Method of generating starter culture, starter culture and fermentation method with its application

FIELD: chemistry.

SUBSTANCE: claimed solutions deal with a method of generating a starter culture, the starter culture and a fermentation method with an application of the said starter culture. The claimed method of generating the starter culture includes impact on a parent bacterial strain, which contains, at least, a part of the locus CRISPR, with a bacteriophage to obtain a mixture of bacteria, which contains a bacteriophage-resistant variant strain, containing the modified locus CRISPR, which contains, at least, one additional spacer in the said modified locus CRISPR; independent impact on the same parent bacterial strain with the same bacteriophage to obtain the mixture of bacteria, which contains other bacteriophage-resistant variant strain, containing the modified locus CRISPR, which contains, at least, one additional spacer in the said modified locus CRISPR, different from the additional spacer in the first bacteriophage-resistant variant strain, selection of the said bacteriophage-resistant variant strains from the mixtures of bacteria and their separation.

EFFECT: claimed inventions make it possible to obtain bacteriophage-resistant cultures and can be applied in the food industry in manufacturing fermented products.

29 cl, 23 dwg, 20 tbl, 23 ex

 

The scope to which the invention relates

The present invention relates to methods and compositions related to the modulation of the resistance of cells to a nucleic acid target product or its transcription. In some preferred embodiments, the implementation, the present invention relates to compositions and methods for applying one or more genes or proteinscasto modulate the resistance of cells to a nucleic acid target product or its transcription. In some preferred embodiments, the implementation, the present invention relates to methods and compositions that find use in the development and use of combinations of strains and rotations of starter cultures. In additional embodiments, the implementation, the present invention relates to a method of marking and/or identification of bacteria. In some preferred embodiments, the implementation, the present invention relates to a method of use of CRISPR loci to identify potential virulence phage against cells and use of CRISPR-cas to modulate the genetic sequence of the phage for a higher level of virulence. In some embodiments, the implementation, the present invention relates to a means and compositions for the development and application of bacteriophages as biological agents is ontrol.

The level of technology

Culture and, in particular, starter cultures are widely used in the food industry in the manufacture subjected to fermentation products, including dairy products (e.g. yogurt, buttermilk, and cheese), meat products, bakery products, wine and herbal products. Obtaining labor-intensive crops, occupies a large space and equipment, and there is a significant risk of causing pollution damage to bacteria and/or phages during the stages of reproduction. The failure of bacterial cultures due to infection and reproduction of bacteriophages (phages) is a big problem during the industrial use of bacterial cultures. There are many different types of phages and continues to produce new strains. In addition, there is a need for methods and compositions for tracking bacteria used in these cultures. Indeed, despite advances in the development of cultures, there remains a need to improve crops for industrial applications.

A brief description of the invention

The present invention relates to methods and compositions related to the modulation of the resistance of cells to a nucleic acid target product or its transcription. In some preferred embodiments, implementation, N. the present invention relates to compositions and methods for applying one or more genes or proteins casto modulate the resistance of cells to a nucleic acid target product or its transcription. In some embodiments, the implementation, the present invention relates to methods and compositions that find use in the development and use of combinations of strains and rotations of starter cultures. In additional embodiments, the implementation, the present invention relates to a method of marking and/or identification of bacteria. In some preferred embodiments, the implementation, the present invention relates to a method of use of CRISPR loci to identify potential virulence phage against cells and the use of CRISPR-cas to modulate the genetic sequence of the phage for a higher level of virulence. In some embodiments, the implementation, the present invention relates to a means and compositions for the development and application of phages as biocontrol agents.

The present invention relates to a method for generating at least one resistant to bacteriophages variant strain containing stages: (a) impact on the parent bacterial strain containing at least a part of the CRISPR locus, at least one nucleic acid sequence to obtain a mixture of bacteria containing at least one abutment is ivy to bacteriophages variant strain, containing the modified CRISPR locus; (b) selecting resistant to bacteriophages variant strain of a mixture of bacteria; (C) selecting resistant to bacteriophages variant strains containing additional fragment of the nucleic acid in the modified CRISPR locus of resistant to bacteriophage strains selected in stage (b); and (d) allocating at least one resistant to bacteriophages variant strain, where the strain contains an additional fragment of the nucleic acid in the modified CRISPR locus. In some preferred embodiments, implementation, methods, in addition, include a phase comparison of the CRISPR locus or part of the parent bacterial strain and the modified CRISPR locus are resistant to bacteriophages variant strain to identify resistant to bacteriophages variant strains containing at least one additional fragment of the nucleic acid in the modified CRISPR locus that is not present in the CRISPR locus of the parent bacterial strain. In some particularly preferred embodiments, implementation, methods, in addition, include the stage of selecting resistant to bacteriophages variant strains containing additional fragment of the nucleic acid in the modified CRISPR locus. In some embodiments, implementation of maternal bacterial ø the AMM is exposed to two or more sequences of nucleic acids. In some embodiments, implementation of the parent bacterial strain is subjected to the simultaneous effects of two or more nucleic acids sequences, while in some alternative embodiments, implementation of the parent bacterial strain is sequentially exposed to two or more sequences of nucleic acids. In some particularly preferred embodiments, implementation of the parent bacterial strain is subjected to nucleic acid sequences by infection, at least one bacteriophage containing the sequence of nucleic acid. In some other preferred embodiments, the implementation of at least one bacteriophage selected from the group of families of viruses consisting of: Corticoviridae, Cystoviridae, Inoviridae, Leviviridae, Microviridae, Myoviridae, Podoviridae, Siphoviridae, and Tectiviridae. In some additional preferred embodiments, the implementation of at least one bacteriophage is a naturally occurring bacteriophage, whereas in some other preferred embodiments, the implementation of at least one bacteriophage is a mutant bacteriophage obtained by selective pressure from the use of resistant to bacteriophages bacterial strain. In another preference is sustained fashion options implementation the parent bacterial strain is exposed to the nucleic acid through the natural mechanism of capture of nucleic acids. In some embodiments, the implementation, the natural mechanism of capture of nucleic acids includes natural competence. In some additional embodiments, the implementation, the natural mechanism of capture nucleic acids of the parent bacterial strain is carried out by conjugation or transformation. In some embodiments, implementation, resistant to bacteriophage strain is a case-insensitive mutant bacteriophages. In yet some additional embodiments, implementation of the parent bacterial strain is a case-insensitive mutant bacteriophages. In some other embodiments, implementation of the 5' end and/or end 3' of the CRISPR locus of the parent bacterial strain is compared with the modified CRISPR locus are resistant to bacteriophages variant strain. In some other embodiments, implementation of the 5' end and/or end 3'of at least the first CRISPR repeat or at least the first CRISPR spacer of the CRISPR locus of the parent bacterial strain is compared with the modified CRISPR locus are resistant to bacteriophages variant strain. In some embodiments, implementation, resistant to bacteriophages Varian is hydrated strain contains, at least one additional fragment of the nucleic acid in the modified CRISPR locus. In some additional embodiments, the implementation of at least part of the CRISPR locus of the parent bacterial strain and at least part of the modified CRISPR locus are resistant to bacteriophages variant strain compared with the amplification of at least part of the CRISPR locus and at least part of the modified CRISPR locus, for receiving the amplified sequence of the CRISPR locus and the amplified sequence of the modified CRISPR locus. In some embodiments, implementation, amplification is carried out using PCR (polymerase cableway reaction). In some preferred embodiments, the implementation of at least part of the CRISPR locus of the parent bacterial strain and at least part of the modified CRISPR locus are resistant to bacteriophages variant strain are compared by sequencing at least part of the CRISPR locus and at least part of the modified CRISPR locus. In some particularly preferred embodiments, implementation, methods, in addition, include the stage of sequencing the amplified sequence of the CRISPR locus and the amplified sequence of the modified CRISPR locus. Some extra VA is Ianto implementation an additional fragment of the nucleic acid in the modified CRISPR locus represents an additional element of repeat-spacer. In some preferred embodiments, implementation, additional element of repeat-spacer contains at least 44 nucleotides. In some alternative preferred embodiments, implementation, additional element of repeat-spacer contains from about 44 to about 119 nucleotides. However, it is not intended that the present invention should be limited to these specific size ranges, because other sizes can be used in the present invention, as described in this application. In some embodiments, implementation, additional element of repeat-spacer contains at least one nucleotide sequence that has at least 95% identity with the CRISPR repeat in the CRISPR locus of the parent bacterial strain. In some other embodiments, implementation, additional element of repeat-spacer contains at least one nucleotide sequence that has at least 95% identity with the nucleotide sequence in the genome of at least one bacteriophage. In some particularly preferred embodiments, implementation of the parent bacterial strain isone industrially applicable strain. In some additional embodiments, implementation of the parent bacterial strain susceptible to infection, at least one bacteriophage. In some other preferred embodiments, implementation of the parent bacterial strain contains a culture selected from starter cultures, probiotic cultures and cultures of food additives. In some preferred embodiments, implementation of the parent bacterial strain contains a strain, obtained from the culture. In some particularly preferred embodiments, implementation, culture is a starter culture, probiotic culture and/or culture supplements. In yet some additional embodiments, implementation of the parent bacterial strain selected from theEscherichia, Shigella, Salmonella, Erwinia, Yersinia, Bacillus, Vibrio, Legionella, Pseudomonas, Neisseria, Bordetella, Helicobacter, Listeria, Agrobacterium, Staphylococcus, Streptococcus, Enterococcus, Clostridium, Corynebacterium, Mycobacterium, Treponema, Borrelia, Francisella, Brucella, Campylobacter, Klebsiella, Frankia, Bartonella, Rickettsia, Shewanella, Serratia, Enterobacter, Proteus, Providencia, Brochothrix, Bifidobacterium, Brevibacterium, Propionibacterium, Lactococcus, Lactobacillus, Pediococcus, LeuconostocandOenococcus

The present invention also includes at least one resistant to bacteriophages variant strain, obtained using the presented in the present description means. In some preferred embodiments, implementation, this is th invention relates to resistant to bacteriophages variant strains, where is resistant to bacteriophages variant strain is an industrially applicable strain, which represents the at least one component of the starter cultures, probiotic cultures, culture, food additives and other useful crops.

The present invention also relates to compositions containing resistant to bacteriophages variant strain, obtained using the presented in the present description means. In some embodiments, the implementation, the present invention relates to compositions containing at least two resistant to bacteriophages variant strain, obtained using the presented in the present description means. The present invention also relates to food and/or feed containing at least one of these compositions. The present invention also relates to methods of producing food and/or feed, comprising adding at least one of these compositions for food or feed. The present invention also relates to starter cultures, probiotic cultures, cultures of food additives and other useful crops that contain at least one of these compositions. The present invention also relates to methods of fermentation, comprising adding at least one of the quiet songs to the starter culture. In some embodiments, the implementation, the present invention also relates to methods of fermentation, comprising adding at least one of these compositions to the environment fermentation conditions under which fermentation components of the fermentation medium. In some embodiments, implementation, fermentation is not affected by the presence of bacteriophages. In some embodiments, implementation, Wednesday fermentation is a food product. In some preferred embodiments, implementation of the food product is a dietary product. In some particularly preferred embodiments, exercise, diet product is a milk. In some other embodiments, the implementation of at least two different compositions containing two or more resistant to bacteriophages variant strain that is consistently exposed to the fermentation medium.

The present invention also relates to methods of reducing harmful population of bacteriophages in the environment of fermentation, including the impact of fermentation, at least one resistant to bacteriophages variant strain, obtained using the presented in this description of how the conditions under which reduced the population of bacteriophages.

The present invention also Rel is relates to methods of generating, at least one resistant to bacteriophages variant strain, comprising the stage of: (a) impact on the parent bacterial strain containing at least a part of the CRISPR locus, at least one nucleic acid sequence to obtain a mixture of bacteria containing at least one resistant to bacteriophages variant strain containing the modified CRISPR locus; (b) selecting resistant to bacteriophages variant strain of a mixture of bacteria; (C) comparison of the CRISPR locus or part of the parent bacterial strain and the modified CRISPR locus are resistant to bacteriophages variant strain containing at least one additional fragment of the nucleic acid in the modified CRISPR locus that is not present in the CRISPR locus of the parent bacterial strain; (d) selecting resistant to bacteriophages variant strains containing additional fragment of the nucleic acid in the modified CRISPR locus; (e) analyzing at least one additional fragment of the nucleic acid in the modified CRISPR locus to identify at least one resistant to bacteriophages variant strain; and (f) allocating at least one resistant to bacteriophages variant strain.

The present invention also relates to methods for the am generating mutants of phage, avoiding CRISPR, including: (a) obtaining at least one parent phage and resistant to phage bacterial strain containing at least one CRISPR locus, where the CRISPR locus contains a nucleic acid sequence that is at least about 95% identical, at least one protospatharios sequence in the genome of at least one parent phage; (b) the impact of at least one parent phage-resistant phage bacterial strain in such conditions, to be received at least one phage; and (C) selecting at least one variant phage, where at least one phage is capable to infect resistant to phage bacterial strain and represents the mutant phage that avoids CRISPR. In some embodiments, implementation, resistant to phage bacterial strain is a resistant to bacteriophages variant strain, obtained using the presented in the present description means. In some embodiments, implementation, methods, in addition, include a phase comparing at least part of at least one protospatharios sequence and CRISPR motif located near at least one protospatharios sequence variant phage, at least one FR the spacer elements sequence and motif CRISPR parent phage. In yet some additional embodiments, implementation, methods, in addition, include the stage of selection of variant phages that infect resistant to phage bacterial strain, where variant phages contain the mutant phages that avoids CRISPR, and where phages, avoiding CRISPR contain at least one mutation in at least one protospatharios sequence and/or in the CRISPR motif mutants of phage avoiding CRISPR. In yet some additional embodiments, implementation, methods constantly repeated one or more times using mutants of phage avoiding CRISPR and the other resistant to phages CRISPR bacterial strain containing at least one CRISPR locus, where the CRISPR locus contains a nucleic acid sequence that is at least 95% identical to at least one protospatharios sequence mutants of phage avoiding CRISPR. In yet some additional embodiments, the implementation of at least one bacteriophage selected from the group of families of viruses consisting of Corticoviridae, Cystoviridae, Inoviridae, Leviviridae, Microviridae, Myoviridae, Podoviridae, Siphoviridae, and Tectiviridae. In some preferred embodiments, implementation, resistant to phage bacterial strain selected from theEscherichia, Shigella, Salmonella, Erwinia, Yersinia, Bacillus, Vibrio, Legionella, Pseudomonas, Neisseria, Bordetella, Helicobacter, Listeria, Agrobacterium, Staphylococcus, Enterococcus, Clostridium, Camplyobacter, Corynebacterium, Mycobacteriu, Treponema, Borrelia, Francisella, Brucella, Klebsiella, Frankia, Bartonella, Rickettsia, Shewanella, Serratia, Enterobacter, Proteus, Providencia, Brochothrix, Bifidobacterium, Brevibacterium, Propionibacterium, Lactococcus, Lactobacillus, Pediococcus, Leuconostoc, StreptococcusandOenococcus.

The present invention also relates to mutants of phage avoiding CRISPR obtained using the presented in the present description means. In some embodiments, implementation, mutant phages that avoids CRISPR contain two or more mutations present in at least two protoplasmic sequences and/or in the CRISPR motif.

The present invention also relates to mutants of phage avoiding CRISPR, where the genome of the mutant phages that avoids CRISPR generally created by genetic engineering to include mutations in at least one protosphere and/or the CRISPR motif. In some embodiments, the implementation of at least one CRISPR motif mutated in the mutant phages that avoids CRISPR, while in some alternative embodiments, the implementation of at least one CRISPR motif subjected to deletions in the mutant phages that avoids CRISPR. The present invention also relates to compositions containing at least one mutant phage that avoids CRISPR.

The present invention also relates to methods for regulating bacterial populations in the product, including the impact on the composition containing at least one mu is ant phage, avoiding CRISPR, environment, fermentation, where the fermentation medium contains at least one population of unwanted bacteria, in such conditions that the population of unwanted bacteria is reduced and the fermentation medium is used to generate the product. In some embodiments, implementation, product selected from foodstuffs, animal feed, cosmetic products, products for personal care, hygiene products, veterinary products and food additives. In still some embodiments, some of the implementation methods are repeated at least once, and other compositions and/or compositions containing other mutants of phage avoiding CRISPR, used in rotation.

In some embodiments, the implementation, the present invention relates to methods and compositions for the application of one or more genes or proteinscasto modulate the stability in the cage against a nucleic acid target or product its transcription. In some additional embodiments, the implementation, the present invention relates to compositions and methods of using the sequence of the recombinant nucleic acid containing at least one genecasand at least two CRISPR repeat together, at least one CRISPR spacer, where at least one CRISPR spacer is heterologous, Myung is our least to one genecasand/or at least two CRISPR repeats, for modulation of resistance to nucleic acid target or products of transcription. In yet some additional embodiments, the implementation, the present invention relates, at least one nucleic acid sequence containing at least one genecas.

In some embodiments, the implementation, the present invention relates, at least one nucleic acid sequence containing at least one genecasand at least two CRISPR repeat. In some embodiments, the implementation, the present invention relates to a nucleic acid sequence containing at least one genecasand at least one CRISPR spacer. In some embodiments, the implementation, the present invention relates to a nucleic acid sequence containing at least one genecasand at least one CRISPR spacer and at least two CRISPR repeat. In some embodiments, the implementation, the present invention relates to the sequence of the recombinant nucleic acid containing at least one genecasand at least two CRISPR repeat together, at least one CRISPR spacer, where the CRISPR spacer is heterologous, at least one of the at gene casand/or at least two CRISPR repeats.

The present invention also relates to constructs containing one or more nucleic acids sequences described in this application. In yet some additional embodiments, the implementation, the present invention relates to vectors containing one or more sequences of nucleic acids or one or more of the constructs described in this application. In some embodiments, the implementation, the present invention relates to cells containing the nucleic acid sequence or construct, or vector described in this application.

The present invention also relates to methods of modulating (e.g., giving or increasing) the resistance of cells to a nucleic acid target product or its transcription, comprising the stage of: (i) identification of the sequence (e.g., conserved sequence) in the body (in some embodiments, implementation, this sequence, which is essential for the function or survival of the organism); (ii) receipt of the CRISPR spacer, which identified homologous sequences; (iii) obtaining a nucleic acid (e.g., recombinant nucleic acids)containing at least one genecasand at least two CRISPR repeat pax is with a spacer; CRISPR; and (iv) introducing a nucleic acid into the cell, thus, to make the cell resistance to the nucleic acid target or to the product of its transcription.

The present invention also relates to methods of modulating (e.g., giving or increasing) the resistance of cells to a nucleic acid target product or its transcription, comprising the stage of: (i) identifying one or more CRISPR spacers or pseudo CRISPR spacers in an organism resistant to the nucleic acid target product or its transcription; (ii) obtaining a recombinant nucleic acid containing at least one gene or proteincasand at least two CRISPR repeat together with the identified one or more spacers; and (iii) introduction of recombinant nucleic acids in the cell, thus, to make the cell resistance to the nucleic acid target or to the product of its transcription.

The present invention also relates to methods of modulating (e.g., giving or increasing) the resistance of cells containing at least one or more genes or proteinscasand two or more CRISPR repeat to the nucleic acid target product or its transcription, comprising the stage of: (i) identifying one or more CRISPR spacers in an organism resistant to the nucleic acid target sludge is the product of its transcription; and (ii) modifying the sequence of one or more spacer(s) CRISPR in the cell so that the spacer(s) CRISPR had homology to the spacer(s) CRISPR in the body.

The present invention also relates to methods of modulating (e.g., giving or increasing) the resistance of cells containing at least one or more genes or proteinscasand two or more CRISPR repeat to the nucleic acid target product or its transcription, comprising the stage of: (i) identifying one or more CRISPR spacers in an organism that is essentially resistant to nucleic acid target product or its transcription; and (ii) modifying the sequence of at least one or more spacer(s) CRISPR in the cell so that the spacer(s) CRISPR had reduced the degree of homology to the spacer(s) CRISPR in the body.

The present invention also relates to methods of modulating (e.g., giving or increasing) the resistance of cells containing at least one or more genes or proteinscasand two or more CRISPR repeat to the nucleic acid target product or its transcription, including the modification of one or more genes or proteinscasand/or two or more CRISPR repeats in the cell.

The present invention also relates to methods of identifying a CRISPR spacer or pseudo CRISPR spacer for the changes in modulating the resistance of cells to a nucleic acid target product or its transcription, incorporating the following stages: (i) obtaining a cell containing at least two CRISPR repeat, and at least one gene or proteincas; (ii) identification of CRISPR spacer or pseudo CRISPR spacers in an organism that is essentially resistant to nucleic acid target product or its transcription; (iii) identification of the sequence of the CRISPR spacer in the cell, so that the spacer had homology with the CRISPR spacer of the body; and (iv) determining, modulating whether the cell is resistant to a nucleic acid target product or its transcription, where the modulation of the resistance of cells to a nucleic acid target product or its transcription indicates that the CRISPR spacer modulates the stability of the cell.

The present invention also relates to methods of identifying genecasfor use in modulating the resistance of cells to a nucleic acid target product or its transcription, comprising the stage of: (i) obtaining a cell containing at least one CRISPR spacer and at least two CRISPR repeat, (ii) genetic engineering of cells, so that it contained at least one genecas; and (iii) determine modulates whether the cell is resistant to a nucleic acid target product or its transcription, where the modulation of the resistance of cells to a nucleic acid target product or its transcription decrees the AET, what genecascan be used to modulate the resistance of the cell.

The present invention also relates to methods of identifying a CRISPR repeat for use in modulating the resistance of cells to a nucleic acid target product or its transcription, comprising the stage of: (i) obtaining a cell containing at least one CRISPR spacer and at least one genecas;(ii) genetic engineering of cells, so that it contains a CRISPR repeat; and (iii) determine modulates whether the cell is resistant to a nucleic acid target product or its transcription, where the modulation of the resistance of cells to a nucleic acid target product or its transcription indicates that the CRISPR repeat can be used to modulate the resistance of the cell.

The present invention also relates to methods of identifying functional combination genecasand CRISPR repeat, comprising the stage of: (a) determining the sequences of the genecasand CRISPR repeat; (b) identifying one or more clusters of genescasaccording to the definition by analysis of sequence comparison; (C) identifying one or more clusters of CRISPR repeats; and (d) combining those genescasand CRISPR repeats, which are within the same cluster, where the combination of gene sequencescasand repeat the and CRISPR, in the same cluster indicates that the combination is a functional combination.

The present invention also relates to methods of modulating pageType bacterial cells containing one or more genes or proteinscasand two or more CRISPR repeats, which includes stages: (i) identifying one or more pseudo CRISPR spacers in the genomic sequence of bacteriophage, which must be modulated stability; and (ii) modifying the sequence of one or more CRISPR spacers bacterial cells, so that the spacer(s) CRISPR bacterial cells had homology with pseudo-spacer (the spacer) CRISPR bacteriophage resistance which must be modulated.

The present invention also relates to methods of modulating (e.g., giving or increasing) the resistance of a bacterial cell by a bacteriophage comprising the stage of: (i) identification of the sequence (e.g., conserved sequence in bacteriophage (preferably, sequence, essential for the function or survival of bacteriophage); (ii) receipt of the CRISPR spacer, which identified homologous sequences; (iii) obtaining a nucleic acid that contains at least one genecasand at least two CRISPR repeat with SP is yerom CRISPR; and (iv) introduction of nucleic acid into the bacterial cell, thus making bacterial cell resistant to a nucleic acid target product or its transcription.

The present invention also relates to methods of modulating (e.g., giving or increasing) the resistance of bacterial cells to a nucleic acid target product or its transcription in bacteriophage comprising the stage of: (i) identifying one or more pseudo CRISPR spacers in the genome of the bacteriophage that is able to provide resistance to nucleic acid target product or its transcription; (ii) obtaining a recombinant nucleic acid containing at least one genecasand at least two CRISPR repeat together with the identified one or more pseudo CRISPR spacers; and (iii) introduction of recombinant nucleic acids in bacterial cells, thus, making bacterial cell resistant to a nucleic acid target product or its transcription.

The present invention also relates to methods of modulating the stability of bacterial cells containing one or more genes or proteinscasand two or more CRISPR repeats to the nucleic acid target product or its transcription in bacteriophage comprising the stage of: (i) identifying one or more pseudo-SP is userow CRISPR in bacteriophage, which is able to provide resistance to nucleic acid target product or its transcription; (ii) identifying one or more CRISPR spacers in the bacterial cell, which must be modulated sustainability; and (iii) modifying the sequence of the spacer(s) CRISPR in the bacterial cell, which must be modulated resistance, so that the spacer(s) CRISPR had a higher degree of homology with pseudo-spacer (the spacer) CRISPR bacteriophage, which must be modulated resistance.

The present invention also relates to methods of determining the resistance of cells to a nucleic acid target product or its transcription, including identification of one or more functional combinations of CRISPR repeat-cas and one or more CRISPR spacers in the cell.

The present invention also relates to cells obtained or derived from presented in the present description means. In some embodiments, implementation. the present invention relates to a CRISPR spacers or pseudo CRISPR spacers, received or obtained by the methods described in this application.

In some embodiments, the implementation, the present invention relates to genescasreceived or obtained by the methods described in this application. Some other option is x implementation the present invention relates to a CRISPR repeats, received or obtained by the methods described in this application. In some embodiments, the implementation, the present invention relates to functional combinations, received or obtained by the methods described in this application. In some embodiments, the implementation, the present invention relates to recombinant CRISPR loci containing at least one CRISPR spacer or pseudo CRISPR spacer and/or at least one genecasand/or at least one CRISPR repeat and/or functional combination.

In some embodiments, the implementation, the present invention relates to methods of using cells, at least one CRISPR spacer or pseudo CRISPR spacer of at least one genecasat least one CRISPR repeat or their functional combination to modulate the resistance of cells to a nucleic acid target product or its transcription.

In some other embodiments, the implementation, the present invention relates to cell cultures containing at least one cell, at least one CRISPR spacer or pseudo CRISPR spacer of at least one genecasat least one CRISPR repeat or functional combination to modulate the resistance of cells to a nucleic acid target or PR is the product of its transcription.

In some other embodiments, the implementation, the present invention relates to food and/or feed containing presented in this description of culture. In some other embodiments, the implementation, the present invention relates to methods of producing food and/or feed containing presented in this description of culture. In other additional embodiments, the implementation, the present invention relates to food and/or feed derived or obtained are presented in the present description means. In some preferred embodiments, the implementation, the present invention relates to a method of application of the cultures represented in the present description, to obtain food and/or feed.

The present invention also relates to nucleotide sequences containing or consisting of the sequence represented in any of SEQ ID NOS:7-10 and SEQ ID NOS:359-405, as well as their variants, fragments, homologs and derivatives. The present invention also relates to the amino acids encoded are presented in this description of nucleotide sequences. In some embodiments, the implementation, the present invention relates to constructs and/or vectors containing one or more presented in the present description n cleotide sequences. The present invention also relates to cells of the host that contains at least one presented in this description of the constructs and/or nucleotide sequences.

In some embodiments, the implementation of one or more genes or proteinscasused in combination with two or more CRISPR repeats. In some other embodiments implement one or more genes or proteinscasand/or two or more CRISPR repeats are obtained from the same cells. In some additional embodiments, the implementation of one or more genes or proteinscasand two or more CRISPR repeats naturally meet together in the same cage. In still some other embodiments implement one or more genes or proteins are used in combination with one or more CRISPR spacers.

In some embodiments, the implementation, the spacer(s) CRISPR obtained from a different organism than the cell from which the received one or more genes or proteinscasand two or more CRISPR repeats.

In some embodiments, the implementation, the spacer derived from cells that are resistant to nucleic acid target. In some embodiments, the implementation, the CRISPR spacer is a synthetic nucleic acid sequence. In some other embodiments, the implementation, the spacer(s) CRISPR have the t have 100% identity with the nucleic acid-target at least along the length of the crustal spacer.

In some embodiments, the implementation of one or more genes or proteinscasused in combination, at least one or more CRISPR spacers and at least two or more CRISPR repeats. In some embodiments, implementation of the nucleic acid target or the product of its transcription obtained from DNA of the bacteriophage. In some embodiments, implementation of the nucleic acid target or the product of its transcription received at least one plasmid. In some other embodiments, implementation of the nucleic acid target or the product of its transcription received at least one DNA movable genetic element. In some embodiments, implementation of the nucleic acid target or the product of its transcription received from the roaming element and/or insertion sequences. In some alternative embodiments, implementation of the nucleic acid target or the product of its transcription derived from the gene of resistance to antibiotics/antimicrobials. In some alternative embodiments, implementation of the nucleic acid target or the product of its transcription derived from a nucleic acid that encodes at least one virulence factor. In some preferred embodiments, implementation, fuck the EOS virulence includes toxins, internally, hemolysins and/or other virulence factors.

In some embodiments, implementation of the present invention, one or more genes or proteinscasand two or more CRISPR repeats are obtained from the same cells. In some alternative embodiments implement one or more genes or proteinscasand two or more CRISPR repeats occur naturally in the same cell. In some embodiments, the implementation, the CRISPR spacers derived from an organism different from the cell from which the received one or more genescasand/or two or more CRISPR repeats. In some embodiments, the implementation, the cell is a cell of the recipient or the cell of the host.

In some embodiments, the implementation of one or more genes or proteinscasand/or two or more CRISPR repeats are obtained from the same cells. In some embodiments, implementation, spacers obtained from an organism other than cells containing one or more genes or proteinscasand/or two or more CRISPR repeats.

In some embodiments, the implementation of one or more genes or proteinscasand/or two or more CRISPR repeats naturally meet together in the same cage.

In some embodiments, implementation, modification comprises insertion of one or more CRISPR spacers in the cell. N what are the options for implementation, the modification involves the genetic engineering of CRISPR spacer in the cell. In some embodiments, the implementation, the spacer of the cell has 100% homology with the CRISPR spacer or pseudo CRISPR spacer of the body. In some embodiments, implementation of, the whole or part of the spacer in the cell is modified. In some embodiments, implementation, modification includes modification of recombinant spacer. In some embodiments, implementation, modification occurs through spontaneous mutation or mutagenesis. In some embodiments, the implementation of at least one or more CRISPR spacers in the cell subjected to deletions. In some embodiments, the implementation of one or more genescassubjected to deletions. In some embodiments, implementation, CRISPR and/or one or more genescassubjected to deletions. In some embodiments, the implementation of one or more genes or proteinscasand/or two or more CRISPR repeats subjected to deletions. In some embodiments, implementation of the nucleotide sequence of the genecasand the CRISPR repeat are obtained from the same or different strains. In some embodiments, implementation of the nucleotide sequence of the genecasand the CRISPR repeat are obtained from the same or different types.

In some embodiments, implementation of the nucleotide sequence of the genecasand repeat the and CRISPR obtained from the same or different genera. In some embodiments, implementation of the nucleotide sequence of the genecasand the CRISPR repeat are obtained from the same or different organisms.

In some embodiments, implementation of the present invention, nucleic acid-target bacteriophage is a highly conservative sequence of the nucleic acid. In some embodiments, implementation of nucleic acid-target bacteriophage encodes a protein specificity of the owner. In some other embodiments, implementation of nucleic acid-target bacteriophage encodes a protein that is essential for survival, replication or growth of bacteriophage. In some other embodiments, implementation of nucleic acid-target bacteriophage encodes a helicase, primase, head or tail structural protein, a protein with a conservative domain (for example, Golin, lysine etc) or at least one conservative sequence among the important genes of the phage.

In some embodiments, the implementation, the method for determining the resistance of cells to a nucleic acid target or its products transcription includes the additional step of comparing the sequence of one or more CRISPR spacers in the cell with the sequence of the nucleic acid target. In some alternative embodiments, implementation, SPO is about determining the resistance of cells to a nucleic acid target or its products transcription includes the additional step of determining the profile of the resistance of the cell.

In some embodiments, implementation, culture is a starter culture or probiotic culture.

The present invention also applies to "labeled bacteria, which is resistant to the phage (i.e. insensitive to bacteriophage mutants", "BIM"). In some embodiments, the implementation, the present invention relates to bacteria containing one or more sequences occurring in at least one genome of the bacteriophage, which is integrated into the CRISPR locus of bacteria. Derived from phage sequence provides a label that can be identified by the localization and/or sequence and/or the neighboring sequence.

In some embodiments, the implementation, the present invention relates to duplicated sequences (e.g., duplicated the CRISPR repeats), which are derived from the parent bacterium and also re-integrated, sequentially, simultaneously or essentially simultaneously along with the sequence derived from the genome of the bacteriophage.

In addition, the present invention relates to methods that facilitate the integration of one or more other sequences of the bacteriophage in the CRISPR locus of the bacterial strain. In some embodiments, implementation, integration with other sequences of the BAC is riffage in the CRISPR locus of the bacterial strain is a random phenomenon. Thus, it is not always the same locus of the genome of the bacteriophage, which is integrated into the CRISPR locus of bacteria. However, after its integration, it is saved and, thus, becomes a distinct label for labeling and/or tracking bacteria. Accordingly, one or more of the sequences originating from the genome of the bacteriophage are not only new to the CRISPR locus of the parent bacterium, but also with a tag that is unique for each bacteria. Therefore, the present invention relates to a method of tagging (e.g., marking) and/or the identification of bacteria.

In some embodiments, the implementation, the methods of the present invention are natural and do not produce genetically modified organisms. In some preferred embodiments, the implementation, the present invention relates to a method of tagging bacteria, comprising the stage of: (a) influence of bacteriophage on the parent bacterium; (b) selecting a mutant that is insensitive to phage; (C) comparison of the CRISPR locus or a part thereof from the parent bacterium and the mutant is not sensitive to the bacteriophage; and (d) selection labeled bacteria containing the additional DNA fragment in the CRISPR locus that is not present in the parent bacteria.

The present invention also relates to labeled bacteria obtained from the COI is whether the methods of the present invention. In some embodiments, the implementation, the present invention relates to cell cultures containing at least one labeled bacterial strain. In some embodiments, the implementation, the present invention relates to food product and/or feed containing labeled bacteria, including, without limitation, cell cultures containing such labeled bacteria. The present invention also relates to methods of producing food and/or feed containing at least one labeled bacterial strain. In some embodiments, the implementation, the methods include adding at least one labeled bacterial strain or cell culture to food and/or feed.

The present invention also relates to methods of generating variants of the CRISPR containing stages: (a) influence of bacteriophage on the parent bacterium; (b) selection of bacteria that are resistant to bacteriophage (i.e. the "mutant insensitive to phage"); (C) comparison of the CRISPR locus or a part thereof from the parent bacterium and mutant insensitive to bacteriophage; (d) selection labeled bacteria containing the additional DNA fragment in the CRISPR locus that is not present in the parent bacteria; and (e) identifying and/or cloning and/or sequencing of additional DNA fragment. The present invention targetnode variants CRISPR, obtained with the use described in this application methods. In some particularly preferred embodiments, implementation options CRISPR are resistant to phage mutant strains that have the modified CRISPR locus with additional spacer.

In some additional embodiments, the implementation, the present invention also relates to a method of applying at least one nucleotide sequence obtained or derived from bacteriophage, for marking and/or identification of bacteria, where the nucleotide sequence is integrated within the CRISPR locus of the parent bacterium.

In some embodiments, the implementation, the present invention relates to a method of applying at least one nucleotide sequence of marking and/or identification of bacteria, where the nucleotide sequence is obtained or can be obtained: (a) the influence of bacteriophage on the parent bacterium; (b) selecting a mutant that is insensitive to phage; (C) comparison of the CRISPR locus or a part thereof from the parent bacterium and the mutant is not sensitive to the bacteriophage; and (d) the selection labeled bacteria containing the additional DNA fragment in the CRISPR locus that is not present in the parent bacteria. In yet some additional embodiments, implementation, this is th invention relates to methods of identifying labeled bacteria, includes stage screening bacteria for identification of additional DNA fragment within the CRISPR locus bacteria, as another aspect of the present invention.

In some embodiments, the implementation, the present invention relates to methods of identifying labeled bacteria, comprising the stage of: (a) screening of bacteria for identification of additional DNA fragment in the CRISPR locus; (b) determining the nucleotide sequence of the additional DNA fragment; (C) comparing the nucleotide sequence of the additional DNA fragment with a database of labeled bacteria, received or obtained by the method according to the present invention; and (d) identifying in the database labeled bacteria nucleotide sequence that corresponds to an additional DNA fragment.

In some preferred embodiments, the implementation, the 5' end and/or end 3' of the CRISPR locus of the parent bacterium is compared with the labeled bacteria. In some alternative preferred embodiments, implementation, and compares at least the first CRISPR repeat or first CRISPR spacer (e.g., cor first CRISPR spacer) on the 5' end of the CRISPR locus. In some embodiments, the implementation is compared, at least, the last CRISPR repeat the last CRISPR spacer (e.g., cor the last CRISPR spacer) on the end 3' of the CRISPR locus.

<> In some preferred embodiments, the implementation, the methods of the present invention include stage selection labeled bacteria containing the additional DNA fragment at the 5' end and/or at the end 3' of the CRISPR locus that is not present in the parent bacteria. In some alternative preferred embodiments, implementation, methods, in addition, include impacts on the parent bacterium of two or more bacteriophages or simultaneously, or sequentially. In some embodiments, implementation of the CRISPR locus or part thereof from the parent bacterium and the bacteriophage insensitive to the mutant compared with the amplification of the CRISPR locus or a part thereof from the parent bacterium and/or insensitive to phage mutant. In some particularly preferred embodiments, implementation, amplification is performed using PCR. In some alternative embodiments, the implementation, the CRISPR locus or part thereof from the parent bacterium and the bacteriophage insensitive to the mutant compared with the sequencing of the CRISPR locus or a part thereof from the parent bacterium and/or insensitive to phage mutant. In some preferred embodiments, the implementation, the CRISPR locus or part thereof from the parent bacterium and the bacteriophage insensitive to the mutant compared with the amplification and sequencing of the locus CRIPR or part thereof from the parent bacterium and/or insensitive to phage mutant. In some alternative preferred embodiments, implementation, additional DNA fragment has a length of at least 44 nucleotides. In some additional preferred embodiments, the implementation of the selected labeled bacteria containing two or more additional DNA fragment. In yet some additional embodiments, implementation, additional DNA fragment contains at least one nucleotide sequence that has at least about 95% identity, or preferably 100% identity with the CRISPR repeat in the CRISPR locus of the parent bacterium. In some embodiments, implementation, additional DNA fragment contains at least one nucleotide sequence that has at least about 95% identity, and, in some embodiments, implementation, preferably, about 100% identity with the nucleotide sequence in the genome of the bacteriophage used to select the labeled bacteria. In some embodiments, the implementation, the present invention also includes at least one additional DNA fragment, which contains a first nucleotide sequence and the second nucleotide sequence, where at least one of the nucleotide sequences has about 95% identity, and, in some of which the option exercise, preferably, about 100% identity with the nucleotide sequence in the genome of the bacteriophage used to select the labeled bacteria.

In some embodiments, the implementation, the present invention relates to maternal bacteria that are suitable for use as a crop seed, probiotic cultures and/or food additives. In some embodiments, implementation, maternal bacteria selected from suitable kind, including, without limitation,Escherichia, Shigella, Salmonella, Erwinia, Yersinia, Bacillus, Vibrio, Legionella, Pseudomonas, Neisseria, Bordetella, Helicobacter, Listeria, Agrobacterium, Staphylococcus, Streptococcus, Enterococcus, Clostridium, Corynebacterium, Mycobacterium, Treponema, Borrelia, Francisella, Brucella, Bifidobacterium, Brevibacterium, Propionibacterium, Lactococcus, Lactobacillus, Pediococcus, Leuconostoc andOenococcus.In some embodiments, the implementation, the bacteriophage is selected from a suitable family of viruses, including, without limitation, Corticoviridae, Cystoviridae, Inoviridae, Leviviridae, Microviridae, Myoviridae, Podoviridae, Siphoviridae, and Tectiviridae. In some embodiments, the implementation, the present invention relates to cell cultures that were selected from starter cultures, probiotic cultures and/or food additives. In some particularly preferred embodiments, the implementation, the present invention relates to methods of identifying labeled bacteria, including phase comparison, at least one additional DNA fragment database PEFC is guatelmala bacteriophages and/or database of bacterial sequences.

The present invention also relates to strains of S. thermophilus containing the sequence obtained or derived from bacteriophage, where the sequence contains a CRISPR spacer of the strain DGCC7778 Streptococcus thermophilus, referred to in this description SEQ ID NO:680 (caacacattcaacagattaatgaagaatac; SEQ ID NO:680).

In yet some additional embodiments, the implementation, the present invention relates to strains of S. thermophilus containing the sequence obtained or derived from bacteriophage, where the sequence contains SEQ ID NO:680 below during transcription (e.g., directly below during transcription) of the CRISPR repeat at least one CRISPR locus.

In other embodiments, the implementation, the present invention relates to strains of S. thermophilus containing the sequence obtained or derived from bacteriophage, where the sequence contains SEQ ID NO:680 below during transcription (e.g., directly below during transcription) of the first CRISPR repeat at least one CRISPR locus.

In other embodiments, the implementation, the present invention relates to strains of S. thermophilus containing the sequence obtained or derived from bacteriophage, where the sequence contains a CRISPR spacer (5'-3') from strain DGCC7778 S. thermophilus (tccactcacgtacaaatagtgagtgtactc; SEQ ID NO:681). In yet some additional embodiments, implementation, and present the finding relates to the strains of S. thermophilus containing the sequence obtained or derived from bacteriophage, where the sequence contains SEQ ID NO:681 below during transcription (e.g., directly below during transcription) of the first CRISPR repeat at least one CRISPR locus.

In some embodiments, the implementation of the present invention to the strains of S. thermophilus containing the sequence obtained or derived from bacteriophage, where the sequence contains SEQ ID NO:683:

The CRISPR sequence (5'-3') strain DGCC7710-RH1 Streptococcus thermophilus

In some embodiments, the implementation, the present invention relates to strains of S. thermophilus containing the sequence obtained or derived from bacteriophage, where the sequence contains SEQ ID NO:683 below during transcription (e.g., directly below during transcription) of the first CRISPR repeat at least one CRISPR locus. Strains of S. thermophilus containing the sequence obtained or derived from bacteriophage, where the sequence contains SEQ ID NO:685 (i.e. 5'-TACGTTTGAAAAGAATATCAAATCAATGA-3').

In some embodiments, the implementation, the present invention relates to strains of S. thermophilus containing the sequence obtained or derived from bacteriophage, where the sequence contains SEQ ID NO:685 below to hike transcription (for example, directly below during transcription) of the first CRISPR repeat at least one CRISPR locus.

In some embodiments, the implementation, the present invention relates to methods and compositions that find use in the development and use of combinations of strains and rotations of starter cultures. In some additional embodiments, the implementation, the invention relates to the use of one or more CRISPR BIMs) in the starter cultures. In some other embodiments, the implementation, the invention relates to the use of one or more CRISPR BIMs in a rotational scheme. In some other embodiments, the implementation, the invention relates to the use of one or more combinations of CRISP BIMs in a rotational scheme.

The present invention also relates to a tool for the analysis of CRISPR body of the target to enable comparison of the spacer elements of the sequences with the genome of phage biological control. In some embodiments, the implementation, the present invention relates to a tool for predicting the virulence of phage and selection of at least one phage biological control, at least against one microorganism target.

The present invention also relates to methods and compositions for the use of CRISPR-cas (i.e. natural mutagenesis, in some the x preferred options for implementation) for design, at least one variant resistant to phages CRISPR at least one microorganism of the target, which is then used to generate mutant phage, which transmits the stability of the CRISPR-cas by mutations within the Fig, the corresponding sequence selected from the spacer elements of the sequences, pseudoracemic sequences proximal sequence motifs recognition and so on, to enhance the virulence of the phage. In some preferred embodiments, implementation, phage with enhanced virulence finds application as biological control agents.

In some embodiments, the implementation, the present invention relates to compositions and methods suitable for obtaining phage, with enhanced virulence compared with the parent phage. In some embodiments, the implementation of at least one cloned spacer is introduced into the active locus CRISPR-cas to obtain resistant to the phage variant cells for use in generating mutant phage. In some preferred embodiments, implementation methods include the introduction sequence, which serves as a specific target sequence of the genome of phage (for example, areas that are highly susceptible as a target of the spacer or the follower of the spine of recognition to enable the owner of the spacer). In some additional embodiments, the implementation, the present invention relates to methods and compositions for the direct engineering of phage to the genome sequence corresponding to the spacer, respectively motorolas.

The present invention also relates to methods for the evolution of this phage using acquired resistance CRISPR to the corresponding phage strain-owner to create a more virulent and therefore the effective agent of biological control.

Description of figures

In Fig. 1 schematically shows that the integration of CRISPR spacers in the CRISPR locus of S. thermophilus provides resistance against bacteriophage with which the CRISPR spacer manifests identity. Maternal DGCC7710 sensitive to the phage, and BIM DGCC7710RH1 resistant to the phage. BIM DGCC7710RH1 has a new spacer (Sn) in the CRISPR locus that exhibits 100% identity with the sequence of the phage. As shown in stage (B)strain stimulated by phage 858, and selected resistant to phage mutant. As shown in stage (C), the CRISPR locus 1 mutant has an additional spacer, which has 100% identity with the region 31.921-31.950 base pairs phage.

In Fig. 2 schematically shows that the integration of CRISPR spacers in the CRISPR locus of S. thermophilus provides resistance against bacteriophage with which the CRISPR spacer manifests the identity of the Parent DGCC7710-sensitive phage, and BIM DGCC7710RH2 resistant to the phage. BIM DGCC7710RH2 has a new spacer (Sn) in the CRISPR locus that exhibits 100% identity with the sequence of the phage. As shown in stage (B)strain stimulated by phage 858, and selected resistant to phage mutant. As shown in stage (C), the experiment was independently repeated and selected resistant mutant. The CRISPR locus 1 mutant has an additional spacer (different from those in RH1), which has 100% identity with the region 17.125-17.224 base pairs phage.

In Fig. 3 graphically presents the illustration of the receive construct CASIKO, in which the cas1 gene torn homologous recombination.

In Fig. 4 graphically presents the receipt construct using restriction enzymes to generate the construct RT from the S1S2 construct. There are restriction sitesBglIwithin the loop, which you can cut out the "middle" part. After enzymatic digestion of the ligase used to connect together two end pieces, thereby generating a new construct that has RT, but no spacers.

In Fig. 5 graphically presents the integration of the construct RT.

In Fig. 6 graphically presents the illustration created by genetic engineering of the S1S2 construct using specific primers and repeated PCR reactions. The first panel illustrates the use of a CR is emery and the Protocol for the first two PCR reactions (reaction No. 1 seed P1 and P2 and the reaction of no 2 with primers P2 and P3). On the second panel shows the PCR products obtained from the first two PCR reactions with the reaction product No. 1 on the left and a reaction product No. 2 to the right. The third panel shows a third PCR reaction using a combination of products of the first two PCR reactions as template for a third PCR reaction, and primers P1 first response along with the primer P4 second reaction. The fourth panel shows the PCR product No. 3, which is technically generates the S1S2 construct.

In Fig. 7 graphically presents the details of the structure of the primer to primer 2 and 3, which contain the key sequence for the experiment was obtained from the spacers are identical to the sequences of phage (PCR products obtained from these PCR primers generate the spacers, which will ultimately provide resistance to phages).

In Fig. 8 graphically presents the integration of the S1S2 construct.

In Fig. 9 graphically shows a General view of the CRISPR locus of S. thermophilus, newly acquired spacer in resistant to phage mutants and the corresponding sensitivity to phages. Upstairs is the CRISPR1 locus DGCC7710 (WT, wild type). The repeat region/spacer WT presents in the middle: repeats (black diamonds), the spacers (numbered gray squares), leader (L, white square) and terminal repeat (T, black diamond). In the lower left part shows in detail the contents of the spacer on whether the agreement side of the locus are resistant to phage mutants with newly acquired spacers (white squares, S1-S14). The right shows the sensitivity of each strain to the phage 858 and 2972 histogram efficiency belascoaran (EOR), which represents the ratio of the number of plaques mutant strain to the number of plaques strains wild-type.

In Fig. 10 presents engineering CRISPR spacer, inactivation of the genecasand the corresponding sensitivity to the phage. I, mutant WTF+S1S2II, mutant WTF+S1S2ΔCRISPR1 where CRISPR1 was subjected deletions; III, mutant WTF+S1S2::pR, where CRISPR1 was phased out and replaced with a unique repeat; IV, WTF+S4::pS1S2, the mutant strain WTF+S4where CRISPR was duplicated and replaced with a variant that contains S1 and S2; WTF+S152::pcas5 - inaktivirovannye cas5; VI, WTF+S152::pcas7 - inaktivirovannye cas7. pOR1 indicates inactivated plasmid (12). Sensitivity to phage, each phage in the ratio of phage 858 and 2972 presented in the lower part in the form of a histogram efficiency belascoaran (EOR).

In Fig. 11 shows schematically the construction of the S1S2 construct.

In Fig. 12 schematically shows the structure of WTF+S1S2ΔCRISPR1.

In Fig. 13 presents the combination of the CRISPR spacer S1 with the corresponding genomic region of phage 858 and two mutant phages that escaped resistance to CRISPR strain WTF+S1S2 .

In Fig. 14 schematically shows the structure resistant to phage variant of the first level. Each option has one additional spacer within its CRISPR. Additional spacers are not connected with each other (for example, each has a different sequence). All the spacers come from phage R.

In Fig. 15 schematically shows the second level resistant to phage variants exhibiting increased resistance to phages. Destination options (A1.n and A2.n) derived from strain a and have a coherent integration of additional spacers in the CRISPR, all of the spacers are different from each other and derived from phage R.

In Fig. 16 schematically shows the second level resistant to phage variants exhibiting increased resistance to phages. The final option (A1pqr) comes from strain and is consistent integration of additional spacers in the CRISPR originating from 3 different phages (i.e., from the phage P, Q and R).

In Fig. 17 shows schematically the CRISPR1 locus (panel a) and CRISPR3 locus (panel) strains of S. thermophilus, described in examples 7 to example 16. The names of the strains presented on the left side of the drawing. Black arrows represent the CRISPR repeats, “R” denotes the repetition and “RT” refers to Terminal repeat. Gray arrows, numbered from 1 to 32 in frequent is a and from 1 to 12 in part b represent, respectively, the CRISPR1 spacers and the spacers CRISPR3, as they are in DGCC7710. White arrows, numbered with S4 on S35, are more CRISPR spacers that are specific to the described strains.

In Fig. 18 schematically shows a variant implementation of the present invention, in which the detection sequence and the CRISPR repeat are integrated on one end of the CRISPR locus. Panel a indicates the CRISPR locus and the elements, including repeats (R), the spacer (S), the leader of the above during transcription and trailer below during transcription with limit retry (RT), adjacent to the trailer, and genescasnearby (here, 4 genescascalled fromcas1bycas4drawn not to scale). Genescascan be at either end or be broken down and be present at both ends. In addition, genescascan be localized on either of the two DNA strands. Panel b shows the sequence of the phage with the fragments of the sequence (Sn)is used as an additional spacer (i.e. marking sequence). Panel C shows the insertion of a new spacer (Sn) (i.e., the detection sequence) on one end of the CRISPR locus (close to the leader in this example, the 5' end of the CRISPR locus), between the two repetitions. Panel D presents a comparison of the contents of the CRISPR locus between the parent and mutant bacteria (i.e. labeled bacteria) with the new spacer (Sn) (i.e. mA is kyuusei sequence), integrated on one end of the CRISPR locus (close to the leader in this example)between repetitions. New spacer (Sn) is the marking sequence, which is specific for the mutant bacteria (i.e. labeled bacteria). In some embodiments, implementation, this method adds one or more spacers of the sequence of the phage.

In Fig. 19 presents a schematic representation of a variant of implementation, in which two marker sequences and two CRISPR repeat are integrated on one end of the CRISPR locus. In panel A, (A) specify the CRISPR locus and the elements, including repeats (R), the spacer (S), the leader of the above during transcription and trailer below during transcription with limit retry (RT), adjacent to the trailer, and genescasnearby (here, 4 genescascalled fromcas1bycas4drawn not to scale). Genescascan be at either end or be broken down and be present at both ends. Genescascan be localized on either of the two DNA strands. On the panel In the sequence of the phage is shown in black with two fragments of the sequence (Sn and Sn'), used as an additional spacers (i.e. marking sequences). Panel C shows the insertion of new spacers (i.e. marking sequences (Sn and Sn'), one is m and the same end of the CRISPR locus (close to the leader in this example, the 5'end), each of which lies between two repetitions. Panel D presents a comparison of the contents of the CRISPR locus between the parent and mutant bacteria (i.e. labeled bacteria) with two new spacers (Sn and Sn'), integrated on the same end of the CRISPR locus (close to the leader in this example, the 5'end), each localized between repetitions. New spacers Sn and Sn' are marking sequence, which is specific for the mutant. In some embodiments, implementation, this method adds one or more spacers of the sequence of the phage.

In Fig. 20 shows a graph showing the evolution of the number of phages in milk containing 107CFU/ml D2972 during fermentation with DGCC7710 (black diamonds) or with DGCC9836 (empty squares). Milk was a 10% (mass/V) milk powder in water. The incubation temperature was 42°C.

In Fig. 21 presents a graph showing the evolution of the cumulated number of phage on WTphi2972+S20and WTphi2972+S21milk containing 107CFU/ml D2972 during fermentation inoculated WTphi2972+S20(dashed line) or WTphi2972+S21(light gray), or WTphi2972+S20(dashed line), and WTphi2972+S21(dark gray). Milk was a 10% (mass/V) milk powder in water. Those who incubation temperature was 42°C.

In Fig. 22 presents a Web Logo for motif CRISPR1 NNAGAAW (SEQ ID NO:696).

In Fig. 23 presents the combination of the selected protospatharios CRISPR3 and flanking regions, and web lgo for motif CRISPR3 NGGNG (SEQ ID NO:723). This drawing presents

Description of the invention

The present invention relates to methods and compositions related to the modulation of the resistance of cells to a nucleic acid target product or its transcription. In some preferred embodiments, the implementation, the present invention relates to compositions and methods for applying one or more genes or proteinscasto modulate the resistance of cells to a nucleic acid target product or its transcription. In some preferred embodiments, the implementation, the present invention relates to methods and compositions that find use in the development and application of combinations of strains and rotations of starter cultures. In additional embodiments, the implementation, the present invention relates to a method of marking and/or identification of bacteria. In some preferred embodiments, the implementation, the present invention relates to the use of CRISPR loci to identify potential virulence phage against cells and the use of CRISPR-casto modulate genetic pic is egovernance phage to increase the level of virulence. In some embodiments, the implementation, the present invention relates to a means and compositions for the development and application of phages as biocontrol agents.

Streptococcus thermophilus is a gram-negative bacterial species with low G+C, which is a key species used for fermentation systems dairy cultures to get yogurt and cheese. Comparative genomics analyses of closely related strains of S. thermophilus previously showed that genetic polymorphism primarily occurs in hypervariable loci, such as operons eps and rps, as well as two loci clustered inserted at regular intervals short palindromic repeats (CRISPR) (see, for example, Jansenet al.,Mol. Environ., 43:1565 [2002]; Bolotinet al.,Environ., 151:2551 [2005] Bolotin andet al.,Nat. Biotechnol., 22:1554 [2004]). As described in more detail in this application, the CRISPR loci usually consist of several not related direct repeats, separated by segments of variable sequences called spacers, and often coexist with genescas(associated with CRISPR). Although the function of CRISPR loci biologically not been installed, in silico analyses of the spacers revealed homology sequence with foreign elements, including the sequence of bacteriophages and plasmids (see, for example, provides links to work Bolotin et al., Microbio; Mojica et al. and Pourcel et al.). By relying solely on in silico analyses, there have been several hypotheses, suggesting the role of CRISPR genes andcasthat include providing immunity against foreign genetic elements, through a mechanism based on the interference RNA (see Makarova et al., Biol. Direct., 1:7 [2006]). However, it is not intended that the present invention be limited to any particular mechanism and/or means of action.

Modern strategies that are used in industry to minimize infection by the bacteriophage and the resulting insolvency of bacterial cultures include the application of: (i) mixed starter cultures; and (ii) the use of alternating strains with different profiles of susceptibility to phages (i.e. the rotation of the strains). Traditionally, the starter culture used in the dairy industry, are mixtures of strains of lactic acid bacteria. Complex composition of mixed starter cultures ensures that it provides a certain level of stability. However, repeated subcultivation mixed cultures of strains leads to unpredictable changes in the allocation of individual strains and, ultimately, often to the dominance of undesirable strain. This in turn can lead to increased susceptibility to phage attack and the risk of insolvency is ti fermentation.

Rotation of the selected bacterial strains that are sensitive to different phages, represents another approach, currently used to restrict the development of phages. However, it is difficult and burdensome to identify and select a sufficient number of strains having different profiles pageType to ensure efficient and reliable rotation programs. In addition, continuous use of strains requires careful monitoring to detect new infectious phages and require quick replacement of the infected strain resistant bacterial strain. In industrial plants where large quantities of the main mass of starter cultures get well before use, such quick response is usually impossible. So, there have been several attempts to improve the resistance of crops for use in industry.

In addition, although it would be useful to have a starter culture, which are labeled so that it was possible to determine their origin, it was not done. Indeed, although the possibility of inserting a synthetic oligonucleotide in strain for marking or tagging using recombinant DNA technologies, labeled strain was considered to be a genetically modified organism, and could therefore be faced in legal issues is at an industrial scale applications. Thus, in this area there is a need for natural methods and compositions suitable for introduction into bacteria unusual sequence that could be used for identification and/or tracking of bacteria.

Bacteriophages are the most extensive biological entity (which can be challenged) on the planet (see Breitbart and Rohwer, Trends Environ., 13:278 [2005]). Their widespread distribution and large number have an important impact on microbial ecology and evolution of bacterial genomes (see, Chibani-Chennoufi et al., J. Bacteriol., 186:3677 [2004]). Therefore, bacteria have evolved a variety of mechanisms for natural protection, which are aimed at various stages in the life cycle of phages, significantly blocking the adsorption preventing the injection of DNA, limiting the input DNA and abortive infection systems. These antiviral barriers may also be subjected to genetic engineering and manipulation for the improvement of population control phage (see, for example, Chibani-Chennoufi et al., see above; and (Sturino and Klaenhammer, Nat. Rev. Environ., 4:395 [2006]).

Numerous bacteria were selected by the people and is extensively used for fermentation and bioengineering processes. Unfortunately, domesticated bacteria used in industry, often susceptible to phage attack, including those genera, and species, which are widely used as elochnykh cultures (see Brussiw, Ann. Rev. Environ., 55:283 [2001]). Accordingly, the industry has developed various strategies to combat the phage on the basis of diversity of strains insensitive to bacteriophage mutants and plasmids bearing the mechanisms of resistance to phages.

Definitions

Yet other definitions in this specification, all technical and scientific terms used in this application have the same meaning as commonly understood to the average person skilled in the art to which the present invention is intended. Although the implementation described in this application of the invention find use any methods and materials similar or equivalent to those described in the present application, the present application describes illustrative methods and materials. Unless the context clearly indicates otherwise, as used in this description, the terms in the singular shall include the corresponding plural form. Unless otherwise indicated, nucleic acids are written left-to-right orientation from 5' to 3'; amino acid sequences are written left to right in the orientation from amino to carboxy, respectively. It should be understood that the invention is not limited to described a particular methodology, protocols, and reagents, as they may vary, depending on the account is a hundred, in which they are used by specialists in this field.

It is assumed that every maximum numerical limitation given throughout this description, includes every lower numerical limitation, as if such lower numerical limitation was clearly written in the present description. Each minimum numerical limitation given throughout this description should include each higher numerical limitation, as if such a higher numerical limits have been clearly described in the present description. Each numerical range represented throughout this description should include each a narrower range that falls within such broader numerical range, as if such narrower numerical ranges were clearly described in the present description.

Used in the present description, the term "naturally occurring" refers to the elements and/or process that occurs in nature.

Used in the present description, the term "construct", "conjugate", " cassette" and "hybrid" includes a nucleotide sequence that is directly or indirectly attached to other sequences (e.g., a regulatory sequence such as a promoter). In some embodiments, the implementation, the present invention relates to the instructon, containing the nucleotide sequence is functionally associated with this regulatory sequence. The term "functionally linked" refers to the position of direct mutation and suppressor, which describes the components are in communication, allowing them to function in their intended manner. The regulatory sequence functionally linked" to the coding sequence, legasuite so that was achieved by the expression of the coding gene expression in conditions compatible with the control sequence. Used in the present description, the term "regulatory sequence" includes promoters and enhancers, and other signals regulating the expression. Used in the present description, the term "promoter" is used in the usual sense, understood in this area, for example, the binding site of RNA polymerase. In some embodiments, implementation constructs contain or Express a marker, which provides a choice construct nucleotide sequence, for example, in bacteria. There are different markers that can be used, for example, those markers that provide resistance to antibiotics/antimicrobial agents.

In some embodiments, the implementation, the construct contains a vector (e.g. a plasmid). In some other what their options implementation the present invention relates to a vector containing one or more constructs or sequences described in this application. Used in the present description, the term "vector" includes vectors, expression vectors, transformation and Shuttle vectors. The term "vector transformation" means a construct capable of transfer from one organism to another organism, which may be the same or may represent another species. The constructs that can be transported from one species to another, sometimes referred to as "Shuttle vectors". In some embodiments, the implementation, the vectors are transformed into suitable cell host as described in this application. In some embodiments, implementation, vectors are plasmid or fagbemi vectors provided by the origin of replication, optionally a promoter for the expression of polynucleotide, and optionally a regulator of the promoter. In some embodiments, the implementation, the vectors contain one or more selected marker nucleotide sequences. The most appropriate system selection of industrial microorganisms are those which are formed by a group of selection markers, which do not require mutations in the host organism. In some embodiments, implementation, vectors are used in vitro (EmOC is emer, to obtain RNA or for transfection or transformation of a host cell). In some embodiments, implementation, polynucleotide included in a recombinant vector (usually replicated vector), such as a cloning vector or expression. The vector is used for replication of the nucleic acid in a compatible cell host.

Introduction of nucleic acid (e.g., phage, construct or vector) into a cell can be implemented in different ways. For example, in some embodiments, implementation, can find application transduction, transformation, transfection by calcium phosphate, transfection mediated by DEAE-dextran, transfection mediated by cationic lipid, electroporative, transduction or infection. Indeed, any suitable method known in this field, finds use in the present invention. In some embodiments, implementation, cells containing exogenous nucleic acid introduced via phage construct or vector) is selected to use any suitable method known in this field.

Information about cell transformation is well documented in this area, for example, see Molecular Cloning: A Laboratory Manual, 2nd edition, 1989, Cold Spring HarborLaboratory Press) and Ausubelet al.,Current Protocols in Molecular Biology (1995), John Wiley & Sons, Inc. In the context of the introduction of nuclein the Oh of the acid into the cell, in some embodiments, implementation, preferably, the term "introduction" is meant one or more of the transformation, transfection, conjugation or transduction. In some particularly preferred embodiments, implementation, bacterial strains (e.g., maternal bacterial strains, variant bacterial strains, etc.) "operates"at least one phage, so that the nucleic acid of the phage was introduced into the cells of the bacterial strain.

Used in the present description, the terms "nucleic acid sequence", "nucleotide sequence" and "nucleic acid" refers to any nucleic acid sequence, including DNA, RNA, genomic, synthetic, recombinant (e.g., cDNA). It is assumed that these terms cover a double-strand and/or single-stranded sequence, or representing semantic or the antisense strand, or a combination of both. The sequence of the recombinant nucleic acid is obtained by applying any suitable techniques of recombinant DNA. In some embodiments, the implementation as described in this application, the provided nucleic acid sequence include gene sequences that encode CRISPR, Cas and other sequences. Indeed, as used in the context, the crust is ASEE the invention encompasses nucleic acid sequences, which encode different CRISPR sequences, including, without limitation, the spacers, pseudoseizure, leaders, etc. and sequence cas and other bacterial and phage ("bacteriophobia") nucleic acid sequences.

The terms "nucleic acid molecule encoding," "nucleic acid sequence encoding," "DNA sequence encoding" refers to the order or sequence of deoxyribonucleotides along the threads of deoxyribonucleic acid. The order of these deoxyribonucleotides determines the order of amino acids along the polypeptide (protein) chain. Thus, the DNA sequence encodes the amino acid sequence.

Used in this description in the context of the introduction of amino acid sequence in a cell, the term "introduced" refers to any method suitable for transferring nucleic acid sequence into the cell. Such methods of administration include, without limitation, the merger of protoplast, transfection, transformation, coupled binding and transduction. In some particularly preferred embodiments, the implementation, the nucleic acid is introduced into cells of the recipient after infection of cells with phage (bacteriophage).

In some embodiments, the implementation sequence of the nucleic KIS is from and nucleic acids, provided in the present invention are isolated or substantially purified. By "isolated" or "essentially purified" is meant that the molecules of nucleic acids or their biologically active fragments or variants, homologues or derivatives essentially devoid of components typically found in Association with nucleic acid in its natural state. Such components include, without limitation of other cellular material, culture medium, the materials, the resulting recombinant products, and various chemicals used in the chemical synthesis of nucleic acids.

In some embodiments, the implementation of "isolated" nucleic acid sequence or nucleic acid or usually devoid of nucleic acid sequences that flank the interest of nucleic acid s genomic DNA of the organism from which was obtained a nucleic acid (for example, coding sequences present at the ends of the 5' or 3'). However, the molecule may include some additional grounds or fragments that do not have a damaging impact on the basic characteristics of the composition.

Used in the present description the term "modification" refers to the changes made before the crystals of nucleic acid sequences and/or amino acids. In some embodiments, implementation, modifications are made using genetic engineering methods (e.g., recombinant), while in other embodiments, implementation, modifications are made using naturally occurring genetic mechanisms. It is assumed that all or part of the sequence will be modified using the methods of the present invention. In some preferred embodiments, the implementation of the modified nucleic acid can include one or more naturally occurring or recombinante received CRISPR spacers, genes or proteinscas, CRISPR repeats, the CRISPR loci, as well as nucleic acids of the bacteriophage. Any suitable method known in this field, finds use in the present invention, including, without limitation, the use of PCR, cloning, directed to the site of mutagenesis, etc. Really manufactured kits find use in the present invention. In some embodiments, implementation, use of synthetic oligonucleotides. In some embodiments, implementation, used methods, such as homologous recombination (e.g., insertion or deletion of CRISPR spacers). In some embodiments, implementation of genetic engineering involves the activation of one or more after the euteleostei nucleic acids (e.g., CRISPR loci, CRISPR repeats, CRISPR spacers, cas genes or proteins, or functional combinations of genes cas and CRISPR repeats or combinations thereof).

In some embodiments, the implementation, one or more CRISPR spacers or pseudo CRISPR spacers are inserted, at least one CRISPR locus. In some embodiments, implementation, modification does not interrupt one or more genescasat least one CRISPR locus. In other embodiments implement one or more genescasremain intact. In yet some additional embodiments, implementation, modification does not interrupt one or more CRISPR repeats, at least one CRISPR locus. In some embodiments, the implementation, one or more CRISPR repeats remain intact. In some other embodiments, the implementation, one or more CRISPR spacers are inserted into the CRISPR locus or within at least one CRISPR locus. In some other embodiments, the implementation, one or more spacers or pseudo CRISPR spacers are inserted at the 5'end of at least one CRISPR locus.

In some embodiments, implementation, modification comprises the introduction of at least one CRISPR spacer or pseudo CRISPR spacer in the cell (e.g., a recipient cell). In some other embodiments, implementation, modification comprises the introduction of at least one of the on or more CRISPR spacers or pseudo CRISPR spacers in (for example, for modification or substitution) of one or more CRISPR spacers or a recipient cell. In some embodiments, the implementation, the CRISPR spacer of the cell are the same, while in other embodiments, implementation, they are different. In some embodiments, implementation, modification comprises inserting at least one CRISPR spacer or pseudo CRISPR spacers from the body of a donor in a recipient cell. In some embodiments, other implementation, the modification comprises insertion of one or more CRISPR spacers or pseudo CRISPR spacers from the body of a donor in a recipient cell under conditions suitable for the modification or substitution of one or more CRISPR spacers or pseudo CRISPR spacers cells of the recipient. In some embodiments, the implementation, one or more CRISPR spacers or pseudo CRISPR spacers from the body of the donor is inserted into one or more, preferably, two or more CRISPR repeat cells. In some preferred embodiments, the implementation of at least one functional combination of CRISPR repeat-cas remains intact in the cell.

In some other embodiments, the implement is inserted adjacent to one or more (preferably, two or more spacers or pseudo CRISPR spacers. Used in the present description, the term "adjacent" means "next" in the th broadest sense and includes "directly adjacent" to one or more spacers or pseudo CRISPR spacers cells of the recipient. (i.e., the spacer(s) or pseudo CRISPR-spacer(s) CRISPR inserted so that between the spacers were not intermediate nucleotides).

In other additional embodiments, the implementation, the spacer(s) or pseudo CRISPR-spacer(s) CRISPR is inserted so that it is at least about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50 to about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 200, about 300, about 400, about 500, about 600, about 700, about 800, about 900, about 1000 to about 10000, about 100,000 or about 1000000 or more intermediate nucleotides between the spacers.

In some other embodiments, implementation, intermediate nucleotide referred to as the "leader sequence". In the present description, these terms are used interchangeably. The leader sequence may have a different length in different bacteria. In some embodiments, implementation of the leader sequence has a length of at least about 20, about 25, about 30, about 35, about 40, about 45, about 50 to about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, p is IMEMO 100, about 200, about 300, about 400, or about 500, or more nucleotides. In some preferred embodiments, implementation of the leader sequence is located between the gene ofcas(3') and the first CRISPR repeat (5'end) of the CRISPR locus. In some embodiments, implementation of the leader sequence has a length of about 20-500 nucleotides.

In some embodiments, the implementation, one or more CRISPR spacers or pseudo CRISPR spacers from the donor organism are inserted adjacent to one or more genescascells of the recipient, where genescasare the same or different. In some additional embodiments, the implementation, one or more CRISPR spacers or pseudo CRISPR spacers from the donor organism are inserted adjacent to the same or different spacers cells of the recipient.

In another embodiment, each of one or more CRISPR spacers or pseudo CRISPR spacers such as one or more CRISPR spacers or pseudo CRISPR spacers from the donor organism is inserted adjacent to the same or other CRISPR repeats cells. In another embodiment, each of one or more CRISPR spacers or pseudo CRISPR spacers such as one or more CRISPR spacers or pseudo CRISPR spacers from the donor organism is inserted adjacent to the ne and the same or other genes cascells of the recipient.

In some other embodiments, the implementation, the sequence of one or more CRISPR spacers from the donor organism are provided in the conditions under which the cell-recipient is modified such that the CRISPR spacer has homology with the CRISPR spacer or pseudo CRISPR spacer of the donor organism. In some embodiments, the implementation, the CRISPR spacer has 100% homology with the CRISPR spacer of the donor organism.

In some embodiments, the implementation, the spacer(s) CRISPR or pseudo CRISPR spacers contain DNA or RNA of genomic, synthetic or recombinant origin. In some embodiments, the implementation, the spacer(s) CRISPR or pseudo CRISPR spacers are double-strand, whereas in other embodiments, implementation, they are single-stranded, representing either the sense or antisense strand or combinations thereof. It is envisaged that the spacer(s) CRISPR or pseudo CRISPR spacers should be obtained using techniques of DNA (e.g., recombinant DNA), as described in this application.

In some embodiments, implementation, modification comprises insertion of one or more CRISPR spacers or pseudo CRISPR spacers from the body of the donor, which is essentially resistant to the nucleic acid target or products of transcription in one or more loci CRISR essentially sensitive cells. In some embodiments, the implementation, the insertion occurs in the field or between the functional combination of at least two CRISPR repeats and at least one genecasessentially in the sensitive cell. In some embodiments, implementation, modification includes modification (e.g., mutation) cells of the recipient (for example, plasmid DNA or genomic DNA), so that one or more genescascreated in a cell's DNA. In some embodiments, implementation, genescascloned in a construct, a plasmid or vector, etc. which is then transformed into the cell using any suitable method.

In some embodiments, implementation, modification includes modification (e.g., mutation) of the DNA-recipient (for example, such as DNA plasmids or genomic DNA), so that one or more, preferably, two or more CRISPR repeats are created in the DNA of cells. In some embodiments, implementation, CRISPR repeats cloned in a construct, a plasmid or vector, etc. which is then transformed into the cell using a suitable method.

In some embodiments, implementation, modification includes modification (e.g., mutation) of the DNA-recipient (for example, DNA plasmids or genomic DNA), so that one or more functional combinations cas-CRISPR repeats mouthbut cloned into a construct, plasmid or vector, which is then transformed into the cell using a suitable method.

In some embodiments, implementation, modification includes modification (e.g., mutation) of the DNA-recipient (for example, DNA plasmids or genomic DNA), so that one or more CRISPR spacers are created in the DNA of cells. In some embodiments, the implementation, the CRISPR spacers may be cloned into a construct, a plasmid or vector, which is then transformed into the cell using a suitable method. In some embodiments, the implementation, the CRISPR spacer planiruetsja two CRISPR repeats (i.e., the CRISPR spacer has at least one CRISPR repeat on each side).

In some embodiments, implementation, modification comprises insertion of one or more CRISPR spacer (e.g., heterologous CRISPR spacers) near (for example, adjacent or directly adjacent) to one or more genescasand/or leader sequence. Thus, in some embodiments, implementation, organization of naturally occurring CRISPR locus is maintained after insertion of one or more CRISPR spacers.

Used in the present description, the term "nucleic acid target" refers to any nucleic acid sequence or product of its transcription, the resistance to which the cage (e.g., the cell-recipient) is modulated. In some embodiments, implementation, resistance directed against the nucleic acid sequence target. Mainly, it gives stability to the cage to the body of the donor, which can be obtained nucleic acid-target (nucleic acid-target). Thus, in some embodiments, implementation, inserting a pseudo CRISPR spacer derived from bacteriophage, or spacers (spacers) CRISPR, which (who) is / are complementary or homologous to one or more pseudo-spacer (the spacer) CRISPR, into a recipient cell, confers resistance to bacteriophage. Thus, in some preferred embodiments, implementation, inserting between the two CRISPR repeats pseudo CRISPR spacer derived from bacteriophage, or spacers (spacers) CRISPR, which (who) is / are complementary or homologous to one or more pseudo-spacer (the spacer) CRISPR, into a recipient cell, confers resistance to bacteriophage. In another aspect, is provided a method of modulating the stability of the cells of the recipient to the nucleic acid or the product of its transcription.

The present invention also relates to a method of determining the profile of resistance of cells to a nucleic acid target. Used in this op is sanija the term "profile of sustainability" means one or more entities, which is resistant or sensitive cell. Accordingly, in some embodiments, the implementation, the profile of sustainability cells reflects that the cell is resistant to the first bacteriophage sensitive to the second bacteriophage resistant to the first mobile genetic element and sensitive to the first gene of resistance to antibiotics, etc.

In some embodiments, implementation, identifies and/or sequeiros one or more genes or proteinscasCRISPR, one or more CRISPR repeats, one or more genescasone or more functional combinationscas-CRISPR repeats, one or more CRISPR spacers and/or one or more CRISPR spacers, etc. inside the cell in order to predict/determine the likely profile of sustainability of a given cell. In some embodiments, implementation, identifies and/or sequeiros one or more CRISPR spacers inside the cell in order to predict/determine the likely profile of sustainability of a given cell. Suitable methods of detection include, without limitation, PCR, hybridization DNA-DNA hybridization, DNA-RNA, DNA microarray, etc. Really, it is assumed that any suitable method can be used in the present invention. In additional embodiments, the implementation, the likely profile of sustainability specific bacterial the Noah cells to one or more bacteriophages used as a factor the forecast of lithotype for microbial selection. In some additional embodiments, the implementation of one or many genesCasand/or one or more CRISPR repeats sequeiros in addition to one or more CRISPR spacers for verification of compatibility of combination genecas-CRISPR repeat or to identify new pairs of compatible combinationscas/redo.

Used in the present description, the term "modulating the stability" refers to the inhibition, reduction, reduction, induction, giving, restoration, elevation, increase, or other effect on the resistance of cells to a nucleic acid target, as taken in the context.

Used in the present description, the term "sustainability", is not intended to be meaning that the cell is 100% resistant to nucleic acid target product or its transcription.

Used in the present description, the term "resistance to nucleic acid target product or its transcription" means that the resistance is given to the cell or organism (e.g., phage), which contains or produces a nucleic acid target or the product of its transcription. In some embodiments, implementation of the minimum component required to give immunity or resistance to nucleic acid target product or its transcription represents at least one cas gene (or one Bel is to Cas) and at least two CRISPR repeat flanking the spacer.

In some embodiments, the implementation, the present invention relates to methods for modulating (e.g., giving or increasing) the resistance of cells to a nucleic acid target product or its transcription, which includes stages: identification sequence (e.g., conserved sequence) in the body (preferably, a sequence that is essential for the function or survival of the organism); get CRISPR spacer, which contains a sequence homologous (e.g., 100% identical) to the identified sequence; obtaining a nucleic acid that contains at least one genecasand at least two CRISPR repeat with the CRISPR spacer; and (iv) transforming cells of nucleic acid, thus, to make the cell resistance to the nucleic acid target or to the product of its transcription.

Used in the present description, the term "conservative sequence" in the context of the identification of conserved sequence in an organism does not have to be conserved in the literal sense, because sufficient knowledge of one sequence of this organism. In addition, the sequence does not have to be part of an important entity. One is about in some embodiments, implementation, conservative sequence is a sequence that is essential for the function and/or survival and/or replication and/or infectivity, and the like of an organism or cell. In some embodiments, implementation, conservative sequence contains a helicase, primase. Head or tail structural protein, a protein with a conservative domain (for example, holing, lysine, etc.), or conservative sequence among the important genes of the phage.

In some other embodiments, the implementation, the present invention relates to methods for modulating (e.g., giving or increasing) the resistance of cells to a nucleic acid target product or its transcription, which includes stages: identifying one or more CRISPR spacers in an organism resistant to the nucleic acid target product or its transcription, preparation of recombinant nucleic acid containing at least one genecasand at least two CRISPR repeat together with the identified one or more spacers; and transformation of cells a recombinant nucleic acid, thus, to make the cell-recipient of resistance to nucleic acid target or to the product of its transcription.

In some embodiments, the implementation, the present invention relates to an str is obam to modulate (e.g., giving or increasing) the resistance of cells containing at least one or more genes or proteinscasand one or more, preferably, two or more CRISPR repeats to the nucleic acid target product or its transcription, which includes stages: identifying one or more CRISPR spacers in an organism resistant to the nucleic acid target product or its transcription; and modifying the sequence of one or more spacers (spacers) CRISPR in the cell so that the spacer(s) CRISPR had homology to the spacer (spacer) CRISPR in the body. In some embodiments, the implementation, one or more CRISPR spacers in the cell-modified recipient (for example, by genetic engineering methods) so that the spacer(s) CRISPR had homology with one or more spacers (spacers) CRISPR in the body of a donor that is essentially resistant to nucleic acid target product or its transcription, to give the cell resistance to the nucleic acid target. In some preferred embodiments implement one or more genes or proteinscasand one or more, preferably, two or more CRISPR repeats in the cell represent the functional combination, as described in the present application.

Methods of genetic engineering include suitable methods known in this field, in the including without limitation adding (for example, insert), deletions (e.g., deletion or modification (e.g., mutation) of a sequence of one or more CRISPR spacers and/or one or more pseudo CRISPR spacers in the cell so that the CRISPR spacer had homology (for example, increased homology after genetic engineering) with one or more CRISPR spacers of the body donor. This phase of engineering leads to the production of cells, which is essentially sensitive to a nucleic acid target product or its transcription, being resistant to nucleic acid target product or its transcription.

In some additional embodiments, the implementation, the present invention relates to a method of reducing or decreasing the resistance of cells to the recipient that contains one or more genes or proteinscasand one or more, preferably, two or more CRISPR repeats to the nucleic acid target product or its transcription.

In some embodiments, implementation methods include stages: identifying one or more CRISPR spacers in an organism that is essentially resistant to nucleic acid target product or its transcription; and modifying the sequence of at least one or more spacer(s) CRISPR in the cell so that the spacer(s) CRISPR had reduced the degree of homology with what pasuram (spacers) CRISPR in the body.

In other embodiments, implementation, methods of modulating (e.g., decrease) the resistance of cells containing one or more genes or proteinscasand one or more, preferably, two or more CRISPR repeats to the nucleic acid target product or its transcription stage include: identification of CRISPR spacer or pseudo CRISPR spacers in an organism containing a nucleic acid target or the product of its transcription, the resistance of which should be modulated; and identification of CRISPR spacer in the body, which must be modulated sustainability; and (iii) adaptation sequence of the CRISPR spacer in the body, which must be modulated resistance, so that the CRISPR spacer had a lower degree of homology to the CRISPR spacer or pseudo CRISPR spacer of the body containing the nucleic acid target or the product of its transcription, the stability of which must be modulated.

One or more CRISPR spacers in fact, a sustainable cell subjected to genetic engineering to make the cell sensitivity to the nucleic acid target. Methods of genetic engineering, which can be used include, without limitation adding (e.g., insertion), deletion (e.g., deletion or modification of one or more functional combinations of CRISPR repeat-cas or their parts or fra the cops in essentially stable cell and/or addition (for example, insert), deletions (e.g., deletion or modification of one or more CRISPR spacers or parts thereof, or fragments essentially stable cell. This stage engineering leads to the production of cells, which is essentially resistant to nucleic acid target product or its transcription, becoming essentially sensitive to the nucleic acid target product or its transcription.

In some embodiments, implementation, to enhance sensitivity of the cell, it is envisaged that one or more CRISPR spacers, one or more cas genes, one or more, preferably, two or more CRISPR repeats and/or one or more functional combinations of CRISPR repeat-cas from essentially stable cells will be removed, subject to deletions or modified so that more was not given to sustainability. In some embodiments, implementation, cells that are sensitive to nucleic acid or the product of its transcription, get to their levels within a given culture (e.g., starter culture) could optionally be modulated (e.g. reduced). Thus, in some embodiments, implementation, developed starter culture containing two or more bacterial strains, so that all members of the culture were sensitive to the same agent (for example, about the wounded and the same bacteriophage). Thus, when the time comes when more desirable to culture was alive, the culture is in contact with the same single agent for the destruction of all members of the culture. In some embodiments, the implementation, the sensitivity of cells is modulated to one or more agents (e.g., phage), so that the agent was destroyed only a certain proportion of cells in the culture (for example, about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, or about 95% of the cells in culture).

In some embodiments, implementation, cell-recipient undergoes genetic engineering so that it contains a CRISPR spacer or the sequence corresponding to the pseudo CRISPR spacer, thereby making the cell resistant to a nucleic acid target product or its transcription. The cell is appropriately subjected to genetic engineering so that the CRISPR spacer or the sequence corresponding to the pseudo CRISPR spacer was used together with the functional combination of CRISPR repeat-cas, as described in this application.

In some embodiments, the implementation, the cell is resistant to the nucleic acid target product or its transcription is subjected to genetic engineering so that the CRISPR spacer, giving immunity against nucleic acid-target or p is of oduct its transcription, was inserted into the cell, which contains a functional combination of CRISPR repeat-cas, thereby making the cell resistant to a nucleic acid target product or its transcription.

In some other embodiments, the implementation is a sequence of one or more CRISPR spacers or pseudo CRISPR spacers cells, which are resistant to nucleic acid target product or its transcription. Then the cell-recipient undergoes genetic engineering so that it contained the sequence of the CRISPR spacer and functional combination of CRISPR repeat-cas, thereby making the cell resistant to a nucleic acid target product or its transcription.

In some additional embodiments, implementation, get the CRISPR spacer of the cell recipient and functional combination of CRISPR repeat-cas in the same or another cell (for example, the same or a different cell-recipient). Then another cell-recipient undergoes genetic engineering so that it contained the sequence of the CRISPR spacer and functional combination of CRISPR repeat-cas, thereby making the cell resistant to a nucleic acid target product or its transcription.

In some embodiments, implementation, resistance directed against the product of transcription of a sequence of nucleic acid to the slots of the target (for example, transcript sequence of the nucleic acid target, in particular, RNA or mRNA), transcript (e.g., transcript of sense and antisense RNA) or the product of transcription of the polypeptide. In some embodiments, implementation, this gives the cell resistance against the donor organism from which the product of transcription.

In some embodiments, the implementation, the nucleotide sequence of a target contains DNA or RNA of genomic, synthetic or recombinant origin. In some other embodiments, implementation of, the nucleotide sequence is a double-strand, whereas in another embodiment, it is single-stranded, presenting or sense or antisense strand or combinations thereof. In some embodiments, the implementation, the nucleotide sequence is the same as a naturally occurring form, while in other embodiments, implementation, she obtained from her. In some embodiments, the implementation, the sequence of a target nucleic acid derived from a gene. In some other embodiments, the implementation, the sequence of a target nucleic acid derived from a variant, homologue, fragment or derivative of a gene. In some preferred embodiments, implementation, nucleic acid sequence-target obtained from the tank is of eritage. In some preferred embodiments, implementation, nucleic acid sequence-target obtained from DNA plasmids. In some preferred embodiments, implementation, nucleic acid sequence-target derived from mobile genetic element. In some additional embodiments, implementation, nucleic acid sequence-target received from the roaming element or sequence of the insert. In other additional embodiments, implementation, nucleic acid sequence-target derived from a gene that confers resistance. In some other embodiments, implementation, nucleic acid sequence-target derived from a gene, which confers resistance to the antibiotic or antimicrobial agent. In some preferred embodiments, implementation, nucleic acid sequence-target derived from the virulence factor. In some additional embodiments, implementation, nucleic acid sequence-target derived from a toxin, internalin or hemolysin.

In some preferred embodiments, implementation, nucleic acid sequence-target or the product of its transcription obtained from one or more bacteria. Thus, in some preferred embodiments, implementation, sustainability of bacterial cells is modulated and the use of methods and compositions of the present invention. In some preferred embodiments, implementation, nucleic acid sequence-target derived from a gene associated with resistance to the transfer of plasmids in bacteria. In some embodiments, the implementation, one or more CRISPR spacers in the cell are modified so that the CRISPR spacer of the cell had homology to the CRISPR spacer and/or pseudo CRISPR spacer contained in the DNA plasmids of bacterial cells, thereby providing resistance against specific plasmids (plasmids). This prevents the transfer of foreign DNA into the cell. In some preferred embodiments, implementation, target specific areas within the DNA plasmids in order to provide immunity against DNA plasmids. For example, in some embodiments, implementation, target sequences within the origin of replication of plasmids or sequences within genes encoding replication proteins.

In some embodiments, the implementation, the present invention relates to a method, which includes stages: identification of CRISPR spacer or pseudo CRISPR spacer obtained from DNA plasmids the bacterial cell wall, against which must be modulated resistance; and modifying the sequence of the CRISPR spacer in the cell, which must be modulated resistance to SP is user CRISPR had homology to the CRISPR spacer and/or pseudo CRISPR spacer, contained in DNA plasmids the bacterial cell.

In some embodiments, the implementation, the present invention relates to a method of imparting resistance against the cage transfer plasmids, which includes stages: identification of CRISPR spacer and/or pseudo CRISPR spacer obtained from DNA plasmids; identifying one or more functional combinations of CRISPR repeat-cas gene in the cell, which is essentially sensitive to the plasmid; and genetic engineering of one or more CRISPR loci in essentially sensitive cell so that they contain one or more CRISPR spacers and/or pseudo CRISPR spacers from the plasmid, thereby making the cell resistant.

In some embodiments, the implementation, the nucleotide sequence of a target obtained from a gene associated with resistance to one or more mobile genetic elements. In some embodiments, implementation, specific CRISPR spacers and/or pseudo CRISPR spacers derived from one or more mobile genetic elements, are added within the CRISPR locus of the cells in order to provide resistance against mobile genetic elements (for example, floating elements and sequence of the inserts), thus preventing the transfer of foreign DNA and genetic drift. In some embodiments, the wasp is estline, targets are specific areas within the transposon sequences and inserts in order to provide immunity against mobile genetic elements. For example, in some embodiments, implementation, targets include, without limitation conjugative the transposon (Tn916), class II transposons (Tn501), sequence insertions (IS26) and genes trespass.

In some embodiments, the implementation, the present invention relates to a method, which includes stages: identification of CRISPR spacer and/or pseudo CRISPR spacer derived from one or more mobile genetic elements of the cell, against which must be modulated stability, and modification of the CRISPR spacer in the cell, which must be modulated resistance, so that the CRISPR spacer and/or pseudo CRISPR spacer of the cell had homology to the CRISPR spacer contained in the mobile genetic element (elements) of the cell.

In some embodiments, the implementation, the present invention relates to a method of imparting resistance cell against one or more mobile genetic elements, which includes stages: identification of CRISPR spacer and/or pseudo CRISPR spacer derived from one or more mobile genetic elements; identifying one or more functional combinations of CRISPR repeat-cas gene in the cell, to ora essentially sensitive to one or more mobile genetic elements; and genetic engineering of one or more CRISPR loci in essentially sensitive cell so that they are contained or had homology to one or more CRISPR spacers and/or pseudo CRISPR spacers from one or more mobile genetic elements, to give the cell stability.

In some embodiments, the implementation, the nucleotide sequence of a target obtained from a gene associated with resistance to antibiotics and/or antimicrobial agents. Used in the present description, the term "antimicrobial" refers to any composition that kills or inhibits the growth or reproduction of microorganisms. It is assumed that the term includes antibiotics (i.e. composition produced by other microorganisms), as well as synthetically produced compositions. Genes of resistance to antimicrobial agents include, without limitationblatem, blarob, blashv, aadB, aacCl, aacC2, AASS, aacA4, mecA, vanA, vanH, vanX, satA, aacA-aphH, vat, vga, msrA, suland/orint. Genes of resistance to antimicrobial agents include, without limitation to the generaEscherichia, Klebsiella, Pseudomonas, Proteus, Streptococcus, Staphylococcus, Enterococcus, HaemophilusandMoraxellamobile genetic elements. Genes of resistance to antimicrobial agents also include genes that are derived from bacterial species, including the ez restrictions Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Proteus mirabilis, Streptococcus pneumoniae, Staphylococcus aureus, Staphylococcus epidermidis, Enterococcus faecalis, Staphylococcus saprophyticus, Streptococcus pyogenes, Haemophilus influenzae and Moraxella catarrhalis. In some embodiments, implementation, specific CRISPR spacers and/or pseudo CRISPR spacers derived from genes encoding resistance to antimicrobial agents, are added within the CRISPR locus of the cells of the recipient in the conditions under which prevents gene transfer of resistance to antimicrobial agents (i.e. markers). In some embodiments, the implementation of the targets also include vanR, (i.e. resistance to vancomycin), tetR (i.e. resistance to tetracycline and/or stability factors, which provide resistance to beta-lactamase.

In some embodiments, the implementation, the present invention relates to a method comprising the stage of: identifying one or more CRISPR spacers and/or pseudo CRISPR spacers derived from a cell that contains one or more genes of resistance to antimicrobial agents or markers; and modifying the sequence of the CRISPR spacer in the cell that does not contain or does not expresses genes of resistance to antimicrobial agents or markers, so that the CRISPR spacer of the cell had homology to one or more CRISPR spacers and/or pseudo CRISPR spacers contained in the cell, which will gain one or more genes of resistance to antimicrobial agents.

In some embodiments, the implementation, the present invention relates to methods of modulating the acquisition of markers of resistance to antimicrobial agents in cells, comprising the stage of: identifying one or more CRISPR spacers and/or pseudo CRISPR spacers derived from a cell that contains one or more genes of resistance to antimicrobial agents or markers; identifying one or more CRISPR loci in the cell that does not contain or does not expresses genes of resistance to antimicrobial agents or markers; and modifying the sequence of the CRISPR spacer in the cell that does not contain or does not expresses genes of resistance to antimicrobial agents or markers so that the CRISPR spacer and/or pseudo CRISPR spacer had homology to the CRISPR spacer contained in the cell resistant to the transfer of genes giving resistance to one or more antimicrobial agents.

In some embodiments, the implementation, the nucleotide sequence of a target received at least one gene associated with the factor (factors) virulence. In some embodiments, implementation, specific CRISPR spacers and/or pseudo CRISPR spacers derived from the genes encoding virulence factors, are added within the bacterial CRISPR locus for ensuring that the Oia resistance gene transfer, giving the virulence of the bacteria. In some embodiments, implementation, targets are the factors that usually contribute to microbial virulence (e.g., pathogens), such as toxins, internally, hemolysins and other virulence factors.

The present invention also relates to a method comprising the stage of: identifying one or more CRISPR spacers and/or pseudo CRISPR spacers derived from a cell that contains one or more virulence factors; and modifying the sequence of the CRISPR spacer in the cell that does not contain or does not expresses the factor(s) virulence, so that the CRISPR spacer of the cell had homology to one or more CRISPR spacers and/or pseudo CRISPR spacers contained in the cell, which contains one or more virulence factors.

In some embodiments, the implementation, the present invention relates to a method of making the cell resistance to one or more factor (s) virulence marker (markers), which includes stages: identifying one or more CRISPR spacers and/or pseudo CRISPR spacers derived from one or more factor (s) virulence or token (token); identifying one or more functional combinations of CRISPR repeat-casin the cell, with which the society is sensitive to one or more factor (factors) virulence or marker (markers); and genetic engineering of one or more CRISPR loci in essentially sensitive cell so that they include one or more CRISPR spacers and/or pseudo CRISPR spacers from one or more factor (s) virulence marker (markers) to give the cell stability.

The present invention encompasses the use of their variants, homologues, derivatives and fragments, including variants, homologues, derivatives and fragments of CRISPR loci, CRISPR spacers, pseudo CRISPR spacers, genes or proteins cas, CRISPR repeats, functional combinations of CRISPR repeat-cas gene, sequences of target nucleic acids or products of their transcription.

Used the term "variant" is used to refer to a naturally occurring polypeptide or a nucleotide sequence which differs from the sequence of the wild type.

The term "fragment" indicates that the polypeptide or the nucleotide sequence contains a fraction of the sequence of the wild type. It may contain one or more large contiguous segments of a sequence, or many small segments. The sequence may also contain the elements of a sequence, for example, it can represent a hybrid protein with another protein. Preferably, the sequence contains at least 50%, preferably at least 65%, preferably at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 96%, preferably at least 97%, preferably at least 98%, most preferably at least 99% sequence wild-type.

Preferably, the fragment retains 50%, preferably 60%, preferably 70%, preferably 80%, preferably 85%, preferably 90%, preferably 95%, preferably 96%, preferably 97%, preferably 98% or, most preferably, 99% of the activity of the polypeptide or the nucleotide sequence of the wild type.

Preferably, the CRISPR spacer or pseudo CRISPR spacer contains at least 50%, preferably at least 65%, preferably at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 96%, preferably at least 97%, preferably at least 98%, most preferably at least 99% sequence wild-type. Preferably, the CRISPR spacer saves 50%, preferably 60%, preferably 70%, preferably 80%, predpochtitel is it 85%, preferably 90%, preferably 95%, preferably 96%, preferably 97%, preferably 98% or, most preferably, 99% of the activity of the polypeptide or the nucleotide sequence of the wild type.

Preferably, the gene ofcassaves at least 50%, preferably at least 65%, preferably at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 96%, preferably at least 97%, preferably at least 98%, most preferably at least 99% sequence of the wild type. Preferably, the CRISPR spacer saves 50%, preferably 60%, preferably 70%, preferably 80%, preferably 85%, preferably 90%, preferably 95%, preferably 96%, preferably 97%, preferably 98% or, most preferably, 99% of the activity of the polypeptide or the nucleotide sequence of the wild type.

Preferably, the protein iscassaves at least 50%, preferably at least 65%, preferably at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 96%, preferably by at least 97%, preferably at least 98%, most preferably at least 99% sequence of the wild type. Preferably, the protein cas saves 50%, preferably 60%, preferably 70%, preferably 80%, preferably 85%, preferably 90%, preferably 95%, preferably 96%, preferably 97%, preferably 98% or, most preferably, 99% of the activity of the polypeptide or the nucleotide sequence of the wild type.

Preferably, the CRISPR repeat retains at least 50%, preferably at least 65%, preferably at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 96%, preferably at least 97%, preferably at least 98%, most preferably at least 99% sequence of the wild type. Preferably, the CRISPR spacer saves 50%, preferably 60%, preferably 70%, preferably 80%, preferably 85%, preferably 90%, preferably 95%, preferably 96%, preferably 97%, preferably 98% or, most preferably, 99% of the activity of the polypeptide or the nucleotide sequence of the wild type.

Preferably, the functional combination of CRISPR repeat-caswith ranae, at least 50%, preferably at least 65%, preferably at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 96%, preferably at least 97%, preferably at least 98%, most preferably at least 99% sequence of the wild type. Preferably, the functional combination of CRISPR repeat-cassaves 50%, preferably 60%, preferably 70%, preferably 80%, preferably 85%, preferably 90%, preferably 95%, preferably 96%, preferably 97%, preferably 98% or, most preferably, 99% of the activity of the polypeptide or the nucleotide sequence of the wild type.

Preferably, the sequence of the target nucleic acid retains at least 50%, preferably at least 65%, preferably at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 96%, preferably at least 97%, preferably at least 98%, most preferably at least 99% sequence wild-type. Preferably, the sequence-target nukleinovokisly saves 50%, preferably, 60%, preferably 70%, preferably 80%, preferably 85%, preferably 90%, preferably 95%, preferably 96%, preferably 97%, preferably 98% or, most preferably, 99% of the activity of the polypeptide or the nucleotide sequence of the wild type.

In some embodiments, the implementation, the fragment is a functional fragment. Under the "functional fragment" of a molecule is meant a fragment preserves or having essentially the same biological activity as the intact molecule, In all cases, the fragment molecule retains at least 10%, at least about 25%, about 50%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%or about 99% of the biological activity of the intact molecule.

The term "homologue" means an entity having a certain homology with discuss amino acid sequences and discuss nucleotide sequences. In the present description, the term "homology" is equivalent to "identity".

In the present context, a homologous sequence is taken with the inclusion of the amino acid sequence which may be at least 75, 85 or 90% identical, preferably at measures which, on 95%, 96%, 97%, 98% or 99% identical to discuss the sequence. Although homology can also be considered from the point of view of the analogy (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention, it is preferable to Express the homology from the point of view of the identity of the sequence.

In the present context, a homologous sequence is taken with the inclusion of nucleotide sequence which may be at least 75, 85 or 90% identical, preferably at least 95%, 96%, 97%, 98% or 99% identical to discuss the sequence. Although homology can also be considered from the point of view of the analogy (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention, it is preferable to Express the homology from the point of view of the identity of the sequence.

Comparison of homology can be done visually, or more common, using the public programs of sequence comparison. These commercially available computer programs can calculate % homology between two or more sequences.

Percentage (%) homology can be calculated from related sequences (i.e. one sequence is combined with the other sequence and each amino is islote in the sequence is directly compared with the corresponding amino acid in the other sequence, every once in a single residue). This is called a combination of "no gaps". Usually, such alignments without gaps performed only by a relatively small number of residues.

Although this is a very simple and consistent way, it does not take into account that, for example, identical to other parameters pair, one insertion or deletion will cause the exception of alignment, thus possibly leading to a significant reduction % homology when the full alignment. Therefore, most of the comparisons are designed for optimal alignments that take into account the possible insertions and deletions without unnecessary reduction in overall scoring homology. This is achieved by inserting "gaps" in the alignment of sequences with the attempt to maximize local homology.

However, these more complex methods intend "penalties for gaps, each gap, which occurs when combined, so that for the same number of identical amino acids, a combination of sequences as much as possible with a small number of gaps, reflecting a higher relationship between the two compared sequences to reach a higher scoring than sequences with many gaps. "The cost of affine gaps" is typically used to implement relatively high penalties for things is a pressing gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used scoring system gaps. High penalties for gaps, of course, will give you an optimized alignment with fewer gaps. Most programs combine to provide the possibility of modifying penalties for gaps. However, it is preferable to use default values when using such software for comparing sequences. For example, when using a software package GCG Wisconsin Bestfit, the penalty for gaps default for amino acid sequences is -12 for the gap and -4 for each protruding end.

Therefore, the calculation of the maximum percent homology, first, requires optimal alignment with regard to penalties for gaps. A suitable computer program for carrying out such combination is a software package GCG Wisconsin Bestfit (Wisconsin University, USA; Devereux et al., 1984, Nucleic Acids Research 12:387). Examples of other software that can perform the comparison of sequences include, without limitation software packages BLAST (see Ausubel et al., 1999, ibid - Chapter 18), FASTA (Atschul et al., 1990, J. Mol. Biol., 403-410), a set of benchmarking tools GENEWORKS and CLUSTAL. And BLAST and FASTA are available for offline search and search in real time (see Ausubel et al., 1999, ibid, page 7 through 58 to 7-60). But not the which applications preferably using the GCG program Bestfit. The tool, called BLAST 2 Sequences, you have to compare protein and nucleotide sequence (see FEMS Environ Lett 1999 174(2): 247-50; FEMS Environ Lett 1999 177(1): 187-8).

Although the final % homology can be measured from the point of view of identity, the process of alignment is usually not based on the comparison of pairs according to the principle "all or nothing". Instead, it is generally used scoring matrix scoring of similarity, which determines the scores for each pairwise comparison on the basis of chemical similarity or evolutionary distance. An example of such a commonly used matrix is the matrix BLOSUM62 matrix default set of programs BLAST. In the programs of the GCG Wisconsin in General are public or default values, or when delivered, customized table of character comparisons (additional details provided in the application guide). For some applications, preferably using a public default values for the GCG package. Or if using other software, matrix default - such as BLOSUM62.

After the software gave the best combination, it is possible to calculate % homology, preferably, percent identity of the sequences. The software usually does this as part of the cf is Vania sequences and generates a numeric result.

If there are penalties for gaps when determining the identity of the sequence, then you can use the following options:

For BLAST
Outdoor gap0
The gap continued0

For CLUSTALDNAProtein
Word size21To triple
The penalty for gaps1010
The gap continued0,10,1

For comparison of polypeptide sequences can be used in the following structures: the punishment for creating the gap of 3.0 and the penalty for gap continued to 0.1. The degree of identity in relation to the amino acid sequence can be determined, at least 5 contiguous amino acids, to determine, at least, is about 10 contiguous amino acids, at least 15 contiguous amino acids, at least 20 contiguous amino acids, at least 30 contiguous amino acids, at least 40 contiguous amino acids, at least 50 contiguous amino acids, or at least 60 contiguous amino acids. The sequence may also have deletions, insertions or substitutions of amino acid residues which produce a silent change and result in a functionally equivalent substance. Deliberate amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or amputations nature of the residues, while preserving the activity of secondary binding substances. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine and tyrosine.

Conservative substitutions may be made, for example, in accordance with the following table. Amino acids in the same block in the second column and preferably in the same line in the third is Tolba may be replaced with each other:

AliphaticNot polarG A P
I L V
Polar is not chargedC S T M
N Q
Polar - chargedD E
K R
AromaticH F W Y

The present invention also encompasses homologous substitution (the substitution and replacement are used in this description to denote the mutual replacement of an existing amino acid residue, with an alternative residue)that may occur, i.e. the substitution similar to similar residue, for example, basic to basic, acidic for acidic, polar for polar etc May not be homologous substitution, i.e. from one class of residue to another or alternatively involving the inclusion of not natural amino acids such as ornithine (hereinafter referred to as Z), ornithine diaminoalkanes acid (hereinafter referred to as B), norleucine ornithine (hereinafter, perilipin, titillans, nafcillin and phenylglycine.

Substitution, which is s can also be not natural amino acids, include: alpha* and alpha-disubstituted* amino acids, N-alkylaminocarbonyl*, lactic acid*, halide derivatives of natural amino acids such as triptorelin*, p-Cl-phenylalanine*, p-Br-phenylalanine*, p-1-phenylalanine*, L-allyl-glycine*, β-alanine*, L-α-amino butyric acid*, L-γ-amino butyric acid*, L-α-aminoadamantane acid*, L-ε-aminocaproic acid#, 7-aminoheptanoic acid*L-methioninamide#*, L-norleucine*, L-Norvaline*, p-nitro-L-phenylalanine*, L-hydroxyproline#, L-thioproline*, methyl derivatives of phenylalanine(Phe) such as 4-methyl-Phe*, pentamethyl-Phe*, L-Phe(4-amino)#, L-Tyr(methyl)*, L-Phe(4-isopropyl)*, L-Tic(1,2,3,4-tetrahydroisoquinoline-3-carboxyl acid)*, L-diaminopropionic acid # and L-Phe(4-benzyl)*. The symbol * has been used with the purpose of the discussion above (relative to homologous or not homologous substitution) to specify the hydrophobic nature of the derivative, while # to specify the hydrophilic nature of the derivative, #* indicates amphipatic characteristics.

Variant amino acid sequences include the appropriate group of spacers, which are suitable for insertion between any two amino acid residues of the sequence, including alkyl groups such as methyl, ethyl or various groups in addition to amino acid spacers such as the remains of the Chapter is of CIN or β-alanine. Another form of variation includes the presence of one or more amino acid residues in peptides form will be understandable to experts in this field. For the avoidance of doubt, "pateena form" is used to denote a variant amino acid residues, where the nitrogen atom of the residue is α-carbon substitution group, rather than to the α-carbon. Protease to obtain peptides in peptides form well known in this field.

The nucleotide sequence for use in the present invention may include synthetic or modified nucleotides. This region is famous for a number of different types of modified oligonucleotides. They include key chains methylphosphonate and phosphorotioate and/or adding circuits acridine or polylysine at the ends of the 3' and/or 5' of the molecule. For the purposes of the present invention, it should be understood that the nucleotide sequence can be modified by any method available in this area. Such modifications may be performed to enhance activity in vivo or life expectancy of the nucleotide sequences used in the present invention.

CRISPRs

CRISPRs (clustered inserted at regular intervals short palindrome repeats), also known as SPIDRs (Direct repeats with inserted intermediate the diversified spacers) are a recently described family of loci DNA which are usually specific for a particular bacterial species. The CRISPR locus is a separate class is inserted in between repeats of short sequences (Ishinoet al,J. Bacteriol., 169:5429-5433 [1987] and Nakata et al., J. Bacteriol., 171:3553-3556 [1989]). Similarly inserted in the gaps SSRs were identified inHaloferax mediterranei, Streptococcus pyogenes, AnabaenaandMycobacterium tuberculosis (see,Groenenet al.,Mol. Environ., 10:1057-1065 [1993]; Hoeet al.,Emerg. Infect. Dis., 5:254-263 [1999]; Masepohlet al.,Biochim. Biophys. Acta 1307:26-30 [1996]; and Mojicaet al.,Mol. Environ., 17:85-93 [1995]). The CRISPR loci differ from SSRs structure repeats, which were named short, arranged in equal intervals (Janssenet al.,OMICS J. Integ. Biol., 6:23-33 [2002]; and Mojicaet al.,Mol. Environ., 36:244-246 [2000]). The repeats are short items that are clusters, which are always located at regular intervals formed by the unusual inserted sequences with constant length (Mojica et al. [2000], see above). Although the sequence of repeats is highly conservative among strains, the number inserted in between repetitions and sequences of regions of the spacers differ from strain to strain (van Embden et al., J. Bacteriol., 182:2393-2401 [2001]).

The CRISPR loci consist of short and highly conservative partially palindromic repeats of DNA, usually from 24 to 40 base pairs, containing the internal and leaf inverter is new replays up to 11 base pairs. Although identified isolated elements, they are arranged in clusters (up to about 20 or more on the genome) of repeat units that are located at intervals, educated unusual inserted sequences from 20-58 base pairs. To date, up to 20 CRISPR loci were detected within one chromosome.

CRISPRs generally homogeneous within a given genome, and most of them are identical. However, there are examples of heterogeneity, for example, Archea (Mojica et al. [2000], see above).

Used in the present description, the term "CRISPR locus" refers to a segment of DNA that includes all the CRISPR repeats, starting with the first nucleotide of the first CRISPR repeat and ending with the last nucleotide of the last (end) of the CRISPR repeat.

Although the biological function of the CRISPR loci are unknown, have been proposed some hypotheses. For example, it has been suggested that they are involved in attaching chromosomes to the cell structure, or in chromosome replication and the division replicon (Jansenet al.,OMICS 6:23-33 [2002]; Jansenet al,Mol. Environ., 43:1565-1575 [2002]; and Pourcelet al.,Environ., 151:653-663 [2005]). Mojica et al. (Mojica et al., J. Mol. Evol., 60:174-182 [2005]) have hypothesized that CRISPR may participate in the provision of specific immunity against foreign DNA, and Piurcel et al. (see above) put forward the hypothesis that CRISPRs are p is ctory, capable of capturing pieces of foreign DNA, as part of the protection mechanism. Bolotin et al. (see above) suggests that the elements of the CRISPR spacer are traces of past implementations of extrachromosomal elements, and forward a hypothesis that they provide cell immunity against infection of the phage, and more generally, against the expression of foreign DNA by encoding the antisense RNA. Bolotin et al. (see above) also suggests that genescasnecessary for the formation of CRISPR. However, it is not intended that the present invention be limited to any particular mechanism, function theory by means of actions.

The genome of Streptococcus thermophilus LMG18311 contains 3 of the CRISPR locus (34 repeat), consisting of 36 base pairs repeated sequences are different in CRISPR1 (34 repeat), CRISPR2 (5 repetitions) and CRISPR3 (one sequence). However, they are perfectly preserved within each locus. Replays of CRISPR1 and CRISPR2, respectively, separated by an intermediate 33 and 4 sequences of length 30 base pairs. All these intermediate sequences differ from each other. They also differ from the sequences detected in strain CNRZ1066 (41 intermediate sequences within CRISPR1) and in strain LMD-9 (16 within CRISPR1 and 8 within CRISPR3), which both represent the S. thermophilus.

In question is the area known various methods of identifying a CRISPR loci. For example, Jensen et al. (Jensen et al. [2002]. Cm. above) describe based on computer analysis approach, in which there is the search part of CRISPR in nucleotide sequences using the program PATSCAN Department of mathematics and Computer Science Argonne National Laboratory, Argonne, IL., USA. The algorithm used for the identification of CRISPR motifs, represented p1 = a...bc...dp1c...dplc...dp1, where a and b are the lower and upper limit of the size of the repeat and p1 and c, and d represented the lower and upper limit of the size of the spacer sequences. The values a, b, c and d can vary from about 15 to 70 base pairs with increments of 5 grounds. In some preferred embodiments, the implementation, the CRISPR loci are identified with the drawing points on the graph (for example, by using a computer program Dotter).

Any suitable method known in this field, finds application in the analysis of similar sequence. For example, the analysis can be performed using the NCBI BLAST database of microbial genomes and GenBank, as is well known in this field. In addition, nucleotide sequences, including those presented in the present description, are included in the database (for example, an Internet site GenBank or JGI genome). Used in the present description, the term "higher during transcription" Osnach the et in the direction of 5', and below during transcription" means in the direction 3'.

In additional variants of implementation, the methods of the present invention are used in the amplification procedure (see, for example, Mojica et al. [2005], see above; Pourcel et al. [2005], see above). Amplification of the desired DNA can be achieved by any method known in this field, including the polymerase reaction chain (PCR). "Amplification" refers to the additional copies of the nucleic acid sequence. This is in General carried out using PCR technology, well known in this field. "The polymerase reaction chain" (or polymerase chain reactions ("PCR") is well known to specialists in this field. In the present invention, oligonucleotide primers are designed for use in PCR reactions to amplify all or part of the CRISPR locus.

The term "primer" refers to an oligonucleotide, occurring or naturally as in a purified restriction preware, or obtained synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which induced the synthesis of the product of protruding end of the primer, which is complementary to the strands of the nucleic acid (i.e. in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable t is mperature and pH). In some embodiments, implementation, primer is single-stranded for maximum efficiency in amplification, although in other embodiments, implementation, primer is a double-strand. In some embodiments, implementation, primer is oligodeoxyribonucleotide. The primer must be sufficiently long to allow synthesis products stickout in the presence of an inducing agent. The exact length of the primer will depend on many factors, including temperature, source of primer and applied way. The primers for PCR typically have a length of at least about 10 nucleotides, and most typically have a length of at least about 20 nucleotides. Methods and conducting PCR are well known in this field and include, without limitation methods using paired primers, intragenic primers, a single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially incorrectly paired primers, etc.

In some preferred embodiments, the implementation of the present invention, the CRISPR locus or part thereof from the parent bacterium and labeled bacterium are compared using any suitable method known in this field. In some preferred embodiments, the implementation of this is part II of the invention, the CRISPR locus or part thereof from the parent bacterium and labeled bacteria compared with the amplification of the CRISPR locus or a portion thereof. In addition to the well known cyclic methods of amplification (such as PCR, the reaction ligase chain etc), other methods, including without limitation methods of isothermal amplification, are used in the present invention. Well known methods of isothermal amplification, which are used in the present invention include, without limitation, amplification bias threads (SDA), Q-beta replicase, amplification of sequence-based nucleic acid (first NASBA) and autostacking replicatio sequence.

In some other preferred embodiments, the implementation of the present invention, the CRISPR locus or part thereof from the parent bacterium and labeled bacteria compared with the amplification and sequencing of the CRISPR locus or a portion thereof. In some embodiments, implementation, compare one end of the CRISPR loci, while in other embodiments, implementation, and compares the ends 3', and the ends 5' loci. In some other embodiments, implementation, compare one ends (for example, the ends 5') of CRISPR loci. In some embodiments, implementation, compares at least the last CRISPR repeat at the end 3' of the CRISPR locus and/or, at least, the last spacer CRISP (for example, cor the last CRISPR spacer) on the end 3' of the CRISPR locus and/or at least the first CRISPR repeat at the 5' end of the CRISPR locus and/or at least the first CRISPR spacer (e.g., cor first CRISPR spacer) and the 5' end of the CRISPR locus. In some preferred embodiments, implementation, compare at least the first CRISPR repeat at the 5' end of the CRISPR locus, and/or at least the first CRISPR spacer (e.g., cor first CRISPR spacer) on the 5' end of the CRISPR locus. In some additional preferred embodiments, implementation, compares at least the last spacer (for example, at least short of the last CRISPR spacer) on the end 3' of the CRISPR locus and/or at least the first CRISPR spacer (e.g., at least short of the first CRISPR spacer) on the 5' end of the CRISPR locus. In some other preferred embodiments, implementation, compare at least the first CRISPR spacer (e.g., cor first CRISPR spacer) at the ends 5' of the CRISPR loci.

In some embodiments, implementation, CRISPR loci contain DNA, while in other embodiments, implementation, CRISPR loci contain RNA. In some embodiments, implementation of the nucleic acid is genomic in origin, whereas in other embodiments, the implementation, it is synthetic or recombinant origin. In some embodiments, the implementation, the CRISPR loci are DV is nitevibe, while in other embodiments, implementation, they are single-stranded, representing either the sense or the antisense strand, or a combination of both. In some embodiments, implementation, CRISPR loci is obtained by using the techniques of recombinant DNA, as disclosed in the present description.

The present invention also relates to methods of generating variants of the CRISPR. These variants are expressed, are highlighted, cloned and/or sequeiros using any suitable method known in this field. In some particularly preferred embodiments, implementation options CRISPR are resistant to phage mutant strains that have the modified CRISPR locus with additional spacer. In some particularly additional implementation options, these options are used as targets for detection/identification, or to create methods engineering resistance to molecules of nucleic acid. In another implementation options, these options are used in the development of biological control agents.

In the context of the present invention, the CRISPR locus is oriented as described below. Leader CRISPR is a conservative segment of DNA of a certain size. The orientation of the CRISPR locus is established by using follow what their characteristics:

the position of the CRISPR relative to neighboring genescas(sequences associated with CRISPR); CRISPR1 is localized below in the course of transcription from 4 genescas(genes str0657, str0658, str0659 and str0660 within the sequence of the chromosome CNRZ1066);

this sequence repeat can form secondary structure hairpins", although it is not completely palindromes, and the reverse complementary sequence;

(differs from direct sequence. In General, the 5' end of direct sequence richer nucleotides G and T than the 5' end of the reverse complementary sequence. In addition, since the base pairing G-T better than the base pairing a-C, the structure of the "studs" in General stronger in a straight threads; and

used in this description, the position of the limit is a repeat end repeat, which shows the variation of the sequence at its end 3'in General is a limit repetition.

Leader sequence of the CRISPR is a conservative segment of DNA of a certain size, which is localized directly above during transcription from the first repeat. For example, the leader of the CRISPR1 sequence of S. thermophilus is a segment of DNA that begins immediately after terminilogy the his codon of the gene str0660, and ending immediately before the first retry. Leader sequence of the CRISPR is localized at the 5' end of the CRISPR locus. Leader sequence of the CRISPR is localized directly above during transcription of the first CRISPR repeat of the CRISPR locus.

Trailer sequence of the CRISPR is a conservative segment of DNA of a certain size, which is located directly below during transcription from the end of the repeat. For example, trailer CRISPR1 sequence of S. thermophilus is a segment of DNA that begins immediately after the end of the loop, and ending immediately before the termination codon of the gene str0661 (located on the opposite DNA strand). Trailer sequence of the CRISPR is located directly below during transcription end repeat.

For example, a leader sequence and CRISPR trailer CRISPR sequence in the CRISPR1 locus of the strain Streptococcus thermophilus CNRZ1066 are:

Leader sequence of the CRISPR:

Trailer CRISPR sequence:

Leader sequence of the CRISPR complies with the provisions 625038 on 625100, and trailer CRISPR sequence corresponds to positions with 627845 on 627885 in the complete genome (SR) S. Thermophilus.

Used in the present description, the term "higher during transcription" means in the direction of 5', and below during transcription" means in the direction 3'. Used in the present description, the term "part" in the context of the CRISPR locus means, at least about 10 nucleotides, about 20 nucleotides, about 24 nucleotides, about 30 nucleotides, about 40 nucleotides, about 44 nucleotides, about 50 nucleotides, about 60 nucleotides, about 70 nucleotides, about 80 nucleotides, about 90 nucleotides, about 98 nucleotides, or even about 100, or more nucleotides (e.g., at least about 44-98 nucleotides) of the CRISPR locus. In some preferred embodiments, the implementation, the term "position" means at least about 10 nucleotides, about 20 nucleotides, about 24 nucleotides, about 30 nucleotides, about 40 nucleotides, about 44 nucleotides, about 50 nucleotides, about 60 nucleotides, about 70 nucleotides, about 80 nucleotides, about 90 nucleotides, about 98 nucleotides, or even about 100, or more nucleotides (e.g., at least about 44-98 nucleotides) from one or both ends (i.e. the ends 5' and/or 3') locus CRISPR. In some preferred embodiments, the implementation, the term "position" refers, at least approximately to the first 44 nucleotides of the 5' end of the CRISPR locus or about the last 44 nucleotides of the end 3' of the CRISPR locus

In some other embodiments, the implementation, the term "position" in the context of the CRISPR locus means, at least about 10 nucleotides, about 20 nucleotides, about 24 nucleotides, about 30 nucleotides, about 40 nucleotides, about 44 nucleotides, about 50 nucleotides, about 60 nucleotides, about 70 nucleotides, about 80 nucleotides, about 90 nucleotides, about 98 nucleotides, or about 100, or more nucleotides (e.g., at least about 44-98 nucleotides) below during the transcription of the first nucleotide of the first CRISPR repeat at the 5' end of the CRISPR locus or higher in the course of transcription from the first nucleotide of the first CRISPR repeat at the end 3' of the CRISPR locus. In some preferred embodiments, the implementation, the term "position" refers, at least approximately to the first 44 nucleotides below during transcription from the first nucleotide of the first CRISPR repeat at the 5' end of the CRISPR locus or at least about 44 nucleotides above during transcription from the last nucleotide of the last CRISPR repeat at the end 3' of the CRISPR locus.

In some embodiments, the implementation, the minimum size of the duplicated sequence is about 24 nucleotides, and the minimum size of the marking sequence is about 20 nucleotides. Thus, in some site is titeling options implementation the term "position" in the context of the CRISPR locus means, at least 44 nucleotides.

In some embodiments, the implementation, the maximum size of the duplicated sequence is about 40 nucleotides, and the maximum size of the marking sequence is approximately 58 nucleotides. Thus, in some embodiments, the implementation, the term "position" when used in the context of the CRISPR locus means, at least 98 nucleotides. In some preferred embodiments, the implementation, the term "position" in the context of the CRISPR locus means, at least about 44-98 nucleotides.

When comparing the CRISPR locus or a part thereof from the parent bacterium and labeled bacteria, compares at least about 10 nucleotides, about 20 nucleotides, about 24 nucleotides, about 30 nucleotides, about 40 nucleotides, about 44 nucleotides, about 50 nucleotides, about 60 nucleotides, about 70 nucleotides, about 80 nucleotides, about 90 nucleotides, about 98 nucleotides, or about 100 (e.g., at least about 44-98 nucleotides) of the CRISPR locus.

In some preferred embodiments, implementation, compare at least about 10 nucleotides, about 20 nucleotides, about 24 nucleotides, about 30 nucleotides, about 40 Amu is tidow, about 44 nucleotides, about 50 nucleotides, about 60 nucleotides, about 70 nucleotides, about 80 nucleotides, about 90 nucleotides, about 98 nucleotides, or about 100 (e.g., at least about 44-98 nucleotide on the 5' end of the CRISPR locus or at the end 3' of the CRISPR locus. In some preferred embodiments, implementation, compares, at least about the first 44 nucleotides at the 5' end of the CRISPR locus or at least about the first 44 nucleotides at the end 3' of the CRISPR locus.

In some embodiments, implementation, compare at least about 10 nucleotides, about 20 nucleotides, about 24 nucleotides, about 30 nucleotides, about 40 nucleotides, about 44 nucleotides, about 50 nucleotides, about 60 nucleotides, about 70 nucleotides, about 80 nucleotides, about 90 nucleotides, about 98 nucleotides, or about 100, or more nucleotides (e.g., at least about 44-98 nucleotides) below during the transcription of the first nucleotide of the first CRISPR repeat at the 5' end of the CRISPR locus or higher in the course of transcription from the last nucleotide the last CRISPR repeat at the end 3' of the CRISPR locus. In some preferred embodiments, implementation, compares, at least about the first 44 nucleotides below during transcription from the first nucleotide of the first CRISPR at the 5' end of the CRISPR locus or about 44 nucleotides above during transcription from the last nucleotide of the last CRISPR repeat at the end 3' of the CRISPR locus.

In some embodiments, the implementation, the minimum size of the duplicated sequence is about 24 nucleotides, and the minimum size of the marking sequence is about 20 nucleotides. In some preferred embodiments, implement, measure, compare, 44 nucleotides. In some alternative embodiments, the implementation, the minimum size of the duplicated sequence is about 40 nucleotides, and the maximum size of the marking sequence is approximately 58 nucleotides. In some preferred embodiments, implementation, compare at least 98 nucleotides. In some alternative preferred embodiments, implementation, compare at least about 44-98 nucleotides.

Used in the present description, the term "CRISPR repeat" is the usual value used in this field (i.e. multiple short direct repeats that do not show or show very little sequence variability within a given CRISPR locus). Used in this description in the context of the term "CRISPR repeat" synonomized the term "CRISPR".

The CRISPR locus contains one or more CRISPR repeats, and there are CRISPR spacers. Thus, the CRISPR repeat corresponds to the repeat sequences within the Ah of the CRISPR locus. For example, except for terminal repeat, a typical sequence repeat CRISPR1 sequence of S. thermophilus is:

Observed point changes the sequence of this repeat, but they were very rare. Compared to this typical sequence repeat, end sequence repeat always shows the same change at the end 3'. There was also a point of changing the sequence of this terminal repeat, but they were also very rare. The CRISPR repeats can naturally occur in the parent bacteria. Access numbers in the gene Bank sequences CRISPR1 include:

As additionally described in detail in this application, the duplicated sequence is produced, can be produced, obtained or can be obtained from the parent bacteria. In some preferred embodiments, the implementation, the sequence contains genomic DNA of the parent bacteria. In some particularly preferred embodiments, implementation, duplicated the sequence of the CRISPR (for example, in the same CRISPR locus) integrates repeatedly, sequentially, simultaneously or essentially simultaneously along with the marker sequence in the parent bacterium to obtain the sword is Noah bacteria.

The number of nucleotides in the repeat is in General from about 20 to 40 base pairs (for example, 36 base pairs), but in other embodiments, implementation, ranges from about 20 to about 39 base pairs, from about 20 to about 37 base pairs, from about 20 to about 35 base pairs, from about 20 to about 33 base pairs, from about 20 to about 30 base pairs, from about 21 to about 40 base pairs, from about 21 to about 39 base pairs, from about 21 to about 37 base pairs from about 23 to about 40 base pairs, from about 23 to about 39 base pairs, from about 23 to about 37 base pairs, from about 25 to about 40 base pairs, from about 25 to about 39 base pairs, from about 25 to about 37 base pairs, from about 25 to about 35 base pairs, or from about 28 or 29 base pairs.

The number of nucleotides in the repeat is in General from about 20 to about 40 base pairs. but may range from about 20 to about 39 base pairs, from about 20 to about 37 base pairs, from about 20 to about 35 base pairs, from about 20 to about 33 base pairs, from about 20 to about 30 base pairs, from about 21 to about 40 base pairs, from about 21 to about 39 base pairs, from about 21 to about 37 base pairs, from about 23 to about 40 pairs OS is Avani, from about 23 to about 39 base pairs, from about 23 to about 37 base pairs, from about 25 to about 40 base pairs, from about 25 to about 39 base pairs, from about 25 to about 37 base pairs, from about 25 to about 35 base pairs, or from about 28 or 29 base pairs. The number of repetitions may be in the range of from about 1 to about 140, from about 1 to about 100, from about 2 to about 100, from about 5 to about 100, from about 10 to about 100, from about 15 to about 100, from about 20 to about 100, from about 25 to about 100, from about 30 to about 100, from about 35 to about 100, from about 40 to about 100, from about 45 to about 100, from about 50 to about 100, from about 1 to about 135, from about 1 to about 130, from about 1 to about 125, from about 1 to about 120, from about 1 to about 115, from about 1 to about 110, from about 1 to about 105, from about 1 to about 100, from about 1 to about 95, from about 1 to about 90, from about 1 to about 80, from about 1 to about 70, from about 1 to about 60, from about 1 to about 50, from about 10 to about 140, from about 10 to about 130, from about 10 to about 120, from about 10 to about 110, from about 10 to about 95, from about 10 to about 90, from about 20 to about 80, from about 30 to about 0, from about 30 to about 60, from about 30 to about 50, from about 30 to about 40, or about 32.

In some other embodiments, the implementation, the number of nucleotides in the repeat is from about 20 to about 39 base pairs, from about 20 to about 37 base pairs, from about 20 to about 35 base pairs, from about 20 to about 33 base pairs, from about 20 to about 30 base pairs, from about 21 to about 40 base pairs, from about 21 to about 39 base pairs, from about 21 to about 37 base pairs, from about 23 to about 40 base pairs, from about 23 to about 39 base pairs from about 23 to about 37 base pairs, from about 25 to about 40 base pairs, from about 25 to about 39 base pairs, from about 25 to about 37 base pairs, from about 25 to about 35 base pairs, or from about 28 or 29 base pairs.

In some embodiments, the implementation, the number of repeats ranges from about 1 to about 144, from about 1 to about 100, from about 2 to about 100, from about 5 to about 100, from about 10 to about 100, from about 15 to about 100, from about 20 to about 100, from about 25 to about 100, from about 30 to about 100, from about 35 to about 100, from about 40 to about 100, from about 45 to about 100, from about 50 to about 100 from prima is but 1 to about 135, from about 1 to about 130, from about 1 to about 125, from about 1 to about 120, from about 1 to about 115, from about 1 to about 110, from about 1 to about 105, from about 1 to about 100, from about 1 to about 95, from about 1 to about 90, from about 1 to about 80, from about 1 to about 70, from about 1 to about 60, from about 1 to about 50, from about 10 to about 140, from about 10 to about 130, from about 10 to about 120, from about 10 to about 110, from about 10 to about 95, from about 10 to about 90, from about 20 to about 80, from about 30 to about 70, from about 30 to about 60, from about 30 to about 50, from about 30 to about 40, or about 30, 31, 32, 33, 34 or 35 repeats.

In some embodiments, the implementation, the number of repeats ranges from about 2 to about 140, from about 2 to about 100, from about 5 to about 100, from about 10 to about 100, from about 15 to about 100, from about 20 to about 100, from about 25 to about 100, from about 30 to about 100, from about 35 to about 100, from about 40 to about 100, from about 45 to about 100, from about 50 to about 100.

In some other embodiments, the exercise, number of repetitions ranges from about 2 to about 135, from about 2 to about 130, from about 2 to about 125, from about 2 to the ome 120, from about 2 to about 115, from about 2 to about 110, from about 2 to about 105, from about 2 to about 100, from about 2 to about 95, from about 2 to about 90, from about 2 to about 80, from about 2 to about 70, from about 2 to about 60, from about 2 to about 50, from about 2 to about 40, from about 2 to about 30, from about 2 to about 20, from about 2 to about 10, from about 2 to about 9, from about 2 to about 8, from about 2 to about 7, from about 2 to about 6, from about 2 to about 5, from about 2 to about 4, from about 2 to about 3.

In some embodiments, implementation, CRISPR repeats contain DNA, while in other embodiments, implementation, CRISPR repeats contain RNA. In some embodiments, implementation of the nucleic acid is genomic in origin, whereas in other embodiments, the implementation, it is synthetic or recombinant origin. In some embodiments, implementation, genes CRISPR repeats are double-strand or single-strand representing the sense or antisense strand or combinations of these. In some embodiments, implementation, genes CRISPR repeats are obtained by applying the techniques of recombinant DNA (e.g., recombinant DNA), as described in this application.

In some embodiments, the implementation, one or more repeat the s CRISPR used for genetic engineering of cells (for example, cell-recipient). In some preferred embodiments, the implementation, one or more, preferably, two or more CRISPR repeats are used for genetic engineering of cells (e.g. cells of the recipient), which in combination with one or more genes or proteins cas and one or more CRISPR spacers modulates the resistance of cells against nucleic acid-target or product its transcription. For example, in some embodiments, implement, repeat(s) CRISPR inserted into the cell's DNA (e.g. plasmid and/or genomic DNA of the cell-recipient)using any suitable method known in this field. In additional embodiments, implement, repeat(s) CRISPR are used as a matrix for modification (e.g., mutations) in the DNA of a cell (e.g., plasmid and/or genomic DNA of the cells of the recipient) in order to create or tighten genetic engineering repeat(s) CRISPR in a cell's DNA. In additional embodiments, implement, repeat(s) CRISPR are present at least in one construct, at least one plasmid and/or at least one vector, etc. In other embodiments, implementation, CRISPR repeats are injected into the cell using any suitable method known in this field.

In additional embodiments, the implementation, the present invention relates to sposobem identification of CRISPR repeat for use in modulating the resistance of a cell against a nucleic acid target or product its transcription, incorporating the following stages: (i) obtaining a cell containing at least one CRISPR spacer and at least one genecas; (ii) genetic engineering of cells, so that it contains a CRISPR repeat; and (iii) determine modulates whether the cell resistance against nucleic acid-target or product its transcription, where the modulation of the resistance of cells against nucleic acid-target or product its transcription indicates that the CRISPR repeat can be used to modulate the resistance.

In some other embodiments implement one or more genes or proteinscasused together or in combination with one or more, preferably, two or more CRISPR repeats and, optionally, one or more CRISPR spacers. In some particularly preferred embodiments implement one or more gene(s) or protein (protein)casand repeat(s) CRISPR form a functional combination, as described below. In some embodiments, implementation, CRISPR repeats contain any of the nucleotides presented in SEQ ID NOS:1-22. SEQ ID NOS:1-12 obtained from S.thermophilus, SEQ ID NOS:13-16 obtained from Streptococcus agalactiae, SEQ NO:17 obtained from S.mutans and SEQ ID NOS:18-22 obtained from S. pyogenes.

The CRISPR spacer

Used in the present description, the term "CRISPR spacer" on vative not duplicate spacer elements of the sequence, which exist between multiple short direct repeats (i.e. CRISPR repeats) or CRISPR loci. In some embodiments, implementation of the present invention, the CRISPR spacer" refers to a segment of nucleic acid that planiruetsja two CRISPR repeats. It was found that the sequence of the CRISPR spacers often have significant similarities with a variety of mobile DNA molecules (e.g., bacteriophages and plasmids). In some preferred embodiments, the implementation, the CRISPR spacers are located between two identical CRISPR repeats. In some embodiments, the implementation, the CRISPR spacers are identified by sequence analysis in fragments of sequence localized between the two CRISPR repeats. In some preferred embodiments, the implementation, the CRISPR spacer naturally present between two identical multiple short direct repeats that are palindrome.

It is of interest that the cells bearing these CRISPR spacers, unable to become infected with molecules containing DNA sequences homologous to the spacers (Mojica et al., 2005). In some preferred embodiments, the implementation, the CRISPR spacer homologous nucleic acid target product or its transcription, or identified sequence. Although the homology mo is but also to consider from the point of view of similarity, in the context of the present invention, it is preferable to Express the homology from the point of view of the identity of the sequence. It is believed that homologous sequence comprises a CRISPR spacer, which can be, at least, about 70, about 75, about 85, or about 90% identical, or at least about 91, about 92, about 93, about 94, about 95, about 96, about 97, about 98, about 99% identical to the sequence of the nucleic acid target or product its transcription or identified sequence. In some preferred embodiments, the implementation, the CRISPR spacer of about 100% identical to the sequence of the nucleic acid target. It is also noted that the number of CRISPR spacers in these loci or the CRISPR locus may vary between species. In addition, the number of the spacers is in the range from about 1 to about 140, from about 1 to about 100, from about 2 to about 100, from about 5 to about 100, from about 10 to about 100, from about 15 to about 100, from about 20 to about 100, from about 25 to about 100, from about 30 to about 100, from about 35 to about 100, from about 40 to about 100, from about 45 to about 100, or from about 50 to about 100. In some preferred embodiments, the implementation, the number is about spacers is in the range from about 1 to about 135, from about 1 to about 130, from about 1 to about 120, from about 1 to about 115, from about 1 to about 110, from about 1 to about 105, from about 1 to about 100, from about 1 to about 95, from about 1 to about 90, from about 1 to about 80, from about 1 to about 70, from about 1 to about 60, from about 1 to about 50, from about 1 to about 40, from about 1 to about 30, from about 1 to about 20, from about 1 to about 10, from about 1 to about 9, from about 1 to about 8, from about 1 to about 7, from about 1 to about 6, from about 1 to about 5, from about 1 to about 4, from about 1 to about 3 or from about 1 to about 2. In some preferred embodiments, the implementation, the CRISPR spacers are identified by sequence analysis in the form of fragments of DNA sequencing, localized between the two repeats.

As described in the present application, the present invention relates to methods and compositions that facilitate the use of one or more genes or proteinscasin combination with one or more, preferably, two or more CRISPR repeats, suitable for imparting specificity of immunity, at least one CRISPR spacer in the cell-recipient. In some preferred embodiments, the implementation of at least one of the genes or elkow casand at least one CRISPR repeat are used in functional combinations to impart specificity of immunity, at least one CRISPR spacer in the cell.

Used in the present description, the term "specificity of immunity" means that a given immunity against a specific nucleic acid sequence or product of its transcription using a specific sequence of the CRISPR spacer or pseudo CRISPR spacer. As indicated in the present description, the CRISPR spacer does not confer resistance to any nucleic acid sequence or product of its transcription, but only those sequences against which the CRISPR spacer or pseudo CRISPR spacer is homologous (e.g., those that are identical by about 100%).

In some embodiments, the implementation, the spacer(s) CRISPR obtained from the donor organism, which is different from the cells of the recipient. In some embodiments, implementation, cell donors and recipients represent different bacterial strains, species and/or genera. In some preferred embodiments, the implementation of at least one of the genes or proteinscasand/or at least one CRISPR repeats derived from organisms other than the recipient's organism. In some preferred embodiments, implementation, p is renosance, at least two of the CRISPR repeat. In some additional preferred embodiments, the implementation, the CRISPR spacers are obtained from an organism, which is heterological for cell recipient or another donor cells from which received, at least one of the genes and/or proteinscasand/or at least one CRISPR repeats. In some alternative preferred embodiments, the implementation, the CRISPR spacers obtained from an organism, which is homologous to the cells of the recipient or another donor cells from which received, at least one of the genes and/or proteinscasand/or at least one CRISPR repeats. In some preferred embodiments, the implementation, the spacer(s) CRISPR constructed(s) and received(s) using recombinant methods known in this field. Indeed, it is assumed that the CRISPR spacers will be obtained using any suitable method known in this field.

In some embodiments, the implementation, the CRISPR spacers of heterologic to the cell to the recipient from which the received at least one of the genes and/or proteinscasand/or at least one, and in some embodiments, implementation, two or more CRISPR repeat. In some alternative embodiments, the implementation, the CRISPR spacers are homologous to the cell-recipient of catalogproduct, at least one of the genes and/or proteinscasand/or at least one, and in some embodiments, implementation, two or more CRISPR repeat. Indeed, it is assumed that any of the elements used in ways that will be heterologous or homologous. In some embodiments, the implementation, where multiple elements (for example, any combination of the spacer (spacer) CRISPR, repeat (repeats) CRISPR, a gene (genes) cas and protein (protein) Cas), some elements are homologous to each other, and some elements are heterologous to each other (for example, in some embodiments, the implementation, the spacer(s) CRISPR and cas genes are homologous, but the replay(s) CRISPR is/are heterologous). Thus, in some embodiments, the implementation, the CRISPR spacer is not naturally associated with CRISPR repeat and/or cas genes and/or functional combination of the CRISPR repeat-cas gene. Indeed, it is assumed that any combination of heterologous and homologous elements are used in the present invention. In other additional embodiments, implementation, cells donor cells and recipient are heterologous, while in other embodiments, implementation, they are homologous. It is also assumed that the elements contained within the cells of the donor and cell-reci is antov, are homologous and/or heterologous. Elements (for example, the CRISPR spacers) are introduced into a plasmid and/or genomic DNA of the cells of the recipient using any suitable method known in this field.

In some preferred embodiments, the implementation of at least one CRISPR spacer is used for genetic engineering of cells (e.g. cells of the recipient). In some additional embodiments, the implementation, one or more CRISPR spacers are used in combination with one or more cas genes and/or one or more, preferably, two or more CRISPR repeats (in some preferred embodiments, the implementation uses one or more functional combinations) for modulating the resistance of a cell against a nucleic acid target or product its transcription to obtain cells subjected to genetic engineering. In some other embodiments, the implementation, the CRISPR spacers are used as a matrix for modification (e.g., mutations), there plasmid and/or genomic DNA of the cells (e.g. cells of the recipient), so were created the CRISPR spacers in the cell's DNA. In some embodiments, the implementation, the spacer(s) CRISPR is copied (cloned), at least in one construct, the plasmid or vector, which then cell-recipient transformed with IP is the use of any suitable way, known in this field.

In some other embodiments, the implementation, the present invention relates to methods of identifying a CRISPR spacer for use in modulating the resistance of a cell against a nucleic acid target or product its transcription, comprising the stage of: obtaining a cell containing at least two CRISPR repeat, and at least one gene or proteincas; identifying at least one CRISPR spacer in the body (for example, the body of the donor), modification of the sequence of the CRISPR spacer of the cell, so that he had homology with the CRISPR spacer of the body donor containing nucleic acid target; and determining, modulating whether the cell resistance against nucleic acid-target, where the modulation of the resistance of cells against nucleic acid-target or product its transcription indicates that the CRISPR spacer modulates the resistance of cells against nucleic acid-target.

In some preferred embodiments, the implementation, the CRISPR spacers contain or consist of a nucleotide sequence in any one or more of SEQ ID NOS:23-460 and/or SEQ ID NOS:522-665. SEQ ID NOS:23-339, 359-408, 522-665 obtained from S.thermophilus, while SEQ ID NOS:340-358 obtained from S.vestibularis, SEQ ID NOS:409-446 obtained from S.agalactiae, SEQ ID NOS:447-452 obtained from S.mutans and SEQ ID NOS:453-460 derived from these bacteria to antibiotics.

In particularly preferred embodiments, the implementation, the CRISPR spacers are ornamented with two CRISPR repeats (i.e., the CRISPR spacer has at least one CRISPR repeat on each side). Although it is not intended that the present invention be limited to any particular mechanism, theory or hypothesis, it is envisaged that this CRISPR spacer derived from the 5' end of the CRISPR locus containing the gene(s) cas and/or the leader sequence, the lower the resistance, given that the CRISPR spacer. Thus, in some embodiments, implementation of the present invention, the modified one or more of the first 100 CRISPR spacers from the 5' end of the CRISPR locus, whereas in other embodiments, implementation of the modified one or more of the first 50 CRISPR spacers from the 5' end of the CRISPR locus. In some additional embodiments, the implementation of the modified one or more of the first 40 CRISPR spacers from the 5' end of the CRISPR locus, whereas in some other embodiments, implement, modify the I one or more of the first 30 CRISPR spacers from the 5' end of the CRISPR locus, in other additional embodiments, the implementation of the modified one or more of the first 20 CRISPR spacers from the 5' end of the CRISPR locus, and in some cases implementing, modifying, and combining one or more of the first 15 CRISPR spacers from the 5' end of the CRISPR locus. In some preferred embodiments, the implementation of the modified one or more of the first 10 CRISPR spacers from the 5' end of the CRISPR locus. As indicated in the present description, different bacteria have different number of CRISPR spacers, thus, in some embodiments, implementing, modifying, and combining different spacers.

Cor of CRISPR spacer

For a particular type CRISPR within microbial species, the CRISPR spacer usually presents certain prevailing in length, although the size may vary. It was found that the CRISPR types described so far contain a spacer certain predominant length from about 20 base pairs to about 58 base pairs.

Used in the present description, the term "short CRISPR spacer" refers to the length of the shortest observed spacer within type CRISPR. Thus, for example, within type I CRISPR S.thermophilus (CRISPR1), the predominant length of the spacer 30 base pairs in the minority spacers ranging in size from 28 base pairs up to 32 base pairs. Thus, in type I CRISPR S.thermophilus cor of CRISPR spacer member is carried out as a continuous fragment sequencing length of 28 base pairs.

In some preferred embodiments, the implementation of the present invention, the CDF of the CRISPR spacer homologous nucleic acid target, the product of its transcription or identified sequence along the length of the cow sequence. As indicated above, although homology can also be considered from the point of view of similarity, in some preferred embodiments, the implementation of the present invention, the homology is expressed from the point of view of the identity sequence. Thus, in some embodiments, the implementation of the homologous sequence covers the CDF of the CRISPR spacer, which may be identical, at least about 90%identical or at least about 91, about 92, about 93, about 94, about 95, about 96, about 97, about 98, or about 99% nucleic acid target, the product of its transcription or identified sequence along the length of the cow sequence. In some particularly preferred embodiments, implementation of the CDF of the CRISPR spacer of about 100%identical to the nucleic acid target, the product of its transcription or identified sequence along the length of the cow sequence.

During the creation of the present invention, analyzed CRISPR sequences of different strains S.hermophilus, including closely related industrial strains and resistant to phage variants. Differences in the number and type of spacers was observed mainly in the CRISPR1 locus. It is noteworthy that, as it turned out, the sensitivity to phages correlates with the content of the CRISPR1 spacer. In particular, the content of the spacer was almost identical between the parent strains and resistant to phage derivatives, except for spacers present in the latter. These data suggest a potential link between the presence of additional spacers and differences in the sensitivity of this strain to the phages. This observation stimulated the study of the origin and function of additional spacers present in resistant to phage mutants.

Used in the present description, the term "pseudo-CRISPR spacer" refers to a nucleic acid sequence present in an organism (for example, the body of the donor, including, without limitation, a bacteriophage), which is preferably essential for the function and/or survival and/or replication and/or infectivity, etc. and which contains the sequence of the CRISPR spacer. In some embodiments, implementation, pseudo CRISPR spacers are used when receiving sequences of CRISPR spacers that are complementary or homologous the pseudo CRISPR spacer. In some particularly preferred embodiments, implementation, these sequences find use in modulating the resistance.

In some embodiments, the implementation of at least one pseudo-CRISPR spacer and the spacer(s) CRISPR, which is (are) complementary to or homologous to at least one pseudo-spacer (the spacer) CRISPR used for genetic engineering of cells of the recipient. In some preferred embodiments, the implementation of at least one pseudo-CRISPR spacer or spacer(s) CRISPR, which is (are) complementary to or homologous to at least one pseudo-spacer (the spacer) CRISPR used in combination with one or more genes or proteins cas and/or with one or more CRISPR repeats (for example, one or more combinations thereof) for genetic engineering of cells of the recipient, so that the stability of the cell-recipient was modulated against a nucleic acid target or product its transcription.

In some embodiments, implementation, pseudo-CRISPR spacer or spacer(s) CRISPR, which is (are) complementary to or homologous to at least one pseudo-spacer (the spacer) CRISPR, inserted into a plasmid and/or genomic DNA of the cells of the recipient using any suitable method known in this field.

Some additional options, which the ants implementation pseudo CRISPR spacers are used as a matrix for modification (e.g., mutations), there plasmid and/or genomic DNA of the cells of the recipient, so were created the CRISPR spacers in the plasmid and/or genomic DNA of the cell. In some other embodiments, implementation, pseudo CRISPR spacers or spacer(s) CRISPR, which is (are) complementary (complementary) or homologous (homologous) to one or more pseudo-spacer (the spacer) CRISPR, cloned in a construct, plasmid and/or the vector, and so on, is entered/entered in the cell-host using any suitable method known in this field.

CAS and cas genes

Used in the present description, the term "gene cas has the usual value used in this field, and refers to one or more cas genes, which generally connected, associated or located near or close to flanking CRISPR loci. A comparative review of the Cas protein family is represented in the document adhesive et al. (Adhesive et al., PLoS. Comput. Biol., 1(6): e60 [2005]), which describes 41 newly recognized family of genes associated with CRISPR (cas), in addition to the four previously known gene families. As indicated in the present description, the CRISPR system belong to different classes with different types of repetitions, sets of genes and species ranges. As indicated in the present description, the number cas in the CRISPR locus can vary between species.

In some embodiments, the implementation, the present invention relates to methods and compositions for the use of one or more cas genes or proteins, or, separately or in any combination with one or more CRISPR spacers to modulate the stability of cells (e.g. cells of the recipient) against nucleic acid-target or product its transcription.

In some embodiments, the implementation of one or more genes and/or proteins cas occur naturally in the cell-recipient and one or more heterologous spacer integrated/integrated or inserted adjacent to one or more genes or proteins cas. In some embodiments, the implementation of one or more genes and/or proteins cas is/are heterologous to the cell to the recipient, and one or more spacers is/are homologous or heterologous. In some preferred embodiments, the implementation, the spacers are integrated or inserted adjacent to one or more genes or proteins cas.

In some other embodiments, the implementation, the present invention relates to methods and compositions for the application of one or more genes or proteinscasand at least two CRISPR repeats for modulating resistance in the cell (e.g. the cell-recipient) against nucleic acid-m is Sheni or product its transcription.

In other additional embodiments, the implementation, the present invention relates to methods and compositions for the application of one or more genes or proteinscasand at least two CRISPR repeats and at least one CRISPR spacer for modulating resistance in the cell (e.g. the cell-recipient) against nucleic acid-target or product its transcription.

Patterns CRISPR usually found near the four genes, calledcas1bycas4. The most common location of genes is acas3-cas4-cas1-cas2. It seems that Cas3 protein is a helicase, while reminiscent of the RecB family of economies and enriched with cysteine motif, indicating that DNA binding. Cas1 in General is highly essential and is the only protein Cas, continuously found in all species that contain CRISPR loci. Cas2 yet to be described.cas1-4usually characterized by their proximity to the CRISPR loci and their widespread distribution of bacterial and realnum species. Although not all genescas1-4associated with the entire CRISPR loci, all of them are detected at multiple subtypes.

In addition, many bacterial species have another cluster associated with CRISPR structures of three genes, referred to in this description of thecas1B, cas5 andcas6(see Bolotin et al. [2005], above). It is noted that the nomenclature of the cas genes are still made. Thus, in the present description, the text should be understood in context. In some embodiments, implementation, genecasselected from thecas1, cas2,cas3,cas4, cas1B,cas5and/orcas6. In some preferred embodiments, implementation, genecasrepresents acas1.In some embodiments, implementation, genecasselected from fragments, variants, homologues and/or derivatives thereof,cas1, cas2,cas3,cas4, cas1B,cas5and/orcas6.In some additional embodiments, the implement, the combination of two or more genescasare used, including any suitable combination, including those presented in document WO 07/025097 included in the present description by reference. In some embodiments, implementation, comprises many genescas. In some embodiments, implementation, there are many different and/or identical genescas. In some embodiments, implementation, there are many different and/or identical genescasor any combination thereof, as presented in document WO 07/025097.

In some embodiments, implementation, genescascontain DNA, while in other embodiments, implementation, genescascontain RNA. In some embodiments, implementation of nucleic acid is the meet of genomic origin, whereas in other variants of implementation, it is synthetic or recombinant origin. In some embodiments, implementation, genescasare double-strand or single-strand representing either the sense or the antisense strand, or a combination of both. In some embodiments, implementation, genescasobtained by using the techniques of recombinant DNA (e.g., recombinant DNA), as described in this application.

As described in the present application, in some embodiments, implementation, genecascontains a fragment of the gene ofcas(i.e. the fragment of the gene ofcascontains part of the sequence of the wild type). In some embodiments, the implementation, the sequence contains at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence wild-type.

In some embodiments, implementation, preferably, the gene ofcasrepresented genecasthat is closest to a leader of the placenta is successive or first CRISPR repeat at the 5' end of the CRISPR locus - such ascas4orcas6.

In some embodiments, implementation, Cas protein selected from Cas1, Cas2, Cas3, Cas4, Cas1B, Cas5 and/or Cas6, as well as fragments, variants, homologues and/or derivatives. In some other embodiments, implementation, Cas protein selected from Cas1, Cas2, Cas3, Cas4, Cas1B, Cas5 and/or Cas6, and their combinations, as described in document WO 07/025097. In some embodiments, implementation, Cas protein selected from one or more of the Cas1, Cas2, Cas3, Cas4, Cas1B, Cas5 and/or Cas6, or multiple same or different Cas proteins, in any suitable number and/or combination.

The term "Cas protein" also encompasses many Cas proteins (for example, from about 2 to about 12 Cas proteins, preferably, from about 3 to about 11 Cas proteins, preferably, from about 4 to about 10 Cas proteins, preferably, from about 4 to about 9 Cas proteins, preferably, from about 4 to about 8 Cas proteins, and preferably, from about 4 to about 7 Cas proteins; for example, 4, 5, 6 or 7 Cas proteins).

In some embodiments, implementation, Cas proteins encoded by the genescascontaining DNA, while in other embodiments, implementation,cascontain RNA. In some embodiments, implementation of the nucleic acid is genomic in origin, whereas in other embodiments, the implementation, it is synthetic or recombinant origin. In some embodiments, Khujand the exercise of, genescasare double-strand or single-strand representing the sense or antisense strand or combinations thereof. In some embodiments, implementation, genescasobtained by using the techniques of recombinant DNA (e.g., recombinant DNA), as described in this application.

The present invention also relates to methods of identifying genecasfor use in modulating the resistance of a cell against a nucleic acid target or product its transcription, comprising the stage of: obtaining a cell containing at least one CRISPR spacer and at least two CRISPR repeat; genetic engineering of cells, so that it contained at least one genecas; and determining, modulating whether the cell resistance against nucleic acid-target or product its transcription, where the modulation of the resistance of cells against nucleic acid-target or product its transcription indicates that the genecascan be used to modulate the resistance of the cell.

In some other embodiments, the implementation, the present invention relates to methods and one or more cas genes, which can be used in genetic engineering of cells (e.g. cells of the recipient). In some preferred embodiments, the implementation, one or more cas genes using the tsya for genetic engineering of cells (for example, cell-recipient), which in combination with one or more, preferably, two or more CRISPR repeats and one or more CRISPR spacers finds use in modulating the resistance of a cell against a nucleic acid target or product its transcription. For example, in some embodiments, implementation, gene(s) cas pasted/inserted into the cell's DNA (e.g. plasmid and/or genomic DNA of the cell-recipient) using any suitable method known in this field. In some additional embodiments, implementation, cas genes are used as matrix for modification (e.g., mutations) in the DNA of a cell (e.g., plasmid and/or genomic DNA of the cell-recipient) so that cas genes were created or formed in a cell's DNA. In some embodiments, implementation, cas genes are present at least in one construct, at least one plasmid, and/or at least one vector which is then introduced (injected) into the cell using any suitable method known in this field.

In some embodiments, implementation, genescascontain at least one clustercasselected from any one or more of SEQ ID NOS:461, 466, 473, 478, 488, 493, 498, 504, 509 and 517. In other embodiments, implementation, genescascontain any one or more of the C SEQ ID NOS: 462-465, 467-472, 474-477, 479-487, 489-492, 494-497, 499-503, 505-508, 510-517, used alone or together with any suitable combination. In some preferred embodiments, implementation, cluster(s) is/are used in combination with one or more, preferably, two or more CRISPR repeats and, optionally, one or more CRISPR spacers. In some additional embodiments, the implementation, one or more cas genes or proteins, or used/used in suitable combinations.

As indicated in the present description, this set of genes or proteins cas always associated with the repeated sequence within a CRISPR locus. Thus, it appears that genes or proteins cas-specific repeat DNA (i.e. genes or proteins cas and repeated sequences of functional pair).

Accordingly, certain combinations of one or more cas genes or proteins, or one or more, preferably, two or more CRISPR repeats are used in order to ensure that the CRISPR spacer gave resistance to the nucleic acid target or product its transcription in the cell (e.g. the cell-recipient). Accordingly, it is surprisingly found that you cannot just use any genes or proteins cas, or any CRISPR repeats. Instead, sign nastojasih the invention, that combination is functional.

In the context described in the present application is a combination of CRISPR repeat-cas gene, the term "functional" means that the combination can give the stability of the nucleic acid target or homologous to the product of its transcription when used in conjunction with the CRISPR spacer, which is combined with the nucleic acid target or by-product of its transcription or homology them. Used in the present description, the terms "functional combination of CRISPR repeat-cas" and "functional combination of CRISPR repeat-cas gene" includes functional combination, in which cas is a cas gene or protein Cas.

Suitably, one or more genes or proteinscasand/or one or more, preferably, two or more CRISPR repeats are obtained from the same cells (e.g., the same cell-recipient). In some embodiments, implementation, when used in the context, the term "produced" is synonymous with the term "receive". In some preferred embodiments, implementation, when used in the context, the term "happening" is also synonymous with "received", as it is not intended that the present invention is definitely limited to items that are "happening". In some embodiments, implementation, when using the context the term "happening" is synonymous with the term "receive".

In some embodiments, the implementation of one or more genes or proteinscasand/or one or more, preferably, two or more CRISPR repeats derived from the same CRISPR locus within the genome or plasmids, preferably genome or plasmids of the same strain, species or genus. In some other embodiments implement one or more genes or proteinscasand/or one or more, preferably, two or more CRISPR repeats derived from the same CRISPR locus within a genome or a plasmid, preferably, a single genome or plasmids of the same strain, species or genus. In some embodiments, the implementation of one or more genes or proteinscasand/or one or more, preferably, two or more CRISPR repeats together occur naturally. In other additional embodiments, the implementation of one or more genes or proteinscasand/or one or more, preferably, two or more CRISPR repeats together are found naturally in the same cell (i.e. the cell-recipient). In other embodiments implement one or more genes or proteinscasand/or one or more, preferably, two or more CRISPR repeats together are found naturally in the same anoma cells (for example, cell-recipient). In other additional embodiments, the implementation of one or more genes or proteinscasand/or one or more, preferably, two or more CRISPR repeats together are found naturally in the same genome of the strain, species or genus. In some other preferred embodiments, the implementation, the present invention refers to any suitable combination of nucleic acid, consisting essentially of at least two CRISPR repeats and at least one gene or proteincas.

In some embodiments, the implementation, the term "consists essentially of" refers to the combination of at least two CRISPR repeats and at least one gene or proteincas,and excluding the at least one additional component of the CRISPR locus (for example, in the absence of one or more spacers (spacers) CRISPR and/or in the absence of one or more normal (regular) leader sequence (sequence) of the CRISPR locus. In some alternative embodiments, the implementation, the term "consists essentially of" refers to the combination of at least two CRISPR repeats and at least only one gene or proteincas,and excluding all other components of the CRISPR locus (for example, a naturally occurring CRISPR locus). In some other embodiments, implementation, Ter is in "consists essentially of" refers to the combination at least, only one gene or proteincas,and excluding all other components of the CRISPR locus (for example, a naturally occurring CRISPR locus). In some other embodiments, the implementation, the term "consists essentially of" refers to the combination of at least two CRISPR repeats and at least only one gene or proteincas,and excluding at least one other component of the CRISPR locus, preferably, eliminating at least one other component of a naturally occurring CRISPR locus. In some some embodiments, the implementation, the term "consists essentially of" refers to the combination of at least two CRISPR repeats and at least one gene or proteincasprovided that there is at least one other component of natural CRISPR locus (e.g., essentially none). Thus, it is assumed that the term finds use in the context. In some embodiments, the implementation, the present invention refers to any suitable combination of at least two CRISPR repeats and at least one gene or proteincasprovided that no all the other components of the CRISPR locus (e.g., essentially no), it is preferable that no all the other components of the CRISPR locus of the natural combination of repetition (repetition) and CRISPR one is about or more genes or proteins casused in combination, or together with one or more CRISPR spacers. In some additional embodiments, the implementation of one or more genes or proteinscasused in combination, or together with at least one or more CRISPR spacers and at least one or more, preferably, two or more CRISPR repeats. In some embodiments, the implementation, the spacer(s) CRISPR provided or obtained from an organism (e.g., body donor), which is different from cells (e.g. cells of the recipient), which received one or more genes or proteinscasand/or one or more, preferably, two or more CRISPR repeats.

Given the different locations of the repetition (repetition) and CRISPR gene (genes) or protein (protein)casespecially functional combinations of CRISPR repeat-cas. In some embodiments, the implement, the combination contains, consists of or essentially consists of at least any number from about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20 CRISPR repeats, in combination with any number of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 4, about 15, about 16, about 17, about 18, about 19, or about 20 genes or proteinscas(for example, 16 CRISPR repeats and 12 genes or proteinscasor 18 CRISPR repeats and 20 genes or proteinscas,or any combinations of them). The present invention relates to retry (retries) and CRISPR gene (genes)cassituated in a different way, as presented in document WO 07/025097. In some embodiments, the implementation in which the combination of genecasand CRISPR repeat contains more than one genecas, it should be understood that the CRISPR repeat is inserted at the end of the 3' genecasat the 5' end of genescasor between genescasprovided that at least one of the genescasremains functional.

In some embodiments, the implementation, the first combination of CRISPR repeat-gene or proteincas(containing at least one gene or proteincasand at least two CRISPR repeat, where both derived from the same CRISPR locus within the genome) is used in combination with the second combination of CRISPR repeat-gene or proteincas(containing at least one gene or proteincasand at least two CRISPR repeat, where both derived from the same or different CRISPR locus within the genome). Accordingly, in these embodiments of the invention, the first and second combinations derived from the same or different lo the mustache CRISPR within the genome. Thus, in some embodiments, the implementation, the first and second combinations of CRISPR repeat-gene or proteincasderived from different genomes (for example, from different genomes within the same cluster), as described in more detail later in this application.

In some embodiments, implementation of the present invention, the first and/or second combination of CRISPR repeat-gene or proteincas(containing at least one cas gene and at least two CRISPR repeat derived from the same CRISPR locus within the genome) are used in combination with about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10, or more combinations of the CRISPR repeat-gene or proteincas(each containing at least one gene or protein cas and at least two CRISPR repeat derived from the same or other CRISPR loci within the genome). Accordingly, in these embodiments of the invention, the combination obtained from the same or other CRISPR loci within the genome. In some other embodiments of the invention, the combination obtained from various genomes (for example, different genomes within the same cluster), as described in more detail later in this application.

Thus, in some embodiments, implementation, to ensure that Kombinacija CRISPR repeat-gene or protein casgave stability, repeat(s) and CRISPR gene(s) or protein (protein)castogether occur naturally within the CRISPR locus of the genome. In some embodiments, implement, repeat(s) and CRISPR gene(s) or protein (protein)castogether occur naturally within the CRISPR locus of the genome. In some embodiments, the implementation of these functional combination, taken together, give resistance against nucleic acid-target or product its transcription.

In some other embodiments, the implementation, the present invention relates to a method of identifying a functional combination of a gene or proteincasand CRISPR repeat, which includes stages: analysis of sequences (e.g. sequences of nucleic acid or protein) gene or proteincasand CRISPR repeat; identifying one or more clusters of genes or proteinscas; identifying one or more clusters of CRISPR repeats; and combining those genes or proteinscasand sequences of CRISPR repeats, which are within the same cluster.

In some additional embodiments, the implementation, the present invention relates to a method of identifying a functional combination of a gene or proteincasand CRISPR repeat for use in modulating the resistance of cells against kleinova acid target or product its transcription, incorporating the following stages: obtaining cells holding a combination of one or more genes or proteinscasand one or more, preferably, two or more CRISPR repeats; genetic engineering of cells, so that it contained one or more CRISPR spacers; and determining, modulating whether the cell resistance against nucleic acid-target, where the modulation of the resistance of cells against nucleic acid-target or product its transcription indicates that the combination can be used to modulate the resistance of cells against nucleic acid-target.

In some embodiments, the implementation sequence of the gene and/or proteincasand/or CRISPR repeat derived from the same or other strains, species, genera and/or organisms. In some embodiments, the implement, the combination contains DNA and/or RNA of genomic, recombinant and/or synthetic origin. In some embodiments, implement, repeat(s) CRISPR contains DNA and/or RNA of genomic, recombinant and/or synthetic origin. In some embodiments, implementation, gene(s)cascontains DNA and/or RNA of genomic, recombinant and/or synthetic origin. Indeed, it is assumed that the present invention covers any combination of DNA and/or RNA for each of ELEH the clients (for example, genecasand/or the CRISPR repeat. In some embodiments, implementation, items are analyzed using any suitable methods known in this field. In some embodiments, the implementation, the CRISPR repeat and/or genecasare double-strand, whereas in other embodiments, implementation, each of them is single-stranded, representing either the sense or antisense strand or combinations thereof.

In some embodiments, the implementation, one or more described in this application functional combinations are used for genetic engineering of cells (e.g. cells of the recipient). In some preferred embodiments implement one or more functional combinations are used for genetic engineering of cells (e.g. cells of the recipient), which in combination with one or more CRISPR spacers finds use in modulating the resistance of a cell against a nucleic acid target or product its transcription. In some embodiments, implementation, functional combinations are inserted into the cell's DNA-recipient (for example, plasmid or genomic DNA) using any suitable methods known in this field. In some additional embodiments, implementation, functional combinations are used as matrix for the modification (for example, Muta is AI) DNA-recipient (for example, DNA plasmid and/or genomic DNA) in order to create a functional combination in a cell's DNA. In yet some additional embodiments, implementation, functional combinations are cloned into a construct, a plasmid or vector, etc. which is then transformed into the cell using methods such as described in this application and known in this field.

In some embodiments, implementation, functional, combination, or may be obtained by a process comprising the stages: sequence analysis of the genecasand CRISPR repeat; identifying one or more clusters of genescas; identifying one or more clusters of CRISPR repeats; and combining sequences of those genescasand CRISPR repeats, which are within the same cluster, where the combination of gene sequencescasand CRISPR repeat within the same cluster indicates that the combination is a functional combination.

As mentioned above, surprisingly, it was found that cannot simply be exchanged combination of CRISPR repeat-casbetween any cells (e.g., any of the strains, species or genera), as this necessarily results in functional combinations of CRISPR repeat-cas. Indeed, for the combination (combination of CRISPR repeat- caswere functional, they must be compatible. Thus, it is envisaged that it is impossible to include genescasor CRISPR repeats between different CRISPR loci while they are from the same cluster. Even more surprisingly, the clusters do not comply with the phylogeny of the organism". In particular, within the same organism can be several CRISPR. As a result, it is believed that the functional combination of CRISPR repeat-casrequires the combination was included in the cluster, in contrast to inclusion into the body.

For the avoidance of doubt, the term "cluster"as used in the present description, refers to a cluster of genes located in the same locus (typically forming an operon), but the output from the analysis of sequence comparison (e.g., comparative analysis of multiple sequences and/or alignments of multiple sequences and/or analysis by plotting points on a graph). Accordingly, in some embodiments, implementation, cluster analysis of CRISPR loci is performed using various methods known in this field (e.g., such as described in the present application is the analysis by plotting points on a graph or multiple alignment) with the subsequent calculation of the dendrogram. In some embodiments, the implementation, the cluster represents to the ACC, a family or group of sequences.

Mainly, the use of naturally occurring together combinations (combinations) of CRISPR repeat-casprovides interchange combinations and within, and between this, through this, providing the possibility of obtaining by means of genetic engineering stability of one strain, using a combination of another strain.

Bacteriophage

Used in the present description, the term "bacteriophage" (or "phage") has the usual meaning, understood in this area (i.e., the virus that selectively infects one or more bacterial species). Many bacteriophages specific to a particular genus or species or strain of bacteria. In some preferred embodiments, implementation, phages capable of infecting maternal bacteria and/or cells of the hosts. In some embodiments, implementation, bacteriophages are virulent for the parent bacteria. In some embodiments, implementation, phages are lytic, while in other embodiments, implementation, phages are lishennymi.

Lytic bacteriophage is a one that should political path through the completion of the lytic cycle, and not joining in lysogeny way. Lytic bacteriophage exposed to viral replication, leading to cell lysis is embrane, the destruction of cells and release of progeny particles of the bacteriophage capable of infecting other cells.

Lysogeny bacteriophage is the one who is able to join lysogeny the way in which the bacteriophage becomes dormant, passive part of the genome of the cells by the prior completion of its lytic cycle.

Bacteriophages, which are used in the present invention include, without limitation, the bacteriophages, which applies to any of the following families of viruses: Corticoviridae, Cystoviridae, Inoviridae, Leviviridae, Microviridae, Myoviridae, Podoviridae, Siphoviridae, or Tectiviridae. In some embodiments, implementation, finds particular use bacteriophage that infects bacteria pathogenic to plants and/or animals (including humans). In some particularly preferred embodiments, implementation, modulates the resistance of cells against bacteriophage.

In some particularly preferred embodiments, the implementation, the bacteriophage of the present invention include, without limitation bacteriophages capable of infecting a bacterium that naturally contains one or more CRISPR loci. The CRISPR loci have been identified in more than 40 prokaryotes (see, for example, Jansen et al., Mol. Environ., 43:1565-1575 [2002]; and (Mojica et al. [2005]), including, without limitation, Aeropyrum, Pyrobaculum, Sulfolobus, Archaeoglobus, Halocarcula, Methanbacterium, Methanococcus, Methanosarcina, Methanopyrus, Pyrococcus, Picrophilus, Thermoplasma, Corynebacterium, Mycobacterium, Streptomyces, Aquifex, Porphyromonas, Chlorobium, Thermus, Bacillus, Listeria, Staphylococcus, Clostridium, Thermoanaerobacter, Mycoplasma, Fusobacterium, Azarcus, Chromobacterium, Neisseria, Nitrosomonas, Desulfovibrio, Geobacter, Myxococcus, Campylobacter, Wolinella, Acinetobacter, Erwinia, Escherichia, Legionella, Methylococcus, Pasteurella, Photobacterium, Salmonella, Xanthamonas, Yersinia, Treponema and Thermotoga.

In some embodiments, implementation, bacteriophages include without limitation those bacteriophages capable of infecting bacteria belonging to the following genera: Escherichia, Shigella, Salmonella, Erwinia, Yersinia, Bacillus, Vibrio, Legionella, Pseudomonas, Neisseria, Bordetella, Helicobacter, Listeria, Agrobacterium, Staphylococcus, Streptococcus, Enterococcus, Clostridium, Corynebacterium, Mycobacterium, Treponema, Borrelia, Francisella, Brucella, and Xanthomonas.

In other additional embodiments, implementation, bacteriophages include without limitation those bacteriophages capable of infecting (or transducible) lactic acid bacteria, Bifidobacterium, Brevibacterium, Propionibacterium, Lactococcus, Streptococcus, Lactobacillus (e.g., L. acidophilus), Enterococcus, Pediococcus, Leuconostoc and Oenococcus.

In some embodiments, implementation, bacteriophages include without limitation those bacteriophages capable of infecting Lactococcus lacti (e.g., L. lactis ssp. lactis and L. lactis ssp. cremoris and L. lactis ssp. lactis biovar diacetylactis), Streptococcus thermophilus, Lactobacillus delbrueckii subspecies bulgaricus, Lactobacillus helveticus, Bifidobacterium lactis, Lactobacillus acidophilus, Lactobacillus casei, Bifidobacterium infantis, Lactobacillus paracasei, Lactobacillus salivarius, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus gsseri, Lactobacillus johnsonii or Bifidobacterium longum.

In some embodiments, implementation, bacteriophages include without limitation those bacteriophages capable of infecting any fermentative bacteria susceptible to destruction by infection with bacteriophage, including, without limitation, methods of obtaining antibiotics, amino acids and solvents. The products obtained by fermentation, which, as is well known, experienced infection with bacteriophage, and the corresponding positive fermentative bacteria include homemade cheese (Lactococcus lactis ssp. lactis, Lactococcus lactis subspecies cremoris), yogurt (Lactobacillus delbrueckii subspecies bulgaricus, Streptococcus thermophilus), Swiss cheese (S. thermophilus, Lactobacillus lactis, Lactobacillus helveticus), blue cheese (Leuconostoc cremoris), Italian cheese (L. Bulgaricus, S. thermophilus), viili (Lactococcus lactis subspecies cremoris, Lactococcus lactis subspecies lactis biovar diacetylactis, Leuconostoc cremoris), Yakult (Lactobacillus casei), casein (Lactococcus lactis subspecies cremoris), natto ((Bacillus subtilis var. natto), wine (Leuconostoc oenos), sake (Leuconostoc mesenteroides), polymyxin (Bacillus polymyxa), colistin (Bacillus colistrium), bacitracin (Bacillus licheniformis), L-glutamic acid (Brevibacterium lactofermentum, Microbacterium ammoniaphilum) and acetone and butanol (Clostridium acetobutylicum, Clostridium saccharoperbutylacetonicum).

In some preferred embodiments, implementation, bacteria, which are used in the present invention include, without limitation S. thermophilus, L. delbrueckii, subspecies bulgaricus and/or Lactobacillus acidophilus.

In some particularly site is titeling options implementation bacteriophages include without limitation those bacteriophages capable of infecting bacteria, which contain one or more heterologous CRISPR loci. In some embodiments, implementation, bacteriophages include one or more heterologous CRISPR loci and/or one or more heterologous genes cas. and/or one or more heterologous CRISPR repeats and/or one or more heterologous CRISPR spacers.

Infection of bacteria by phage occurs as a result of injection or transfer of phage DNA into cells. In some embodiments, implementation, infection leads to the expression (i.e. transcription and translation) of the nucleic acid of bacteriophage within the cell and the continuation of the life cycle of bacteriophage. In some embodiments, the implementation, including recombinant bacteriophage, are also expressed recombinant sequences within the genome of a phage (e.g., nucleic acid-reporters).

It was found that the sequence of the CRISPR spacers in prokaryotes often have significant similarities with a variety of DNA molecules, including such genetic elements as chromosomes, bacteriophages and conjugative plasmids. It was reported that cells carrying these CRISPR spacers, unable to become infected with molecules containing DNA sequences homologous to the spacers (see Mojica et al. [2005]).

In some embodiments, implementation of the present invention, one or more pseudo-spacers derived from the DNA of the bacteriophage, or the spacer(s) CRISPR, which (who) is / are complementary or homologous to one or more pseudo-spacer (the spacer) CRISPR are added within the CRISPR locus of the cells (e.g. cells of the recipient), to modulate (e.g., software), resistance to a specific bacteriophage, thus essentially preventing the attack of the phage.

In some preferred embodiments, implementation, targets are defined region within the genome of the phage to obtain pseudo-spacers, including, without limitation, genes encoding proteins specificity of the host, including those that provide recognition of the owner of a particular phage, such as helicase, primase, head or tail of structural proteins, proteins with conservative domain (for example, holing, lysine, and others), or conservative sequence among the important genes of the phage.

Any nucleic acid derived from the genome of the phage, can give immunity to phage when inserting, for example, between the two repeats in the active CRISPR locus. In some embodiments, implementation, immunity more "effective"when the CRISPR spacer corresponds to an internal sequence of the gene of the phage. In some particularly preferred embodiments, implementation of the IMM shall nite get even more "effective", when gene encodes a "core protein (e.g., antireceptor).

In some preferred embodiments, the implementation, the present invention relates to a method of making a cell (e.g. a bacterial cell) resistance to bacteriophage, comprising the stage of: (a) providing one or more pseudo CRISPR spacers, at least one bacteriophage; (b) identifying one or more functional combinations of CRISPR repeat-casin the cell, in at least one cell, which is essentially sensitive to the bacteriophage; and (C) genetic engineering of one or more CRISPR loci in essentially sensitive cell so that they contain one or more pseudo CRISPR spacers from bacteriophage or one or more spacer(s) CRISPR, which (who) is / are complementary or homologous to one or more pseudo-spacer (the spacer) CRISPR to give the cell stability.

In yet some additional embodiments, the implementation, the present invention relates to a method of making a cell (e.g. a bacterial cell) resistance to bacteriophage, comprising the stage of: (a) providing one or more pseudo CRISPR spacers, at least one bacteriophage; (b) identifying one or more functional combinations stand the ora CRISPR- casat least one cell, which is essentially sensitive to the bacteriophage; and (C) inserting one or more pseudo CRISPR spacers from bacteriophage or one or more spacers (spacers) CRISPR, which (who) is / are complementary or homologous to one or more pseudo-spacer (the spacer) CRISPR essentially in sensitive cell to make the cell essentially resistance to bacteriophage.

In yet some additional embodiments, the implementation, the present invention relates to methods of modulating isotype bacterial cells, comprising the stage of: (a) providing one or more pseudo CRISPR spacers, at least one bacteriophage; (b) identifying one or more functional combinations of CRISPR repeat-casin the cell, in at least one cell, which is essentially sensitive to the bacteriophage; and (C) genetic engineering of one or more CRISPR loci in essentially sensitive cell so that they contain one or more pseudo CRISPR spacers from bacteriophage or one or more spacer(s) CRISPR, which (who) is / are complementary or homologous to one or more pseudo-spacer (the spacer) CRISPR.

In still some other embodiments, the implementation of the present invention relative to the tsya to methods of modulating isotype bacterial cells, incorporating the following stages: (a) providing one or more pseudo CRISPR spacers, at least one bacteriophage; (b) identifying one or more functional combinations of CRISPR repeat-casat least one cell, which is essentially sensitive to the bacteriophage; and (C) inserting one or more pseudo CRISPR spacers from bacteriophage or one or more spacers (spacers) CRISPR, which (who) is / are complementary or homologous to one or more pseudo-spacer (the spacer) CRISPR essentially in the sensitive cell.

In yet some additional embodiments, the implementation, the present invention relates to a method of making a cell (e.g. a bacterial cell) resistance to bacteriophage, comprising the stage of: (i) identification of pseudo-CRISPR spacer in bacteriophage containing the nucleic acid target or the product of its transcription, against which will modulate stability; and (ii) modifying the sequence of the CRISPR spacer of the cell, so that the CRISPR spacer of the cell had homology with pseudo CRISPR spacer of the bacteriophage containing the nucleic acid-target.

In some embodiments, the implementation, the present invention relates to a method of making a cell (e.g. a bacterial cell) resistance to the bacteria is of riffage, incorporating the following stages: (i) identification of pseudo-CRISPR spacer in bacteriophage containing the nucleic acid target or its expression product, against which will modulate stability; and (ii) modifying the sequence of the CRISPR spacer of the cell, so that the CRISPR spacer of the cell had 100% homology or identity with pseudo CRISPR spacer of the bacteriophage containing the nucleic acid-target.

In yet some additional embodiments, the implementation, the present invention relates to methods of modulating isotype bacterial cells, comprising the stage of: (i) identification of pseudo-CRISPR spacer in bacteriophage containing the nucleic acid target or its expression product, against which will modulate stability; and (ii) modifying the sequence of the CRISPR spacer of the cell, so that the CRISPR spacer of the cell had homology with pseudo CRISPR spacer of the bacteriophage containing the nucleic acid-target.

In some embodiments, the implementation, the present invention relates to methods of modulating isotype bacterial cells, comprising the stage of: (i) identification of pseudo-CRISPR spacer in bacteriophage containing the nucleic acid target or its expression product, against which will modulate stability; and (ii) modifying the sequence of the CRISPR spacer of the cell so that Acer CRISPR cells had 100% homology or identity with pseudo CRISPR spacer of the bacteriophage, containing the nucleic acid-target.

In some embodiments, the implementation, the CRISPR spacer of the bacterial cell has 100% homology or identity with the sequence (such as pseudo-CRISPR spacer) in the bacteriophage containing the nucleic acid-target.

In some alternative embodiments, the implementation, the CRISPR spacer of the bacterial cell forms a part of the CRISPR locus containing functional combination of CRISPR repeat-casas described in this application.

In some particularly preferred embodiments, implementation of the nucleic acid target or the product of its transcription in bacteriophage is a highly conservative sequence of the nucleic acid. In some other preferred embodiments, implementation of the nucleic acid target or the product of its transcription in bacteriophage is a gene that encodes a protein specificity of the owner. In some additional embodiments, implementation of the nucleic acid target or the product of its transcription in bacteriophage encodes an enzyme that is essential for the survival, replication and/or growth of bacteriophage. In other additional embodiments, implementation of the nucleic acid target or the product of its transcription in bacteriophage encodes a helicase, primase, head or tail structure the structural protein or a protein with the conservative domain (for example, holing, lysine and so on).

In some preferred embodiments, implementation, obtained bacterial cells that have reduced susceptibility to the multiplication of bacteriophage or infection." This term is used in the present description, refers to the bacteria as having low or absent sensitivity to the multiplication of bacteriophage or infection for them, compared with wild-type bacteria under cultivation (for example, in the dairy environment).

In some embodiments, implementation, bacterial cells exhibit low susceptibility to the multiplication of bacteriophage". This term refers to the level of reproduction of bacteriophage in bacteria, which is below levels that would cause adverse effects on the culture in a given period of time. Such harmful effects on culture include, without limitation, the lack of collapse of milk during the production of fermented dairy products (e.g. yoghurt or cheese), inadequate or slow the decrease in pH during the manufacture of fermented dairy products (e.g. yoghurt or cheese), slow ripening of the cheese and/or damage the texture of the food product to such an extent that it becomes unappetizing or unsuitable for use.

For the equivalent set of culturing conditions, bacterial susceptibility to the tank is eritage of the present invention in General is expressed in comparison with wild-type bacteria. In some embodiments, implementation, bacteria are about 100 times lower (Efficiency belascoaran [EOP]=10-2), preferably, about 1000 times lower (EOP=10-3), preferably, about 10,000 times lower (EOP=10-4), and most preferably, about 100,000 times lower (EOP=10-5). In some preferred embodiments, the implementation, the level of reproduction of bacteriophages in culture is measured after about 14 hours of incubation, the culture, preferably after about 12 hours, and more preferably after about 7 hours, more preferably after about 6 hours, more preferably after about 5 hours, and most preferably, about 4 hours.

In additional embodiments, the implementation, the present invention relates to a method of making the sensitivity of the cells (e.g. bacterial cells) against bacteriophage, comprising the stage of: (a) providing a pseudo CRISPR spacer, at least one bacteriophage; (b) identifying one or more functional combinations of CRISPR repeat-casin the cell, which is essentially resistant to bacteriophage; and (C) genetic engineering of one or more CRISPR loci essentially in sensitive cell so that they contain one or more pseudo-spacers or one or more of the LCA the spacer (spacer) CRISPR, which (who) is / are complementary or homologous to one or more pseudo-spacer (the spacer) CRISPR, which have reduced the degree of homology, compared with one or more CRISPR loci essentially in sustainable cell.

In other embodiments, the implementation, the present invention relates to methods of modulating (e.g., reduction) of lithotype cells (such as bacterial cells)that contains one or more cas genes or proteins, or one or more, preferably, two or more CRISPR repeat, comprising the stage of: (i) identification of pseudo-CRISPR spacer in bacteriophage against which will modulate stability; and (ii) modifying the sequence of the CRISPR spacer of the cell, so that the CRISPR spacer of the cell had reduced the degree of homology with pseudo CRISPR spacer of the bacteriophage containing the nucleic acid target.

In some embodiments, the implementation, the present invention relates to methods of modulating (e.g., reduce or decrease) the resistance of a bacterial cell that contains one or more cas genes or proteins, or one or more, preferably, two or more CRISPR repeat, against bacteriophage, comprising the stage of: (i) identifying one or more pseudo CRISPR spacers in bacteriophage against which will modulate the CA shall ascioti; and (ii) modification of the CRISPR spacer in a bacterial cell, which will modulate the resistance, so that the CRISPR spacer had a lower degree of homology with pseudo-spacer (the spacer) CRISPR bacteriophage against which will modulate the resistance.

In some embodiments, the implementation, the CRISPR spacer of the cell has a reduced degree of homology (for example, reducing the homology of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 90 or about 95%), compared with the pseudo-spacer (the spacer) CRISPR bacteriophage against which will modulate the resistance.

In some embodiments, implementation, bacterial cells obtained using the methods of the present invention, so that the cells had an increased susceptibility to the multiplication of bacteriophage". Used in the present description, the term refers to bacteria that have increased or higher susceptibility to the growth of bacteriophage, compared with wild-type bacteria during cultivation the AI (for example, in the dairy environment).

In some embodiments, the implementation, the term "high susceptibility to the multiplication of bacteriophage" refers to the reproduction of bacteriophage in bacteria, which is higher than the level that would cause adverse effects on the culture in a given period of time. Such harmful effects on culture include, without limitation, the lack of collapse of milk during the production of fermented dairy products (e.g. yoghurt or cheese), inadequate or slow the decrease in pH during the manufacture of fermented dairy products (e.g. yoghurt or cheese), slow ripening of the cheese and/or damage the texture of the food product to such an extent that it becomes unappetizing or unsuitable for use.

For the equivalent set of culturing conditions, bacterial susceptibility to bacteriophage of the present invention in General is expressed in comparison with wild-type bacteria. In some embodiments, implementation, bacteria are about 100 times lower (Efficiency belascoaran [EOP]=10-2), preferably, about 1000 times lower (EOP=10-3), preferably, about 10,000 times lower (EOP=10-4), and most preferably, about 100,000 times lower (EOP=10-5). In some preferred embodiments, domestic the, the reproduction of bacteriophages in culture is measured after about 14 hours of incubation, the culture, preferably after about 12 hours, and more preferably after about 7 hours, more preferably after about 6 hours, more preferably after about 5 hours, and most preferably, about 4 hours.

In some preferred embodiments, the implementation, the CRISPR spacer planiruetsja two CRISPR repeats (i.e., the CRISPR spacer has at least one CRISPR repeat on each side).

In some embodiments, implementation of the present invention, the parent bacterium (e.g., "parent bacterial strain) exposed to (for example, repeatedly, sequentially, simultaneously or essentially simultaneously) more than one bacteriophage (e.g., mixtures of one or more phages). In some embodiments, implementation of the parent bacterial strain sensitive to each of bacteriophages, which are exposed to in the mix, whereas in other embodiments, implementation, bacterial strain sensitive to some of bacteriophages, but resistant to others.

Used in the present description, the term "marker sequence" refers to a part of the additional DNA fragment, which was obtained from the genome of one or more bacteriophages(e.g., "plus-circuit" of the genome of one or more bacteriophages)that affect the parent bacterium in accordance with the methods of the present invention, and are used as labels or markings (e.g., providing an unusual label or unusual markings).

Marking sequence is usually a sequence that is naturally occurring in the bacteriophage. Preferably, a marking sequence has an identity with naturally occurring in the bacteriophage sequence at least about 90%, about 95%, about 96%, about 97%, about 98%, about 99% (e.g., the genome of the bacteriophage from which it is derived). In the most preferred options for implementation, marking the sequence has an identity of about 100% (e.g., the genome of the bacteriophage, from which he received).

In some embodiments, implementation, marking the sequence has an identity of less than about 40%, about 30%, about 20%, about 10%, about 5%, about 4%, about 3%, about 2%, about 1% or about 0% with any other CRISPR spacers or containing CRISPR spacers in one or more CRISPR loci labeled bacteria.

In some embodiments, implementation, marking sequence is identically is here less than about 40%, about 30%, about 20%, about 10%, about 5%, about 4%, about 3%, about 2%, about 1% or about 0% with any other sequence in one or more CRISPR loci labeled bacteria.

In some additional embodiments, implementation, marking sequence that is identical to sequence (such as the CRISPR spacer) in the CRISPR locus of bacteria. In some other embodiments, implementation, marking sequence that is identical sequence that is identical to sequence (such as the CRISPR spacer) in the CRISPR locus of the bacteria away from the polymorphism of one or more single nucleotide (e.g., polymorphism of one or two single nucleotide).

In some preferred embodiments, implementation, marking sequence has a length of at least about 20 nucleotides, while in some particularly preferred embodiments, implement, it has a length of from about 20 to about 58 nucleotides.

In some particularly preferred embodiments, the implementation of at least one marker sequence is integrated into the parent bacterium. In some additional embodiments, implementation, also integrates at least one duplicated consequently the industry (for example, duplicated the sequence of the CRISPR repeat)derived from the genome of the parent bacteria or one or more of the plasmids maternal bacteria (for example, megaplasmid). It is not intended that the present invention limited to any particular mechanism or theory. However, it is believed that is copied or substituted by at least one duplicated sequence of the genome of the parent bacteria. In particular, it is believed that usually duplicated the sequence of the CRISPR repeat in the CRISPR locus and the marker sequence integrated into the genome of a bacterium directly (i.e. below during transcription) new duplicated CRISPR repeat.

In some particularly preferred embodiments, the implementation of at least one duplicated sequence is a sequence of the CRISPR repeat, which has an identity of at least about 90%, about 95%, about 96%, about 97%, about 98% or about 99% with CRISPR repeats in one or more CRISPR locus of the parent bacterium and/or labeled bacteria. Most preferably, at least one duplicated sequence is a sequence of the CRISPR repeat, which has an identity of at least about 100% with CRISPR repeats in one or more CRISPR loci m is turinskoi bacteria and/or labeled bacteria. In some preferred embodiments, implementation, duplicated sequence has a length of at least 24 nucleotides, while in some particularly preferred embodiments, implementation, duplicated, it has a length of from about 24 to about 40 nucleotides.

In some preferred embodiments, the implementation of at least one marker sequence and at least one duplicated sequence is integrated into the parent bacterium. It is not intended that the present invention limited to any particular mechanism or theory. However, it is believed that each time a marking sequence integrates into the genome of the parent bacteria, it is accompanied by the repeated, sequential, simultaneous or substantially simultaneous integration of the at least one duplicated sequence. Accordingly, at least one pair of sequences containing a marking sequence and duplicated sequence, integrated into the parent bacterium through it leading to obtain labeled bacteria.

In some preferred embodiments, the implementation of at least one marker sequence and at least one duplicated posledovatelno the ü integrate next door to each other. Preferably, at least one marker sequence and at least one duplicated sequence is integrated directly adjacent to each other so that no intermediate sequences of nucleotides.

In some embodiments, implementation, duplicated sequence attached, linked or merged with one end (for example, the 5' end or the end 3') marking sequence. Preferably, the duplicated sequence is connected, attached or fused to the 5' end of coding sequence. Accordingly, after integration one pair of sequence, duplicated sequence is a first sequence on the 5' end of the CRISPR locus and the marker sequence is a second (e.g., following) the sequence of the CRISPR locus, following in the course of transcription of duplicated sequence. In some preferred embodiments, implementation of the sequence directly attached, connected, or directly fused between the duplicated sequence and marking sequence no intermediate nucleotides.

Thus, in some embodiments, the implement, a pair of duplicated sequence and marking the consequences of the successive integrates into the genome of the parent bacteria to obtain labeled bacteria. Duplicated sequence occurs, may be obtained or can be obtained from the genome of the parent bacteria, and marking the sequence occurs, may be obtained or can be obtained from the genome of the bacteriophage, which is used to maternal infection bacteria.

To my surprise, it was even found that in some embodiments, implementation, multiple pairs of sequences integrated into the genome of the parent bacteria. In accordance with these variants of implementation, multiple pairs contain the first pair containing the duplicated sequence and marking sequence, and the second pair containing the second duplicated sequence and the second marking sequence. The second duplicated sequence usually contains the same sequence (for example, identity of more than about 95%, about 96%, about 97%, about 98%, about 99% or about 100%) as the first duplicated sequence. Marking sequence usually contains a sequence that is different (e.g., identity of less than about 40%, about 30%, about 20%, about 10%, about 5%, about 4%, about 3%, about 2%, about 1% or about 0%) of the first marking sequence is. This is also the case in the variants of implementation, which integrated an additional pair of sequences.

Accordingly, the configuration of multiple pairs typically contains:

[duplicated sequence - marking sequence]n,

where n=2, 3, 4, 5, 6 or more.

Preferably, the configuration of multiple pairs typically contains:

[repeat CRISPR - marking sequence]n,

where n=2, 3, 4, 5, 6 or more.

In some embodiments, implementation, configuration, multiple pairs typically contains:

5'-[duplicated sequence - marking sequence]n-3'

where n=2, 3, 4, 5, 6 or more.

Preferably, the configuration of multiple pairs typically contains:

5'-[ CRISPR repeat - marking sequence]n-3'

where n=2, 3, 4, 5, 6 or more.

Accordingly, in some embodiments, implementation, multiple pairs integrated into the parent bacterium. In some embodiments, implementation, marking sequence is integrated adjacent to: (i) duplicated sequence that is homologous (e.g., identical to) the naturally occurring sequence in the parent bacteria; (ii) duplicated sequence that is homologous (e.g., identical to) the natural the public occurring sequences in the CRISPR locus of the parent bacterium; or (iii) is preferable, duplicated sequence that is homologous (e.g., identical to) the naturally occurring CRISPR repeat in the CRISPR locus of the parent bacterium.

After each exposure to the parent bacterium and the bacteriophage in independent experiments, a marking sequence in each of the labeled bacteria represents a different nucleotide sequence, thereby creating a sequence, which is unusual for each bacteria. Thus, without regard to any particular theory, it is believed that after exposure of the bacteriophage to the parent bacterium, a marking sequence that is integrated into the parent bacterium, obviously, randomly selected from the genome of the bacteriophage. However, it is not intended that the present invention is limited to random phenomena integration.

Mostly, these amazing data is used in the context of the present invention due to the fact that a randomly selected marking sequence provides an unusual label or the label in the labeled bacteria. Surprisingly, it was also found that when the same parent bacterium affects the same bacteriophage, marking sequence that is integrated into the independence of the s/separate experiments, has a different sequence, thereby resulting in obtaining unusual labels in the labeled bacteria after each impact.

In some embodiments, implementation, randomly selected marking sequence is identified in the labeled bacteria on the basis of one or more of the following properties of coding sequences:

(1) Localization of coding sequences in one or more CRISPR loci are not sensitive to the bacteriophage mutant. As described in this application, the marking sequence is usually localized on one and/or both ends (e.g., the 5' end and/or the end of a 3', preferably, the 5'end) of the CRISPR locus labeled bacteria;

(2) Marking the sequence has a high degree of homology or identity (for example, identity 100%) with the sequence of the genome of the bacteriophage, which affected the parent bacterium; and/or

(3) the Marking sequence fused, linked or attached (e.g., directly fused, linked or attached)at least one sequence (for example, CRISPR repeat), which is duplicated from the genome of the parent bacteria. Typically, as described in this application, this additional pair of sequences localized on one or both ends (e.g., Conte' and/or the end of a 3', preferably, the 5'end) of the CRISPR locus labeled bacteria.

In some described in this application variants implementation markings/labels, one or more duplicated sequences (e.g., duplicated the CRISPR repeat of maternal bacteria) are integrated into the CRISPR locus of the parent bacterium. In some preferred embodiments implement one or more described in this application pairs of duplicated sequence - marking sequence integrated into the CRISPR locus of the parent bacterium. In some embodiments, implementation, marking sequence (sequence) and/or duplicated sequence (sequence) integrated within the CRISPR locus of the parent bacterium. In some other embodiments, implementation, marking sequence (sequence) and/or duplicated sequence (sequence) integrated on one or both ends of the CRISPR locus of the parent bacterium. In some embodiments, implementation, marking sequence (sequence) and/or duplicated sequence (sequence) integrated at both ends of the CRISPR locus of the parent bacterium so that the sequence located on the 5' end and the end 3' of the CRISPR locus. One of duplizieren the x sequences will typically represent the first sequence at the 5' end of the CRISPR locus, and marking the sequence will be directly below during transcription from the duplicated sequence. Another duplicated sequence will represent the last sequence at the end 3' of the CRISPR locus and the marker sequence will be directly above during transcription from the duplicated sequence.

In some embodiments, implementation, marking sequence (sequence) and/or duplicated sequence (sequence) integrated in one or more CRISPR loci. In some embodiments, implementation, marking sequence (sequence) and/or duplicated sequence (sequence) integrated on one end of the CRISPR locus of the parent bacterium so that the sequence (sequence) are at the end 3' of the CRISPR locus. Duplicated sequence will represent the last sequence at the end 3' of the CRISPR locus and the marker sequence will be directly above during transcription from the duplicated sequence. Preferably, a marking sequence (sequence) and/or duplicated sequence (sequence) integrated the us on one end of the CRISPR locus of the parent bacterium so, what sequence are the 5' end of the CRISPR locus. Duplicated sequence is a first sequence on the 5' end of the CRISPR locus and the marker sequence is directly below in the course of transcription from the duplicated sequence.

As described in this application, a marking sequence (sequence) is a specific strain of the label in the sense that the marking sequence, which is integrated or inserted from bacteriophage in the parent bacterium is different each time the parent bacterium (e.g., same parent bacterium) is subjected to bacteriophage (e.g., bacteriophage). Therefore, a marking sequence is used as an unusual label for a given bacterial strain.

Marking sequence (sequence) and/or duplicated sequence (sequence) integrated in one or several different CRISPR loci, while in other embodiments, implementation, two or more different marking sequence and/or duplicated sequences are integrated in a single CRISPR locus, and in some embodiments, implementation, each of the two or more different marking pic is of egovernance and/or duplicated sequences integrated in two or more different CRISPR loci. Each of the marking sequences from each of the bacteriophage and/or each of the duplicated sequences (duplicated CRISPR repeat) from the parent bacteria can be integrated in the same CRISPR locus.

In some embodiments, implementation, each of the marking sequences and/or each of the duplicated sequences are integrated on one or both ends of the same CRISPR locus. In some other embodiments, implementation, each of the marking sequences and/or each of the duplicated sequences integrated at the 5' end and/or 3' of the same CRISPR locus. Preferably, each of the marking sequences and/or each of the duplicated sequences integrated at the 5' end of the same CRISPR locus. In some embodiments, implementation, each of the marking sequences and/or each of the duplicated sequences from maternal bacteria integrate again, simultaneously or essentially simultaneously. In some embodiments, implementation, each of the marking sequences and/or each of the duplicated sequences from maternal bacteria are integrated sequentially, whereby the first color sequence and/or the first dup is itirapina sequence integrates into the parent bacterium. The second marking sequence from the second bacteriophage and/or other duplicated sequence is then integrated into the parent bacterium. Appropriately, a marking sequence and/or duplicated sequence integrates into the chromosomal DNA of the parent bacteria.

In some embodiments, implementation, each of the marking sequences and/or each of the duplicated sequences integrated at one end (for example, the 5'end) of the same CRISPR locus adjacent (e.g., adjacent) to each other. Thus, in some embodiments, implementation, each of the marking sequences and/or each of the duplicated sequences integrated in series, whereby the first sequence is integrated into the parent bacterium at one end (e.g., within or on the 5' end and/or end 3') of the CRISPR locus. Then the second marking sequence and/or duplicated sequence can be integrated into the parent bacterium adjacent (e.g., directly adjacent) to the first pair of sequences. In some embodiments, the implementation, the second sequence are integrated into the parent bacterium adjacent (e.g., directly adjacent) to the 5' end or the end 3' of the first on is sledovatelnot. Preferably, the second sequence are integrated into the parent bacterium adjacent (e.g., directly adjacent) to the end 3' of the first sequence, etc. In some embodiments, implementation, each of the sequences are integrated adjacent (e.g., adjacent) to each other within the end of the 3' and/or 5' end of the same CRISPR locus of the parent bacterium. In some preferred embodiments, implementation, each of the sequences are integrated adjacent (e.g., adjacent) to each other at the 5' end of the same CRISPR locus of the parent bacterium. Preferably, each of the sequences is integrated adjacent (e.g., adjacent) to each other above during transcription of the 5' end of the CRISPR locus of the parent bacterium. Preferably, each of the sequences is integrated adjacent (e.g., adjacent) to each other above during transcription 5' CRISPR repeat of the CRISPR locus of the parent bacterium. Most preferably, each of the sequences is integrated adjacent (e.g., adjacent) to each other above during transcription of the first 5' of the CRISPR repeat of the CRISPR locus of the parent bacterium.

Labeled bacteria

Used in the present description, the term "labeled bacteria" and "labeled bacterium" refers to the parent bacteria or parent bacterial strain, the one or more CRISPR loci or part of them have been modified (for example, motivovany) in such a way that they are insensitive to one or more bacteriophages, which was able to influence them. As additional details are described in the present application, in some embodiments, implementation of the tagged bacterium affects more than one bacteriophage (e.g., or repeatedly, sequentially or simultaneously), so it accumulates one or more genomic modifications within one or more CRISPR loci in such a way that they become insensitive to each of bacteriophages, which they wrought.

To infect cells, the bacteriophage injects or transfers its nucleic acid into the cell when the nucleic acid of the phage existing independently of the genome of the cell. In some embodiments, implementation, infection leads to expression (i.e. transcription and translation) of the nucleic acid of bacteriophage within the cell and the continuation of the life cycle of bacteriophage.

In some embodiments, implementation, after exposure to bacteriophage labeled bacterium has reduced or absent susceptibility to infection by bacteriophage and/or reproduction, compared with the parent bacterium. Used in the present description, the term "reduced or absent susceptibility to infection by bacteriophage and/or its reproduction" of the means, the level of infection with bacteriophage and/or its reproduction in labeled bacteria does not cause harmful effects on the labeled bacteria.

Thus, in some embodiments, implementation of the present invention, the parent bacterium is not destroyed after exposure to bacteriophage due to mutations of the parent bacteria so that it becomes sensitive to the bacteriophage.

In some embodiments, implementation, labeled bacteria insensitive or substantially insensitive to further infection by the bacteriophage and/or its reproduction. In additional embodiments, implementation, labeled bacteria insensitive or substantially insensitive to one or more mechanisms that the bacteriophage uses for infection and/or multiplication of bacteria. In some embodiments, implementation, labeled bacteria insensitive or substantially insensitive to all mechanisms that the bacteriophage uses for infection and/or multiplication of bacteria. In other additional embodiments, implementation, labeled bacteria develops one or more mechanisms that weaken, inactivate or destroy the bacteriophage during the cycle of infection. In some other embodiments, the implementation, the present invention relates to labeled strains selected standard procedures SK is hininga, known in this field, to highlight insensitive to phage mutants.

In some embodiments, implementation of the present invention, labeled bacterium containing a marking sequence of the CRISPR locus that is not present in the parent bacterium is selected after comparing the CRISPR locus or a part thereof from the parent bacterium and labeled bacteria.

In some preferred embodiments, the implementation of the selected labeled bacteria containing within or at the 5' end and/or the end 3' of the CRISPR locus of the additional DNA fragment that is not present in the parent bacteria. Preferably, the selected labeled bacterium containing a marking sequence adjacent (e.g., directly adjacent) to the end 3' of the newly duplicated sequences in the CRISPR locus labeled bacteria, which is not present in the parent bacteria. Most preferably, is selected labeled bacterium containing a marking sequence adjacent (e.g., directly adjacent) to the end 3' of the first CRISPR repeat of the CRISPR locus in labeled bacteria, which is not present in the parent bacteria.

In some embodiments, implement, allocate and/or cloned marking sequence (e.g., one or more marking after the of euteleostei). In some other embodiments, implementation, sequeiros marking sequence (e.g., one or more marker sequences). These embodiments of benefit, because they not only provide information about the localization of coding sequences within the CRISPR locus, but also its specific sequence. In some embodiments, implementation, this information is stored in the database, thereby providing unusual label for this bacteria, as well as a means for subsequent tracking and/or identification of bacteria.

When a known sequence of coding sequences in the labeled bacteria, one marking the sequence used in the identification of bacteria. Using a variety of methods known in this field and described in this application, determine the sequence and/or localization of coding sequence. This sequence is then mapped to, for example, with a database of bacterial sequences and/or the database of sequences of bacteriophages and/or database labels/labels for the identification of bacteria.

The donor organism

Used in some embodiments of the implementation of the term "Monarchianism" refers to an organism or cell, which received the CRISPR repeat and/or genecas,and/or their combination (combination) and/or the CRISPR spacers. In some embodiments, the implementation, the term "donor organism" refers to an organism or cell from which the received one or more, preferably, two or more CRISPR repeat and/or one or more genescasand/or their combination (combination) and/or CRISPR spacers. They may be the same or different. In some embodiments, the implementation, the CRISPR spacer and/or pseudospace CRISPR obtained synthetically. In some embodiments, the implementation of the donor organism or cell contains one or more CRISPR spacers that give specific immunity against nucleic acid target and the product of its transcription. In additional embodiments, the implementation of the donor organism or cell from which the obtained genecasand/or the CRISPR repeat and/or their combination, is also a cell/organism of the recipient for recombinant CRISPR locus. They may be the same or different. In other embodiments, the implementation of the donor organism or cell from which the received CRISPR spacer is a cell/organism of the recipient for recombinant CRISPR locus. They may be the same or different. In the variants of implementation, in which the donor organism is bacterial the bacterial cell, the donor organism usually contains a CRISPR spacer, which gives specific immunity against nucleic acid-target or product its transcription. In some embodiments, the implementation, the organism is a bacterial cell, while in other embodiments, it is a bacteriophage.

A host cell

Used in the present description, the term "a host cell" refers to any cell that contains a combination of, the construct or vector, and the like, in accordance with the present invention. In some embodiments, implementation, cell host transformed or transfected with a nucleotide sequence contained in the vector (for example, a cloning vector). In some embodiments, the implementation, the nucleotide sequence can be carried in the vector for replication and/or expression of the nucleotide sequence. Cells are selected to be compatible with the vector and in some embodiments, implementation, prokaryotic (e.g., bacterial) cells.

Cell-recipient

Used in the present description, the term "cell-recipient" refers to any cell which is modulated or should be modulated resistance against nucleic acid-target or product its transcription. Not the which options implementation cell-recipient refers to any cell containing a recombinant nucleic acid in accordance with the present invention. In some embodiments, implementation, cell-recipient contains one or more, preferably, two or more CRISPR repeats and one or more genes or proteinscas. Appropriately, the CRISPR repeats and genes or proteinscasform a functional combination of the cell-recipient, as described in this application. In some other embodiments, implementation, cell-recipient contains one or more modified CRISPR repeats and/or one or more modified genes or proteinscas. Appropriately modified CRISPR repeats and/or modified genes or proteinscasform a functional combination of the cell-recipient, as described in this application. In some embodiments, implementation, cell-recipient contains one or more genetically engineered CRISPR repeats and/or one or more genetically engineered genes or proteinscas. Appropriately, genetically engineered CRISPR repeats and/or genetically engineered genes or proteinscasform a functional combination of the cell-recipient, as described in this application. In some alternative embodiments, about what westline, cell-recipient contains one or more recombinant CRISPR repeats and/or one or more recombinant genes or proteinscas. Appropriately, recombinant CRISPR repeats and/or recombinant genes or proteinscasform a functional combination of the cell-recipient, as described in this application. In yet some additional embodiments, the implementation, the cell-recipient contains one or more naturally occurring CRISPR repeats and one or more naturally occurring genes or proteincas. Properly, repeat(s) and CRISPR gene(s) or proteinscasform a functional combination.

In some embodiments, implementation, cell-recipient contains a combination of one or more modified, genetically engineered, recombinant or naturally occurring CRISPR repeats and one or more modified, genetically engineered, recombinant or naturally occurring genes or proteincas. Suitably, one or more modified, genetically engineered, recombinant or naturally occurring repeat(s) CRISPR or one or more modified, genetically engineered, recombinant or naturally occurring genes or proteincasabout the will is formed functional combination.

In some embodiments, implementation, cell-recipient is a prokaryotic cell. In some preferred embodiments, the implementation, the cell-recipient is a bacterial cell. Suitable bacterial cells described in this application. In some embodiments, implementation of the bacterial cell is selected from a species of lactic acid bacteria, a Brevibacterium, a Propionibacterium, a Lactococcus, a Streptococcus, a Lactobacillus, including Enterococcus species, Pediococcus species, a Leuconostoc and species Oenococcus. Suitable species include, without limitation Lactococcus lactis, including Lactococcus lactis ssp. lactis and Lactococcus lactis ssp. cremoris, Lactococcus lactis subspecies cremoris, Leuconostoc sp., Lactococcus lactis subspecies lactis biovar, Streptococcus thermophilus, Lactobacillus delbrueckii subspecies bulgaricus and Lactobacillus helveticus, Bifidobacterium lactis, Lactobacillus acidophilus, Lactobacillus casei.

In some embodiments, the implementation of which will modulate the stability of the cell, a bacterial cell is used for the fermentation of meat (including beef, pork and poultry), including, without limitation, lactic acid bacteria, Pediococcus cerevisiae, Lactobacillus plantarum, Lactobacillus brevis, Micrococcus species, Lactobacillus sakei, Lactobacillus curvatus, Pediococcus pentosaceus, Staphylococcus xylosus and Staphylococcus vitulinus and mixtures thereof, as is well known in this field. In some alternative embodiments, the implementation for the fermentation of vegetables (such as carrots, cucumbers, tomatoes, peppers, and cabbage) COI the box is used bacterial cell, including, without limitation, Lactobacillus plantatum, Lactobacillus brevis, Leuconostoc mesenteroides, Pediococcus pentosaceusand mixtures thereof, as is well known in this field. In some alternative embodiments, the implementation, the bacterial cell is used for the fermentation of the dough obtained from cereals (e.g. wheat, rye, rice, oats, barley and maize). In some other embodiments, implementation of the bacterial cell used for the production of wine. Usually, this is achieved by fermentation of fruit juice, usually grape juice. In some embodiments, the implementation, the bacterial cell is used for fermentation of milk to get the cheese (e.g., Lactobacillus delbrueckii subspecies bulgaricus, Lactobacillus helveticus, Streptococcus thermophilus, Lactococcus lactis ssp. lactis, Lactococcus lactis subspecies cremoris, Lactococcus lactis subspecies lactis biovar diacetylactis, Lactococcus, Bifidobacterium and Enterococcus and their mixtures), as is well known in this field. In some other embodiments, the implementation, the bacterial cell is used for the fermentation of eggs (e.g., Pediococcus pentosaceus, Lactobacillus plantarum and their mixtures), as is well known in this field. In some other embodiments, the implementation, the bacterial cell is used in the cosmetic or pharmaceutical compositions.

In some embodiments, implementation, cage, which will modulate the resistance, is a bacterium that naturally contains one or more locus is in CRISPR. The CRISPR loci have been identified in more than 40 prokaryotes (see adhesive et al. [2005], above), including, without limitation, Aeropyrum, Pyrobaculum, Sulfolobus, Archaeoglobus, Halocarcula, Methanobacterium, Methanococcus, Methanosarcina, Methanopyrus, Pyrococcus, Picrophilus, Thermoplasma, Corynebacterium, Mycobacterium, Streptomyces, Aquifex, Porphyromonas, Chlorobium, Thermus, Bacillus, Listeria, Staphylococcus, Clostridium, Thermoanaerobacter, Mycoplasma, Fusobacteriutn, Azarcus, Chromobacterium, Neisseria, Nitrosomonas, Desulfovibrio, Geobacter, Myxococcus, Campylobacter, Wolinella, Acinetobacter, Erwinia, Escherichia, Legionella, Methylococcus, Pasteurella, Photobacterium, Salmonella, Xanthamonas, Yersinia, Treponema and Thermotoga.

The parent strain of bacteria

Used in the present description, the terms "parent bacterium and maternal bacteria" and "parent strain" refers to any bacteria/bacteria/strains, which affects one or more bacteriophages. In some embodiments, implementation, bacteriophages are virulent for the parent bacterial strain, whereas in other embodiments, implementation, they are not virulent. In some particularly preferred embodiments, implementation, maternal bacteria susceptible to a virulent phage. In some preferred embodiments, implementation of the parent strain with a bacteriophage. In some particularly preferred embodiments, implementation, infection by the phage attaches to the parent bacteria/strain or subpopulations insensitivity to future infections tank is areopagos. In some preferred embodiments, exercise, infection, maternal bacteria" one or more bacteriophages leads to the creation of tagged strain, which can be selected on the basis of its insensitivity bacteriophage. In some preferred embodiments, the implementation, "resistant to bacteriophage mutants" are bacteria that are marked or the state in accordance with the methods of the present invention. In some embodiments, implementation, maternal bacteria are bacterial strains wild type. In some preferred embodiments, implementation, maternal bacteria are bacterial strains wild-type bacteria, which have not previously been infected with any of the bacteriophage. In some preferred embodiments, implementation, maternal bacteria are bacterial strains wild-type bacteria, which have not been previously marked or the state, while in some alternative embodiments, implementation, maternal bacteria are resistant to bacteriophage mutants that have been previously marked or state.

In some particularly preferred embodiments, the implementation, the parent bacterium selected from any bacteria that naturally contains one or more lock the owls CRISPR. As mentioned above, the CRISPR loci have been identified in more than 40 prokaryotes (see adhesive et al. [2005], above), including, without limitation, Aeropyrum, Pyrobaculum, Sulfolobus, Archaeoglobus, Halocarcula, Methanobacterium, Methanococcus, Methanosarcina, Methanopyrus, Pyrococcus, Picrophilus, Thermoplasma, Corynebacterium, Mycobacterium, Streptomyces, Aquifex, Porphyromonas, Chlorobium, Thermus, Bacillus, Listeria, Staphylococcus, Clostridium, Thermoanaerobacter, Mycoplasma, Fusobacterium, Azarcus, Chromobacterium, Neisseria, Nitrosomonas, Desulfovibrio, Geobacter, Myxococcus, Campylobacter, Wolinella, Acinetobacter, Erwinia, Escherichia, Legionella, Methylococcus, Pasteurella, Photobacterium, Salmonella, Xanthamonas, Yersinia, Treponema and Thermotoga.

In some embodiments, the implementation, the parent bacterium contains one or more heterologous CRISPR spacers, one or more CRISPR repeats and/or one or more heterologous genescas. In some alternative embodiments, the implementation, the parent bacterium contains one or more heterologous CRISPR loci, preferably, one or more full of CRISPR loci. In some other embodiments, the implementation, the parent bacterium naturally contains one or more CRISPR loci, and also contains one or more heterologous CRISPR spacers, one or more heterologous CRISPR repeats, and/or one or more heterologous genescas. In some additional embodiments, the implementation, the parent bacterium naturally contains one or more CRISPR loci, and also contains one or a number of the heterologous CRISPR loci, preferably, one or more full of CRISPR loci.

In some preferred embodiments, implementation, resistant to phage a subpopulation created by the impact on maternal bacteria, at least one phage, is a pure culture. However, it is not intended that the present invention is limited to pure cultures of bacterial strains, variants and phage. Indeed, it is assumed that the present invention covers a mixed culture of cells and phage. In some embodiments, the implementation of the mixed culture is a mixture of various mutants, corresponding to the different phenomena of integration in the same and/or different CRISPR loci.

Although it is not intended that the present invention is so limited, the preferred parent bacterial genus are Streptococcus and Lactobacillus. Indeed, it is assumed that any bacterial species will be used in the present invention, including, without limitation, Escherichia, Shigella, Salmonella, Erwinia, Yersinia, Bacillus, Vibrio, Legionella, Pseudomonas, Neisseria, Bordetella, Helicobacter, Listeria, Agrobacterium, Staphylococcus, Streptococcus, Enterococcus, Clostridium, Corynebacterium, Mycobacterium, Treponema, Borrelia, Francisella, Brucella, Bifidobacterium, Brevibacterium, Propionibacterium, Lactococcus, Lactobacillus, Enterococcus, Pediococcus, Leuconostoc, Oenococcus and/or Xanthomonas. In some embodiments, implementation, maternal bacteria contain or receive the HN of lactic acid bacteria, including, without limitation, Bifidobacterium, Brevibacterium, Propionibacterium, Lactococcus, Streptococcus, Lactobacillus (e.g., L. acidophilus), Enterococcus, Pediococcus, Leuconostoc and/or Oenococcus. In other embodiments, implementation of the parent bacteria contained or derived from lactic acid bacteria, including, without limitation, Lactococcus lactis (e.g., L. lactis ssp. lactis and L. lactis ssp. cremoris and L. lactis ssp. lactis biovar diacetylactis), L. delbrueckii ssp. bulgaricus, L. helveticus, L. acidophilus, L. casei, L. paracasei, L. salivarius, L. plantarum, L. reuteri, L. gasseri, L. johnsonii, Bifidobacterium lactis, B. infantis, B. longum and/or Streptococcus thermophilus.

In some embodiments, implementation of the present invention, the parent bacterium is a bacterium of food grade" (i.e., the bacterium that is used and generally regarded as safe for use in preparation and/or food and/or feed). In some preferred embodiments, the implementation, the parent bacterium suitable for use as starter cultures, probiotic cultures and/or food additives. In additional embodiments, the implementation, the parent bacterium is used for the fermentation of meat (including beef, pork, lamb and poultry), including, without limitation, lactic acid bacteria, Pediococcus cerevisiae, Lactobacillus plantarum, L. brevis, L. sakei, L. curvatus, Micrococcus species, Pediococcus pentosaceus, Staphylococcus xylosus, S. vitulinus and mixtures thereof (see, for example, Knorr (ed.),Food Biotechnologyat 538-39 [987]; and Pederson,Microbiology of Fermented Foodsat 210-34, 2d ed. [1979]; and U.S. patent No. 2225783, fully incorporated into the present description by reference). In other additional embodiments, the implementation, the parent bacterium used to ferment vegetables (such as carrots, cucumbers, tomatoes, peppers, and cabbage), including, without limitation, L. plantatum, L. brevis, Leuconostoc mesenteroides, Pediococcus pentosaceusand mixtures thereof (see, for example, Knorr, see above; Pederson, see above; andU.S. patent No. 3024116, 3403032, 3932674 and 3897307). In some embodiments, the implementation, the parent bacterium used to ferment the dough obtained from cereals (e.g. wheat, rye, rice, oats, barley and maize). In some embodiments, the implementation, the parent bacterium is used for the production of wine by fermentation of fruit juice (e.g., grape juice). In some additional embodiments, the implementation, the parent bacterium is used for fermentation of milk (for example, L. delbrueckii ssp. bulgaricus, L. acidophilus, S. thermophilus and their mixtures (see Knorr, see above; Pederson, see above, pp. 105-35). In some preferred embodiments, the implementation, the parent bacterium is used for cheese production, including, without limitation, L. delbrueckii ssp. bulgaricus, L. helveticus, L. lactis ssp. lactis, L. lactis ssp. cremoris, L. lactis ssp. lactis biovar diacetylactis, S. thermophilus, Bifidobacterium Enterococcus and their mixtures (see Knorr, see above Pederson, see above, pp. 135-51). In some embodiments, implementation, maternal bacteria used for the fermentation of eggs, including, without limitation, Pedicoccus pentosaceus, Lactobacillus plantarum and their mixtures (see Knorr above). In some embodiments, the implementation, the parent bacterium is used in fermentation for the production of various products, including, without limitation, cheddar and homemade cheese (e.g., L. lactis, ssp. lactis, L. lactis, ssp. cremoris), yogurt (L. delbrueckii, subspecies bulgaricus and S. thermophilus), Swiss cheese (such as S. thermophilus, L. lactis and L. helveticus), cheese with added cultures Penicillum (Leuconostoc cremoris), Italian cheese (L. bulgaris and S. thermophilus), while (L. lactis subspecies cremoris, L. lactis ssp. lactis biovar diacetylactis, Leuconostoc cremoris), Yakult (L. casei), casein (L. lactis ssp. cremoris), natto ((Bacillus subtilis variant natto), wine (Leuconostoc oenos), sake (Leuconostoc mesenteroides), polymyxin (Bacillus polymyxa), colistin (Bacillus colistrium), bacitracin (Bacillus licheniformis), L-glutamic acid (Brevibacterium lactofermentum and Micobacteriukm ammoniaphilum) and acetone and butanol (Clostridium acetobutyricum and Clostridium saccharoperbutylacetonicum). In some preferred embodiments, the implementation of maternal bacterial species selected from S. thermophilus, L. delbrueckii, subspecies bulgaricus and/or Lactobacillus acidophilus.

In some embodiments, implementation, maternal bacteria are used in the methods, including, without limitation, production of antibiotics, production of amino acids, the production of solvents and carried the CTB other economically useful materials. In some embodiments, implementation, maternal bacteria are used in cosmetic, therapeutic and/or pharmaceutical compositions. In some embodiments, implementation, compositions have certain types of activity, including, without limitation, skin regeneration, including without limitation property against wrinkles, remove old scars, recovery of tissues affected by burn, promote healing of the skin, remove age spots, etc. In some embodiments, implementation, song, or stimulate, or inhibit the growth of hair and nails. In some additional embodiments, the implementation, the compositions contain at least one microbial culture and/or labeled bacteria, and/or a cell culture obtained using the methods and compositions of the present invention.

In other embodiments, implementation of the parent bacteria are mutants that are insensitive to phage. Thus, in some embodiments, implementation, maternal bacteria insensitive to one or more bacteriophages. In some preferred embodiments, the implementation, the parent bacterium is not a mutant, not sensitive to the bacteriophage, bacteriophage, the impact of which will be during the use of the present invention.

Starter is culture

Starter cultures are widely used in the food industry in the manufacture of fermented foods, including dairy products (such as yogurt and cheese), meat products, bakery products, wine and vegetable products.

Starter cultures used in the manufacture of many fermented dairy, cheese and butter-oil products include bacteria cultures, generally classified as lactic acid bacteria. Such bacterial starter culture impart specific characteristics of the various dairy products by performing a number of functions.

Produced not concentrated culture of bacteria are called in the industry "mother cultures" and multiply on the production site, for example, a dairy plant, before adding to the food source material, such as milk, for fermentation. Starter culture, breeding in the production area for inoculation in the food source material, referred to as "the bulk of the leaven."

Suitable starter cultures for use in the present invention includes any organism that is used in the food, cosmetic or pharmaceutical industry (i.e. "used industrial culture" or "industrially used strains").

Starter ku is Tory get methods, well known in the art (see, for example, U.S. patent No. 4621058 included in the present description by reference). In some embodiments, implementation, starter culture obtained by introduction of inoculum, for example, bacteria in growth medium (for example, a medium or fermentation) to obtain the inoculated medium and incubating the inoculated medium to obtain a starter culture.

Dried starter culture produced by techniques well known in the art (see, for example, U.S. patent No. 4423079 and 4140800). Any suitable form of dried starter cultures used in the present invention, including solid dosage forms (e.g. tablets, pills, capsules, powders, granules and powders)that are wetted, spray dried, freeze dried or liofilizirovannami. In some embodiments, implementation, dried starter cultures for use in the present invention is presented or in the form of deep-frozen pills or in the form of a freeze dried powder. Dried starter culture in a deeply frozen pellet or freeze dried powder receive in accordance with any suitable technique known in the field.

In some embodiments, implementation of the starter culture used in the present invention, presented in the form of concentrates, which contain essentially a high concentration of one or more bacterial strains. In some embodiments, implementation, concentration dissolved in water or resuspended in water or other suitable solvents (for example, corresponding to the growth environment, mineral oil or vegetable oil). Dried starter culture according to the present invention in the form of concentrates receive in accordance with methods known in this field (e.g., by centrifugation, filtration or a combination of such methods).

In some embodiments, implementation, starter culture suitable for use in the dairy industry. When used in the dairy industry, the starter culture is selected from a species of lactic acid bacteria, Bifidobacterium species, species Brevibacterium, type Propionibaqcterium. Suitable starter culture group of lactic acid bacteria include commonly used strains of the species Lactococcus, species Streptococcus, species of Lactobacillus, including Lactobacillus acidophilus, Enterococcus species, Pediococcus species, Leuconostoc species and species Oenococcus.

Culture of lactic acid bacteria commonly used in the manufacture of fermented dairy products (buttermilk, yogurt or sour cream) and in the manufacture of butter and cheese (such as brie (soft cheese) or havarti (semi-soft cheese escaravage milk)). The species Lactococcus include widely used Lactococcus lactis, including Lactococcus lactis subspecies, lactis and Lactococcus lactis, ssp. cremoris.

Other species of lactic acid bacteria include Leuconostoc sp., Streptococcus thermophilus, Lactobacillus delbrueckii subspecies bulgaricus and Lactobacillus helveticus. In addition, probiotic strains (such as Lactococcus) include widely used Lactococcus lactis, including Lactococcus lactis, ssp. lactis and Lactococcus lactis, ssp. cremoris.

Mesophilic culture of lactic acid bacteria commonly used in the manufacture of fermented dairy products such as buttermilk, yogurt or sour cream, and in the manufacture of butter and cheese (such as brie or havarti). Other types include Lactococcus Lactococcus lactis subspecies cremoris, Lactococcus lactis, Leuconostoc sp., Lactococcus lactis subspecies lactis biovar, Streptococcus thermophilus, Lactobacillus delbrueckii subspecies bulgaricus and Lactobacillus helveticus. In addition, in some embodiments, implementation of probiotic strains such as Bifidobacterium lactis, Lactobacillus acidophilus, Lactobacillus casei, are added during manufacture to enhance the taste and odor or health.

Culture of lactic acid bacteria commonly used in the manufacture of cheese of the cheddar and Monterey Jack"include Streptococcus thermophilus, Lactococcus lactis, ssp. lactis and Lactococcus lactis, subspecies cremoris, or combinations thereof.

Thermophilic culture, usually used in the manufacture of Italian cheeses, such as "pasta filata" or Parmesan include Streptococcus thermophilus is Lactobacillus delbrueckii, subspecies bulgaricus. Other Lactobacillus species (e.g., Lactobacillus helveticus) are added during manufacture to obtain the desired taste and smell.

In some preferred embodiments, the implementation, the body of the starter culture contains or consists of genetically modified strain obtained in accordance with the presented in the present description means, from one of the above lactic acid bacteria or any other strain starter culture.

The choice of organisms for starter culture according to the invention will depend on the specific type of products that will receive and process. For example, for the manufacture of cheese and butter, are widely used mesophilic culture species Lactococcus, kind and Leuconostoc species of Lactobacillus, while for yogurt and other fermented dairy products, typically used thermophilic strains of Streptococcus species and species of Lactobacillus.

In some embodiments, the implementation, the starter culture is a dried starter culture, digidratirovannogo starter culture, frozen starter culture or a concentrated starter culture. In some embodiments, implementation, starter culture is used when direct inoculation medium or fermentation.

In some embodiments, implementation, starter cult of the RA contains pure culture (i.e. with only one bacterial strain). In some alternative embodiments, the implementation, the starter culture is a mixed culture (i.e. containing at least two different bacterial strain).

Lactic acid bacteria

Especially suitable starter culture, in particular, dried starter cultures for use in the present invention, contain lactic acid bacteria.

Used in the present description, the term "lactic acid bacteria" refers to gram, microaerophilic or anaerobic bacteria that ferment sugar with the receipt of acids including lactic acid as the predominantly produced acid, acetic acid, formic acid and propionic acid. The most used industrial lactic acid bacteria are found among species of Lactococcus, such as Lactococcus lactis, Lactobacillus species, Bifidobacterium species, Streptococcus species, species Leuconostoc, Pediococcus species, Propionibacterium species.

Starter culture according to the present invention can contain one or more species of lactic acid bacteria such as Lactococcus lactis, Lactobacillus delbrueckii, subspecies bulgaricus and Streptococcus thermophilus, or combinations thereof.

Starter culture of lactic acid bacteria commonly used in the food industry in the form of mixed cultures of strains containing the same is or a few species. For a number of mixed cultures of strains, such as starter culture yogurt containing Lactobacillus delbrueckii, subspecies bulgaricus and Streptococcus thermophilus, there is a symbiotic relationship between species, where the lactic acid is larger in comparison with the cultures of lactic acid bacteria of the same strain (see, for example, Rajagopal et al., J. Dairy Sci., 73:894-899 [1990]).

Products

Suitable products for use in the present invention include, without limitation, food products, cosmetic products or pharmaceutical products. Any product, which is obtained from the culture or it contains, is provided in accordance with the present invention. They include, without exception, fruits, legumes, fodder crops and plants, including derived products, grain and derived from grain products, dairy foods and products derived from dairy products, meat, poultry, sea food, cosmetic and pharmaceutical products.

The term "food product" is used broadly and includes food, food products, food ingredients, dietary supplements and functional foods.

Used in the present description, the term "dietary ingredient" includes a composition that is added or can be added to food products, and includes compositions that can be used on either the fir levels in a wide variety of products, which require, for example, acidification or emulsification.

Used in the present description, the term "functional food" means a food product that is able to provide not only a nourishing effect and/or gustatory satisfaction, but is also capable of providing the consumer with a more favorable effect. Although there is no legal definition of a functional food product, the majority of parties that have interest in this field agree that manufactured food products have a specific impact on health.

The term "food product comprises a food product for humans and food for animals (i.e. food). In a preferred aspect, a food product intended for human consumption.

In some embodiments, the implementation, the cells described in this application, contain or be added to the ingredient of the food product, food Supplement or functional food product. In some embodiments, implementation of the food product is presented in a liquid form (e.g., solution), in the form of a gel, emulsion or solid substance that is defined by way of application and/or administration.

Cells described in the present application, are used in obtaining food, such as one or more of: confectionery product is, dairy products, meat products, meat products poultry and fish products and bakery products. In some embodiments, implementation, bacteria are used as ingredients of soft drinks, fruit juices, soft drinks containing whey protein, Wellness teas, beverages, cocoa, milk beverages, beverages with Lactobacillus, yoghurt, drinking yoghurt, wine, etc.

Also provided is a method of obtaining a food product, the method involves mixing cells in accordance with the present invention with the ingredient of the food product (such as the source material for the food product). The way to get food is also another aspect of the present invention.

Appropriately, the food product described in this application, is a dairy product. In some preferred embodiments, implementation, dairy product is yogurt, cheese (e.g., sour soft cheese, hard cheese, semi-hard cheese, cheese etc), buttermilk, fresh Eastern European cheese, sour cream, yogurt, thick cream, fermented beverage based on whey, Mare's milk, milk drink or yogurt drink.

Used in the present description, the term "food" has a very broad sense, because what he is intended to cover food for people as well as for animals other than human beings (i.e. food). In some preferred embodiments, the implementation of food intended for human consumption. Used in the present description, the term "food" includes raw and processed plant material and plant material. This term covers any food suitable for consumption by the animal, including, without limitation, cattle, poultry, fish, crustacea and/or Pets.

Creating resistant to phage strains and starter cultures

During development of the present invention, have been clarified: resistance to phage with the participation of the CRISPR-cas genes and their role in resistance to incoming foreign DNA and the influence of spacers inserted within CRISPR, the specificity of this resistance. Importantly, the present invention relates to methods and compositions for creating resistant to phage strains and starter cultures. In some embodiments, implementation, maternal strain "And" affects phage "P", and selected resistant to phage variant (Variant A"). The analysis Options A (for example, using PCR and/or DNA sequencing to confirm the presence of additional inserted spacer within the CRISPR locus. Then determined the nucleotide sequence of an additional spacer(Spacer Sp1.0). Typically, the spacer Sp1.0 is a fragment size of approximately 30 nucleotides from a phage P, and it provides resistance to phage P and related phages (related phages" are those that contain the sequence of the spacer in their genomes and determine the family of phages).

Regardless of the first effects of the phage, the same strain And exposed to the same phage P, and selects the second-resistant phage variant (Variant A). Option I selected in order to have an additional spacer (Spacer Sp2.0), inserted within the CRISPR locus, but with the sequence of the spacer Sp2.0 that differs from the sequence of the spacer Sp1.0. Typically, the spacer Sp2.0 is a fragment size of approximately 30 nucleotides from a phage P, and it provides resistance to phage P and related phages. Similarly, in some embodiments, implementation, option A option to Ah generated by exposure to the same strain And the same phage R. All the options "A" is chosen so that was an additional spacer inserted (Spacer Sp3.0 to Spx.0) within the CRISPR locus, but with the sequence of all of the spacers Sp, different from each other. Typically, the spacers Sp are fragments of approximately 30 nucleotides from a phage P, and all obespechivayushchego to phage P and related phages.

Although these options can be used, they are limited from the point of view of the extent of their sustainability. Thus, in some embodiments, the implementation would have the advantage of developing resistant to phage strains of the second level. Indeed, had the advantage of the further development of these resistant to phage variants by increasing and expanding their resistance to phages. Usually, it can be estimated that the level of resistance will be about the level of stability of the single mutations occurring within the genome of the phage, within the sequence corresponding to the spacer (i.e., from about 10-4up to 10-6). Therefore, resistant to phage strains that accumulate different spacers within the CRISPR locus, have an increased level of resistance to phage containing the sequence of these spacers within their genome (i.e. because it has to happen multiple single mutations within the genome of the phage).

In some embodiments, implementation, variants of the second level are produced by the selection of mutant phage through the impact of phage P option on A. Usually, this mutated phage (phage P1.0) is a mutation (a deletion, point mutation, etc) in the genome within the region containing the sequence of the spacer Sp1.0. Option A sensitive to phage R. Then, option A exposes the I impact of phage R and selected resistant to phage option (option A1.1). Version 1.1 is also chosen so that it had an additional spacer inserted (Spacer Sp1.1) within the CRISPR locus, but with the sequence of the spacer Sp1.1 that differ from the sequences of the spacers Sp1.0 from Sp2.0 to Spx.0. Typically, the spacer Sp1.1 is a fragment size of approximately 30 nucleotides from a phage R, and it should provide resistance to phage R and related phages. Option A1.1 resistant to phage l and preferably has an increased resistance to phage P due to the accumulation of spacer Sp1.0 and Sp1.1.

In additional embodiments, the implementation of the newly mutated phage (phage R) is generated through the impact of phage R on option A1.1. Then, after exposure to phage R on version 1.1, a new version A1.2, which contains one new additional spacer (Sp1.2). The spacer provides resistance to phage l and, preferably, increases resistance to phage R and P (i.e. due to the accumulation of spacers Sp1.0, Sp1.1, Sp1.2). In other additional embodiments, implementation, various spacers (for example, 2, 3, or 4) re-accumulate inside strain through a variant A1, then option A1.1, then option A1.2, etc. to obtain variants, highly resistant to phages (option EP). In some embodiments, implementation, additional different spacers can be accumulated in one item same strain by means of variant A2, then option A2.1, then option, A2.2, etc. for parallel generation of another variant of strain And highly resistant to phages (option EP). The same strategy is used with options from A3 to Ah.

In some embodiments, implementation, feature strains that are resistant to more than one family of phages. Because this strain can be sensitive to more than one family of phages, in some embodiments, the implementation, it is desirable to increase the resistance of strains to many families of phages with additional spacers (spacers) within the CRISPR locus originating from other families of phages (see Fig. 16). For example, phages P, Q and R are representative of the phages of the three families of phages capable of infecting strain of A. using the above and in this section the method will have the option, resistant to all three families of phages. In some embodiments, implementation, phage P is used to generate variant A1R(containing the spacer Sp1), which is resistant to the phage R. Then, for case A1Raffects phage Q, and selects the phage-resistant phage (Option A1pq). Option A1pqhas one additional spacer (Sq1), is inserted into the CRISPR locus. Typically, the spacer Sq1 is a fragment size of approximately 30 nucleotides of phage Q, and it is especial resistance to phage Q and related phages. Option A1pqresistant to phage P, and phage Q. Then, option A1pqexposed to phage R, and selected resistant to phage (Option A1pqr). Option A1pqrhas a third additional spacer (Sr1), is inserted into the CRISPR locus. Typically, the spacer Sr1 is a fragment size of approximately 30 nucleotides from a phage R, and it also provides resistance to phage R and related phages. Option A1pqrresistant to all three phages.

In additional embodiments, the implementation described above are used in combination to obtain increased or enhanced resistance to phages. In some particularly preferred embodiments, implementation, these options have high levels of resistance to multiple families of phages. In some embodiments, implementation, derived strains that are resistant to certain phages or families of phages, which are problematic in certain factories and/or fermenters.

Mediated CRISPR immunity and applications for resistant to phage strains

Unlike the provisions of the prior art, which Express the hypothesis that CRISPR or CRISPR spacers can participate in giving specific immunity, the present invention is based in part on the surprising data that genes or proteins cas require the attendance for immunity against nucleic acid-target or product its transcription. However, it is not intended that the present invention be limited to any particular mechanism, function or means of action.

Even more surprisingly, during the creation of the present invention, it was found that one or more cas genes or proteins, or associated with two or more CRISPR repeats within CRISPR loci. In other words, it appears that genes or proteins cas-specific CRISPR repeat DNA, meaning that the genes or proteins cas and re-sequence form a functional pair. Accordingly, one or more CRISPR spacers are used with one or more of these functional pairs (i.e. spacers CRISPR and cas genes) for modulating the resistance of a cell against a nucleic acid target or product its transcription.

In one embodiment, for one or more CRISPR spacers gave cell immunity, repeat(s) and CRISPR gene(s) or cas proteins form a functional combination (i.e. repeat(s) and CRISPR gene(s) or cas proteins are compatible).

In additional preferred embodiments, the implementation, the present invention relates to genes/proteins cas that affect bacterial resistance to phages. In additional other preferred embodiments, the implementation, the present invention relates, at least two types of the oram CRISPR and at least one gene/protein cas that can be used to forecast the definition and/or modification of bacterial resistance to phages. Indeed, the present invention relates to methods of modifying lithotype (i.e. resistance/sensitivity to different phages) bacteria. Therefore, identification and identification of CRISPR loci in cells and phage provides a means for identification, prediction and modification of the profile of sustainability cells, as well as interactions between the phage and the host.

Mainly, the use of one or more CRISPR loci, two or more CRISPR repeats, one or more cas genes or proteins, or and/or one or more CRISPR spacers in genetic engineering provides a means for obtaining resistant or sensitive variants of cells for use within a wide variety of applications in the biotechnology industry.

As discussed in more detail below, the phages are natural parasites of bacteria that can develop during fermentation. After infection by phages, bacteria are destroyed, which violates the fermentation process. When lactic fermentation, these infection by phages often have a significant economic impact in the range from reduced quality fermented product to complete p the Teri product.

To overcome the problems associated with phages, companies producing starter culture, have developed various strategies. Traditional programs obtain starter cultures depended on the rotational protection strategies phages (PDRS) to minimize failures due to attack of phages (see, for example,Klaenhammer, Adv. Appl. Environ., 30:1 [1984]; Lawrence et al., J. Dairy Res. 43:141 [1976)); and Whitehead and Hunter, J. Dairy Res., 15:112 [1947]). These strategies are based on multiple, genetically unrelated strains that are likely to show a different range of sensitivity to phages (i.e. other lithotype). When the phage appears during the process of fermentation using a strain, they instead used for fermentation strain, which ideally has a different littp (i.e. with a different type of sensitivity to phages). Historically, however, proved difficult to identify a sufficient number of different lithotypes for successful use of these strategies. Indeed, many strains representing industrial interest are very rare functional characteristics (for example, rapidly oxidizing texturemode S. thermophilus). In addition, not all strains are the relevant characteristics to obtain as starter cultures. In addition, due to their rarity and increase the size of the dairy factories, these strains are intensively used.

There are additional problems associated with traditional strategies rotation of starter cultures. Although some strains with the introduction not attack existing phages, phages often ultimately occur due to a mutation, modification, and design of phages that attack the newly introduced strain (see, for example, Heap and Lawrence, N.Z.J. Dairy Sci. Technol., 11:16 [1976]; Limsowtin and Terzaghi, N.Z.J. Dairy Sci. Technol., 11:251 [1976]; Pearce, N.Z.J. Dairy Sci. Technol., 13:166 [1978]; and Sanders and Klaenhammer, Appl. Environ. Environ., 40:500 [1980]). In addition, in many cases, the duration and starter activity rotations complex strains is unpredictable and often leads to early insolvency (see, for example, Limsowtin et al., N.Z.J. Dairy Sci. Technol.,13:1 [1977]; and Thunell et al., J. Dairy Sci., 64, 2270 [1981]). In addition, the long rotation involving numerous strains, increase the level and diversity of the phage to infect the plant (see, for example, Heap and Lawrence, N.Z.J. Dairy Sci. Technol., 12:213 [1981]; Lawrence et al., J. Dairy Sci., 61:1181 [1978]; and (Thunell et al., J. Dairy Sci. 64, 2270 [1981]).

To combat the proliferation of phages traditional programs of starter cultures depended on the use of strains exhibiting the same or similar technological and functional properties, but different sensitivity to phages. These strains are used in rotation for a successful fermentation. These programs traditionally based on multiple GE is eticheski not related strains which subsequently exhibit a different range of sensitivity to phage (littp). In alternative approaches (see, for example, U.S. patent No. 5593885) programs are used starter cultures on the basis of sets of isogenic strains that exhibit different sensitivity to phages, instead of genetically unrelated strains expressing other lithotype. Used in the present description, the term "set of isogenic strains determines the strains that are identical with chromosomal perspective, but that each is distinguished by the presence of one or several mechanisms of resistance to phages that are outbound from the plasmid. In such a program rotation starter cultures when the phage appears during the process of fermentation using a strain, a strain that is ideally refers to another isotype (i.e. with a different range of sensitivity to phages), which is used as a replacement for fermentation. Thanks to another isotype, the second strain is not affected by the phage, which remain resting in the environment. Then a large part of the population of dormant phage are washed away, followed by fermentation and readjustment, and eradicated by the time the first strain again used for fermentation, if the system is running in dedicated mode.

The present invention from OSISA to improved methods and compositions suitable for solving these problems in the fermentation industry. Indeed, the present invention relates to improved methods and compositions for the fermentation industry and, in particular, for the dairy industry with the selection of strains that are suitable to meet the needs of rotation strategy to protect against phages. In addition, the present invention relates to methods and compositions suitable for use strains with isotype that are adapted to the particular environment of the phage. In particular, the present invention relates to methods and compositions suitable for the evolution of this strain in different isotype to obtain strains that differ from each other only by the range of their sensitivity to phages (lithotype). This difference of lithotype is a function of CRISPR-cas, as described in this application. In some preferred embodiments, implementation, various Linotype obtained by "modulation" of resistance to the phage. In some particularly preferred embodiments, implementation, although lithotype are different strains of this type have identical metabolism (e.g., carbon, nitrogen, etc. and, thus, identical functions (e.g., acidification, smell and taste, texture and so on). This provides a means for Ampl the qualification structure of the rotation starter. In addition, opportunities for industrial processing are resistant to phage strains are identical (e.g., nutritional requirements, resistance to operation of the processing and so on), thus reducing the need for the development of certain industrial processes. Indeed, the present invention relates to methods and compositions suitable for minimizing failures fermentation due to phage attack. In some embodiments, the implementation, the methods and compositions presented to obtain starter cultures with high resistance to phages by the Association of multiple resistant to phage strains that differ in their lization. In some alternative embodiments, the implementation, the methods and compositions presented to obtain starter cultures with strictly identical industrial functions for use with rotary dairy fermentation. In other embodiments, the implementation of the presented methods and compositions, which are suitable for replacement on existing starters by preventing frequent attacks of phages in dairy plants, introduction of a new bacterial strain that is resistant to phages involved in this attack phage. In some embodiments, implementation, these methods and compositions are used again to fight against successive attacks of phages.

Some will add the selected options implementation the starter culture is a mixed bacterial culture. In some particularly preferred embodiments, implementation, leaven contains an equal number of multiple (i.e. at least 2) resistant to phage variants, which differ only in their CRISPR and their sensitivity to phages. In some embodiments, implementation, these options apply to the first level resistant to phage variants (for example, variants A plus A as described above). In some preferred embodiments, implementation options selected option on the second level resistant to phage variants (for example, options A1.4 plus A2.4, as described above). In some particularly preferred embodiments, implementation options selected among third-level resistant to phage variants. In such mixed bacterial cultures, when one of the options is attacked by this phage, other options should not be attacked by phage due to their great sensitivity to phages, and are not adverse effects on fermentation.

In some other embodiments, the implementation uses the primary ferment and maintenance ferment. Basic sourdough prepared from the same strain. In some embodiments, implementation, this strain belongs to the first level resistant to phage variants, while others preferred options for implementation, the strain belongs to the second level, and in another more preferred variants of implementation, the strain belongs to the third level. In some preferred embodiments, implementation, maintenance ferment based on resistant to phage variant obtained independently from the same parent strain. This second-resistant phage variant differs from other variants of its CRISPR and refers to the first level resistant to phage variants, while in other preferred embodiments, the implementation, the strain belongs to the second level, and in some other more preferred embodiments, the implementation, the strain belongs to the third level. For example, in some embodiments, implementation, basic sourdough made from version A1.4 and the supporting leaven made from strain A2.4. After the first appearance of phage during fermentation the main leaven, the leaven is removed and replaced by a supporting leaven. In some preferred embodiments, the implementation, the third starter is also obtained as the maintenance of the leaven, which should serve as a support to support. In some preferred embodiments, implementation, each of sourdough made of multiple resistant to phage variants.

In some embodiments, the implementation of the present invention relative to the tsya to methods and compositions suitable for rotation strategy. In some embodiments, implementation, instead of removing leaven, often attacked by phages, yeast are used in a cyclical manner, even if there is attack of the phage. This strategy limits the number subject to the development of starter cultures. In some particularly preferred embodiments, implementation, each leaven made from strains resistant to many phages, instead of one. This provides increased countering emerging phage. In some embodiments, implementation, feature ferment, made to order. In some preferred embodiments, implementation, produced resistant to phage variants for a specific fight against phages, which are present on this enzymatic plant or installation.

Typing

In another aspect the present invention relates to a method of identification (e.g. typing) labeled bacteria.

In one embodiment, the phase identification is performed by amplification (e.g., PCR amplification) of the CRISPR locus or a portion thereof.

The first primer can be used for hybridization with a sequence which is located above in the course of transcription from the first CRISPR repeat of the CRISPR locus. As an example, the first primer may hybridisierung with neighboring Geno is, which is located above in the course of transcription from the CRISPR locus.

The second primer can hybridisierung below in the course of transcription, at least the first CRISPR spacer or, at least, from the bark of the first CRISPR spacer. The second primer can hybridisierung so far as a trailer or even below in the course of transcription of the adjacent gene. Preferably, the second primer's hybrid within the CRISPR locus. Preferably, the second primer's hybrid, at least partially below during the transcription of the CRISPR spacer or core of the CRISPR spacer.

After amplification, a marking sequence can be identified using various methods known in this field.

As an example, the marker sequence can be identified by determining the restriction type of product amplification. Accordingly, after amplification of DNA containing the CRISPR locus or a portion of it can be digested (e.g., cut) one or more restriction enzymes.

Used in the present description, the term "restriction enzymes" refer to enzymes (e.g., bacterial enzymes, each of which cut double-strand DNA at specific nucleotide sequences or around it. estriction enzymes are well known in this area and can be easily obtained, for example, from various industrial sources (e.g., New England Biolabs, Inc., Beverly, Massachusetts). Similarly, use of restriction enzymes are also generally well known and accepted in the field. Can be used restriction enzymes, which are produced by between 10 and 24 DNA fragments when cut CRISPR locus or a portion thereof. Examples of such enzymes include, without limitation, for example, in the form of bands in gel electrophoresis. Restriction enzymes can be used to create Polymorphism Restriction Fragment Length (RFLP).

RFLP generated by cutting ("restriction") DNA molecules with restriction endonucleases. Isolates were many hundreds of these enzymes that are naturally produced by bacteria. Essentially, bacteria employ such enzymes as a defense system for the recognition, and then splitting (restriction) any foreign DNA molecules that can enter into a bacterial cell (e.g., viral infection). It was found that each of the many hundreds of different restriction enzymes cuts (i.e. the "splits" or "limit") the DNA sequence of 4 basic nucleotides (A, T, G, C)that make up a DNA molecule, for example, one enzyme can specifically and only to recognize the sequence A-A-T-G-C, while the other can specifically and only to recognize the sequence G-T-A-C-T-A, etc. depending on unusual enzyme involved such recognizable sequences can vary in length from such a small number as 4 nucleotides to the number reaching 21 nucleotides. The more recognizable sequences, the smaller number of restriction fragments of this will be because the more site recognition, the lower the probability that he will be re-detected throughout the DNA.

As another example, the marker sequence can be identified by determining or detecting differences in the size of the amplification product.

Separation can be achieved by any appropriate method for DNA extraction, including, without limitation, gel electrophoresis, high performance liquid chromatography (HPLC), mass spectroscopy and the use of a microfluidic device. In one embodiment, amplification products or DNA fragments are separated by electrophoresis on agarose gel. Gel electrophoresis separates charged molecules of different size, the velocity of their motion through the stationary gel under the influence of an electric current. These dedicated amplification products or DNA fragments can be easily visualized, such as the er, staining with ethidium bromide and visualization of the gel under UV light. The type of banding reflects the sizes of restriction-digested DNA or amplification products.

As another example, the marker sequence can be identified by sequencing the amplification products.

The sequence of the amplified products may be obtained by any method known in this field, including how automatic and manual sequencing. See, for example, Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York; Roe et al. (1996) DNA Isolation and Sequencing (Essential Techniques Series, John Wiley & Sons).

Methods of hybridization are also covered by the scope of the present invention, or using the nucleic acid molecule as a probe or a nucleic acid molecule capable of hybridisierung with a specific nucleotide sequence. See, for example, Sambrook et al. (1989) Molecular Cloning: a Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York).

In methods of hybridization, the probe(s) hybridization may represent fragments of genomic DNA, products, amplificatoare PCR, or other oligonucleotides, and may contain all or part of the known nucleotide sequence. In addition, it can be mechen detectable group, such as32R, or any other detectable mA is-ker, such as other radioisotopes, fluorescent compound, enzyme or co-factor of the enzyme. The term "labeled" in respect of the probe is intended to encompass direct labeling of the probe connection (i.e. physical link) detectable substance to the probe, as well as indirect labeling of the probe interaction with another reagent that is exposed to direct tagging. Examples of indirect labeling include end-labeling of probe DNA with Biotin so that it was possible to identify fluorescent labeled streptavidin.

Also covered are methods, including methods of hybridization for detection or differentiation of bacterial strains. They include, without limitation southern blotting (see, for example, Vaqn Embden et al. (1993) J. Clin. Environ. 31:406-409), the analysis of the mobility shift (see, for example, published patent application U.S. No. 20030219778), analyses sequencing using oligonucleotide chips (see, e.g., Pease et al. (1994) Proc. Natl. Acad. Sci. USA 91:5022-5026), spoligotyping (see, for example, Kamerbeek et al. (1997) J. Clin. Environ. 35:907-914), Fluorescent In Situ Hybridization (FISH) (see, e.g., Amann et al. N(1990) J. Bacteriol. 172:762-770) analyses heteroduplexes tracking or analysis heteroduplexes mobility (see, for example, White et al. (2000) J. Clin. Environ. 38:477-482).

Marking sequence that is identified can be compared with database sequences, fago and/or database of bacterial sequences. Usually, a marking sequence is comparable to the one or more sequences in the database of sequences of phages, but not in the database of bacterial sequences.

As new labeled bacteria obtained using the methods described in this application can be created in the database labels, allowing specific identification of the bacteria that was in the state.

In some aspects the invention relates to the use of the sequence obtained or derived from bacteriophage (for example, when receiving labeled bacteria) for marking and/or identification of bacteria, where the specified sequence integrated at one end of the CRISPR locus of the parent bacterium.

In another aspect the invention relates to the use of the sequence obtained or derived from bacteriophage (for example, when receiving labeled bacteria) for marking and/or identification of bacteria, where the sequence contains: (i)at least one sequence that is homologous (e.g., identical) to the CRISPR repeat in the CRISPR locus of the indicated bacteria; and (ii) the marking sequence.

In another aspect the invention relates to the use of the sequence for marking and/or identification of bacteria (for example, when receiving the sword of the Noah bacteria), where the specified sequence is obtained or can be obtained: (a) the influence of bacteriophage on the parent bacterium; (b) the choice is not sensitive to bacteriophage mutant; (C) comparison of the CRISPR locus or a part thereof from the parent bacterium and the bacteriophage insensitive to mutant; and (d) selecting sequences in the CRISPR locus or portion insensitive to phage mutant, which is not present in the parent bacteria.

CRISPR and eukaryotes

As described in this application, it was shown that CRISPR provides resistance against the nucleic acids included in prokaryotes. In particular, it was shown that CRISPR spacers exhibiting homology to the viral DNA (e.g., nucleic acid bacteriophage), provide resistance against the virus, sharing a sequence identity of at least one spacer elements sequence. However, also provides that the CRISPR system, including genes and/or proteins cas along with the spacers, repetitions, leader and trailer of the cell does not currently contain CRISPR loci, will be used to provide resistance to nucleic acids de novo. Indeed, in some embodiments, the implementation of such manipulations are used with a variety of eukaryotes, including, without limitation, other stomach is s, mushrooms, etc. Provides that the CRISPR system is transferred into eukaryotic cells using any suitable method known in this field. Including, without limitation, transformation via plasmids. In these variants of implementation, the CRISPR loci, and if necessary, the signals of transcription/translation, included in the DNA plasmids, all for the expression and functions of sequences in eukaryotic cells.

In some additional embodiments, implementation, spacer elements of the sequence are subjected to genetic engineering so that they had an identity with viral sequences representing the interest of infection involved owner. In some preferred embodiments, implementation, these methods and compositions provide resistance to the host cell against viruses that share sequence identity with the CRISPR spacer introduced into the cell. In some particularly preferred embodiments, implementation, viruses, include, without limitation HIV, orthomyxoviruses, paramyxoviruses, pseudomycelium, RSV (sarcoma virus of Rausch), influenza, measles, varicella, rubella, coronaviruses, hepatitis viruses, caliciviruses, poxviruses, herpesviruses, adenoviruses, papovaviruses, papilloma viruses, enteroviruses, arboviruses, rhabdovirus, arenavirus, arbovirus, Rin is a virus reovirus, coronaviruses, reoviruses, rotaviruses, retroviruses, etc. In some embodiments, the implementation of specific targeting highly conservative sequences of nucleic acids in the CRISPR spacers provides increased resistance against such viruses in eukaryotic cells. In some particularly preferred embodiments, the implementation, the eukaryotic cells are human cells.

CRISPR and generating resistant to phage mutants

During development of the present invention, experiments were carried out to determine whether the CRISPR loci during natural generate resistant to phage mutants. Was chosen as a model system of phage-host, consisting of sensitive phage strain S. thermophilus wild-type, widely used in the dairy industry, DGCC7710 (WT) and two different, but closely related virulent bacteriophages isolated from industrial designs yoghurt, namely phage 858 and phage 2972 (Levesque et al., Appl. Environ. Environ., 71:4057 [2005]). Nine resistant to phage mutants were independently generated by the stimulation of WT strain phage 858, phage 2972 or both, and analyzed their CRISPR loci. The differences are consistently observed in the CRISPR1 locus, where from 1 to 4 additional spacers were inserted next to the spacers 32, prisutstvie the sponding to the WT strain (see Fig. 9). It seems that adding new spacers in response to infection by phage polarized towards the end of the CRISPR locus. This is consistent with previous observations of hypervariability spacers on the top end of the CRISPR locus in different strains (see, for example, Pourcel et al., Environ., 151:653 [2005]; Lillestol et al, Archaea 2:59 [2006]). Sequence analysis of additional spacers inserted in the CRISPR1 locus of various resistant to phage mutants revealed a similarity to the sequences found within the genomes of the phages used for stimulation. Similarity was observed for all phage genomes, most of the functional modules and coding and no coding threads. Seemed that a specific target has not been a specific sequence, gene or functional group. These results indicate that after the CRISPR1 locus was resistant to bacteriophages, it was modified by the integration of new spacers, obviously derived from the DNA of the phage. However, it is not intended that the present invention limited to any specific mechanism.

Surprisingly, it has been observed that some strains were resistant to both phages, while others were resistant only to the phage used in a provocative test (see Fig. 9). It was expected that the profile of resistance to phages correlates with the content of the spacers, whereby strains with spacers, such as spacers, S3, S6 and S7, showing 100% identity with the conservative sequences in both phages were resistant to both phages. On the contrary, when the nucleotide polymorphism was observed between the sequence of the spacer and phage (from 1 to 15 SNPS (polymorphism, single nucleotide) on 29 or 30 nucleotides), it seemed that the spacers, such as spacers S1, S2, S4, S5, and S8, did not ensure stability (see Fig. 9).

In addition, when inserted several spacers (S9-S14), the levels of resistance to phages were higher. These data indicate that the CRISPR1 locus is exposed to dynamic and rapid evolutionary changes triggered by exposure to phage. These results indicate that the CRISPR loci can really change during the generation resistant to phage mutants and establish the relationship between the content of CRISPR and sensitivity to phages. Thus, it is envisaged that the presence of CRISPR spacer identical to the sequence of the phage, provides resistance against phages containing the specific sequence.

To determine whether the content of the CRISPR locus of resistance to phages, the CRISPR1 locus was modified by the addition or deletion of spacers, and tested the sensitivity of the strain to the phages. All constructs were generated and the integration of iravani in the chromosome of S. thermophilus using methods known in the art (see, for example, Russell and Klaenhammer, Appl. Environ. Environ., 67:4361 [2001]). The spacers and repeats in the CRISPR1 locus of strain WTF+S1S2was removed and replaced by a single repeat without any spacer. The resulting strain WTF+S1S2ΔCRISPR1 was sensitive to phage 858, indicating that the resistance to the initial phage-resistant phage mutant (WTF+S1S2) was probably related to the presence of S1 and S2 (see Fig. 10).

In addition, to determine whether the addition of spacers resistance to phages, the CRISPR1 locus of strain WTF+S4replaced only option containing the spacers S1 and S2. Then tested the sensitivity of the obtained construct the phage. The resulting strain WTF+S4::pS1S2 acquired increased resistance to phage 858, suggesting that these two spacer capable of providing resistance to phages de novo (see Fig. 10). These observed modifications establish the relationship between the content of the CRISPR spacer and resistance to phages.

In the process of generating strain WTF+S1S2ΔCRISPR1, WTF+S1S2::pR, was created a variant that contains an integration vector with one repeat, inserted between the cas genes and native CRISPR1 locus (see Fig. 10). Suddenly, the strain WTF+S1S2::pR was feelings which in the case of phage 858, although the spacers S1 and S2 continued to be present on the chromosome (see Fig. 10). Similarly, the construct WTF+S4::pS1S2 lost sensitivity to phage 2972, although the spacer S4 is present in the chromosome (see Fig. 10). These results pointed to the fact that some spacers did not provide the stability and likely to be effective, they must be in a specific genetic context.

Although early experiments testified about the involvement in DNA repair (Makarova et al., Nucl. Acids Res., 30:482 [2002]), modern hypothesis is that cas genes (Jansen et al., Mol. Environ., 43:1565 [2002]; and adhesive et al., PloS Comput. Biol., l:e60 [2005]) are mediated CRISPR immunity (Makarova et al., Biol. Direct. 1:7 [2006]). In additional experiments, two cas gene in strain WTF+S1S2were inactivated, namely, cas5 (COG3513) and cas7, which is equivalent str0657/stu0657 and str0660/stu0660 (Bolotin et al., Nat. Biotechnol., 22:1554 [2004]; and (Bolotin et al., Environ., 151:2551 [2005]). Inactivation cas5 led to the loss of resistance to phage (see Fig. 10). In addition, it is possible that cas5 acts as nucleases, because it contains the motif nucleases type HNH. In contrast, inactivation cas7 did not change resistance to phage 858 (see Fig. 10). However, it is not intended that the present invention be limited to any particular mechanism. In addition, experiments to generate mutants CRISPR1 stable who's to phage, from knockout cas7, had no effect. Although there is no intention that the present invention limited to any particular mechanism, it may be due to the fact that Cas7 is involved in the synthesis and/or inserting new spacers and additional repetitions.

After testing the sensitivity of resistant to phage mutants, it was found that plaque formation was dramatically reduced, but that a relatively small population of bacteriophages retained the ability to infect mutants. Next was analyzed variants of phage obtained from phage 858, which retained the ability to infect WTF+S1S2. In particular, we have investigated the sequence region of the genome corresponding to the additional spacers S1 and S2, two virulent phage variants. In both cases, the genome sequence variant phage was metirovan, and in a sequence corresponding to the spacer S1, identified two different types of polymorphism single nucleotide (see Fig. 13).

In General, it seems that in prokaryotes have evolved a system of "immunity" based on the nucleic acid, whereby the specificity is determined by the contents of the CRISPR spacer, whereas the enzyme stability is ensured by the Cas. In addition, there have been opinions that some of the cas genes that are not directly both is that sustainability, indeed involved in the insertion of additional spacers and CRISPR repeats as part of the adaptive immune response. This system is based on nucleic acid contrasts with the amino acid based parallel systems in eukaryotes, whereby adaptive immunity is not inherited. The inherited nature of CRISPR spacers justifies the use of CRISPR loci as targets for evolutionary teruya and comparative genomic studies (see Pourcel et al, supra; Groenen et al, Mol. Environ., 10:1057 [1993]; Mongodin et al, J. Bacteriol., 187:4935 [2005]; and (DeBoy et al, J. Bacteriol., 188:2364 [2006]). Due to the fact that this system responds to the environment phage, it probably plays a significant role in prokaryotic evolution and ecology and provides a historical perspective of the impact of phages, but also as a prognostic tool to determine the sensitivity to phages. However, there is no intention that the present invention limited to any particular mechanism. However, the present invention relates to methods and compositions for the use of the system CRISPR/cas as a means of protection from viruses, as well as potential for reducing the dissemination of mobile genetic elements and the acquisition of undesirable attributes, such as genes for antimicrobial resistance and markers virulent the spine. In some embodiments, implementation, from the perspective of the evolution of phage, in addition, it is envisaged that an integrated sequence of the phage into CRISPR loci will also provide additional points of attachment to facilitate recombination during subsequent infection by phages, thus increasing the gene pool to which you have access phages (see Hendrix et al., Proc. Natl. Acad. Sci. USA 96:2192 [1999]). Because the CRISPR loci are found in most bacterial genera and are ubiquitous in Archea (see Jansen et al., supra; Lillestol et al., supra; and Goode and Bickerton J. Mol. Evol., 62:718 [2006]), they provide a new understanding of relationships and jointly directed evolution between prokaryotes and their predators.

Phages biological control

The present invention also relates to methods and compositions for the development of phage as a means of biological control. As indicated in the present description, the bacteria may become resistant to phage attack by incorporating sequences (spacers), derived from phages in active CRISPR loci. The phage can avoid this resistance mutation within the sequence of the genome corresponding to the spacer or sequence recognition motif CRISPR, to obtain system Cas-CRISPR. Through repeated cycles of stimulation with phages to create resistant to phage derivatives, oborudova the different CRISPR strain-master, and selection of mutants avoidance of phages, the present invention relates to a phage that were modified within sequences of target CRISPR and/or suspected sites of CRISPR recognition that direct insertion of the spacer. In addition, the present invention relates to a phage that were synthetically constructed, so that was fixed sequence of the CRISPR motif for this system Cas-CRISPR. These "modified" phages used in the form of a mixture or sequential rotation scheme, reduce the ability of bacteria to target to adapt the resistance through the CRISPR system. Indeed, the present invention relates to a varied set of virulent phages for use as a means of biological control. In particularly preferred embodiments, the implementation, the target of this diversity is guided CRISPR mechanism of resistance to phages, so that the ability of a host organism to develop resistance against phage attack (through CRISPR) dramatically decreased or eliminated. The introduction of various phages or in the form of a mixture, or in a sequential rotation, further reduces the ability of the host organism to adapt or develop guided CRISPR resistance to phages.

Phages are natural antimicrobial agents that intensely investigated as a therapeutic agent, alternative antibiotics. This interest has recently been renewed due to the proliferation of pathogens that are resistant to many antibiotics. As with antibiotics, bacteria have developed multiple mechanisms to overcome the attacks of the phages. The present invention relates to methods and compositions involving the use of Cas-CRISPR in mediating resistance to phage for generating a diverse population of phages, to create a synthetic phage deprived of sequences of CRISPR motif, as well as to methods for the introduction of such phage, which will reduce the body's ability target to develop resistance against phage.

As described in detail in this application, system Cas-CRISPR disclosed in a wide range of organisms, which include examples of pathogenic genera. After infection with phage can be detected that the bacteria, avoiding lysis, contain a new spacer elements sequence (sequence) within the CRISPR locus. The new spacer is usually a certain length, which is typical for a given CRISPR locus, and is derived from the genome of the attacking phage to which it gives stability. Because the level of resistance given one spacer, often incomplete, the phage can avoid this mechanism. The analysis avoids phages" indicates that the genomes were motivovany in the respective spacer elements after which outermost, find out in the sustainable option of the owner, or near it. In addition, "avoiding the phages are fully virulent for mediated CRISPR variant of the host from which they were received.

One unusual aspect of therapeutic phage that distinguish it from traditional antibiotics, is the ability to multiply exponentially in combination with infected bacteria. Although he may have an advantage from the point of view of pharmacological perspective, it also provides unique opportunities for phage to develop in the direction of the adaptive response of bacteria to target the phage attack.

Bacteria have evolved several mechanisms to protect against virulent phage. After infection with phage, the analysis of surviving bacteria was found that some isolates had inserted a new spacer elements element within their resident CRISPR locus, the sequence of which was identical to the sequence found in the corresponding genome of the phage. During stimulation of the phage, these options first generation mediated CRISPR resistance to phage to form plaques; phages which were found fully infective for the parent bacteria, and derivative. The analysis of these phages avoidance CRISPR" pointed to the fact that their genomes were motivovany in the sequence corresponding to the CRISPR spacer, the content is of asempa in resistant to phage variant, or in the proximal sequence, which is considered directs the insertion of the spacer and identified as CRISPR motif specific to this system Cas-CRISPR. Therefore, the phage avoidance CRISPR" potentially more virulent than the parent bacteria or variant of the first generation.

As mentioned above, the CRISPR loci have been identified in several genera/species that include examples of known pathogens and harmful microorganisms. Also, as described in the present application, the present invention relates to methods and compositions for use of CRISPR loci in combination with Cas proteins to give "immunity" to penetrate foreign DNA, in particular, the bacteriophages. Also, as described in this application, bacterial strains, including active loci CRISPR-cas containing a spacer, which is identical to the corresponding sequence within the genome of the phage (i.e. "procaspases"), give this bacterial strain is resistant to the phage. In some particularly preferred embodiments, the implementation sequence of the genome of phage biological control known. In some particularly preferred embodiments, the implementation, the selected microorganism target is examined for the presence of CRISPR loci. In some preferred embodiments, implementation, used PCR using the m specific primers for the conserved sequences which flank the CRISPR loci of the microorganism target. In some preferred embodiments, implementation, product(s) amplification sequeiros in comparison with the genome sequence of phage biological control. In some preferred embodiments, the implementation, the generation of variants that are resistant to CRISPR the phage, and the analysis of the spacers/protospatharios provides a means to identify specific CRISPR motif. After identification, the sequence information is used to design and synthesis of phage deprived of CRISPR motif. Thus, the resulting phage-sensitive mediated CRISPR-cas sustainability. In these assessments, no spacers with similarity to the genome of the phage, indicates the susceptibility of the microorganism target for phage biological control. Thus, the phage biological control has a high degree of virulence and effectiveness as an agent of biological control.

The present invention relates to methods and compositions suitable for use in food, feed, medical and veterinary industry to generate phage with a broader range of hosts and how they can be applied for more effective biological control bacteria. The present invention relates to means for obtaining a sufficient number of the quality modified phages (in response to CRISPR) for a significant decrease in the ability of native bacteria to develop effective resistance, mediated CRISPR. The present invention also relates to methods of application/introduction, structured so that the speed of development of native bacteria was significantly reduced.

Experimental section

The following examples are provided to demonstrate and further illustrate certain preferred embodiments and aspects of the present invention, and they should not be construed as limiting its scope.

In the following experimental section, the following abbreviations stand for: °C (degrees centigrade); rpm (revolutions per minute); H2O (water); HCl (hydrochloric acid); AA (amino acid); bp (base pairs); kb (thousands of base pairs); KD (kilodaltons); μg and ug (micrograms); mg (milligrams); ng (nanograms); μl and ul (milliliters); mm (millimeters); nm (nanometers); μm and um (micrometer); M (moles); mm (mmol); U (units); BB (volts); MM (molecular weight); sec (seconds); min (minute/minutes); HR (hour/hours); MOI (multiplicity of infection); EAR (effectiveness belascoaran); MgCl2(magnesium chloride); NaCl (sodium chloride); OD420(optical density at 420 nm); PAGE (electrophoresis on polyacrylamide gel); EtOH (ethanol); PBS (saline phosphate buffer [159 mm NaCl, 10 mm buffer phosphate, pH to 7.2]); SDS (sodium dodecyl sulphate); Tris (Tris(hydroxymethyl)aminomethane); mass/about (the ACCA to volume); V/V (volume to volume); Amicon (Amicon, Inc., Beverly, MA); ATS (American type culture collection, Manassas, VA); Amersham (Amersham Biosciences, Inc., Piscataway, NJ); NEB (New England Biolabs, Beverly, MA); Becton Dickinson (Becton Dickinson Labware, Lincoln Park, NJ); BioRad (BioRad, Richmond, CA); Clontech (CLONTECH Laboratories, Palo Alto, CA); Difco (Difco Laboratories, Detroit, MI); GIBCO BRL or Gibco BRL (Life Technologies, Inc., Gaithersburg, MD); Sigma (Sigma Chemical Co., St. Louis, MO); Sorvall (Sorvall Instruments, a subsidiary of DuPont Co., Biotechnology Systems, Wilmington, DE).

Unless otherwise indicated, the present invention uses conventional techniques of chemistry, molecular biology, Microbiology, recombinant DNA and immunology, which may make the average person skilled in the art. Such techniques are well known to specialists in this field.

Used in the present description, the designation of DGCC7710 also referred to as “WT” (wild type); DGCC7710RH1 also referred to as “DGCC7710-RH1” and “RH1”; DGCC7710RH2 also referred to as “DGCC7710-RH2 and RH-2”; DGCC7778cas1 also referred to as “DGCC7778cas1KO”, “CASIKO” and “cas1 KO”; DGCC7778cas4 also referred to as “DGCC7778cas4KO”; DGCC7778 also referred to as “WT858+S1S2”; DGCC7778RT also referred to as “WT858+S1S2::pR; DGCC7778RT', also referred to as “WT858+S1S2ΔCRISPR1”; DGCC7710-R2, also referred to as “WT2972+S4; and DGCC7710-R2S1S2 also referred to as “WTF+S4::pS1S2.”

Example 1

The manipulation of specific phage by spacers

In this example, the described experiments carried out by the La manipulation-specific phage by spacers. In some experiments, specific for phage spacer inserted into an existing, functional CRISPR to ensure the sustainability of the corresponding phage. Used bacterial strain was represented by Streptococcus thermophilus ST0089, and the phage was a phage 2972. S. thermophilus ST0089 is industrially important strain used in the manufacture of yogurt. He generally amenable to manipulation and receptive to well-known virulent phage 2972.

The CRISPR loci were identified in strain ST0089. It was mainly determined by sequencing the whole genome ST0089. Alternatively, the CRISPR loci are identified by PCR using sets of blades with sequences identical to the previously identified elements of S. thermophilus CRISPR.

After identification, determined the sequence of the CRISPR loci and proximal regions containing relevant cas genes.

For further manipulation of the selected at least one specific locus CRISPR-cas. The functionality of this locus was identified by in silico analysis spacer elements areas and their homology with the DNA sequence of phage (i.e. absence and/or presence of the spacer elements of the sequence and correlation with infectivity of the phage strain ST0089). In the absence of this correlation, the functionality assumed on the basis of presets is of all documented items (i.e. repetition, spacers, leader sequences and cas genes that putatively encode proteins full length).

A suitable spacer elements sequence (sequence) were selected from the genome of phage 2972. The criteria used for selection of the spacer, generally based on the length of the spacers within the CRISPR locus and identity (preferably, about 100%) sequence phage. Indeed, any suitable sequence of phage finds application in various embodiments, implementation of the present invention.

In some embodiments, implementation, chemically synthesized unit CRISPR consisting of spacer elements sequence of phage 2972, flanked by two repeated elements (identical to the selected CRISPR locus). By definition, this synthetic unit CRISPR" has a length of approximately 100 bp and is too short to ensure integration into the CRISPR locus.

Therefore, additional flanking DNA was designed along with the CRISPR unit. To facilitate integration, received at least 500 bp identical to the CRISPR locus of the target, which is homologous to the DNA that flanks the synthetic CRISPR unit.

In additional embodiments, implementation, there are multiple approaches. In one embodiment, competes with the addition of a new spacer in beings who have in store CRISPR. In some alternative embodiments, the implementation, the entire CRISPR locus is replaced with a synthetic CRISPR unit.

The resulting integrant CRISPR was verified using DNA sequencing of the CRISPR locus prior to biological testing. In addition, the tested types of sensitivity to phages of integrante CRISPR against phage 2972 and compared with the parent strain.

Designed integrant CRISPR successfully demonstrated a direct correlation between the presence of specific spacer within the proper context of the CRISPR-cas.

In additional experiments, performed the insertion of spacer, homologous DNA phage, in a recipient cell. In these experiments, a new CRISPR spacer was constructed from DNA of phage (100% identity in the DNA of the phage) within the anti-receptor gene and inserted into the cell in the CRISPR locus. Anti-receptor gene was targeted because it was found that the CRISPR spacers from other strains show a semblance of anti-receptor genes of the phage. 4 strain, bearing spacers, showing the identity of the anti-receptor genes of the phage, were resistant to a particular phage. The mutant was subjected to phage and found that it is stable.

In additional experiments, the spacer inserted in the original host, but not in the CRISPR locus. The resulting mutant remained sensitive to the phage is. Thus, these experiments showed that the spacer must be in a certain environment within the context of CRISPR and cas genes.

In other experiments, a specific CRISPR spacer has been subjected to deletions of naturally occurring CRISPR locus. This deletion eliminated the immunity against this phage, and the master became sensitive (i.e. lost resistance to the phage, which was homologous to the spacer. The results of these experiments are presented in Fig. 10.

In some additional experiments, one-piece combination of CRISPR repeat-cas were inserted into a recipient cell to provide immunity against incoming nucleic acids.

In additional experiments, the plasmids containing CRISPR spacer, obtained using the methods described in the present description. Attempted transfer of this plasmid into the cells that contain the same spacer, were unsuccessful. However, plasmids that do not contain a spacer, can be transformed into cells. In Fig. 11 and 12 illustrate these results.

In other experiments, produced currency combinations CRISPR-cas present in two different strains. It was shown that this exchange of spacers have modified their phenotypes (sensitivity/resistance to phage). As indicated in the present description, when S1S2 is introduced into the strain S4, included sensitivity to the phage (see Fig. 10).

In additional experiments, received various combinations of cas-CRISPR repeat. For functionality requires not only the genes or proteins cas, but specific couples cas-CRISPR repeat. When genes or proteins cas supplied from another CRISPR locus, the strain remains sensitive to the phage.

In some additional experiments, were subjected to the deletion of one or more cas genes (functional units CRISPR-cas). Genes cas needed to provide immunity. The cas mutants are still sensitive to the phage, despite the presence of the spacer, identical DNA phage. In these experiments, deletions were subjected cas5 (formerly known as cas1) cas7 (formerly known as cas4). It has been shown that sustainability requires cas5. In addition, it was shown that for the integration of new spacers required cas7.

In additional experiments, cas genes represented the owner in the TRANS form. When is the knockout of the gene cas, the immune system is restored.

Example 2

Integration of the spacer (spacer) CRISPR

In these experiments, it was shown that the integration of CRISPR spacers in the CRISPR locus provides resistance against phage to which the CRISPR spacer manifests identity. In these experiments, obtained strain DGCC7710RH1 S. thermophilus.

Strain DGCC7710-RH1 Streptococcus thermophilus (deposited in the French National collection ku is tour microorganisms under the number CNCM 1-2423), has at least 3 of the CRISPR locus: CRISPR1, CRISPR2 and CRISPR3. In strains CNRZ1066 and S. thermophilus LMG18311, for which the full sequence of the genome (Bolotin et al., Environ., 151:2551-2561 [2005]), CRISPR1 is localized in the same chromosomal locus: between str0660 (or stu0660) and str0661 (or stu0661).

In strain DGCC7710, CRISPR1 also localized in the same chromosomal locus, between highly similar genes. CRISPR1 strain DGCC7710 contains 33 repeat (including the terminal repeat) and thus, the spacer 32.

These spacers are different from each other. Most of these spacers are new (i.e. not previously documented within CRISPR loci), but four of the spacer near the trailer CRISPR1 identical to one already known to the CRISPR1 spacers:

- 28-th spacer DGCC7710 100% identical to the 31-th repetition of the CRISPR1 spacer strain CNRZ1575 (access number in the gene Bank DQ072991);

- 30th spacer DGCC7710 100% identical to the 27-th CRISPR1 spacer strain CNRZ703 (access number in the gene Bank DQ072990);

- 31-th spacer DGCC7710 100% identical to the 28-th CRISPR1 spacer strain CNRZ703 (access number in the gene Bank DQ072990);

- 32 spacer DGCC7710 100% identical to the 30-th CRISPR1 spacer strain CNRZ703 (access number in the gene Bank DQ072990).

During development of the present invention, the strain DGCC7710RH1 S. thermophilus was isolated as a natural resistant to phage mutant using DGCC7710 as the parent strain and phage D858 as virulent phage. Use the built D858, bacteriophage belonging to the Siphoviridae family of viruses.

CRISPR1 strain DGCC7710-RH1 contains 34 repeat (including the terminal repeat), and, thus, the spacer 33. When compared with the CRISPR1 sequence of strain S. thermophilus DGCC7710, the CRISPR1 sequence of strain DGCC7710-RH1 S. thermophilus has one additional new spacer (and one additional repeat that flanks the new spacer) on one end of the CRISPR locus (i.e. close to the leader at the 5' end of the CRISPR locus). All other spacers of the CRISPR1 locus remained unchanged.

The CRISPR1 sequence (5'-3') strain DGCC7710-RH1 is presented below:

In the above sequence, the leader has the sequence:

Integrated sequence

,

containing repeatingCRISPR shown in the selection with capital letters, and the CRISPR spacer (i.e. a marking sequence) selection lowercase; both shown above in gray. Sequence end repeat and trailer CRISPR repeat are shown below:

End repeat:

The sequence of the trailer:

The sequence of the new spacer

exists within the genome of phage D858.

The spacer sequence found is foreseen between the provisions 31921 and 31950 bp (i.e. "plus chain) genome D858 (and has 100% identity with the genomic sequence of 30 nucleotides):

The new spacer, which is integrated in the CRISPR1 locus of strain DGCC7710-RH1 S. thermophilus, gives the strain resistance to phage D858, as shown in Fig. 1 and table 2-1.

Table 2-1
Phage 2972Phage 858
StrainsBIM on1Sensitivity is required for phage2Homology of spacer-phage3Sensitivity is required for phage2Homology of spacer-phage3
-SStr1SStr1
858S>10 SNPsR100% (2 spacers)
858R100%R100%
858R100%R100%
858S>10 SNPsS100%, but not next to cas
858S>10 SNPsSThe spacers are not left
858S>10 SNPsS100% (2 spacers), but cas1 KO
858S>10 SNPsR100% (2 spacers), but cas4 KO
2972R100% (1 spacer)S5 SNPs
2972S100%, but not next to casRS1S2 100% identical to the phage 858
1The phage used to generate insensitive to phage mutants (BIM)
2The strain sensitivity to phage: S = sensitive, R = resistant, according to analyses of stains and plaque
3Homology between the new spacer mutant and the DNA sequence of phage used to generate mutant

Phages retained the ability to adsorb to the mutants.

In addition, during development of the present invention, the strain DGCC7710-RH2 S. thermophilus was isolated as a natural resistant to phage mutant using strain S. thermophilus DGCC7710 as the parent strain and phage D858 as virulent phage.

CRISPR1 strain DGCC7710-RH2 S. thermophilus contains 34 repeat (including the terminal repeat), and, thus, the spacer 33. When compared with the CRISPR1 sequence of strain S. thermophilus DGCC7710, serial is inost CRISPR1 strain DGCC7710-RH2 S. thermophilus has one additional new spacer (and one additional repeat that flanks the new spacer) on one end of the CRISPR locus (i.e. close to the leader at the 5' end of the CRISPR locus). All other spacers of the CRISPR1 locus remained unchanged.

The CRISPR1 sequence (5'-3') strain DGCC7710-RH2 is presented below:

In the above sequence, the leader sequence is:

Integrated sequence,containing repeatingCRISPR shown in the selection with capital letters, and the CRISPR spacer (i.e. a marking sequence) selection lowercase; both shown above in grey. Sequence end repeat and trailer CRISPR repeat are shown below:

End repeat:

The sequence of the trailer:.

It was shown that the sequence of the new spacer exists within the genome of phage D858.

The spacer sequence (SEQ ID NO:535) is found between the provisions 17215 and 17244 bp (i.e. on the "plus chain) genome D858 (and has 100% identity D858 with the genomic sequence of 30 nucleotides):

New spacer, which is integrated in the CRISPR1 locus of strain DGCC7710-RH2 S. thermophilus, gives the strain DGCC7710-RH2 S. thermophilus resistance to phage D858, as shown in Fig. 2 and table 2-1 (see also Fig. 10).

Example 3

Integration of the knockout construct

This example describes methods used to integrate and knockout construct.

The strains used in these experiments consisted of:

the parent strain S. thermophilus DGCC7710-sensitive phage 858 and 2972

mutant CRISPR DGCC7778 S. thermophilus resistant 858

DGCC7778cas1KO S. thermophilus

DGCC7778cas4KO S. thermophilus

DGCC7778RT S. thermophilus

DGCC7778RT' S. thermophilus

mutant CRISPR DGCC7710R2 S. thermophilus resistant 2972

DGCC7710R2S1S2 S. thermophilus

E. coli EC1,000, provided pOR128 (see Russell and Klaenhammer, Appl. Environ. Environ., 67:4361-4364 [2001]).

Escherichia coli pCR2.1 TOPO provided pTOPO (see the Invitrogen Catalog #K4500-01).

The following plasmids were used in these experiments:

pTOPO, a plasmid used for sublimirovanny different constructs

pTOPOcas1KO contains integral fragment cas1

pTOPOcas4KO contains integral fragment cas4

pTOPOS1S2 contains the construct of the spacer S1S2

pTOPO RT contains the construct terminal repeat RT

pOR128 is a plasmid used for integrating the various constructs in the chromosome of strains of S. thermophilus.

pORcas1KO contains integral fragment cas1

pORcas4KO contains integral fragment cas4

pOR1S1S2 contains the construct of the spacer S1S2

purist contains the construct terminal repeat RT

These seed were used in these experiments:

Cas1

Cas4

S1S2 and RT

Strains and phages were obtained from culture collections Danisco Culture Collection or from the referenced sources (Russell and Klaenhammer, Appl. Environ. Environ., 67:43691-4364 [2001]; and (Levesque et al., Appl. Environ. Environ., 71:4057-4068 [2005]).

Receiving, cleaning and testing of the phages was performed using methods known in the art (see, for example, Duplessis et al, Virol., 340:192-208 [2005]; and (Levesque et al, Appl. Environ. Environ., 71:4057-4068 [2005]).

Strains of S. thermophilus was grown at 37°C or 42°C in M17 medium (Difco) with addition of 0.5% lactose or sucrose. For infection by the phage to the environment to infection by phage was added to 10 mm CaCl2as is known in the art (see, for example, the above links to work Duplessis et al. and Levesque et al.).

The enzymes used for restriction perevarivanii and PCR, were purchased by the company Invitrogen and used according to manufacturer's instructions. PCR was performed on a thermal Cycling device Eppendorf Mastercycler Gradient, as is known in the art (see, for example, Barrangou et al., Appl. Environ. Environ., 68:2877-2884 [2002]).

Inactivation of genes and site-specific insertion of the chromosome of S. thermophilus plasmid by homologous recombination was performed by sublimirovanny system pCR2.1 TOPO Invitrogen, subsequent cloning in the system pOR1 using E. Coli as the host, and constructs ultimately purified and transformed into S. thermophilus, as described previously (Russell and Klaenhammer, see above).

Integration of the construct RT

Using genetic engineering construct RT, as shown in Fig. 4, the construct was inserted directly after Cas4, as shown in Fig. 5. Maternal DGCC7778 resistant to phage 858. The parent strain has two spacer regions (S1 and D2), which is identical to the DNA of phage 858. The resulting strain (RT) lost resistance to phage 858. This result indicates that cas genes must be in close proximity to the spacer (spacer) for the purpose of stability. As shown in Fig. 3, the parent DGCC7778 was subjected to genetic engineering in order to destroy the cas1 gene, leading to loss of stability, meaning that cas1 necessary to stabilize. As shown in Fig. 3, the parent DGCC7778 was subjected to genetic engineering in order to destroy the gene cas4. In addition, the S1S2 construct was integrated into the parent DGCC7710, as shown in Fig. 6-8.

Example 4

The selection is resistant to phage mutants and confirmation of CRISPR sequences

This example describes the methods used is when selecting resistant to phage mutants and confirmation of CRISPR sequences. Resistant to phage mutants of S. thermophilus were obtained by stimulation of the strain-host DGCC7710 wild-type (also referred to as “RD534”) phage 2972 and/or phage 858 (Levesque et al., Appl. Environ. Environ., 71:4057 [2005]). Strain-host were grown at 42°C in 10 ml of M17 broth with addition of 0.5% lactose (LM17). When the optical density (600 nm) reached 0.3, and added phages and 10 mm calcium chloride at a final concentration of 107plaque-forming units/ml and 50 mm. Containing the phage culture was incubated at 42°C for 24 hours and monitored for the presence of lysis. Then, 100 μl of lysate was inoculable in 10 ml of fresh LM17. The remaining lysate was centrifuged and the precipitate after centrifugation was inoculable to another test tube containing 10 ml of fresh LM17. These two cultures were incubated at 42°C for 16 hours. Finally, these cultures were diluted and were sown on LM17. Isolated colonies were tested for sensitivity to phage, as known in the art (see Moineau et al., Can. J. Environ., 38:875 [1992]). The CRISPR loci of resistant isolates was verified by sequencing PCR products, and using relevant information about the genome of the phage, known in this area (see Levesque et al., Appl. Environ. Environ., 71:4057 [2005]).

Example 5

Genetic engineering of CRISPR spacers

This example describes the methods used for genetic engineering of CRISPR spacers. The enzymes used to check the Denia restriction perevarivanii and PCR, bought the company Invitrogen and used according to manufacturer's instructions. PCR was performed on a thermal Cycling device Eppendorf Mastercycler Gradient, as is well known in this field.

Inactivation of genes and site-specific insertion of the plasmid by homologous recombination in the chromosome of S. thermophilus were sublimemovies system pCR2.1 TOPO (Invitrogen) by subsequent cloning in the system pOR1 using E. Coli as the host, and constructs ultimately purified and transformed into S. thermophilus, as described previously (Russell and Klaenhammer, Appl. Environ. Environ., 67:4261 [2001]).

DNA from mutant WTF+S1S2used as template for amplification of two different fragments PCR using P1in one reaction and P3and P4in another reaction. Both PCR product was subsequently used as matrices in another PCR reaction using primers P1 and P4 to generate S1S2 construct, in accordance with Fig. 11.

The S1S2 construct was subcloned into the system pCR2.1 TOPO. This construct was digested NotI and HindIII and subsequently cloned in pOR1 in sites NotI and HindIII, receiving the construct pS1S2. Integration pS1S2 in the CRISPR1 locus WTF+S4occurred by homologous recombination at the end of via homologous recombin the tion at the end of the 3' cas7 to generate WT F+S4:: pS1S2.

Construct pR generated using the construct pS1S2 as a matrix. In particular, the S1S2 construct, subcloned in pCR2.1 TOPO was digested using BsrGI, which cuts within the CRISPR repeat. Then prewar re-ligated, and the plasmids containing one repeat and not containing spacer was used in the subsequent cloning in pORI, using NotI and HindIII, generating pR. Integration of pR into the chromosome WTF+S1S2at the end of the 3' cas7 through homologous recombination generated WTF+S1S2::pR, mutant, where the CRISPR1 locus substituted, and, instead, inserted an unusual repeat.

Mutant WTF+S1S2::pR subsequently grown in the absence of erythromycin and sensitive to antibiotics variants were analyzed to identify mutant, which had a complete deletion of the CRISPR1 locus. The deletion resulted from homologous recombination occurring at the end of the 3' ORF (unlike the phenomenon of recombination occurring at the end of the 3' cas7, which led to the restoration of the WT strainF+S1S2), generating WTF+S1S2ΔCRISPR1 (see Fig. 12), the mutant, where the CRISPR1 locus is not subjected to deletion (see also Fig. 10).

Example 6

Inactivation of genes cas

For inactivation of cas5, internal segment cas5 length of 801 bp PCR amplified using primers

This construct was digested EcoRV and HindIII and subsequently cloned in pORI sites EcoRV and HindIII. Integration of this construct in gene cas5 WTF+S1S2occurred by homologous recombination of the internal segment of the gene, resulting in obtaining WTF+S1S2::pcas5-.

Similarly, the inner segment cas7 length of 572 bp PCR amplified using primers

and was subcloned into the pCR2.1-TOPO E. Coli (Invitrogen). This construct was digested EcoRV and HindIII and subsequently cloned in pORI sites EcoRV and HindIII. Integration of this construct in gene cas7 WTF+S1S2occurred by homologous recombination of the internal segment of the gene, resulting in obtaining WTF+S1S2::pcas7- (see Fig. 10-12).

Example 7

Natural ways to insert additional sequences in the CRISPR locus

This example describes how natural call insert additional sequences within the CRISPR locus of the bacterial strain. Used in the present description, the term "additional sequence" is defined as spacer elements, the sequence associated with the sequence of the CRISPR repeat. Specifically, "more consistency" partly occurs from the donor phage capable of infecting a bacterium target, and part of the but, from the duplication of the sequence of the CRISPR repeat. Introduction DNA donor phage in the bacterial cell occurs as a result of infection of the donor cells by phage. The selection of cells that contain additional sequence is carried out by selective pressures donor phage so that the selected modified cells were resistant to the phage.

In these experiments, the parent strain was subjected to the donor phage, and was selected as resistant to phage parent strain (i.e. variant strain). Variant strains analyzed (e.g., PCR and/or DNA sequencing to confirm the presence of additional sequences within the CRISPR locus. Determined the nucleotide sequence of additional sequence. Typically, the additional sequence is a fragment size of approximately 30 nucleotides from the donor phage associated (merged) with the sequence of the CRISPR repeat, and he confers resistance to the donor phage.

In some experiments, the parent strain was pre-cultured overnight in an environment based on milk at 42°C. Then the medium based on milk was inoculable at 0.1% (V/V) pre-culture of the parent strain and suspension of donor phage at MOI 10. After 6 h incubation at 42°C cultivation of crops were sown on nutrient medium to obtain isolated colonies. Then the isolates were tested for their resistance to donor phage (any suitable method known in this field, used in these experiments). Then variant strains were analyzed for the presence of additional sequence within one of their CRISPR loci.

The CRISPR loci amplified PCR, and nucleotide sequence of the obtained PCR products was determined by DNA sequencing using standard methods of PCR and sequencing, known in this area. Then these sequences were compared with sequences of the parent strain using methods known in this field.

In some experiments, DGCC7710 used as a parent strain, and D2792 used as donor phage. Strain DGCC7710 maternal S. thermophilus were exposed to the effect of donor phage D2792, as described above. Received variant strain, called WTphi2972+S6(see table 7-1). Table 7-1 also includes the results for variant strains described in other examples. In table 7-1, EOR expressed relative to the phage D2792. Yet another definition, the location of the additional sequence in the genome of phage given relatively phage D2792.

This variant showed ustoichivosti to D2792, since the efficiency of belascoaran (EOR) D2792 on WTphi2972+S6was reduced by 4 logarithm. DNA was extracted from WTphi2972+S6and its CRISPR1 locus were analyzed by PCR, as is known in the art (see, for example, Bolotin et al. [2005] above), using a combination of one direct primer (or YC70 and/orand one reverse primer (or YC31 and/or. Determined the sequence of the PCR product was compared with the sequence of the CRISPR1 locus DGCC7710. Compared to DGCC7710, it was found that WTphi2972+S6is adding one spacer elements of the sequence size of 30 bp at the 5' end region of its CRISPR1 and duplication sequence repeat, as shown in Fig. 14. Comparison of additional sequences from the genome sequence D2972 shows that the new spacer elements, the sequence is 100% identical to the sequence of the genome D2972 from nucleotide 34521 to nucleotide 34492.

In some additional experiments, WTphi858+S1S2::pcas5 used as a parent strain, and D858 used as donor phage. The obtained variant strain, called WTphi858+S1S2::pcas5phi858+S19(see table 7-1) was resistant to D858 when EOR, reduced by logarithms. DNA was extracted from WTphi858+S1S2::pcas5phi858+S19and his CRISPR3 locus were analyzed by PCR, using one direct primerand one reverse primer. Determined the sequence of the PCR product was compared with the sequence of CRISPR3 locus WTphi858+S1S2::pcas5. Compared to WTphi858+S1S2::pcas5, WTphi858+S1S2::pcas5phi858+S19is adding one spacer elements of the sequence size of 30 bp at the 5' end of the field it CRISPR3 and duplication sequence repeat. Comparison of additional sequences from the genome sequence D858 showed that the new spacer elements, the sequence is 100% identical to the sequence of the genome D858 from nucleotide 33824 to nucleotide 33853.

In other experiments, DGCC7809 used as a parent strain, and D3743 used as donor phage. The obtained variant strain, called DGCC7809phiD3743+S28(see table 7-2) was resistant to D3743 when EOR, reduced by 8 logarithms. DNA was extracted from DGCC7809phiD3743+S28and his CRISPR3 locus were analyzed by PCR, using one direct primerand one reverse primer. The definition is whether the sequence of the PCR product was compared with the sequence of CRISPR3 locus ST0189. Compared to DGCC7809, DGCC7809phiD3743+S28is adding one spacer elements sequence size 29 bp at the 5' end of the field it CRISPR3 and duplication sequence repeat. The sequence of the phage D3743 unknown, but a comparison of the additional sequence with the sequence of the genome of other streptococcal phages indicates that the new spacer elements, the sequence is 100% identical to the sequence of the genome of phage DT1 from nucleotide 6967 to nucleotide 6996.

In other experiments, DGCC3198 used as a parent strain, and D4241 used as donor phage. The obtained variant strain, called DGCC3198phi4241+S29(see table 7-2) was resistant to D4241 when EOR, reduced by 8 logarithms. DNA was extracted from DGCC3198phi4241+S1and its CRISPR1 locus were analyzed by PCR, using one direct primer (or YC70 and/orand one reverse primer (or YC31 and/or. Determined the sequence of the PCR product was compared with the sequence of the CRISPR1 locus DGCC3198. Compared to DGCC3198, DGCC3198phi4241+S29is adding one spacer elements of the sequence size of 30 bp at the 5' end region of its CRISPR1 and duplication sequence repeat. The follower is the outer coat of the phage D4241 unknown, however, comparing the additional sequence with the sequence of the genome of other streptococcal phages indicates that the new spacer elements, the sequence is 100% identical to the sequence of the genome of phage DT1 from nucleotide 3484 to nucleotide 3455.

Below in table 7-2 describes the modified CRISPR variant strains of DGCC7809 and DGCC3198. In this table, EOR expressed relative to the donor phage. The location of the additional sequence in the phage given relatively phage DT1.

Table 7-2

Example 8

Selecting a set of modified CRISPR variant strains from the same parent strain

In this example, describes the methods used to select a set of variant strains from the same parent strain, different additional sequence originating from the same phage. Because different parts of the donor phage are used as sources for additional sequences from the donor phage can be generated by multiple different variant strains. In addition, each variant strain who meet other additional sequence. Therefore, in addition to the variant strain described in example 7, from the same parent strain were developed multiple strains. In some experiments, these additional strains were generated by the effect on the strain-recipient of the same donor phage. It was envisaged that different variant obtained strains was different range of sensitivity to phages.

In independent cultures of the parent strain was subjected to the same donor phage. For each culture was isolated and analyzed one resistant to phage variant, as described in example 7. Additional sequence in each of the variant strains were compared with each other. The range of sensitivity of variant strains to the donor phage and other phages was determined using classical microbiological methods known in this field. Then compare the spectra of the sensitivity of different strains. Selected variant strains were those that showed an additional sequence (sequence) and different spectra of sensitivity to phages.

In some experiments, were selected variety of variant strains of DGCC7710 using D2972 as one donor phage. The parent strain DGCC7710 was subjected to donor f the ha D2972 in four independent cultures, as described in example 7. From each culture was isolated variant strain and accordingly named WTphi2972+S4, WTphi2972+S20, WTphi2972+S21and WTphi2972+S22(see table 7-1).

These variant strains showed resistance to D2972, since the efficiency of belascoaran (EOR) D2972 on the four resistant to phage variants was reduced by 3-5 logarithms. DNA was extracted from WTphi2972+S4, WTphi2972+S20, WTphi2972+S21and WTphi2972+S22and were analyzed by PCR, using methods known in the art (see, for example, Bolotin et al. [2005] above), using a combination of one direct primer (or YC70 and/orand one reverse primer (or YC31 and/or. Determined the sequence of the PCR products was compared with the sequence of the CRISPR1 locus DGCC7710. Compared to DGCC7710, WTphi2972+S4, WTphi2972+S20, WTphi2972+S21and WTphi2972+S22are adding a spacer elements of the sequence size of 30 bp at the 5' end region of its CRISPR1 and duplication sequence repeat, as shown in Fig. 17. The comparison of these new spacer elements of the sequences with the genome sequence D2972 shows that the new spacer elements of a sequence 100% identical to last the sequences of genome D2972, respectively, of the nucleotide 31582 to nucleotide 31611, from nucleotide 25693 to nucleotide 25722, from nucleotide 27560 to nucleotide 27589 and from nucleotide 24624 to nucleotide 24653. It was found that all four additional spacer differed from each other and differed from the spacers described in example 7.

Example 9

Natural ways used to insert second additional sequences in the CRISPR locus

In this example, described natural ways used to call insert second additional sequences in the CRISPR locus. After inserting the second additional sequence from the donor phage in the bacterial CRISPR locus, a variant strain becomes resistant or at least less sensitive to this phage. Therefore, the method described in example 7, is no longer effective for the insertion of additional sequences in the CRISPR locus variant strain. For example, this method cannot be applied to the variant strain WTphi2972+S6(as a parent strain) using D2972 as donor phage, because WTphi2972+S6has significantly reduced sensitivity to D2972 (see example 7).

In some experiments, this problem has been overcome by the use of mutated donor phage obtained from D2972, which includes at least one specific modificati is within its genome (i.e. "mutated phage"). This mutant phage was selected by the impact on the donor phage variant strain, so that the modification (i.e. mutation) parent phage gave him virulence for variant strain.

In some experiments, the mutated phage had a mutation in its genome within the region containing the sequence of additional spacer, which is part of the additional sequence in variant strain. Variant strain was sensitive to this the mutated phage. Variant strain was subjected to the mutated phage, and chose resistant to phage variant (variant 2nd generation) variant strain. Option 2-the second generation was analyzed using suitable methods known in this field (e.g., PCR and sequencing to confirm the presence of additional sequences within the CRISPR locus. Determined the nucleotide sequence of additional sequence. In some experiments, it was found that the additional sequence contains a fragment size of approximately 30 nucleotides of the mutant phage, which provides resistance to the mutated phage.

In some experiments, the variant strain was pre-cultured overnight in the appropriate medium at the milk again at 42°C. Then a suitable environment on the basis of milk was inoculable pre-culture variant strain at a concentration of about 106plaque-forming units/ml and the suspension of donor phage at MOI of more than 100. The culture was incubated overnight at 42°C and then centrifuged. The supernatant was collected and filtered using a filter with a pore size of 0.45 μm. Cultivation of the filtered supernatant was used for inoculation of nutrient agar media seeded variant strain, to obtain isolated plaques of phage using any suitable method known in this field. Isolated plaques were cultured on a variant strain in liquid nutrient media using any suitable method known in this field. Suspension mutant phage was obtained by filtering the culture through a filter with pore size 0.45 µm. Then mutated phage was used as described above (see example 7), to call the insert second additional spacer elements in the sequence of the CRISPR locus variant strain.

In some experiments, WTphi2972+S6(see example 7 and table 7-1) was used as the parent strain and D4724 used as donor phage. Variant strain WTphi2972+S6were cultured in the presence of the high end of the ation of phage D2972. The mutated phage D4724 were isolated by blagoobrazov from the supernatant of this culture on the strain WTphi2972+S6using the methods described above. Verify the virulence of mutant phage D4724 on WTphi2972+S6. Variant strain WTphi2972+S6were subjected to phage D4724 in culture as described in example 7. Got resistant to phage variant strain, named WTphi2972+S6phi4724+S15(see table 7-1).

Compared to WTphi2972+S6this variant strain showed increased resistance to D2972, since the efficiency of belascoaran (EOR) D2972 on WTphi2972+S6phi4724+S15was reduced by more than 8 logarithms (instead of 4 logarithms); in addition, its stability was also increased compared to WTphi2972+S6because he has shown some resistance to D4724 (see table 9-1). DNA was extracted from WTphi2972+S6phi4724+S15and its CRISPR1 locus were analyzed by PCR, as described above, using the same combinations of primers as described above. Determined the sequence of the PCR product was compared with the sequence of the CRISPR1 locus WTphi2972+S6. Compared to WTphi2972+S6, WTphi2972+S6phi4724+S15features the addition of a spacer elements effects the successive size of 30 bp at the 5' end region of its CRISPR1 and duplication sequence repeat, as shown in Fig. 17. Comparison of this additional spacer elements of the sequence with the genome sequence D2972 showed that the second additional spacer elements, the sequence is 100% identical to the sequence of the genome D2972 from nucleotide 1113 to nucleotide 1142.

From independent cultures, using identical experimental conditions were selected and analyzed variant strains WTphi2972+S6phi4724+S17and WTphi2972+S6phi4724+S24(see table 7-1). Compared to WTphi2972+S6these variant strains showed increased resistance to D2972, since the efficiency of belascoaran (EOR) D2972 on WTphi2972+S6phi4724+S17and WTphi2972+S6phi4724+S24was reduced by more than 8 logarithms for both variant strains; and their resistance was also increased compared to WTphi2972+S6because they showed some resistance to D4724 (see table 9-1). In addition, these variant strains are additional spacer elements in the sequence of the CRISPR1, which is 100% identical to the sequence of the genome D2972, respectively, of the nucleotide 33968 to nucleotide 33997 and from nucleotide 30803 to nucleotide 30832.

In additional experiments, WTphi2972+S6phi4724+S15use the Ali as the parent strain and D4733 used as donor phage. The above methods used to generate the mutated phage D4733 of phage D4724. Then the phage D4733 used to obtain resistant to the phage variant strain of WTphi2972+S6phi4724+S15. The obtained variant strain was named WTphi2972+S6phi4724+S15phi4733+S16(see table 7-1). This variant strain contains one additional sequence comprising spacer elements sequence that is 100% identical to the sequence of their genome D2972, from nucleotide 29923 to nucleotide 29894. He showed increased resistance to D2972, since the efficiency of belascoaran (EOR) D2972 on WTphi2972+S6phi4724+S15phi4733+S16was reduced by more than 8 logarithms, and its stability was spread on the phage D4733 (see table 9-1). Table 9-1 describes the resistance to phage modified CRISPR variant strains of DGCC7710. In this table, "nd" indicates that the results were not determined.

Table 9-1

In some experiments, WTphi2972+S4used as the parent strain and D472 used as donor phage. Using the same methods described above were generated mutated phage D4720 of phage D2972. Phage D4720 used to obtain resistant to the phage variants of WTphi2972+S4. The obtained variant strain was named WTphi2972+S4phi4720+S17(see table 7-1). This variant strain contains one additional sequence comprising spacer elements sequence that is 100% identical to the sequence of the genome D2972, from nucleotide 33968 to 33997. He showed increased resistance to D2972, since the efficiency of belascoaran (EOR) D2972 on WTphi2972+S4phi4724+S17was reduced by 6 logarithms (compared to 5 logarithms), and its stability was extended to the phage D4720 (see table 9-1).

Example 10

Alternative natural ways to insert second additional sequence (sequences) in the CRISPR loci

In this example, the described alternative natural ways that can be used to insert second additional sequences in the CRISPR locus. It is known that the parent strain may be sensitive to more than one family of phages. Diversity sensitivity were mainly used for insertion of additional sequences in the CRISPR locus variant strain is, as described in this application. In these experiments, the second donor phage was selected to test the virulence selection of phages at the parent strain and variant strain (strains). Interest second donor phage were those that were virulent for both strains. It was envisaged that these phages probably would represent the family of phages, other than families, presents the original donor phage. After his selection, the second donor phage was used to infect the variant strain. As described in the methods above, resistant to phage variant strain of the second generation was selected and tested for the presence of additional sequences in the CRISPR locus.

In these experiments, a collection of phages (or containing the phage samples) were tested against the parent strain using classical microbiological methods known in this field. Then the phage (or samples)that are virulent to the parent strain, was tested against variant strains using the same methods. One phage (or sample), which was virulent for variant strain, was chosen as the second donor phage. In the case of samples containing phages, one virulent phage was purified to homogeneity on a variant strain using classic is mikrobiologicheskikh ways known in this field. In some experiments, we determined the sequence of the second donor phage. In some experiments, and then used the second donor phage as described above (see example 7) to call insert second additional sequences in the CRISPR locus variant strain.

In some experiments, WTphi2972+S4(see example 8 and table 7-1) was used as the parent strain and D858 used as donor phage. After testing various phages, it was found that the strain DGCC7710 sensitive to phage D2972, and phage D858. In addition, it was found that D858 is against virulent variant strain WTphi2972+S4. The obtained variant strain was named WTphi2972+S4. Therefore, in some experiments the phage D858 was selected as the second phage.

Variant strain WTphi2972+S4was subjected to the second donor phage D858 as described in example 7. Got resistant to phage variant strain, named WTphi2972+S4phi858+S18(see table 7-1), which is resistant to D858 (see table 9-1). This strain exhibits increased resistance to D2972, since the efficiency of belascoaran D2792 on WTphi2972+S4phi858+S18was reduced by more than 8 logarithms (compared with 5 lo what Oriflame for WT phi2972+S4see table 9-1). DNA was extracted from WTphi2972+S4phi858+S18and its CRISPR1 locus were analyzed by PCR, using the same methods and primers, as described previously. Determined the sequence of the PCR product was compared with the sequence of the CRISPR locus WTphi2972+S4. Compared to WTphi2972+S4, WTphi2972+S4phi858+S18features the addition of a spacer elements of the sequence size of 30 bp at the 5' end region of its CRISPR1 and duplication sequence repeat, as shown in Fig. 17. Comparison of this sequence with the sequence of the genome D858 showed that the second additional spacer elements, the sequence is 100% identical to the sequence of the genome D858 from nucleotide 30338 to nucleotide 30367.

In independent experimental work also received another variant strain, named WTphi2972+S4phi4720+S25(see table 7-1)using this method. This variant strain contains one additional sequence comprising spacer elements sequence that is 100% identical to the sequence of the genome D858 from nucleotide 33886 to 33915. He exhibits increased resistance to D2972, since the efficiency of belascoaran D2792 on WTphi2972+S4phi4724+S25was SN the wife more than 7 logarithms (see table 9-1).

Example 11

The Genesis of the modified CRISPR variant strains resistant to multiple phages, multiple insertions of additional sequences in the CRISPR loci

This example describes the development of strains resistant to multiple phages, by re-add the phage sequences in the CRISPR loci, because adding 2 phage sequences in the CRISPR loci is not enough to give this strain of resistance to all phages. For example, it was found that the strain WTphi2972+S4phi858+S18(described in example 10) sensitive to a variety of other phages. In the process of developing resistant to many phage strain parent strain was subjected to a second phage to select a variant strain of the second generation, which is resistant to both phages. Then, the last variant strain was subjected to repeated impact of phages to which he was sensitive, until then, until it was the final variant strain that was resistant to all available phage.

Using methods known in this field, was identified set of 10 reference phages that are representative of the diversity of phages that are able to grow on strain DGCC7710, namely phage D858, D1126, D2766, D2972, D3288, D3821, D4083, D4752, D4753 and N1495. described in example 7, DGCC7710 was subjected to phage D2972 to generate variant strain DGCC9705. It was found that DGCC9705 resistant to phage D2766 and D4752. In addition to phage D2972, but was still sensitive to other phages, as shown in table 11-1. DGCC9705 described in table 11-1, and Fig. 17. DGCC9705 is 1 additional sequence in CRISPR1 and 1 additional sequence in CRISPR3. Sequence analysis of the locus CRISPR1 and CRISPR3 locus was performed in accordance with the methods described in example 7. Determined the sequence of PCR products was compared with sequences of the CRISPR1 locus and 3 DGCC7710. DGCC9705 is 1 extra spacer in its CRISPR1 locus and one additional spacer in the CRISPR3 locus. Spacer elements sequences identical to sequences from phage D2972. Using the same methods, DGCC9705 was then subjected to phage D3821, and then was selected variant strain DGCC9726. In addition to resistance to D2972, DGCC9726 resistant to phage D858, D3821, D4083 and N1495 (see table 11-1). DGCC9726 has 1 more consistency in its CRISPR1, compared with DGCC9705 (see table 7-1 and Fig. 17). Additional spacer elements sequence identical to the sequence of D2972. Through the impact of phage D3288 on strain DGCC9726, was selected DGCC9733. Strain DGCC9733 additionally resistant to phage D3288 and D1126 (see table 11-1). DGC9733 has 1 more consistency in its CRISPR1, compared to DGCC9726 (see table 7-1 and Fig. 17). This spacer elements sequence has the same identity (identity 25 to 30 base pairs) as a sequence of streptococcal phage 7201. Finally, by the last repeated exposure phage D4753, was selected DGCC9836, which is resistant to all phages (see table 11-1). DGCC9836 has 2 additional spacer elements sequence in its CRISPR1 locus and 2 additional spacer elements sequence in its CRISPR3 locus (see table 7-1 and Fig. 17). One spacer elements sequence identical to the sequence in the phage D2972, and 3 other spacer elements sequences identical to sequences in the phage D858.

Table 11-1 presents data on sensitivity to phage modified CRISPR variant strain DGCC9836 and intermediate modified CRISPR variant strains. In this table, “S” indicates the sensitivity and “R” indicates stability.

Table 11-1

Example 12

Natural way to insert multiple additional sequences in the CRISPR locus

This example describes how to insert multiple additional p is sledovatelnot in the CRISPR loci. In these ways, rather than re-use of various phages, the parent strain was subjected to a mixture containing multiple phages. A collection of phages tested against multiple strains using classical microbiological methods to determine the range of their hosts. Selected phages that were virulent to the parent strain but which had a different spectrum owners. Selected phages were mixed and used in the above methods (see example 7) to call the insertion of additional sequences in the CRISPR loci variant strain.

In some experiments, DGCC7710 used as a parent strain, and D858 and D2972 used as donor phage. After testing various phages, it was found that the strain DGCC7710 sensitive to phage D2972, and phage D858. However D2972 and D858 showed different spectra owners in the testing strain DGCC7778, suggesting that these two phage were different.

The parent strain DGCC7710 was subjected to a mixture of phage D858 and D2972, as described in example 7. Got resistant to phage variant strain, named WTphi858phi2972+S9S10S11S12(see table 7-1). He shows resistance to D858, since the efficiency of belascoaran D858 on WTphi858phi2972+S9S10S11S12was reduced by more than 7 logarithms, and t is the train resistance D2972, because the effectiveness of belascoaran D2972 on WTphi858phi2972+S9S10S11S12was reduced by more than 7 logarithms. DNA was extracted from WTphi858phi2972+S9S10S11S12and its CRISPR1 locus were analyzed by PCR, using the same methods and primers, as described above. Determined the sequence of the PCR products was compared with the sequence of the locus of CRISPR1 and CRISPR3 locus DGCC7710. Compared to DGCC7710, WTphi858phi2972+S9S10S11S12features the addition of a spacer elements 4 sequences of size 30 bp at the 5' end region of its CRISPR1 and duplication of sequences of iterations, as shown in Fig. 17. Comparison of the additional spacer elements of the sequences with the genome sequence D2972 showed that additional spacer elements of a sequence 100% identical to the sequence D2972 from nucleotide 7874 to nucleotide 7903, from nucleotide 20650 to nucleotide 20621, from nucleotide 8360 to nucleotide 8389 and from nucleotide 18998 to nucleotide 19027.

In other experiments, the strain WTphi858phi2972+S13S14(see table 7-1) also received in accordance with these methods. He shows resistance to D858, since the efficiency of belascoaran D858 on WTphi858phi2972+S13S14was reduced by 7 logarithms, and resistance to D2972, since the efficiency of belascoaran D2972 on WTphi858phi2972+S13S14was reduced by 8 log is IFOV. Comparison of the additional spacer elements of the sequences with the genome sequence D2972 showed that additional spacer elements of a sequence 100% identical to the sequence D2972 from nucleotide 33602 to nucleotide 33361 and from nucleotides 4830 to nucleotide 4801.

Example 13

Natural way to insert multiple additional sequences in the CRISPR locus

This example describes ways of dealing with phages during the fermentation by the use of a variant strain, and not the parent (i.e. wild-type recipient) strain. Thus, this example provides another description of the benefits of variant strains.

In some experiments, carried out the comparison of strain DGCC7710 strain WTphi2972+S20and strain WTphi2972+S26S27during the fermentation of milk in the presence of phage D2972. DGCC7710 is an industrial strain used in fermentation of milk. Strain WTphi2972+S20described in table 7-1 and example 8 and manifests in its CRISPR1 locus additional spacer, compared with strain DGCC7710. Strain WTphi2972+S20exhibits increased resistance to D2972, compared with DGCC7710. WTphi2972+S26S27represents another variant, showing some resistance to D2972 (described in table 7-1) and has 2 additional with whom Asura in its CRISPR1 locus.

Batch fermentation was performed with each strain. First, the environment 10% milk powder (mass/about) were seeded at 1% (V/V) pre-culture tested strain and 104plaque-forming units/ml of phage D2972. The culture was incubated at 42°C for 6 hours After the first fermentation, conducted a second fermentation. Used exactly the same conditions of fermentation, except that was added 0.1% of the volume of fermentata previous fermentation (before adding, fermentat was filtered using a filter with pore size 0.45 µm). Then perform subsequent fermentation under the same experimental conditions as the conditions used for the second fermentation. All fermentation was registered impedancometry. At the end of each fermentation was tested coagulation of milk and performed a titration of phages using methods known in this field.

In the case of fermentation of milk in the absence of phage, the change in impedance when DGCC7710 was above 2500 μs within 6 hours. In the presence of D2972 (DGCC7710 very sensitive to phages, phage D2972 reached a high level of population during the first culture and fermentation could not cause collapse of milk. The change in impedance after 6 hours was always below 500 μs. On the contrary, the fermentation of milk WTphi2972+S20in the presence of D2972 provided perhaps the th collapse milk, at least until the 3rd subculture and marked by slow development level of the phage. The change in impedance has increased to more than 2500 µs up to the 3rd subculture. This demonstrates that the variant strain WTphi2972+S20more appropriate than the parent strain DGCC7710, for acidification of milk in the presence of phages. In addition, the fermentation of milk WTphi2972+S26S27ensured the feasibility of phasing out milk, at least until the last subculture without the development of phage. In addition, the increase in impedance has increased to more than 2500 µs also to the last subculture. This demonstrates that the variant strain WTphi2972+S26S27more appropriate than the parent strain DGCC7710, and even more appropriate than WTphi2972+S20for acidification of milk in the presence of phages. The experiments were performed in duplicate, and the results are presented in table 13-1.

Table 13-1
Comparison of fermentation of milk DGCC7710 or variant strains in the presence of phage D2972
StrainSubcultureThe collapse of milk within 6 hThe level of phage on fermenting strain The change in impedance within 6 h (ISS)
ControlYesNo3246
the first test1NoHigh319
2NoHigh23
the second test1NoHigh287
2NoHigh16
the first test1YesNo3281
2YesLow3148
3Yes Low3251
4YesHigh3101

the second test1YesLow3371
2YesAverage3265
3YesHigh2780
4NoHigh223
the first test1YesNo3322
2YesNo3208
3YesNo3467
4 YesNo3182
the second test1YesNo3260
2YesNo3021
3YesNo3377
4YesNo3246

In the second series of experiments was reproduced comparison of strain DGCC7710 strain WTphi2972+S20and strain WTphi2972+S26S27during the fermentation of milk in the presence of phage D2972. In addition, we studied the strain DGCC9836. Strain DGCC9836 is an even developed a variant strain DGCC7710, which is the result of multiple stimulation phages. This strain manifests 5 additional spacers in its CRISPR1 locus and 3 additional spacer in the CRISPR3 locus (see example 11 and Fig. 17). DGCC9836 resistant to all tested phages.

The experiments were conducted as described above. The results are presented in table 13-2. Regarding the first series of experiments, armentizia milk WT phi2972+S20in the presence of D2972 provided the possibility of the collapse of the milk until the 5th subculture, and measured the slow development of the level of phages. The change in impedance has increased to more than 2500 ISS during the first 5 subcultures, demonstrating that the phages do not affect the acidification of milk. When the 6th subculture, the level of phage significantly increased, and it has violated the fermentation of milk. For the other two variant strains, impacts on the fermentation of milk was not for all 6 subcultures, phages never developed, and recorded the change in impedance was always above 2500 μs.

These experiments demonstrate that strains containing at least one additional spacer elements sequence in the CRISPR1 locus allow fermentation of milk even in the presence of phages. The fermentation of milk was provided even more, when the strains have more than one additional spacer elements in the sequence of the CRISPR loci.

Table 13-2
Comparison of fermentation of milk variant strain DGCC7710 in the presence of phage D2972
StrainSubcultureThe collapse of milk within 6 h The level of phage on fermenting strainThe change in impedance within 6 h (ISS)
1YesNo3171
2YesNo2991
3YesLow2871
4YesAverage2934
5YesAverage2906
6NoHigh661
1YesNo2970
2YesNo2945
3Yes No2617
4YesNo2721
5YesNo2660
6YesNo2605
DGCC98361YesNo3028
2YesNo3115

3YesNo2708
4YesNo2817
5YesNo2845
6YesNo2813

Example 14

War is and phages in fermentation using a combination of modified CRISPR variant strains

This example describes ways of dealing with phages during the fermentation by using a combination of variant strains, rather than using a single strain. Thus, this example illustrates the simultaneous use of one or more variant strains (i.e., the combination of variant strains). Indeed, a mixture of strains exhibit the same functionality, but with these types of applications can use other types of sensitivity to phages. For example, 2 or 3 or even more than described in this application variant strains can be used in such applications. The use of combinations of variant strains with different spacer elements added sequences in their CRISPR loci allows the fermentation to facilitate resistance to any emerging mutant phage.

In some experiments, a comparison was performed between one strain WTphi2972+S21and a combination of 3 strains (namely WTphi2972+S20, WTphi2972+S21and WTphi2972+S22used for the fermentation of milk in the presence of phage D2972. Strains WTphi2972+S20, WTphi2972+S21and WTphi2972+S22described in table 7-1 and example 8. They are independent of variant strains of DGCC7710. Each variant strain showing in his the CRISPR1 locus distinct additional spacer elements of the sequence (which occurred from phage D2972), compared with the strain DGCC7710.

Batch fermentation was performed or one strain WTphi2972+S21or a combination of the three strains. First, the environment 10% milk powder (mass/about) were seeded at 1% (V/V) pre-culture of the same strain or combination of strains and 104plaque-forming units/ml of phage D2972. The culture was incubated at 42°C for 6 hours After the first fermentation was performed a second fermentation. Used exactly the same conditions of fermentation, except that was added 0.1% of the volume of fermentata previous fermentation (before adding, fermentat was filtered using a filter with pore size 0.45 µm). Then perform the subsequent fermentation, using the same experimental conditions used for the second fermentation. All fermentation was registered impedimetry. At the end of each fermentation was tested coagulation of milk and performed a titration of phages using methods known in this field. The experiments were performed in duplicate, and the results are presented in table 14-1.

Table 14-1
Comparison of fermentation of milk WTphi2972+S21or a combination of the three strains in the presence of phage D2972
StrainSubcultureThe collapse of milk within 6 hThe level of phage on fermenting strainThe change in impedance within 6 h (ISS)
DGCC7710ControlNoHigh46
the first test1YesLow3367

2YesHigh3312
3NoHigh555
4NoHigh33
5NoHigh25
the second and is a test 1YesLow3450
2YesHigh3293
3NoHigh1071
4NoHigh29
5NoHigh26

the first test
1YesVery low3242
2YesLow3233
3YesHigh3319
4YesHigh3169
5Yes High3261
the second test1YesVery low3384
2YesLow3178
3YesHigh3206
4YesHigh3295
5YesHigh3209

The fermentation of milk, conducted WTphi2972+S21in the presence of phages was insolvent at the third subculture in both tests. This was shown by the absence of collapse of milk and a high reduction of impedance changes after 6 hours of fermentation. On the contrary, despite some development of phage D2972, fermentation was successfully carried out until the fifth subculture, when he used a mixture of three strains. Collapsing milk was detected in all cultures, and the change in impedance within 6 hours of incubation was never the below 3000 microseconds.

These experiments demonstrate that the use of combinations of variant strains with at least one additional spacer elements sequence in its CRISPR1 locus enables the fermentation of milk in the presence of phages in comparison with the use of one variant strain.

Example 15

The fight against phages in fermentation using rotation modified CRISPR variant strains

In additional experiments, the variant strains had the same functionality, but other types of sensitivity to phages. Thus, in this example, experiments conducted at re/sequential application of several different strains (i.e. modified CRISPR variant strains) sequentially in the rotation scheme.

In some experiments, carried out the comparison of one strain WTphi2972+S21and strains WTphi2972+S20WTphi2972+S21and WTphi2972+S22applied consistently (with rotation) for the fermentation of milk in the presence of phage D2972. The first fermentation of milk was carried out with the strain WTphi2972+S20. Then for the second fermentation used strain WTphi2972+S22and strain WTphi2972+S21used for the third fermentation. Then there was the fourth fermentation, again using PCs is mm WT phi2972+S20with subsequent fermentation of the strain WTphi2972+S22then strain WTphi2972+S21and so on. Strains WTphi2972+S20, WTphi2972+S21and WTphi2972+S22as described in table 7-1. They are independent of variant strains of DGCC7710. Each variant strain exhibits a distinct additional spacer elements sequence in the CRISPR1 locus, compared with strain DGCC7710, which was obtained from a phage D2972.

Batch fermentation was performed using the same experimental methods that are described in example 14. The experiments were conducted in three replications. And the results are presented in table 15-1. Batch fermentation inoculated with one WTphi2972+S20were successful until the 3rd subculture, as shown by the values of the impedance changes above 3000 µs and minimize of milk. These subcultures were not able to collapse the milk, and were registered high values of phages. In contrast, batch fermentation performed by inoculation of milk with rotation 3 different variant strains (WTphi2972+S20, WTphi2972+S21and WTphi2972+S22), were successful before the tenth subculture. In these experimental conditions, the phage could not reproduce and remained at low levels. These results indicate that use the of rotation of variant strains provides increased resistance to phages during fermentation, compared with the use of a variant strain.

Table 15-1

Example 16

The reduction and regulation of populations of phages using the modified CRISPR variant strains

This example describes experiments conducted to determine the ability of the modified CRISPR strain to destroy phage resistance which he had received. In particular, experiments were planned to determine, will decrease if the population of phages to non-detectable levels during fermentation modified CRISPR strain.

In some experiments, DGCC9836 (described in example 11, and Fig. 17) used to perform the fermentation of milk in the presence of phage D2972, compared with fermentation conducted its parent strain DGCC7710 in the presence of D2972. Wednesday 10% milk powder (mass/about) were seeded at approximately 106plaque-forming units/ml pre-culture of the tested strain and 107plaque-forming units/ml of phage D2972. The culture was incubated at 42°C for 24 h At different points in time, took aliquot number and population of phage was measured using a double-layer agar plate seeded DGCC7710 using standard methods known in this field. The results are presented in the Fig. 20. During the fermentation of milk DGCC7710, phage D2972 multiplied, reaching a population of more than 108plaque-forming units/ml on the Contrary, during fermentation DGCC9836, the population of phage D2972 gradually decreased to very low levels (120 plaque-forming units/ml) after 6 hours of incubation, and was almost undetectable after 24 hours of incubation. This last result suggests that phages were destroyed during the fermentation process variant strain DGCC9836.

The ability of the variant strain to destroy the phage, and the lack of sensitivity to phages is an additional advantage compared to the traditional program of the rotation of the starter culture strains insensitive, but harmless to the phages. Indeed, through the use of variant strains, the eradication of dormant phage will occur through a combination of leaching of phages (as in rotation with traditional starter culture) and the destruction of the phage.

In other experiments, the variant strains exhibiting some, but incomplete resistance to phage D2972, were associated with the fermentation of milk in the presence of D2972. Selected variant strains included WTphi2972+S20and WTphi2972+S21as described in example 8 and in table 7-1. These strains show reduced EAR for phage D2972 about 5 logarithmic is. Fermentation of milk was performed as described above (the rate of bacterial inoculation of 106plaque-forming units/ml; speed inoculation phage 107plaque-forming units/ml). Fermentation of milk held or WTphi2972+S20or WTphi2972+S21or a mixture of two strains. At different points in time, recorded a population of phage. To this end, took aliquot number, and the population of phage was measured using a double-layer agar plate seeded or WTphi2972+S20or WTphi2972+S21using standard methods known in this field. The results are presented in Fig. 21, which indicates the amount of phages detected on WTphi2972+S20and WTphi2972+S21for each fermentati milk. When used for fermentation of the same strain (WTphi2972+S20or WTphi2972+S21), the number of identified phage during inoculation was approximately 100 plaque-forming units/ml (due to 5 log reduction EOR). After culturing, the number of phages increased to 106or 107(respectively), corresponding to a multiplication of phages 4-5 logarithms. The factor of multiplication of phages was much lower (2 logarithm) for the fermentation of milk inoculated with 2 strains. Indeed, the number of phages increased from 100 fucking soobrazuya units/ml up to a maximum of about 10 4plaque-forming units/ml of These final results show that during co-cultivation 2 variant strains, the speed of propagation of phages significantly reduced, compared with the speed of propagation of the phage in the culture reached a single variant strains.

Example 17

Insert spacers

This example describes methods and compositions used to insert two spacers in S. thermophilus DGCC7710. The strain of S. thermophilus DGCC7710 (deposited in the French National collection of cultures of microorganisms under the number CNCM 1-2423), has at least 3 of the CRISPR locus: CRISPR1, CRISPR2 and CRISPR3. In CNRZ1066 and LMG18311, for which the full sequence of the genome (see Bolotin et al. [2004] above), CRISPR1 is localized in the same chromosomal locus: between str0660 (or stu0660) and str0661 (or stu0661). In the strain DGCC7710, CRISPR1 also localized in the same chromosomal locus, between similar genes. CRISPR1 strain DGCC7710 contains 33 repeat (including the terminal repeat), and, thus, 32 of the spacer (see Fig. 19). These spacers are different from each other. Most of these spacers have not been previously described as being in the CRISPR loci, but four spacer close to the trailer CRISPR1 identical to the well-known CRISPR1 spacers. For example, 28-th spacer DGCC7710 100% identical to the 31-th spacer strain DGCC7710 CNRZ1575 (access number in the gene Bank DQ072991); 30th spacer DGCC7710 100% identical to the 27-th CRISPR1 spacer CNRZ703 (access number in the gene Bank DQ072990); 31st spacer DGCC7710 100% identical to the 28-th CRISPR1 spacer strain CNRZ703 (access number in the gene Bank DQ072990); and 32nd spacer DGCC7710 100% identical to the 30-th CRISPR1 spacer strain CNRZ703 (access number in the gene Bank DQ072990). The CRISPR1 sequence (5'-3') strain DGCC7710 shown below in SEQ ID NO:678:

D858, the phage used in these experiments is a bacteriophage related to the family Siphoviridae viruses. Although its genome sequence has been completely determined, it obviously remains to be published. This phage is virulent for strain S. thermophilus DGCC7710. Strain DGCC7778 S. thermophilus was isolated in the form of natural, resistant to phage mutant, using DGCC7710 as the parent strain and phage D858 as virulent phage. CRISPR1 strain DGCC7778 contains 35 repeats (including the terminal repeat) and, thus, the spacer 34. Compared to the CRISPR1 sequence of DGCC7710, the CRISPR1 sequence DGCC7778 has two additional adjacent new spacer (and, of course, two additional repeat that flank the new spacers) on one end of the CRISPR locus (i.e. close to the leader). All other spacers of the CRISPR1 locus are the same. The CRISPR1 sequence (5'-3') strain DGCC7778 shown below in SEQ ID NO:678:

If DGCC7778, the first space the and the second spacerare specific to the strain of the label that identifies this labeled strain. It is determined that the sequence of both new spacers exist within the genome of phage D858. The sequence of the second new spacer is detected between the provisions 25471 and 25442 bp (i.e. on the "minus-chain") of the genome D858, with one erroneous pairing (96,7% identical nucleotides to 30 nucleotides).

The sequence of the first spacer is detected between the provisions 31481 and 31410 bp (i.e. the "plus-loop") of the genome D858 (100% identical nucleotides to 30 nucleotides).

Although there is no intention that this invention be limited to any particular mechanism or theory, it is envisaged that two new spacer present in the CRISPR1 locus DGCC7778, are required to obtain a strain DGCC7778 new resistance to phage D858). Spacer "2" (found in DGCC7778) is first inserted into the CRISPR1 locus DGCC7710 (33 repeat and spacer 32) at one end of the CRISPR locus, with one repeat. This box gave the mutant insensitive to bacteriophage (intermediate strain), labeled these additional new spacer (thus bearing 34 repeat and spacer 33). This spacer was obtained from genome D858, but during the process the and insert, probably an error occurred replication or reverse transcription error, leading to point mutations. Because of improper mating (i.e. 1 erroneous pairing) between this newly acquired spacer and labeled by a sequence of phage, the effectiveness of the stability of this intermediate strain for phage D858 was low. The second phenomenon insert spacer happened in this intermediate strain (more resistant to phage D858 than the parent strain DGCC7710, but not "fully" sustainable due to mistakenly mating), resulting in the insertion of the second new spacer (i.e. spacer "1", as found in DGCC7778) on the same end of the CRISPR1 locus, with one repeat. This second insert has given a new resistant to bacteriophage mutant, which was isolated and named DGCC7778. DGCC7778 more resistant to D858 than intermediate strain, and, of course, much more stable than the parent strain DGCC7710, due to the presence of spacer "1", and which is 100% identical to the sequence of labeled phage.

Example 18

The method of tagging DGCC7710 and selection labeled strain DGCC7778

This example describes methods used for marking DGCC7710 and selection labeled strain DGCC7778. Strain DGCC7710 infected/exposed stimulation phage D858 inoculation pasteurized milk strain DGCC7710 in an amount of about 2×106colony forming units/ml and phage 858 in an amount of about 1×10 5colony forming units/ml of Inoculated milk was cultured for 12 hours at 35°C. After incubation, viable bacteria (i.e. those that probably are not sensitive to the bacteriophage mutants) were isolated on non-selective medium (milk-agar plates at 35°C using the appropriate dilution of infected culture. One isolate, called DGCC7778, multiplied in liquid medium M17-glucose at 35°C, and DNA was extracted using the classical Protocol for extraction of DNA, as is well known in this field.

Extract DNA amplified using PCR, as is known in the art (see, for example, Bolotin et al. [2005], see above), using a combination of one direct primer ((or yc70 and/orand one reverse primer (or yc31 and/or. Determined the sequence of the PCR products was compared with the sequence of the CRISPR locus DGCC7710.

Example 19

Obtaining a second labeled strain

This example describes methods used to obtain the second labeled strain. Strain DGCC7710-RH1 S. thermophilus was isolated as a natural resistant to phage mutant using strain DGCC7710 as the parent strain and phage D858 as virulent phage.

CRISPR1 shtam is and DGCC7710-RH1 contains 34 repeat (including the terminal repeat) and thus, the spacer 33. When compared with the CRISPR1 sequence of strain S. thermophilus DGCC7710, the CRISPR1 sequence of strain DGCC7710-RH1 S. thermophilus has one additional new spacer (i.e. a marking sequence) (and, of course, one additional repeat that flanks the new spacer) on one end of the CRISPR locus (i.e. close to the leader at the 5' end of the CRISPR locus). All other spacers of the CRISPR1 locus are the same. The CRISPR1 sequence (5'-3') strain DGCC7710-RH1 represents:

A leader sequence is a.Integrated sequence,shown in gray, including the CRISPR repeat (allocation with capital letters), and the CRISPR spacer (i.e. a marking sequence), which is shown in the selection of lower case letters. Shows end repeatand trailer sequence.

Accordingly, in the case of strain DGCC7710-RH1 S. thermophilus, spaceris specific for strain marking sequence that identifies this mutant strain (i.e. labeled bacteria). You'll find the activities of the spacer is detected between the provisions 31921 and 31950 bp (i.e. "plus chain) genome D858 (and has 100% identity with the sequence of the genome D858 30 nucleotides):

Example 20

Receiving a third labeled strain

This example describes methods used to obtain the third labeled strain. Strain DGCC7710-RH2 S. thermophilus was isolated as a natural resistant to phage mutant using strain DGCC7710 as the parent strain and phage D858 as virulent phage. CRISPR1 strain DGCC7710-RH2 S. thermophilus contains 34 repeat (including the terminal repeat) and thus 33 of the spacer. When compared with the CRISPR1 sequence of strain S. thermophilus DGCC7710, the CRISPR1 sequence of strain DGCC7710-RH2 S. thermophilus has one additional new spacer (i.e. a marking sequence) (and, of course, one additional repeat that flanks the new spacer) on one end of the CRISPR locus (i.e. close to the leader at the 5' end of the CRISPR locus). All other spacers of the CRISPR1 locus are the same.

The CRISPR1 sequence (5'-3') strain DGCC7710-RH2 represents:

A leader sequence is a.

Integrated sequence shown in gray, including the CRISPR repeat (allocation with capital letters), and the CRISPR spacer (i.e. a marking sequence), which is shown in the Department of lower case letters. Shows end repeatand trailer sequence.

Thus, in the case of strain DGCC7710-RH2 Streptococcus thermophilus, spaceris specific to the strain of the label that identifies this mutant strain (i.e. labeled bacteria). It was shown that the sequence of the new spacer exists within the genome of phage D858. The sequence of the spacer is detected between the provisions 17215 and 17244 bp (i.e. the "plus-circuit") of the genome of phage D858 (and has 100% identity with the sequence of the genome D858 30 nucleotides):

The new spacer, integrated in the CRISPR1 locus of strain DGCC7710-RH2 S. thermophilus gives the strain DGCC7710-RH2 S. thermophilus new resistance to phage D858.

Example 21

Construction of phage avoidance CRISPR from resistant bacterial phages options

This example describes how to build phage avoidance CRISPR. First constructed resistant to the phage variants of the hosts, as described in the examples above. In these experiments, the parent strain "And" who is actuat phage "P" and selected resistant to phage variant (variant A"). Option A analyzed (example, PCFR and/or DNA sequencing to confirm the presence of additional inserted spacer within the CRISPR locus. Then determined the nucleotide sequence of an additional spacer (spacer Sp1.0). Typically, the spacer Sp1.0 is a fragment size of approximately 30 nucleotides from a phage P, and it confers resistance to phage P and related phages ("related phages" are those which contain in their genome sequence of the spacer, and define the family of phages).

Regardless of the impact of the first phage, the same strain And exposed to the same phage P, and selects the second-resistant phage variant (variant A). Option I selected for the presence of also inserted additional spacer (spacer Sp2.0) within the CRISPR locus, but when the sequence of the spacer Sp2.0 that differs from the sequence of the spacer Sp1.0. Typically, the spacer Sp2.0 is a fragment size of approximately 30 nucleotides from a phage P, and it confers resistance to phage P and related phages. Similarly, in some embodiments, implementation, variants are generated from A to Ah through the impact of the same phage R for the same strain of A. All the options "And" also selected for the presence of the inserted additional with whom asera (Speiser Sp3.0 to Spx.0) within the CRISPR locus, but when the sequence of spacers Sp, which differ from each other. Typically, the spacers Sp are fragments of approximately 30 nucleotides from a phage P, and they all give resistance to phage P and related phages.

Usually, it can be estimated that the level of resistance would be roughly the level of stability of the single mutations occurring within the genome of the phage within the sequence corresponding to the spacer (i.e. roughly from 10-4up to 10-6). Thus, phages, which avoid mediated CRISPR stability, easy to select. Mutated phages are generated through the impact of phage P option on A. Usually, the mutated phage avoidance CRISPR" (R) contains at least one mutation within the genome, corresponding to the sequence of the spacer Sp1.0 (for example, a deletion (deletion), point mutation (mutation), and so on), or in some preferred embodiments, the implementation, in the field, flanking Sp1.0, plus or minus 200 bp, corresponding to the CRISPR motif. Option A must be sensitive to the phage R. Similarly, independently generated resistant to phage P options (option A, from A to Ah), which contain unusual spacers (respectively, Sp2.0 from Sp3.0 to Spx.0) similarly stimulated by phage P to generate suitable the x mutant phages (respectively, R, from R to R). In the following, can generate a pool of mutant virulent phages, whose genomes were subjected to specific mutations in the sequence, intended as a CRISPR spacer.

Indeed, phage D2792 is fully virulent phage biological control against strains of S. thermophilus DGCC7710 (WT). On the contrary, the analysis of the CRISPR locus related strains WTphi2972+S6, WTphi2972+S4, WTphi2972+S20, WTphi2972+S21and WTphi2972+S22indicates the presence of spacer elements of the sequence, which is similar to sequences found in the phage D2792 that indicates that the phage D2792 has reduced virulence against these strains. These belascoaran (see table 7.1) confirm the reduced virulence of the phage D2792 against these strains. In relation to strain WTphi2972+S6, which was characterized as resistant to phage D2792 due to the presence of the corresponding CRISPR spacer, screening associated with D2792 phage full increased virulence have been identified by phage D4724 and D4733 as promising agents as biological control agents (see table 7-1).

In additional experiments, the strain DGCC7710 exposed to phage D2792 to generate sustainable option WTphi2972+S6. When the strain WTphi2972 +S6exposed to phage D2792, it was possible to distinguish the mutant phage, such as D4724. It was found that this phage D4724 fully virulent for DGCC7710 and WTphi2972+S6. At the second repetition, WTphi2972+S6influenced by phage D4724 to generate sustainable option WTphi2972+S6phi4724+S15. After exposure D4724 on this strain, were identified mutant phages, such as D4733 that are fully virulent in respect of DGCC7710 and WTphi2972+S6. In some embodiments, implementation, consistent repetition is used to generate phage with the desired level of virulence.

Additional examples of mutants of phage is shown in Fig. 13. This drawing shows the mutant phage 858 and 858 is received from the parent phage D858. Mutations correspond to the spacer S1 of WT858+S1S2 stimulated D858.

In some examples, a fully virulent mutants of phage, where the mutation is identified in the CRISPR motif, shown in table 20-1. This table shows the nucleotide sequence in phage wild-type and mutant phages, which correspond to the spacers, the newly acquired mutants of S. thermophilus. The motive AGAAW highlighted in gray. Each mutation is shown in bold and underlined. * indicates a deletion. In this table predstavlyaemogoakterom for couples resistant to phage CRISPR options and virulent mutant phage: DGCC7710 F+S1/phage 2972.S3C, DGCC7710F+S4/phage 2972.S4A or phage 2972.S4C, DGCC7710F+S6/phage 2972.S6A and DGCC7710F+S4F+S32/phage 858.S32A or phage 858.S32D. In this table, the new spacer corresponds to SEQ ID NO:535 (DGCC7710F+S3).

Example 22

Phage avoidance CRISPR" second level

This example describes experiments on the construction of Phage avoidance CRISPR the second level (i.e., multiple mutations aimed at multiple spacers).

Through the repeated process of creating variants with resistance to phage-mediated CRISPR, followed by separation mutated (avoidance CRISPR") phage capable of overcoming the cas-CRISPR, you can create a phage that has been "pre-adapted" multiple mutations against potential resistance mediated CRISPR.

In some embodiments, implementation, variants of the second level is obtained by selection of mutant phage through the impact of phage P option on A. Usually, this mutated phage (phage R) is a mutation (a deletion, point mutation, etc) in its genome within the region containing the sequence of the spacer Sp1.0 or within the region flanking Sp1.0, plus or minus a fragment of 20 bp, matching the th CRISPR motif. Option A sensitive to phage R. Then, option A exposed to phage R, and selected resistant to phage option (option A1.1) (see Fig. 15). Version 1.1 is also chosen so that it had an additional spacer (spacer Sp1.1) within the CRISPR locus, but when the sequence of the spacer Sp1.1 different from the sequence of spacers Sp1.0 from Sp2.0 to Spx.0. Typically, the spacer Sp1.1 is a fragment size of approximately 30 nucleotides from a phage R and confers resistance to phage R and related phages. Option A1.1 resistant to phage l and preferably has an increased resistance to phage P due to the accumulation of spacers and Sp1.0 Sp1.1.

In additional embodiments, the implementation of the newly mutated phage (phage R) is generated through the impact of phage R on option A1.1. Then, after exposure to phage R on option A1.1, get a new option A1.2, which contains one new additional spacer (Sp1.2). This spacer confers resistance to phage l and, preferably, increases resistance to phage R and P (i.e. due to the accumulation of spacers Sp1.0, Sp1.1, Sp1.2). Phage R is fully infectious in relation to the parent strain, as well As options A and A1.1.

In yet some additional embodiments, implementation, other spacers (for example, 2, 3, or 4) re-accumulate in strains with And option A1, the m option A1.1, then option A1.2, etc. to obtain variants, highly resistant to phages (option EP). In some embodiments, implementation, additional other spacers may be stuck in the same strain to option A2 option then A2.1, then option, A2.2, etc. to generate another version of the strain And, in parallel, highly resistant to phages (option EP). The same strategy is used with options from A to Ah.

After the repeated process of creating resistant to phage variants CRISPR and selection of mutant phage avoidance CRISPR (for example, the impact of phage R on version 1.1, which creates a new version A1.2, which contains one new additional spacer (Sp1.2)from which to extract the mutant phage (R), which is fully virulent for option A1.2, A1.1, A and maternal strain of A.

In some embodiments, implementation, combinatorial mutations accumulate re-design of bacterial variants, combining different spacers (for example, Sp2.0, Sp3.0-Spx.0), the influence of the corresponding mutant phage first level (R, R-RH) and selection of mutant phages second level.

Examples of re-combinatorial mutations that create variants that are resistant to CRISPR the phage, and the mutant phage avoidance CRISPR shown in table 22-1. This table presents the list of new spacers, detecting is defined in CRISPR1, and the corresponding region in the phage 2972, 858 and DT1. In this table, "a" indicates a region of DNA that are 100% identical between phage 858 and 2972. "The position 5'" refers to the position 5' of procaspases in the genome of the phage. The underlined and shaded nucleotides in the sequence of fotopaber indicate erroneous pairing between the phage and the spacer. The asterisk (*) indicates a deletion. "Flanking the 3' region" indicates the sequence flanking 3'in the genome of phage. Incorrect mating motive AGAAW are underlined and shaded in grey. In the column labeled "Thread/Module, modules transcription are "E (early expressed genes); "M" (medium expressed genes) and "L" (late expressed genes).

DGCC7710 were subjected to phage 2972 to create resistant to phage variant CRISPR DGCC7710F+S6from which was generated mutant avoidance CRISPR phage 2972.S6B. The impact of phage 2972.S6B on DGCC7710F+S6created resistant to phage variant CRISPR DGCC7710F+S6a2972S56B+S20from which was isolated mutant avoidance CRISPR phage 2972.S20A.

In some embodiments, implementation, feature strains that are resistant to more than one family of phages. Because this strain may be feeling is sustained fashion to more than one family of phages, in some embodiments, the implementation, it is desirable to increase the resistance of the strain to multiple families of phages with additional spacers (spacers) within the CRISPR locus originating from other families of phages (see Fig. 16). For example, phages P, Q and R are representative of the phages of the three families of phages capable of infecting strain of A. Using described in this application, the method will have variants that are resistant to all three families of phages. In some embodiments, implementation, phage P is used to generate variant A1R(containing the spacer Sp1), which is resistant to the phage R. Then, option A1Rexposed to phage Q, and chooses resistant to the phage variant (variant A1pq). Option A1pqone additional spacer (Sq1), inserted within the CRISPR locus. Typically, the spacer Sq1 is a fragment size of approximately 30 nucleotides of phage Q, and he confers resistance to phage Q and related phages. Option A1pqresistant to phage P, and phage Q. Then select option A1pqexposed to phage R, and chooses resistant to the phage variant (variant A1pqr). Option A1pqrhas a third additional spacer (Sr1), inserted within the CRISPR locus. Typically, the spacer Sr1 is a fragment size of approximately 30 nucleotides from a phage R, and he also who confers resistance to phage R and related phages. Option A1pqrresistant to all three phages. In some particularly preferred embodiments, the implementation option is also resistant to related phages.

These phages avoidance CRISPR are used as phage biological control and therapeutic phages. As described above, through the process of creating a mediated CRISPR-resistant phage variants, the impact of phage and selection of virulent phage avoidance CRISPR", generated a mixture of types of phages that contain one and/or multiple mutations, targeted against a single and/or multiple sequences of the genome of the phage, which are potential CRISPR spacers target. Because the target in the form of bacterial hosts can become resistant to phages by incorporating one or multiple spacers, and given that the Cas-CRISPR can be overcome by mutations within the genome of the phage, corresponding to such spacers, the use of a mixture of phages containing various mutations, reduces the frequency of acquisition of individual bacterium successful acquisition of new spacers and proliferation.

In an additional embodiment, the analysis procaspases and flanking regions, according to the determination of the spacers of the respective resistant to phage variants CRISPR, which facilitates identification of CRISPR motif for measuring the Lenna CRISPR. In the example CRISPR1 DGCC7710-resistant phage variants containing the spacers S1-S33, were generated after stimulation by phage 2972 or 858. The combination of procaspases and flanking regions of the genome of phage 2972 or 858, which correspond to the spacers S1-S33, using the software Clustal X, identified motif CRISPR1 as NNAGAAW (SEQ ID NO:696), and was visualized using WebLogo (Fig. 22).

In another example, resistant to phage variants CRISPR3 were obtained from DGCC7710 after stimulation by phage 858 and 3821, and LMD-9 after stimulation by phage 4241. The combination of procaspases and flanking regions of the genomes of the respective phages with the corresponding respective spacers resistant to phage variants CRISPR 3, identified CRISPR motif 3 as NGGNG (SEQ ID NO:723) (Fig. 23).

Analysis to identify the presence of specific CRISPR motif provides a means to identify the localization of the alleged protospatharios within the genome or the other sequence (e.g., plasmids or other mobile genetic element). In the example of sequenced phage 858, 2972 and DT1, the analysis of the distribution of CRISPR motif 1 AGAAW identified the localization of potential protospatharios within their respective genomes. Using the degeneration of the genetic code and/or the use of conservative amino acid substitutions,each motif AGAAW was eliminated in the process of chemical synthesis of the genome, as described for phage OX174, as is well known in this field. Thus, the phage was insensitive to system stability Cas-CRISPR. Thus, the DNA molecule is devoid of specific CRISPR motifs, insensitive to the appropriate system Cas-CRISPR.

These phages and "cocktails" of multiple types of phages are used in rotation strategy (for example, particular sequential introduction of the phage). As an extension of the application of a single cocktail, composed of phage containing different spacer elements mutations, in some embodiments, the implementation of certain sequential use of multiple virulent phages, each of which contains a different spacer elements mutation. For example, using a set of phages avoidance CRISPR" (R, R and R or R, R, R or some combination thereof), each phage is applied separately and in sequence and rotation (P.1.0>P.2.0>P.3.0>P.1.0,P2.0> etc) in order to minimize the likelihood of bacteria-target mediated CRISPR resistance to phage. Similarly, the set of cocktail of phages (i.e. each phage inside a cocktail, and each cocktail has an unusual combination of mutations) is used consistently and by rotation. In some embodiments, implementation, phage and/or cocktail contains one family of phages, whereas in others the other options implementation the phage and/or cocktail contains many families of phages.

Example 23

Functional combination

This example presents various functional combinations that are used in the present invention. Just as an example, the following combination can be used in accordance with the present invention.

Functional combination No. 1

Sequence cas: SEQ ID NO:461 for SEQ ID NO:465 and SEQ ID NO:473 in SEQ ID NO:477 (all of which are sequences of S. thermophilus), as presented below:

with repeat sequences: SEQ ID NO:1 through SEQ ID NO:10

Functional combination No. 2

Sequence cas: SEQ ID NO:466 for SEQ ID NO:472 and SEQ ID NO:478 for SEQ ID NO:487 (all of which are sequences of S. thermophilus), as presented below:

with repeat sequences: SEQ ID NO:11 and/or SEQ ID NO:12.

Functional combination No. 3

Sequence cas: SEQ ID NO:488 for SEQ ID NO:508 and SEQ ID NO:517 for SEQ ID NO:521, as shown below. SEQ ID NOS:488-497 from S. agalactiae, while SEQ ID NOS:498-503 of S. mutans, and SEQ ID NOS:504-508, 517-521 of S. pyogenes.

1. Method of producing a starter culture containing at least two resistant to bacteriophages variant strain, which includes stages:
(a) effects on maternal bacterial strain that contains at least a portion of a CRISPR locus, bacteriophage to obtain a mixture of bacteria containing resistant to bacteriophages variant strain containing the modified CRISPR locus that contains at least one d the additional spacer in the specified modified CRISPR locus;
(b) independent effect on the same parent bacterial strain, indicated at stage (a)containing at least part of the CRISPR locus, the same bacteriophage, which is indicated at stage (a), to obtain a mixture of bacteria containing the other resistant to bacteriophages variant strain containing the modified CRISPR locus that contains at least one additional spacer in the specified modified CRISPR locus;
(c) sampling of these resistant to bacteriophages variant strains of these mixtures of bacteria;
(d) sampling of these resistant to bacteriophages variant strains containing additional spacer in the specified modified CRISPR locus of the above resistant to bacteriophages variant strains, selected on the stage (s); and
(e) allocation of these resistant to bacteriophages variant strains, where these strains contain additional spacer in the specified modified CRISPR locus;
where the sequence at least one additional spacer in resistant to bacteriophages variant strain differs from the sequence at least one additional spacer in the other resistant to bacteriophages variant strain;
and where specified parent bacterial strain is selected from Escherichia, Shigella, Salmonella, Erwinia, Yersinia, Bacillus, Vibrio, Legionella, Pseudomonas, Neissera, Bordetella, Helicobacter, Listeria, Agrobacterium, Staphylococcus, Streptococcus, Enterococcus, Clostridium, Corynebacterium, Mycobacterium, Treponema, Borrelia, Francisella, Brucella, Campylobacter, Klebsiella, Frankia, Bartonella, Rickettsia, Shewanella, Serratia, Enterobacter, Proteus, Providencia, Brochothrix, Bifidobacterium, Brevibacterium, Propionibacterium, Lactococcus, Lactobacillus, Pediococcus, Leuconostoc and Oenococcus.

2. The method according to claim 1, where the specified method further includes a step of comparing the specified CRISPR locus or part of the specified parent bacterial strain and the modified CRISPR locus of these resistant to bacteriophages variant strains to identify resistant to bacteriophages variant strains containing at least one additional spacer in the specified modified CRISPR locus that is not specified in the CRISPR locus of the parent bacterial strain.

3. The method according to claim 1, where the specified parent bacterial strain is infected with bacteriophage.

4. The method according to claim 3, where the specified bacteriophage selected from the group of families of viruses consisting of: Corticoviridae, Cystoviridae, Inoviridae, Leviviridae, Microviridae, Myoviridae, Podoviridae, Siphoviridae, and Tectiviridae.

5. The method according to claim 4, where the specified bacteriophage is a naturally occurring bacteriophage.

6. The method according to claim 4, where the specified bacteriophage is a mutant bacteriophage obtained by selective pressure from the use of resistant to bacteriophages bacteria.

8. The method according to claim 1, where the specified parent bacterial strain is a case-insensitive mutant bacteriophages.

9. The method according to claim 2, where the 5' end and/or end 3' of the specified CRISPR locus of the parent bacterial strain is compared with the specified modified CRISPR locus of these resistant to bacteriophages variant strains.

10. The method according to claim 2, where the 5' end and/or end 3' of at least the first CRISPR spacer of the CRISPR locus of the specified parent bacterial strain is compared with the specified modified CRISPR locus of these resistant to bacteriophages variant strains.

11. The method according to claim 1, where the specified at least part of the said CRISPR locus of the specified parent bacterial strain and at least a part of the said modified CRISPR locus of these resistant to bacteriophages variant strains are compared by amplifying at least part of the CRISPR locus and at least part of the modified CRISPR locus for receiving the amplified sequence of the CRISPR locus and the amplified sequence of the modified CRISPR locus.

12. The method according to claim 11, where the specified amplification provoditsya using polymerase chain reaction.

13. The method according to claim 1, where the specified at least part of the said CRISPR locus of the specified parent bacterial strain and at least a part of the said modified CRISPR locus of these resistant to bacteriophages variant strains are compared by sequencing at least part of the CRISPR locus and at least part of the modified CRISPR locus.

14. The method according to claim 11, further comprising phase sequencing specified amplified sequence of the CRISPR locus and the amplified sequence of the modified CRISPR locus.

15. The method according to claim 1, where at least one of these additional spacers in the specified modified CRISPR locus forms a part of an element of repeat-spacer.

16. The method according to clause 15, further containing stage:
(f) effect on at least one of these resistant to bacteriophages variant strains isolated in stage (e), mutant phage that contains a mutation in its genome in the region containing the sequence of additional spacer element in the repeat-spacer according to stage (e); and
(g) the selection of such resistant to bacteriophages variant strain, which has an additional spacer entered in the CRISPR locus and the sequence specified additional specification of the sulfur differs from the sequence of the spacer element in the repeat-spacer according to stage (e).

17. The method according to clause 15, where the parent bacterial strain is exposed to many families of phages for introduction into the CRISPR locus of additional spacers, originating from each family of phages.

18. The method according to clause 15, where at least one of these spacers forms a part of an element of repeat-spacer, which contains at least about 44 nucleotides.

19. The method according to clause 15, where at least one of these additional spacers forms a part of an element of repeat-spacer, which contains from about 44 to about 119 nucleotides.

20. The method according to claim 1, where the specified parent bacterial strain is an industrially applicable strain.

21. The method according to claim 20, where the specified parent bacterial strain susceptible to infection by at least one bacteriophage.

22. The method according to claim 20, where the specified parent bacterial strain is a strain obtained from a culture selected from starter cultures, probiotic cultures and cultures of food additives.

23. Starter culture obtained by the method according to any of the preceding paragraphs.

24. The method of fermentation, including the addition of starter culture in item 23 to the environment fermentation conditions under which fermentation components specified environment fermentation.

25. The method according to paragraph 24, where the specified bro is giving are not impacted by the presence of bacteriophages.

26. The method according to paragraph 24, where the specified environment fermentation is a food product.

27. The method according to p where the specified food product is a dairy product.

28. The method according to item 27, where the specified dairy product is milk.

29. The method according to paragraph 24, where the specified environment fermentation consistently affect at least two different starter cultures.



 

Same patents:

FIELD: medicine.

SUBSTANCE: method is staged: 1) cervical canal scrapes and biopsy materials of the uterine cervix are used to recover DNA of human papilloma virus; 2) virus genotype is determined; 3) patients with HPV 16 positive CIN are sampled; 4) real-time PCR is used to determine the number of virus DNA copies and a degree of its integration with a host gene (a physical status); 5) a threshold level of the viral load is stated taking into account the physical status of the virus (6.5 lg HPV DNA copies 16 per one cell); 6) the patients are classified according to the determined threshold viral load and physical status of the virus (the episomal and integrated form); 7) the poorly predicted patients having the high viral load (≥6.5 lg DNA copies per one cell) are detected in the episomal form of the virus, while the low load (<6.5 lg DNA copies per one cell) is shown by the integrated form of the virus.

EFFECT: method enables the early prediction of the unfavourable course of cervical intraepithelial neoplasms and potential transition into cervical cancer.

3 cl, 2 dwg, 1 tbl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: diagnostic set is used to determine antibodies in blood, as well as polystyrene dishes. The solid liquor in the amount of 10 mcl is dissolved at the ratio of 1:100. The sample is incubated at 37° for 40-45 min. Secondary incubation with antibody conjugate is carried out at 37°-38° for 55-60 min. By variation of critical value of optical density they determine availability of antibodies in the liquor.

EFFECT: method provides for determination of antibodies in children in a small sampled volume of liquor and may find application in diagnostics of opportunistic infections in children.

4 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: group of inventions relates to diagnosis, particularly to methods and reagents, including biochips, for detecting presence of one or more analysed objects in a sample, based on use of a set of granules which contains a plurality of families or subsets of granules, wherein each of the granules inside each family of granules of a subset can be connected with a labelled probe for capturing nucleic acid, which is capable of binding with an HPV strain specific region of the HPV genome. Each of the families of granules inside each separate set has a different fluorescence intensity.

EFFECT: fast methods and reagents which can be used in diagnosis.

13 cl, 4 ex, 5 tbl

FIELD: medicine.

SUBSTANCE: what is presented is a method for early prediction of the clinical outcome of an antiviral therapy for chronic viral hepatitis C involving detecting the immunological parameters in patient's venous blood, including the content of circulating immune complexes (CIC), and the virological parameters (hepatitis C genotype). Before the beginning of the antiviral therapy, the complex is analysed for B-lymphocytes (CD19), T-suppressor cells (CD8), natural killer cells (CD16), the level of immunoglobulin A (IgA), and the percentage of phagocytosis (F%). Total weight coefficients of the parameters is used to derive an immunological prediction coefficient (IPC). If the IPC value is 1.2 ÷ 3.2, the favourable outcome is predicted, the IPC values being 3.3 ÷ 3.9 shows potential recurrence, while if the IPC value exceeds 3.9, the unfavourable outcome is stated.

EFFECT: effective method for prediction of the clinical outcome of the antiviral therapy before the beginning thereof preventing the need for expensive treatment and inefficient expenditure of monetary resources.

4 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: there are described a method and a kit for detection and identification of herpes viruses HSV-1 and HSV-2 and varicella-zoster virus VZV. A tested sample is amplified with a combination of primers. It is followed by denaturation of amplification products, hybridisation of denaturated one-chain oligonucleotides with probes and detection of hybridised oligonucleotides.

EFFECT: improved efficiency of the method.

12 cl, 9 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: identifying a yersiniosis agent is enabled by using the intestinal yersinia pague FK-100 stripped on a double-layer grass lower layer of which represents an agar medium (pH 7.1) with added ampicillin in the concentration of 50 mcg/ml, while an upper layer of which is produced of the strain being tested cultivated on 1.5% Hottinger's agar at 28°C during one day and inoculated in 4 ml of Hottinger's broth, incubated at temperature 28°C to the final concentration n·108 m.c./ml; thereafter 0.3 ml of the prepared culture is mixed with 4.5 ml of 0.7% Hottinger's agar melted and cooled to 45°C with 50 mcg/ml of ampicillin and poured as a second layer on the agar plates. The inoculation is incubated at 28°C for 20-24 hours. Yersinia enterocolitica in the sample being tested is identified from the other types of yiersinia by the presence of phagolysis on the growth culture.

EFFECT: method provides complete identification effectiveness.

1 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology, virology and veterinary. An attenuated recombinant classical swine fever virus (CSFV) is described. Modification is carried out by progressively mutating a portion of the E2 gene of the highly pathogenic strain Brescia. As a result, two to six amino acids on the section 829-837 are replaced with two to six amino acids which are characteristic for the heterologous E2 glycoprotein of the Bovine Viral Diarrhea Virus (BVDV). A classical swine fever vaccine is also obtained based on the obtained attenuated CSFV. The invention can be used in veterinary.

EFFECT: classical swine fever vaccine is obtained.

7 cl, 7 dwg, 4 tbl, 7 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, virology and medicine. What is disclosed is a recombinant protein containing one or more polypeptides carrying one or more epitopes of one or more human papilloma virus HPV antigens. Said polypeptides are embedded in one or various permissive sites of adenylatecyclase (CyaA) or its fragments. What is also disclosed is the polypeptide coding such protein and their use in expression systems for producing immunogenic compositions and drugs. The invention can be used in medicine.

EFFECT: CyaA fragment possesses the property of said adenylatecyclase protein for targeted interaction with antigen-presenting cells.

60 cl, 21 dwg, 1 tbl, 3 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biochemistry, particularly to a set of primers for amplifying the L1 gene of the human papilloma virus (HPV), a set for detecting the human papilloma virus (HPV) genotype and methods of detecting human papilloma virus (HPV) genotypes. The method involves primary PCR amplification of the HPV L1 gene in an analysed sample using a set of direct and reverse primers which are specific for the L1 gene section. Further, secondary PCR amplification of the product of primary PCR amplification of the L1 gene is carried out using a reverse primer to obtain a biotin-labelled single-stranded L1 gene. The product of secondary PCR amplification and biotin-labelled single-stranded L1 gene undergo a hybridisation reaction with one or more probes for detecting the HPV genotype or a probe for detecting the HPV genotype. Further, the product of the hybridisation reaction reacts with phycoerythrin, bonded with streptavidin. The level of fluorescent substance is measured and probes are identified in the product of the hybridisation reaction to identify the HPV genotype. Further, the HPV genotype is determined, as well as the level of its presence in accordance with probes and the level of the fluorescent substance.

EFFECT: invention provides a method for detecting HPV in a sample with high sensitivity, sufficient for detecting extremely small quantities of HPV in the sample.

8 cl, 2 dwg, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: group of inventions involves a method for virulence prediction of PRRS virus isolate of unknown virulence, as well as a composition which contains the attenuated forms of PRRS virus to be predicted for virulence. The method for virulence prediction of consists in the fact that PRRS virus isolate of unknown virulence is introduced in a certain amount to a pig, and PRRS virus is enabled to replicate over the period of time within 3 to 15 days. During this period, PRRS virus isolate growth rate and/or viremia level are evaluated and compared with the reference growth rate and-or and/or viremia level of PRRS virus isolate of known virulence. And PRRS virus isolate is supposed to exhibit high virulence if growth rate and/or viremia level are similar to such values specific to high virulence isolate, and PRRS virus isolate is expected to have low virulence if growth rate and/or viremia level are similar to such values specific to low virulence isolate.

EFFECT: method allows to predict virulence of new and nondescribed PRRS virus isolates to be thereafter applied in immunological compositions.

12 cl, 9 dwg, 6 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention relates to the field of molecular biology and virology. Claimed are primers, probes and their sets for amplification and detection of type 52 HPV in a tested sample.

EFFECT: invention can be used for medical purposes for the detection of human papilloma viruses.

11 cl, 8 tbl, 5 ex, 4 dwg

FIELD: biotechnology.

SUBSTANCE: method of detecting stem cancer cells is provided, based on incubation of cell samples with fluorescence dyes and subsequent identification of cancer cells in the ultraviolet light, where during the incubation of cell samples, which is carried out with the fluorescent dye, incorporated covalently into double-stranded DNA fragments, the internalization of extracellular exogenous fragments of double-stranded DNA into the intracellular space of stem cells included in the composition of the sample cells, is provided by incubation of cell samples in the solution of the preparation of the fragmented double-stranded DNA at a ratio of 0.5-1 mcg DNA per 1000000 cells in suspension or on a section of tissue for 60-120 minutes, and identification of cancer cells as stem is carried out in ultraviolet light with a wavelength corresponding to the absorption maximum of the fluorochrome inserted into the molecules of fragments of the double-stranded DNA, and the double-stranded DNA fragments are used as DNA fragments of Alu human repeat, enzymatically labelled by precursor comprising covalently sewn fluorochrome dye, or labelled by direct chemical introduction of fluorochrome.

EFFECT: due to increasing the efficiency of detecting stem cancer cells in the initiating condition the invention can be used in medicine.

2 cl, 11 dwg

FIELD: biotechnology.

SUBSTANCE: characterized primers are complementary to sites of variable segment 2 of genome of bluetongue virus of nucleotype C (serotypes 6, 14 and 21) are used in RT-PCR with electrophoretic detection of amplification products for identification of bluetongue virus of serotypes 6, 14 and 21 and have the following composition (5'-3'): direct: GRAYATGRTGGATATWCCG, reverse: GGCTGCACRTCCAYYGARTC.

EFFECT: invention enables to determine the genetic group of nucleotype C of bluetongue virus in samples of the biological material under study using RT-PCR in a short time.

2 tbl, 1 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology. What is described is a kit of primers for amplifying CFTR gene fragments. There are presented biochip and kit of targets for the biochip. What is described is a method for identifying mutations in CFTR human gene causing mucoviscidosis, involving using the above primers. What is presented is a test system comprising the above primers and biochip.

EFFECT: invention extends the range of facilities used for diagnosing mucoviscidosis enabling fast and specific diagnosing of the respective mutations.

10 cl, 2 dwg, 4 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, more specifically to detecting lung cancer by means of an aptamer and can be used in diagnostics. The aptamers are prepared by selection involving alternating rounds of positive selection of the aptamers to minced human tumour lung tissues sampled from oncological patients after the operation and of negative selection to healthy lung tissues and healthy whole blood to determine a pool of the highest-affinity aptamers to be cloned, sequenced and analysed for a binding specificity to tumour lung cells.

EFFECT: prepared aptamers possess high sensitivity to tumour debris and circulating tumour cells in peripheral blood of the patient suffering lung cancer that enables more effective diagnosis of human lung cancer.

3 cl, 2 dwg, 1 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to medicine and microbiology. What is presented is a method for real-time detection of Beijing genotype mycobacterium tuberculosis by detecting IS6110 element insertion in a locus of dnaA-dnaNgenome differing by the fact that real-time PCR is carried out with the use of two specific primers5`-AGATCAGAGAGTCTCCGGACTCA and 5`-CGCCGGGACTGTATGAGTCT and fluorescence-labelled probe R6G-5`-TGTGCACAGCGACACTCACAGCCA-3`-BHQ2; the result is assessed by recording a fluorescence signal in R6G canal at wavelength 555nm; if a sample contains the DNA of the Beijing genotype mycobacterium tuberculosis strain, an exponential growth of the PCR fluorescence signal when a pure DNA analysed is observed between 10 to 15 cycles, and when cell lysates analysed - between 15 and 20 cycles.

EFFECT: invention can be used for laboratory detection of Beijing genotype mycobacterium tuberculosis.

3 dwg, 2 ex

FIELD: biotechnology.

SUBSTANCE: method of carrying out PCR for efficient identification of allelic variants of Waxy-genes of wheat is described. The method differs from the known ones from the technical level in using the forward primer 4F-c: 5'-CCCCCAAGAGCAACTACCAGT-3'. Also the method of PCR-RFLP for efficient identification of allelic variants of Waxy-genes of wheat is described. The method differs from the known ones from the technical level in that after the step of PCR the procedure of RFLP-analysis is performed with endonuclease cleavage of amplicons by the restriction enzyme AcsI.

EFFECT: development of methods of carrying out PCR and PCR-RFLP for efficient identification of allelic variants of Waxy-genes of wheat.

2 cl, 4 dwg, 2 tbl

FIELD: biotechnology.

SUBSTANCE: primers are used for identification of bluetongue virus of nucleotype B (serotypes 3, 13 and 16) by RT-PCR method.

EFFECT: opportunity to determine the genetic group - nucleotype B of bluetongue virus by RT-PCR method, which enables to reduce significantly the material costs and time of the work on definition of serotypes of bluetongue virus in samples of biological material under study.

2 tbl

FIELD: veterinary medicine.

SUBSTANCE: method of carrying out PCR-RFLP for genotyping cattle on alleles A and K of gene DGAT1, which is different from the nearest prototype [1] in that at the stage of PCR the other sequences of the oligonucleotide primers: DGAT1-1: 5'- CCGCTTGCTCGTAGCTTTCGAAGGTAACGC-3' (SEQ ID NO:1): DGAT1-2: 5'-CCGCTTGCTCGTAGCTTTGGCAGGTAACAA-3' (SEQ ID NO:2): DGAT1-3: 5'-AGGATCCTCACCGCGGTAGGTCAGG-3' (SEQ ID NO:3) are used, and at the stage of RFLP the other restriction endonuclease - TaqI is used, with the generation of the genotype-specific fragments: the genotype AA=82/18 bp, the genotype KK=100 bp and the genotype AA=100/82/18 bp (Figures 1 and 2).

EFFECT: development of an efficient method of genotyping the cattle on DGAT1-gene based on PCR-RFLP analysis.

2 dwg, 2 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, more specifically to a kit of synthetic oligonucleotide primers, and can be used forensic identification medicine. The declared kit consists of pairs of primers complementary to respective regions of fifteen microsatellite loci of Y-chromosome which represent pairs of primers one of which is fluorescent-labelled, while the second one is unlabelled with the forward primer for each of the loci bear a fluorescent label on 5'-terminal: TET (4,7,2',7'-tetrachloro-6-carboxyfluorescein) for DYS385a/b, DYS390, DYS391, DYS426 and DYS439; FAM (6-carboxyfluorescein) for DYS392, DYS393, DYS437 and DYS438; and HEX (4,7,2',4',5',7'-hexachloro-6-carboxyfluorescein) for DYS394, DYS388, DYS389I/II and DYS434. The invention also refers to a method for genetic typing for personal identification in the Russian population with the use of the above primers.

EFFECT: invention enables personal identification in the Russian population having higher sensitivity, specificity and accuracy as compared to the existing analogues.

2 cl, 2 dwg

FIELD: biotechnology.

SUBSTANCE: two suspensions are prepared. Clinical polyantibiotic-resistant strains Escherichia coli are added to an isotonic solution of NaCl to achieve the concentration of 30-40 thousand CFU/ml. Copper nanoparticles are added to the solution of NaCl to achieve the concentration of 0.01-0.05 mg/ml. The suspension of ethylenediaminetetraacetic acid - EDTA is prepared by its dilution in distilled water at the rate of 0.1-0.2:1, respectively. NaOH is added to the prepared suspension to obtain the solution of EDTA with pH=7.6-8. The prepared suspensions are connected with the solution of EDTA in the following ratios by wt %: suspension of copper nanoparticles - 70-85, suspension of microorganisms - 10-20, EDTA - 5.10. It is incubated in the shaker at 100-150 rev/min and a temperature of 36-38°C for 40-60 minutes. The resulting biomass is inoculated on the solid nutrient medium with the volume of 20-25 ml in the amount of 0.1-0.12 ml. It is incubated in the thermostat at a temperature of 36-38°C for 18-24 hours. The sensitivity of E.coli strains to antibiotics is determined.

EFFECT: invention enables to increase the sensitivity of the said bacterial strains to antibiotics gentamicin and ampicillin.

2 tbl, 2 cl, 1 ex

Up!