure 8). It is interesting to note that D519AE665A, D519VE665V, D519VE1984A and D519VE1984V showed a significant increase in specific activity to ~1.8 times compared to factor VIII wild-type, according to the single-stage analysis coagulating activity (Figure 8). Specific activity of the second group of mutants (Group B) with a combination of mutations at Glu665 and Glu1984 unexpectedly showed a decrease in specific activity of up to ~2 times, compared to factor VIII wild type, except E665VE1984A, the activity of which was somewhat higher than in the wild type (Figure 8). The third group (Group C), representing the triple mutants showed normal or slightly increased activity in the single-stage analysis (D519VE665VE1984V). However, the activity D19VE665VE1984V in a two-stage analysis was significantly reduced. Because Asp519 are located in the contact region A1 and A2, and Glu665 and Glu1984 are located in the contact area A2 and A3, it is assumed that the trend of increasing specific activity of mutant Group A compared to Group B may be due to more effective interactions at the boundary of A1-A2, affecting the conformation and remain active cofactors form.

Figure 9 summarizes the results of experiments to assess thermal stability of factor VIII at 55°C. the velocity Values obtained for the combined mutations, compared with values of velocities for a single mutant, characterized by the greatest indicators of a specific combination using data for single mutants obtained in Example 5 (Figure 5A). Figure 9 also presents the actual values of the loss rate of activity of factor VIII (see also Table 4). The degree of reduction of the relative velocity loss of activity was associated with the increase observed for the combined mutations. In Group A, the mutants D519AE665A, D519AD665V and D519VE665V showed a significant increase in stability (decrease in the rate of loss of activity) and most of the mutants retained the absolute rate of loss of activity, corresponding to ~ 50% of the values for the wild type. On the other hand, the relative speed of two mutants of Group B(E665AE1984A and E665AE1984V) were slightly higher compared with single mutant with the best metric. In Group C mutants D519AE665VE1984A and D519VE665VE1984A did not show significant changes in the velocity, while the velocity values for D519VE665VE1984V were slightly increased.

It is interesting to note that the increase in stability observed for the combined mutants were more pronounced for forms of factor VIIIa (Figure 10). To increase the sensitivity analysis of the loss of the activity of factor VIIIa for highly stable mutants used a lower concentration of factor VIIIa (1.5 nm) during incubation compared with the concentrations in the previous Examples. A significant increase in stability up to ~4 times compared with single mutations was observed for all mutants in the Group. The actual values of the loss rate of activity of factor VIIIa from D519VE665V and D519VE1984A were 14 and 12% of the values of factor VIII wild type, respectively (Figure 10 and table 4). Mutants of Group B were generally characterized by lower results compared with the single mutants with the best rates from the respective pairs, with E665AE1984A and E665AE1984V showed ~a 2.2-fold and ~a 2.7-fold increase of the values of the loss rate of activity, respectively. Triple mutants (Group C) showed the most significant increase in the stability of the factor VIIIa, the maximum stability was observed for D519VE665VE1984A, which showed scoretotal activity component ~10% of wild-type (Figure 10 and table 4).

Table 4
The loss rate of activity and the activity values for the combined mutants of factor VIII and VIIIa
The loss rate of activity (min-1)Specific activity
Factor VIIIFactor VIIIaSingle-stage
analysis
A two-step
analysis
wild type0,0473 (1,00a)0,1400 (1,00)4,77b(1,00)44,5c(1,00)
D519AE665A0,0255 (0,54)0,0352 (0,25)6,40 (1,34)36,6 (0,82)
D519AE665V0,0213 (0,45)0,0222 (0,16)3,81 (0,80)47,6 (1,07)
D519AE1984A0,0250 (0,53)0,0266 (,19) 4,42 (0,93)36,0 (0,81)
D519AE1984V0,0247 (0,53)0,0319 (0,23)4,55 (0,95)47,9 (1,08)
D519VE665V0,0238 (0,51)0,0198 (0,14)6,65 (1,39)47,5 (1,07)
D519VE1984A0,0256 (0,54)0,0168 (0,12)between 6.08 (1,27)43,0 (0,97)
D519VE1984V0,0259 (0,55)0,0262 (0,19)8,43 (1.77 in)50,5 (1,13)
E665AE1984A0,0324 (0,69)0,1302 (0,93)2,10 (0,44)21,5 (0,48)
E665AE1984V0,0348 (0,74)0,1267 (0,90)the 3.89 (0,82)30,2 (0,68)
E665VE1984A0,0232 (0,49)0,0360 (0,26)5,76 (1,21)39,8 (0,89)
E665VE1984V0,0220 (0,47)0,0671 (0,48)2,50 (0,53)37,9 (0,85)
D519AE665VE1984A0,0246 (0,52)0,0235 (0,17)equal to 4.97 (1,04)46,3 (1,04)
D519VE665VE1984A0,0254 (0,54)0,0142 (0,10)4,29 (0,90)37,9 (0,85)
D519VE665VE1984V0,0307 (0,65)0,0227 (0,16)7,86 (1,65)17,4 (0,39)
D519A0,0336d(0,71)0,0898 (0,64)
D519V0,0262d(0,56)0,0836 (0,60)
E665A0,0359d(0,76)0,0834 (0,60)
E665V0,0309d(0,66)0,0395 (0,28)
E1984A0,0240d(0,51)0,0574 (0,41)
E1984V0,0211d(0,45)0,0471 (0,34)
Standard deviations for values of the loss rate of activity was estimated based on the alignment by the method of least squares, and they are within ~10% from the average.
avalues in parentheses represent values relative to wild-type.
bunits/μg.
cnm formed of factor Xa/min/nm factor VIII.
dData taken from Table 3, above.

For the selected mutants have been analyzing the formation of thrombin; the results are shown in Figures 11A-B. In the analysis of single mutants using a final concentration of 1 nm factor VIII considerable improvement of education thrombin was not identified (see Materials and Methods and Example 4, above). For better comparison the most stable mutant form of factor VIII used a lower concentration of factor VIII (0.2 nm). The results of this analysis showed that D519VE665V features which were rituals ~20% decrease in the lag-period and during the peak, and is ~2.3-fold increase in peak height and ~1.5-fold increase in endogenous thrombin potential (ECPS) compared to factor VIII wild type (Figures 11A-B). Despite the fact that the values of the lag-period and time of peak for D519AE665V, D519VE1984A and D519VE665VE1984A was not significantly different from those for the wild type, the values of the peak height and Epte significantly exceeded the values for wild-type (from ~20% to 70%). In General, the results indicate that all four selected combined mutant with increased stability factor, showed improved formation of thrombin. Such observations indicate that these mutants have a greater ability to increase the formation of thrombin per unit concentration of factor VIII under physiological conditions.

Example 9: Mutants with substitutions of Ala or Val on Asp519, Glu665 and Glu1984 in combination with a mutation Glu113Ala (E113A), resulting in high specific activity

It is known that mutation E113A enhances the specific activity of factor VIII according to the one-stage analysis coagulating activity (see publication of the patent application U.S. No. 10/581471, the authors Fay and others; Wakabayashi et al., “A Glu113Ala Mutation within a Factor VIII Ca(2+)-Binding Site Enhances Cofactor Interactions in Factor Xase,” Biochemistry44:10298-10304 (2005), each of which is incorporated into the present application by reference in full). POSCO is ICU factor VIII, possessing both high stability and high specific activity, represents a unique class of compounds for potential therapeutic applications in the treatment of hemophilia, was analyzed the effect of combining mutations E113A with highly stable mutants described in the previous Examples.

Were obtained mutants with Ala or Val substitutions at residues Asp519, Glu665 and Glu1984 in combination with a mutation E113A using the techniques described in Materials and methods. Such double mutants include: E113AD519A, E113AD519V, E113AE665A, E113AE665V and E113AE1984V (to denote amino acid single-letter code is used).

Values of specific activity, defined by a single-stage analysis for the combined mutants were ~2- ~3.3 times higher than for factor VIII wild type, thus remained normal level of activity in the two-stage analysis. The obtained results indicate that mutations in Asp519, Glu665 or Glu1984 not have a negative effect on the increased activity observed for mutations E113A (Figure 12A). In addition, the rate of loss of activity of factor VIII and VIIIa mutants with E113A in combination with mutations resulting in high stability, was not significantly different from the corresponding values for each source single mutant with high stability (see Figures 5B-C; table 5)that the call is authorized to assume that mutation E113A does not influence the increase of stability parameters for these mutants.

Table 5
The loss rate of activity and the activity values for factors VIII and VIIIa
The loss rate of activity (min-1)Specific activity
Factor VIIIFactor VIIIaSingle-stage
analysis
Two
step
analysis
wild type0,0473 (1,00a)0,1400 (1,00)4,77b(1,00)44,5c(1,00)
E113AD519A0,0471 (0,63)0,0748 (0,53)14,3 (2,99)37,3 (0,84)
E113AD519V0,0297 (0,57)0,0495 (0,35)10,3 (2,16)40,9 (0,92)
E113AE665A0,0270 (0,61)0,0754 0,54) 15,7 (3,29)45,4 (1,02)
E113AE665V0,0286 (0,59)0,0333 (0,24)9,6 (2,02)44,5 (1,00)
E113AE1984V0,0278 (0,53)0,0567 (0,40)13,4 (2,81)48,5 (0,52)
D519A0,0336d(0,71)0,0898 (0,64)
D519V0,0262d(0,56)0,0836 (0,60)
E665A0,0359d(0,76)0,0834 (0,60)
E665V0,0309d(0,66)0,0395 (0,28)
E1984A0,0240d(0,51)0,0574 (0,41)
E1984V 0,0211d(0,45)0,0471 (0,34)
Standard deviations for values of the loss rate of activity was estimated based on the alignment by the method of least squares, and they are within ~10% from the average.
aValues in parentheses represent values relative to wild-type.
bunits/μg.
cnm formed of factor Xa/min/nm factor VIII.
dData taken from Table 3, above.

From the above results, it follows that the mutation E113A can be combined with any of the described in this application mutations causing increased stability, with the aim of obtaining recombinant factor VIII, which is characterized as high specific activity, and increase the stability of the factor VIII/factor VIIIa. This factor includes the combination of mutations E113A (or other suitable substitutions at position E113, as described in published patent application U.S. No. 10/581471, the authors Fay and others, incorporated into the present application by reference in full) with single or multiple mutations causing increased stability, described in this application.

Although in this description presents and thoroughly consider the ENES preferred implementations of the invention, specialists in the art it is obvious that various modifications, additions, substitutions and the like, not exceeding the limits of the invention, which are also included in the scope of the invention defined by the following formula.

1. Recombinant factor VIII contains one or more mutations that increase the stability of both factor VIII and factor VIIIa, where one or more mutations selected from the group consisting of a substitution of the Glu residue for a hydrophobic amino acid residue in the position corresponding to amino acid position 287, 665, and/or 1984 sequence SEQ ID NO: 2, the substitution of the Asp residue for a hydrophobic amino acid residue in the position corresponding to amino acid position 302 and/or 519 sequence SEQ ID NO: 2, and combinations of two or more of these substitutions, where the position of the replacement or replacements specified recombinant factor VIII aligned amino acids 287, 302, 519, 665, and/or 1984 sequence SEQ ID NO: 2 with the alignment of the amino acid sequence of recombinant factor VIII with amino acid sequence SEQ ID NO: 2.

2. Recombinant factor VIII according to claim 1, where hydrophobic amino acid residue is one of Ala, Val, Ile, Leu, Met, Phe or Trp.

3. Recombinant factor VIII according to claim 1,where specified one or more mutations represent a replacement of Asp→Ala in position to meet the future a 302 amino acid sequence SEQ ID NO: 2.

4. Recombinant factor VIII according to claim 1,where specified one or more mutations represent the replacement of Glu→Ala at the position corresponding to the amino acid 287 sequence SEQ ID NO: 2.

5. Recombinant factor VIII according to claim 1,where specified one or more mutations represent the replacement of Glu→Ala or replacement of Glu→Val at position corresponding to amino acid 665 sequence SEQ ID NO: 2.

6. Recombinant factor VIII according to claim 1,where specified one or more mutations represent a replacement of Asp→Ala or replacement of Asp→Val at position corresponding to amino acid 519 of the sequence SEQ ID NO: 2.

7. Recombinant factor VIII according to claim 1,where specified one or more mutations represent the replacement of Glu→Ala or replacement of Glu→Val at position corresponding to amino 1984 sequence SEQ ID NO: 2.

8. Recombinant factor VIII according to claim 1, where the specified one or more mutations are a combination of two or more of these substitutions.

9. Recombinant factor VIII of claim 8, where the two or more replacement include:
(i) substitution of Asp→Val at position corresponding to amino acid 519 of the sequence SEQ ID NO: 2, and the replacement of Glu→Val at position corresponding to amino acid 665 sequence SEQ ID NO: 2;
(ii) substitution of Asp→Ala at the position corresponding to amino acid 519 of the sequence SEQ ID NO: 2, and the replacement of Glu→Val at the position that corresponds to the adequate amino acid 665 sequence SEQ ID NO: 2;
(iii) substitution of Asp→Val at position corresponding to amino acid 519 of the sequence SEQ ID NO: 2, and the replacement of Glu→Ala at the position corresponding to the amino acid 1984 sequence SEQ ID NO: 2;
(iv) substitution of Glu→Val at position corresponding to amino acid 665 sequence SEQ ID NO: 2, and the replacement of Glu→Ala at the position corresponding to the amino acid 1984 sequence SEQ ID NO: 2;
(v) substitution of Glu→Ala at the position corresponding to amino acid 665 sequence SEQ ID NO: 2, and the replacement of Glu→Val at position corresponding to amino 1984 sequence SEQ ID NO: 2;
(vi) replacement of Asp→Ala at the position corresponding to amino acid 519 of the sequence SEQ ID NO: 2, a substitution of Glu→Val at position corresponding to amino acid 665 sequence SEQ ID NO: 2, and the replacement of Glu→Ala at the position corresponding to the amino acid 1984 sequence SEQ ID NO: 2;
(vii) replacement of Asp→Val at position corresponding to amino acid 519 of the sequence SEQ ID NO: 2, a substitution of Glu→Val at position corresponding to amino acid 665 sequence SEQ ID NO: 2, and the replacement of Glu→Ala at the position corresponding to the amino acid 1984 sequence SEQ ID NO: 2;
(viii) substitution of Asp→Val at position corresponding to amino acid 519 of the sequence SEQ ID NO: 2, a substitution of Glu→Val at position corresponding to amino acid 665 sequence SEQ ID NO: 2, and the replacement of Glu→Val at position corresponding to amino 1984 PEFC is the sequences SEQ ID NO: 2.

10. Recombinant factor VIII according to claim 1,whererecombinant factor VIII consists of domains A1, A2, A3, C1 and C2 or their parts.

11. Recombinant factor VIII according to claim 1, where the recombinant factor VIII contains one or more domains, or parts thereof, factor VIII, human, and one or more domains, or parts thereof, factor VIII mammal, not a person.

12. Recombinant factor VIII according to claim 1, where the recombinant factor VIII is essentially cleared.

13. Recombinant factor VIII according to claim 1, where the recombinant factor VIII further comprises one or more additional mutations of (i) mutations that increase the affinity of recombinant factor VIII for one or both factors IXa and X; (ii) mutations that increase the secretion in culture; (iii) mutations that modify the binding sites of proteins serum to increase the time half-life in blood; (iv) mutations that modify the sequence recognized when glycosylation, to reduce the antigenicity and/or immunogenicity; and (v) mutations that modify the calcium-binding the website to increase the activity of the recombinant factor VIIIa.

14. Recombinant factor VIII according to claim 1, additionally containing a substitution of Glu at the position corresponding to the amino acid 113 of the sequence SEQ ID NO: 2, where the position of substitution of the Glu residue of the indicated recombinant fact the RA VIII aligned at the amino acid position 113 sequence SEQ ID NO: 2, when the alignment of the amino acid sequence of recombinant factor VIII c amino acid sequence of SEQ ID NO: 2.

15. Recombinant factor VIII for 14,where recombinant factor VIII contains:
(i) the replacement of Glu→Ala at the position corresponding to the amino acid 113 of the sequence SEQ ID NO: 2, and the replacement of Asp→Ala at the position corresponding to amino acid 519 of the sequence SEQ ID NO: 2;
(ii) replacement of Glu→Ala at the position corresponding to the amino acid 113 of the sequence SEQ ID NO: 2, and the replacement of Asp→Val at position corresponding to amino acid 519 of the sequence SEQ ID NO: 2;
(iii) replacement of Glu→Ala at the position corresponding to the amino acid 113 of the sequence SEQ ID NO: 2, and the replacement of Glu→Ala at the position corresponding to amino acid 665 sequence SEQ ID NO: 2; or
(iv) substitution of Glu→Ala at the position corresponding to the amino acid 113 of the sequence SEQ ID NO: 2, and the replacement of Glu→Val at position corresponding to amino acid 665 sequence SEQ ID NO: 2;
(v) substitution of Glu→Ala at the position corresponding to the amino acid 113 of the sequence SEQ ID NO: 2, and the replacement of Glu→Val at position corresponding to amino 1984 sequence SEQ ID NO: 2.

16. Pharmaceutical composition for the treatment of hemophilia, containing an effective amount of recombinant factor VIII according to claim 1.

17. The pharmaceutical composition according to item 16, further containing stabilizer is Thor.

18. The pharmaceutical composition according to item 16, further containing a delivery vehicle.

19. The pharmaceutical composition according to item 16, further containing a pharmaceutically acceptable carrier.

20. The selected nucleic acid molecule encoding a recombinant factor VIII according to claim 1.

21. The selected nucleic acid molecule according to p. 20, where the encoded hydrophobic residue represents one of Ala, Val, Ile, Leu, Met, Phe or Trp.

22. The selected nucleic acid molecule according to p. 20, where one or more mutations encode the replacement of Asp→Ala at the position of the 302 amino acid sequence SEQ ID NO:2.

23. The selected nucleic acid molecule according to claim 20, where one or more mutations encode the replacement of Glu→Ala at the position corresponding to the amino acid 287 sequence SEQ ID NO:2.

24. The selected nucleic acid molecule according to claim 20, where one or more mutations encode the replacement of Glu→Ala or replacement of Glu→Val at position corresponding to amino acid 665 sequence SEQ ID NO:2.

25. The selected nucleic acid molecule according to claim 20, where one or more mutations encode the replacement of Asp→Ala or replacement of Asp→Val at position corresponding to amino acid 519 of the sequence SEQ ID NO:2.

26. The selected nucleic acid molecule according to claim 20, where one or more mutations encode the replacement of Glu→Ala or replacement of Glu→Val at the position equivalent is the amino 1984 sequence SEQ ID NO:2.

27. The selected nucleic acid molecule according to claim 20, where one or more mutations encode a combination of two or more of these substitutions.

28. The selected nucleic acid molecule according to p. 27, where two or more replacement include:
(i) substitution of Asp→Val at position corresponding to amino acid 519 of the sequence SEQ ID NO:2, and the replacement of Glu→Val at position corresponding to amino acid 665 sequence SEQ ID NO:2;
(ii) substitution of Asp→Ala at the position corresponding to amino acid 519 of the sequence SEQ ID NO:2, and the replacement of Glu→Val at position corresponding to amino acid 665 sequence SEQ ID NO:2;
(iii) substitution of Asp→Val at position corresponding to amino acid 519 of the sequence SEQ ID NO:2, and the replacement of Glu→Ala at the position corresponding to the amino acid 1984 sequence SEQ ID NO:2;
(iv) substitution of Glu→Val at position corresponding to amino acid 665 sequence SEQ ID NO:2, and the replacement of Glu→Ala at the position corresponding to the amino acid 1984 sequence SEQ ID NO:2;
(v) substitution of Glu→Ala at the position corresponding to amino acid 665 sequence SEQ ID NO: 2, and the replacement of Glu→Val at position corresponding to amino 1984 sequence SEQ ID NO: 2;
(vi) replacement of Asp→Ala at the position corresponding to amino acid 519 of the sequence SEQ ID NO:2, a substitution of Glu→Val at position corresponding to amino acid 665 sequence SEQ ID NO: 2, and the replacement of Glu→Ala in position the AI, the corresponding amino 1984 sequence SEQ ID NO:2;
(vii) replacement of Asp→Val at position corresponding to amino acid 519 of the sequence SEQ ID NO:2, a substitution of Glu→Val at position corresponding to amino acid 665 sequence SEQ ID NO: 2, and the replacement of Glu→Ala at the position corresponding to the amino acid 1984 sequence SEQ ID NO:2;
(vii) replacement of Asp→Val at position corresponding to amino acid 519 of the sequence SEQ ID NO:2, a substitution of Glu→Val at position corresponding to amino acid 665 sequence SEQ ID NO: 2, and the replacement of Glu→Val at position corresponding to amino 1984 sequence SEQ ID NO:2.

29. The selected nucleic acid molecule according to claim 20, where the encoded recombinant factor VIII further comprises one or more additional mutations of (i) mutations that increase the affinity of recombinant factor VIII for one or both factors IXa and X; (ii) mutations that increase the secretion in culture; (iii) mutations that modify the binding sites of proteins serum to increase the time half-life in blood; (iv) mutations that modify the sequence recognized when glycosylation, to reduce the antigenicity and/or immunogenicity; and (v) mutations that modify calcium-binding site to increase the activity of the recombinant factor VIIIa.

30. The selected nucleic acid molecule is islote according to claim 20, optionally containing a Glu mutation in the position corresponding to amino acid 113 of the sequence SEQ ID NO:2, where the position of substitution of Glu specified recombinant factor VIII is aligned at the amino acid position 113 sequence SEQ ID NO:2, when the alignment of the amino acid sequence of recombinant factor VIII c amino acid sequence of SEQ ID NO: 2.

31. The selected nucleic acid molecule according to item 30,where recombinant factor VIII includes:
(i) the replacement of Glu→Ala at the position corresponding to the amino acid 113 of the sequence SEQ ID NO:2, and the replacement of Asp→Ala at the position corresponding to amino acid 519 of the sequence SEQ ID NO: 2;
(ii) replacement of Glu→Ala at the position corresponding to the amino acid 113 of the sequence SEQ ID NO:2, and the replacement of Asp→Val at position corresponding to amino acid 519 of the sequence SEQ ID NO:2;
(iii) replacement of Glu→Ala at the position corresponding to the amino acid 113 of the sequence SEQ ID NO:2, and the replacement of Glu→Ala at the position corresponding to amino acid 665 sequence SEQ ID NO:2; and
(iv) substitution of Glu→Ala at the position corresponding to the amino acid 113 of the sequence SEQ ID NO: 2, and the replacement of Glu→Val at position corresponding to amino acid 665 sequence SEQ ID NO: 2; or
(v) substitution of Glu→Ala at the position corresponding to the amino acid 113 of the sequence SEQ ID NO:2, and the replacement of Glu→Val at the position correspond to the eat the amino 1984 sequence SEQ ID NO:2.

32. The selected nucleic acid molecule according to claim 20, characterized in that the nucleic acid is an RNA.

33. The selected nucleic acid molecule according to claim 20, characterized in that the nucleic acid is a DNA.

34. The recombinant expression vector for expression of recombinant factor VIII according to claim 1, where the recombinant expression vector contains the DNA molecule according p, functionally associated with the promoter.

35. A host cell containing the nucleic acid molecule according to claim 20, which produces the recombinant factor VIII according to claim 1.

36. A host cell containing a DNA molecule according p, which produces the recombinant factor VIII according to claim 1.

37. A host cell according p, characterized in that the DNA molecule is a recombinant expressing the vector.

38. A host cell according p or 36, characterized in that a host cell is an animal cell, a bacterial cell, an insect cell, a cell of a fungus, a yeast cell, a plant cell or a cell of algae.

39. The method of preparation of recombinant factor VIII, including:
growing the host cell in p or 36 in the conditions under which a host cell expresses the recombinant factor VIII; and
selection of recombinant factor VIII.

40. The method according to § 39, where the specified growing the host cell carry out in vitro on pitate Inoi environment.

41. The method according to p, where nutrient medium includes the factor a background of Villebranda.

42. The method according to paragraph 41, where a host cell contains a transgene encoding the factor a background of Villebranda.

43. The method according to § 42, where the recombinant factor VIII is secreted into the nutrient medium, but such selection enables selection of recombinant factor VIII from the culture medium.

44. The method according to § 39, further including:
the destruction of the host cell before the specified selection, such selection enables selection of recombinant factor VIII from the decomposition products of cells.

45. A method of treating hemophilia A in the animal, where the method includes:
introduction animal suffering from hemophilia A, an effective amount of recombinant factor VIII according to claim 1, when the animal is observed for effective blood clotting after injury of the vessel.

46. The method according to item 45, where the specified effective amount includes from 10 to 50 units/kg of body weight of the animal.

47. The method according to item 45, where the animal is a mammal.

48. The method according to item 45, where the animal is selected from the group consisting of human, rat, mouse, Guinea pig, dog, cat, monkey, chimpanzee, orangutan, cows, horses, sheep, pigs, goats, rabbit and chicken.

49. The method according to item 45, further comprising periodically repeating the specified introduction.

50. Recombinant the th factor VIII according to claim 1, where one or more mutations comprise from one to three of these mutations.



 

Same patents:

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to biochemistry, in particular to a monoclonal human antibody, specific to alpha-toxin of S. aureus. The claimed invention additionally relates to pharmaceutical compositions for treatment of prevention of the abscess formation in an organ, which contains at least one antibody or one nucleic acid, which codes the said antibody.

EFFECT: invention makes it possible to extend an assortment of antibodies, specific to alpha-toxin of S aureus.

23 cl, 7 dwg, 4 tbl, 6 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, namely to leukolectins, and can be used in medicine. What is prepared is the polypeptide leukolectin characterised by SEQ ID NO:1-8. The recombinant preparation is ensured by using a nucleic acid coding it and integrated into an expression vector which is used to transform a host cell. Testing absence-presence or determining an amount of the polypeptide leukolectin are ensured by using an antibody or an antigen-binding fragment of a variable region of the above antibody which is specifically bound to the polypeptide leukolectin. The polypeptide leukolectin or the nucleic acid coding it are used as ingredients of a pharmaceutical composition in therapy of pathological disorders of skin and mucous membranes.

EFFECT: invention enables treating or preventing autoimmune disorders of skin, inflammatory diseases of skin or mucous membrane, or injured skin in an animal effectively.

16 cl, 19 dwg, 3 tbl, 12 ex

FIELD: biotechnologies.

SUBSTANCE: group of inventions refers to biotechnology and deals with new nucleotide sequences of Torque teno virus (TTV) and vectors containing such sequences. Extracted polynucleotide molecule contains polynucleotide sequence chosen from the group consisting of SEQ ID NO:4, sequence complementary to SEQ ID NO:4 and polynucleotide that is at least 95% identical to SEQ ID NO:4.

EFFECT: inventions can be use for production of vaccines to prevent diseases of pigs and other animals, which are caused by Torque teno virus.

4 cl, 7 dwg, 3 tbl, 10 ex

FIELD: biotechnologies.

SUBSTANCE: recombinant nucleic acid expresses one or several polypeptides of interest, a vector of expression and bacteria, which contain this recombinant nucleic acid. The recombinant nucleic acid contains a natural promotor of a gene of HU-like DNA-binding protein (PhilA) of Lactococcus type with the sequence SEQ TD NO:28, or its homological or functional version, which at least by 95% identical to the promotor with sequence SEQ ID NO:28, functionally linked with one or several open reading frames, heterological for the promotor RhIIA, where the promotor RhIIA is located above one or several open reading frames. The expression vector contains the above recombinant nucleic acid, preferably, the specified vector is produced from pTINX. A bacterium contains the above recombinant nucleic acid or the above vector.

EFFECT: proposed invention makes it possible to increase level of expression of polypeptide genes of interest and therefore produce sufficient number of expressed proteins.

19 cl, 26 dwg, 12 tbl, 9 ex

FIELD: biotechnologies.

SUBSTANCE: proposed vector is designed on the basis of a vector plasmid pEGFP-Nl, containing a DNA fragment, which codes a promotor of a heat shock protein gene hsp70 Drosophila melanogaster and a regular sequence upstream, containing heat shock elements (HSE) in different quantities, a polylinker zone, a gene of green fluorescent protein (GFP) and a gene of stability to neomycin, at the same time the promotor is capable of activation under action of temperature of heat shock of mammals or under toxic effect. Such vector is activated as temperature increases to 38°C or in case of toxic impact at transgenic cells or tissue of mammals. Activity of a promotor within the vector may be regulated, i.e. it is possible to cause either its hyperactivity or its weak leak, or to block activity of this promotor by saturation of the regulatory area with HSE elements.

EFFECT: invention may be used to produce transgenic preparations, where an investigated or used gene will be under control of a regulated non-viral promotor.

3 cl, 20 dwg, 2 ex

FIELD: biotechnologies.

SUBSTANCE: invention relates to a molecule of nucleic acid, which is a cyclic or a linear vector fit for expression, of at least one target polypeptide in cells of mammals, including (a) at least one expressing cassette (POI) for expression of the target polypeptide; (b) an expressing cassette (MSM), including a gene of a selective marker of mammals; (c) an expressing cassette (MASM), including an amplificated gene of a selective marker of mammals; besides, the expressing cassette (POI) is flanked in direction 5' by the expression cassette (MASM), the expression cassette (MSM) is localised in direction 3' from the expression cassette (POI) and in which the expression cassettes (MASM), (POI) and (MSM) are arranged in the same orientation from 5' to 3'. Also the method is disclosed to produce the specified molecule of nucleic acid of the vector, as well as a cell of a host mammal, containing the specified molecule of nucleic acid of the vector, the method to produce a host cell containing the specified molecule of nucleic acid of the vector, and also the method to produce the target polypeptide, using the specified host cell.

EFFECT: invention makes it possible to efficiently produce a target polypeptide in mammal cells.

24 cl, 2 dwg, 4 tbl, 13 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: group of inventions refers to medicine, particularly toxicology and radiology, to drug preparations based on antioxidant proteins and methods of using them. The pharmaceutical composition for treating toxic conditions wherein the therapeutic effect is ensured by the action of antioxidant, antimicrobial, antitoxic human lacroferrin protein on the human body contains non-replicating nanoparticles of human adenovirus serotype 5 genome with inserted human lactoferrin expressing human lactoferrin in the therapeutically effective amount in the body, and an expression buffer with the particle content not less than 2.33×1011 of physical particles per ml of the expressing buffer. The method of therapy involves administering the composition in the therapeutically effective dose of 7×1011 of physical particles to 7×1013 of physical particles per ml of the expressing buffer per an individual; the composition is administered intravenously.

EFFECT: invention provides the stable therapeutic effect after the single administration of the composition.

17 cl, 14 ex, 4 dwg

FIELD: chemistry.

SUBSTANCE: described fused protein contains at least two amino acid sequences. The first amino acid sequence, having 90% sequence identity with an amino acid sequence represented in SEQ ID NO:2, is fused with a second amino acid sequence, having at least 90% sequence identity with an amino acid sequence represented in SEQ ID NO:4.

EFFECT: invention provides immunity against various clinically vital strains of group B streptococci.

9 cl, 5 dwg, 8 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. Described is a plasmid which codes esterase Psychrobacter cryohalolentis K5T and contains Ndel/Xhol - a DNA fragment of plasmid pET32a with length of 5.366 thousand base pairs, which includes a promoter of bacteriophage T7, a translation enhancer of gene 10 of the bacteriophage T7, a transcription terminator of the bacteriophage T7, a bla β-lactamase gene which determines resistance of cells transformed by plasmid pPC023 to ampicillin, a replication initiation section ori; and Ndel/Sall - a DNA fragment with size of 0.869 thousand base pairs, which contains a gene which codes the mature form of esterase Psychrobacter cryohalolentis K5T with an amino acid sequence SEQ ID NO: 2, given in the description, having an C-end hexahestidine linker. Provided is an Escherichia coli bacteria strain which is modified by said plasmid, a producer of a polypeptide having esterase Psychrobacter cryohalolentis K5T activity.

EFFECT: invention increases the level of biosynthesis of esterase to 20% of total cell protein.

2 cl, 2 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: method involves transformation of a Clostridium acetobutylicum cell by a vector containing: a replicon origin enabling its replication in C. acetobutylicum; a replacement cartridge containing a first marker gene surrounded by two sequences homologous to selected sites around the DNA target sequence, enabling recombination of said cartridge; a second marker gene representing upp counter-selection marker. The cells expressing the first marker gene are selected with the cartridge integrated in their genome. The cells not expressing the second marker gene with the eliminated said vector are selected.

EFFECT: invention enables producing the transformed Clostridium acetobutylicum cell which is genetically stable and marker-free.

31 cl, 6 dwg, 4 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, more specifically to modified von Willebrand factor (VWF), and can be used in medicine. A recombinant method is used to preparing modified VWF fused in C-terminal of its primary translation product with N-terminal of albumin by the linker SSGGSGGSGGSGGSGGSGGSGGSGGSGGSGS. The prepared modified VWF is used as a part of the pharmaceutical composition for treating or preventing coagulation failure.

EFFECT: invention enables preparing the modified VWF which maintains its ability to N-terminal dimerisation and C-terminal multimerisation with a prolonged half-period of functional blood plasma occurrence as compared to the half-period of functional VWF occurrence.

17 cl, 5 dwg, 4 tbl, 11 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biochemistry, particularly to a recovered polypeptide which is a biological target for methane-producing cell inhibition, as well as to a recovered polynucleotide which codes this polypeptide. There are disclosed expression vector and cloning vector containing this polynucleotide, and host cells containing the above expression vector. There are described conjugated molecules or fused molecule for methane-producing cell inhibition, as well as antibody or its functional fragment which binds to the above polypeptide. The invention also covers a pharmaceutical composition and methods for inhibiting and identifying the methane-producing cell with the use of the above conjugated molecule or fused molecule and the antibody or its fragment.

EFFECT: invention enables inhibiting the methane-producing cell effectively.

19 cl, 9 dwg, 6 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to immunology. What is presented is an antibody specifically binding to an epitope on CD43 and CEA and modified in a heavy and/or light chain constant region. There are disclosed polynucleotides, vector, host cell and methods for producing the antibody according to the invention, as well as pharmaceutical composition, kit and method of treating non-haemopoietic cancer.

EFFECT: this invention can find further application in therapy and diagnosing of CD43 or CEA mediated diseases.

35 cl, 15 tbl, 5 ex, 4 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to immunology. What is presented is a recovered human integrin α5β1 monoclonal antibody. The antibody is characterised by the fact that it contains 6 CDR, 3 CDR from a light chain and 3 CDR from a heavy chain. A nucleic acid (NA) coding the antibody according to the invention, an expression vector containing a NA molecule, a host cell containing the vector, and a method for preparing the antibody on the basis of the cell are described. There are disclosed: a composition and a method for growth inhibition of the tumour cells expressing human integrin α5β1 on the basis of the antibody. What is described is a version of the method for growth inhibition of the tumour cells expressing human integrin α5β1 using the composition.

EFFECT: invention provides the new antibodies with high (approximately nm, as measured by FACS) binding affinity for human integrin α5β1 that can find application in medicine in therapy of the tumours mediated by integrin α5β1 expression.

13 cl, 36 dwg, 3 tbl, 11 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: group of inventions refers to biotechnology. There are presented versions of the recombinant bacterial strain Escherichia coli that are succinic acid producers and contain a gene coding pyruvate carboxylase. The bacterial strain Escherichia coli SGM1.0 [pPYC] possesses ackA, pta, poxB, ldhA, adhE inactivated genes. The bacterial strain Escherichia coli SGM1.0 [pPYC] possesses ackA, pta, poxB, ldhA, adhE and icIR inactivated genes. The bacterial strain Escherichia coli SGM2.0 [pPYC] possesses ackA, pta, poxB, ldhA, adhE inactivated genes and enhanced expression of aceE, aceF and lpdA genes. The bacterial strain Escherichia coli SGM2.1 [pPYC] possesses ackA, pta, poxB, ldhA, adhE, icIR inactivated genes and enhanced expression of aceE, aceF and lpdA genes. The bacterial strain Escherichia coli SGM3.0 [pPYC] possesses ackA, pta, poxB, ldhA, adhE, pflB inactivated genes and enhanced expression of aceE, aceF and lpdA genes. The bacterial strain Escherichia coli SGM3.1 [pPYC] possesses ackA, pta, poxB, ldhA, adhE, pflB, iclR inactivated genes and enhanced expression of aceE, aceF and lpdA genes. What is also presented is a method for preparing succinic acid with using the above strains.

EFFECT: group of inventions provides higher succinic acid yield.

17 cl, 2 tbl, 2 ex

FIELD: chemistry.

SUBSTANCE: invention concerns biotechnology and nanotechnology. The method includes transforming archaeal cells with a recombinant plasmid, growing cells, selecting flagella and modifying the surface of the flagella. The plasmid structure contains recombinant genes for synthesis of flagellins A1 and A2 which form flagella, wherein the sequence of flagellin A1 or flagellin A2 or sequences of flagellin A and flagellin A2 contain at least one peptide insert for selective binding of metal ions or nanoparticles. The point of the peptide insert in flagellin A1 is defined in the region between first and second glycosylation sites located between position 86 and position 96 of SEQ ID NO:2, and the point of the peptide insert in flagellin A2 is defined in the region between first and second glycosylation sites located between position 82 and position 92 of SEQ ID NO:3, where the length of the peptide insert is 5 to 60 amino acids. The method includes selecting archaeal flagella containing peptide inserts for non-covalent bonding with metal ions, performing fragmentation of flagella into fragments and modifying the surface of flagella by binding peptide inserts with metal ions and oxidising metals, washing, drying and packing the obtained nano-structured material.

EFFECT: method enables to obtain a coating for forming active surfaces on flexible and solid substrates or capsules using archaeal flagella, which enable non-covalent bonding of a wide range of substances such as metal ions, metal nanoparticles, semiconductors and other ligands.

6 cl, 11 dwg, 1 tbl, 12 ex

FIELD: medicine.

SUBSTANCE: invention refers to genetic engineering and can be used for methane-producing cell permeability control. What is prepared is a polypeptide able to permeate into a methane-producing cell and to increase its permeability, characterised by an amino acid sequence SEQ ID NO:117, 118 or 119 or being at least 90% identical to the above sequence, or at least 15 sequential amino acids of the above sequence. What is also prepared is a polynucleotide coding the above polypeptide cloning and expressing vectors used for producing host cells producing the polypeptide or used for the vector replication. The polypeptide can contain a fluorescent tag on an N-terminal amino acid residue.

EFFECT: invention enables providing higher methane-producing cell permeability.

18 cl, 35 dwg, 3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry, particularly to a plant, having high resistance to an AHAS-inhibiting herbicide, which includes at least one Shiloh-8 IMI nucleic acid, parts thereof, a plant cell and seeds. Described is a nucleic acid which encodes a polypeptide which increases herbicide resistance of a plant. Disclosed are an expression cassette and a plant transformation vector which include said nucleic acid. Described are methods of controlling weeds growing near a plant having high resistance to an AHAS-inhibiting herbicide. Disclosed is a method of producing a plant having high resistance to an AHAS-inhibiting herbicide, as well as a method of increasing AHAS activity in a plant. Described is a method of selecting a cell transformed by a vector containing IMI nucleic acid. Also disclosed is a method of increasing resistance to an AHAS-inhibiting herbicide and a weed control method which includes treatment with an AHAS-inhibiting herbicide.

EFFECT: invention enables to obtain a plant which is resistant to an AHAS-inhibiting herbicide, which provides effective control of weeds growing near said plant.

57 cl, 3 dwg, 5 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, particularly to methods for preparing next generation drug preparations and biologically active additives in bioreactors on the basis of transgenic producing mammals. The method for creating transgenic animals producing a protein with stable and high expression in milk, involves producing transgenic mammals with using a vector containing a reporter gene coding a target protein that is a goat beta-casein gene promoter, a bovine growth factor terminator and effective two-fold transcription terminators. The terminators surround an expression cartridge and possess an ability to break genome transcripts effectively in a mammalian genome by the effective protection of transgene expression in the mammalian genome against further repression. The effective two-fold terminators represent any mammalian genome site fulfilling the following conditions: 3'-sites of the two simultaneously expressing and opposite genes containing a site of the second-to-last exon, the last intervening sequence, the last exon and a polyadenylation signal, a space of two polyadenylation signals at different DNA strands is no more than 100 base pairs.

EFFECT: method can be used for creating the transgenic animals with high and stable target protein production in milk for medical and research purposes.

4 dwg, 4 tbl, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: group of inventions relates to the field of biotechnology. Synthetic 5'UTR regions are applied to enhance the transgene expression, with the 5'UTR regions being located between a promoter and a sequence, presenting an interest in an expression vector. The claimed invention also claims vectors, which contain the 5'UTR regions, and a method of enhancing the transgene expression in their application.

EFFECT: claimed invention provides the synthetic 5'UTR regions, which contain the first polynucleotide fragment in the form of the second intron of gene of calcium ATphase of the sarcoplasmic/endoplasmic reticulum and the second polynucleotide fragment, represented by a part of the 5' untranslated region (5'UTR) of casein gene.

25 cl, 17 dwg, 2 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: method of purifying coagulation factor VIII protein from a solution involves: a) contacting the protein with a multimodal resin or a mixed action-type resin containing ligands having a hydrophobic portion and a negatively charged portion; b) elution of the protein with an elution buffer containing at least 1.5M salt and at least 40% (wt/vol) ethylene glycol, propylene glycol or mixture thereof, and calcium ions. The method is a single-step chromatographic process where the coagulation factor VIII protein is captured and does not require adjusting pH or electroconductivity at the feeding step. The method of stabilising the coagulation factor VIII protein, where the coagulation factor VIII protein is captured and stabilised when the protein passes once through a column with a multimodal resin containing ligands having a hydrophobic portion and a negatively charged portion, and elution of the protein with an elution buffer containing at least 1.5M salt and at least 40% (wt/vol) ethylene glycol, propylene glycol or mixture thereof, and calcium ions.

EFFECT: invention reduces the volume of the column about 250-fold and a coefficient of purification equal to 30, high stability of the protein product.

2 cl, 4 dwg, 4 tbl, 7 ex

Up!