Method of specific differentiation of viable rhodococcus immobilised in gel carrier

FIELD: biotechnology.

SUBSTANCE: granule of biocatalyst with the cells contained in it of one or more species of Rhodococcus is placed in a well of a 96-well plate, a colorant iodine-nitro-tetrazolium (INT) is added. After the appearance of specific purple staining formazan the optical density of granule is measured using a tablet photometer. In the case of a stained substrate or preliminary presence of the immobilised biocatalyst in the soil the extraction of formazan is carried out with 96% ethanol and the optical density of the extract is measured. The amount of viable Rhodococcus in the granule of the gel is determined using the calibration dependency diagram of the optical density on the number of living cells in suspension as determined by traditional method of plating on solid growth medium. Then, from the granule stained by the colorant of the biocatalyst or from the granule after extraction of the colorant the DNA is isolated and PCR is performed using sets of species-specific primers. The specific position of the immobilised Rhodococcus is determined.

EFFECT: invention enables to reduce the time differentiation of Rhodococcus and to improve the accuracy of the method.

2 cl, 3 tbl, 4 dwg, 4 ex

 

The invention relates to industrial Microbiology and biotechnology, in particular to methods for detection of microorganisms in biotechnological drugs and the environment, and is intended for differentiated determine the number of viable actinobacteria of the genus Rhodococcus, immobilized water-insoluble gel media. Rhodococci characterized by high activity oxigenase enzyme complex and dominant in contaminated soil microbiocenosis, are one of the most developed bacterial groups in modern biotechnology, promising to create biocatalysts processes of degradation and transformation of organic compounds of all known classes [Ivshyna IN State and problems of development of specialized centers of microbial resources in Russia // Microbiology. - 2012. - T. No. 5 - S.551-560]. With the increasing application of immobilized biocatalysts in biotechnology, in particular fermentation processes and in the treatment of contaminated water and soil, the actual problem is the control of the viability of the microorganisms contained in the matrix media.

Known cultural ways of determining the number of living microorganisms in the biological and environmental objects, based on the seeding researched about what were acquired on a suitable nutrient medium, but they are not designed for the detection of immobilized water-insoluble gels microorganisms that due to the difficulty of their isolation from the gel media. Use direct counting of microorganisms under the microscope, but its use is limited for opaque samples, in particular gels with prisoners in them from microbial cells. Therefore, when studying the viability of gel-immobilized cells mainly use indirect biochemical methods, such as the luciferin-luciferase method of determining the amount of ATP [Efremenko E.N., Tatarinova POSTGRADUATE Effect of long-term storage of the microorganism cells are immobilized in a polyvinyl alcohol cryogel, their survival and biosynthesis of target metabolites // Microbiology. - 2007. - C, No. 3. - P.383-389].

The method consists in carrying out catalyzed by the enzyme luciferase reaction of ATP with protein luciferine and oxygen. Granules biocatalyst placed in DMSO for the extraction of intracellular ATP, and then to the obtained extract add luciferin-luciferase reagent and determine the intensity of luminescence using a luminometer. The exact concentration of ATP is determined by a calibration curve using standard solutions of known concentration of ATP. Next, calculate the number of viable immobile avannah microorganisms using the calibration dependence of the concentration of ATP from the number of living cells of the microorganism suspension, certain traditional method of sowing on the solid nutrient medium. The advantages of this method are (1) flexibility in terms of different media and microorganisms of different taxonomic groups, (2) the absence of correlation between the intracellular concentration of ATP on the physiological state of the cells and (3) high sensitivity of the method.

However, this method cannot be implemented detection of microorganisms, that is the definition of their specific provisions. The disadvantages of the method can also be attributed to the duration and complexity associated with obtaining calibration dependency, and the need to use expensive equipment and reagents. In addition, the disadvantage of this method is the inability to control the efficiency of extraction of intracellular ATP using DMSO, which may vary significantly among different organisms depending on the structure of their cell wall.

A known method of detecting living, damaged and dead cells of microorganisms using flow cytometry [Patent No. 2384624], which allows to detect stained with a fluorescent dye microorganisms at the level of single cells. However, this method is unsuitable for microorganisms, immobilized water-insoluble gels, as it requires ejecta is of microorganisms in a fluid and transmission fluid stream in the flow cell of the flow cytometer. In addition, using this method it is impossible to determine the specific provisions of the organism.

Earlier we described the method of determining the number of viable Rhodococcus immobilized in polyvinyl alcohol cryogel based on the vital staining granules of gel iodonitrotetrazolium (INT) in 96-well tablet and determining the intensity of the violet staining granules that appear due to recovery colorless INT to red-purple formazan in the presence of living actively respirology microorganisms, using a photometer tablet [Kuyukina M.S., Ivshina V, Gavrin monitoring computerized Podorozhko E.A., V.I. Lozinsky, C.E. Jeffree, Philp J..Immobilization of hydrocarbon-oxidizing bacteria in polyvinyl alchohol) cryogels hydrophobized using a biosurfactant // J. Environ. Methods. - 2006. - V.65. - P.596-603]. The resulting formazan was extracted from pellets gel using ethyl acetate, and then determined the optical density of the extract. However, this method cannot determine the specific position of the immobilized bacteria.

There are ways of differentiated determination of gel-immobilized microorganisms with the help of immunological methods, in particular the use of antibodies, highly specific with respect to microorganisms of a particular type. Thus, known immunofluorescent method of selective determine the number of lactococcal cells and brevibacteria, immobiliza the data granules carraginanous gel [Prioult G., Lacroix, S., Turcotte, S., Fliss I. Simultaneous immunofluorescent detection of coentrapped cells in gel beads // Appl. Environ. Environ. - 2000. V.66 (5). - P.2216-2219; Doleyres y, Fliss I., Lacroix C. Quantitative determination of the spatial distribution of pure-and mixed-strain immobilized cells in gel beads by immunofluorescence // Appl. Environ. Biotechnol. - 2002. - V.59 (2-3). - P.297-302]. The method is based on the use of polyclonal antibodies to these types of bacteria. According to the method granule gel prisoners in him microorganisms cut in half, washed with buffer solution, and incubated for 2 hours with polyclonal antibodies labeled with fluorescent dyes ALEXA (568 for lactococcal and 488 for brevibacteria). After 4 times washing with buffer, the pellet was analyzed using confocal laser scanning microscope with appropriate emission. Immunofluorescent signals were processed using special software that allows differentiated determination of the number and distribution of bacteria in the granules of the gel.

This method has several significant disadvantages, chief among which is universalist method and the necessity of obtaining the prior specific polyclonal antibodies for each defined type of microorganisms, which makes the method very expensive, and its possible application is very narrow. In addition, confocal laser scannermicrosoft is very expensive equipment. A significant disadvantage of the method is that quantitative analysis of microorganisms is complicated by the strong dependence of the fluorescent signal from the physiological state of the cells, the chemical composition of the gel and liquid environment, as well as the depth of location of the cells in the thickness of the gel, which makes obtaining reproducible results is almost impossible.

Known methods of detecting living microorganisms in different environments using polymerase chain reaction (PCR). The described method of detecting live cells of a microorganism by differentiation of living cells from dead cells or damaged cells in the tested sample [Patent No. 2395583]. The method comprises the stage of processing of the test specimen poison topoisomerase or poison called DNA gyrase, the stage of extraction of the DNA from the test sample and amplification mesiniaga plot of extracted DNA by PCR, where the length mesiniaga area ranges from 900 to 3000 nucleotides, and the analysis stage of amplification product using gel electrophoresis. The invention allows to determine the presence of living organisms in the sample.

The disadvantage of this method is the impossibility of quantitative determination of viable microorganisms.

Closest to the claimed method is a method for detecting live cells of a microorganism in a test sample [P the tent No. 2410440], providing add to this the test sample cross-linking agent, is able to bind DNA when exposed to light having a wavelength of 350 nm-700 nm; irradiation with light having a wavelength of 350 nm-700 nm; deleting a cross-linking agent; adding medium and further incubation; adding again linking agent, is able to bind DNA when exposed to light having a wavelength of 350 nm-700 nm, to inkubiruemykh test sample; re-irradiation with light having a wavelength of 350 nm-700 nm; extraction of DNA from the test sample and the amplification region target extracted DNA; and analyzing the amplified product.

However, quantitative assessment of living microorganisms in this way impossible in the formulation of a simple PCR and requires CRL real-time (real-time PCR), which requires the use of expensive equipment, software and reagents, the more complex the design of probes and primers. In addition, this method is not tested for microorganisms immobilized in a water-insoluble gel media.

The purpose of the present invention is to develop a simple and rapid method for the quantitative detection of immobilized living cells Rhodococcus different species and functional stability of biocatalysts based on water-insoluble polymer gels. The technical result of the t is aetsa the possibility of continuous monitoring of the viability of one or more strains of Rhodococcus, prisoners in the granules of the biocatalyst, quick selection of the most efficient biocatalysts, as well as monitoring the survival of immobilized bacteria in biological products during storage, the use of bioreactors or the environment. At the same time in the same granule of the biocatalyst to successively determine the number of viable cells and species immobilized bacteria that reduces the time of analysis, reduces the consumption pattern of the biocatalyst and allows you to selectively evaluate the effectiveness monolithic (single component) and mixed (multi-component) biocatalysts based Rhodococcus. Proposed in the present method, the combination of staining INT and conventional PCR is more simple and reliable method for detection of viable bacteria of a certain type. The proposed method involves the simultaneous assessment of the viability of gel-immobilized Rhodococcus using vital staining iodonitrotetrazolium (INT) and their species detection using species-specific PCR. This is necessary, for example, when in the bioreactor or in contaminated water or soil is used several types of Rhodococcus, and representatives of different species immobilized in the same granules of gel media. Method is that you first determine the number of survivors to etock of Rhodococcus in the sample by gel staining INT and measuring the optical density of the gel, and then in the same sample gel determine the species to which the data belong bacteria by PCR with species-specific primers. If a previously published method [Kuyukina M.S., Ivshina V, Gavrin monitoring computerized Podorozhko E.A., V.I. Lozinsky, Jeffree C.E., J.C. Philp Immobilization of hydrocarbon-oxidizing bacteria in poly(vinyl alchohol) cryogels hydrophobized using a biosurfactant // J. Environ. Methods. - 2006. - V.65. - P.596-603] the formed formazan were extracted with ethyl acetate, the present invention uses less toxic and public solvent - ethanol with a higher extraction ability towards formazan.

Significant difference between the claimed invention is a new combination of steps performed actions and methods of analysis (namely spectrophotometric and genetic, i.e. specific staining granules of gel, extraction of dye and determination of optical density, DNA isolation and conducting species-specific PCR) to quantify the viability of immobilized bacteria of different taxonomic groups. The essence of the method lies in the possible separation of bacterial DNA from one gel granules, pre-painted INT, or granules, from which previously was extracted with formazan 96%ethanol, and obtaining accurate results species detection rhodococcal by PCR.

Describes the e way. One gel granule size 5-125 mm3prisoners in cells of one or more types of Rhodococcus concentration 103-109 cells/ml is placed in a well of 96-hole tablet, add 200 ál INT (5 g/l) and after the appearance of specific violet staining (within 1-2 h) measure the optical density of the granules using a photometer tablet at 600-630 nm. When the pellet with immobilized Rhodococcus painted because the color of the gel material, being immobilized biocatalyst painted in liquid medium or in soil, from wells to remove the liquid, the extraction is carried out of formazane of granules by adding 200 ál of 96% ethanol, after incubation for 1 h to remove the pellet and measure the optical density of the extract at 460-500 nm. The number of viable rhodococcal in granule gel estimated using a calibration graph of the dependence of optical density on the number of living cells in suspension, certain traditional method of plating on a dense nutrient medium.

Then from the pre-cut into several pieces with a scalpel colored dye granules or of the same pellets after extraction of the dye produce DNA method, which provides a maximum amount of bacterial DNA from the gel, preferably by the modified method of [Amita J., Vandana So,Guleria R. S., Verma R.K. Qualitative evaluation of mycobacterial DNA extraction protocols for polymerase chain reaction // Mol. Biol. Today. - 2002. - V.3. - P.43-50], which combines thermal and enzymatic lysis of cells Rhodococcus, or using a commercial kit ZR YOU DNA Miniprep Kit (Zymo Research) according to the instructions of the manufacturer. If the preliminary finding of granules immobilized biocatalyst in the soil allocation of bacterial DNA carried out by the modified method of [Dong D. Removal of humic substances from soil DNA using aluminium sulfate // J. Environ. Methods. - 2006. - V. 66. - P. 217-222] or using a commercial kit ZR YOU Soil DNA Miniprep Kit (Zymo Research) according to the instructions of the manufacturer.

The selected DNA is used for PCR using sets of specific primers for the respective types of Rhodococcus. In this respect the terms of the PCR for a specific set of primers. The PCR products analyzed by electrophoresis in 1.5%agarose gel after staining of the gel solution (0.5 μg/ml) of ethidium bromide and the appropriate strips in UV light to determine the specific position of the immobilized bacteria.

Specific examples of carrying out the invention.

Example 1. Prepared two samples of immobilized biocatalyst-based granules of polyvinyl alcohol cryogel (PVA) with a size of 10 mm3prisoners in each of them uglevodorodokislyayuschih is and Rhodococcus (106 cells/ml) - or Rhodococcus ruber IEGM 615, or Rhodococcus opacus IEGM 249 according to the described method [Kuyukina M.S., Ivshina V, Gavrin monitoring computerized Podorozhko E.A., V.I. Lozinsky, Jeffree C.E., J.C. Philp Immobilization of hydrocarbon-oxidizing bacteria in polyvinyl alchohol) cryogels hydrophobized using a biosurfactant // J. Environ. Methods. - 2006. - V.65. - P.596-603]. In the bioreactor contaminated with petroleum hydrocarbons (2%vol.) water was placed 50 pellets biocatalyst (25 pellets from R. ruber and 25 pellets from R. opacus) and incubated for 48 hours then conducted a comparative assessment of the effectiveness of these strains on their viability in the presence of hydrocarbon-contaminated water. For analysis were taken at 10 pellets were washed them from residual hydrocarbon by using a buffer solution and placed in wells of 96-well plate. Granules were stained using INT for 1 h and determined the intensity of the purple coloring on a tablet photometer at 630 nm. Then selected the 5 colored granules were extracted from them formazan 96% ethanol for 1 h and determined the intensity of the dyeing extracts on a tablet a spectrophotometer at 490 nm. The obtained results were calculated on the number of viable cells in the granule via a calibration dependence of optical density on the number of cells for these strains Rhodococcus. Next, each pellet was cut into 4 pieces with a sterile scalpel, placed in a plastic microprobing and perform the selection of bacterial DNA m definiranim method [Amita J., Vandana So, Guleria R. S., Verma R.K. Qualitative evaluation of mycobacterial DNA extraction protocols for polymerase chain reaction // Mol. Biol. Today. - 2002. - V.3. - P.43-50]. To microprobing was added 0.2 ml lisanova buffer (10 mm Tris, 1 mm EDTA, pH 8.0), heated to 85°C for 10 min and immediately frozen at -20°C for 15 minutes and the Mixture was thawed, added lysozyme (20 mg/ml)were mixed and incubated at 37°C for 2 h Further increased the temperature of the mixture to 65°C, was added proteinase K (0.25 mg/ml) and sodium dodecylsulfate (1%) and incubated on a shaker for 30 minutes To a mixture of added BECOMING (10%) and 0.7 M NaCl to a concentration of 1%. Were extracted DNA with a mixture of chloroform/isoamyl alcohol (24:1) with gentle shaking for 5 minutes the mixture was centrifuged at 10 Tyson/min for 1 min and was selected the top fraction of the supernatant. The deposition of bacterial DNA was performed by adding 7.5 M ammonium acetate and isopropanol in a ratio of 1:2 at +4°C for 15 min, the mixture was centrifuged at 12 Tyson/min for 10 min. the Supernatant was decanted, and the residue 3 times washed with 70%ethanol. The precipitate DNA was dissolved in 0.5 ml of 0.01 M Tris-HCl, pH 7,6.

Selected from one of the granules of the gel the DNA was used for PCR with sets of primers for R. ruber and R. opacus described [Bell for K.S., Kuyukina M.S., Heidbrink, S., J.C. Philp, Aw D.W.J., Ivshina I.B., Christofi N. Identification and environmental detection of Rhodococcus species by 16S rDNA-targeted PCR // J. Appl. Environ. - 1999. - V.87. - P.472 - 480, synthesized by "Synthol", Moscow.

Used sets of primers of the following composition:

1) is specific for R. ruber (expected length of the amplified product 302 mon)

a) Rul 5'GTCTAATACCGGATAGGACCTCGGGA3',

b) Ru2 5'TACCGTCACTTGCGCTTCGTCGGTAC3';

2) is specific for R. opacus (expected length of the amplified product 447 mon)

a) Rol 5'TATGACCTTCGGCTGCATGGCTGAG3',

b) Ro2 5' CCGTATCGCCTGGAAGCTCGAG3'.

The reaction mixture volume of 25 µl had the following composition: 10 mm PCR buffer; 2.5 mm MgCl2(for primers to R. ruber) and 1.5 mm MgCl2(for primers for R. opacus); 0.2 mm blend of the four deoxynucleotides (dNTP); 0.2 μm forward and reverse primer; and 0.4 units of Taq DNA polymerase, and 1 µl DNA, diiodotyrosine water. Modes of amplification for these primers as follows: 5 min at 95°C and 35 cycles of 30 sec at 95°C, 30 sec at 64°C (for R. opacus) or 60°C (R. ruber), 30 sec at 72°C, then 10 min at 72°C. PCR Products were visualized using agarose gel electrophoresis. Strains of R. ruber and R. opacus clearly detected by PCR results in granules of gel without staining after staining INT and after extraction of formazan ethanol (figure 1). The average number of immobilized living cells R. ruber was 2.7×106cells/ml, a R. opacus is 1.7×106cells/ml (table 1). Thus, the cell survival of R. ruber after contact with contaminated water is 1.6 times higher than that of cells of R. opacus. Time, p is Ogadenia the entire analysis was 6-8 p.m.

Example 2. Prepared two samples of immobilized biocatalyst-based granules PVA cryogel size 125 mm3prisoners in each of the hydrocarbon-oxidizing bacteria (106 cells/ml) or Rhodococcus ruber IEGM 615, or Rhodococcus erythropolis IEGM 275, as described in example 1. In soil contaminated with oil (10 wt.%), made 200 pellets biocatalyst (100 pellets from R. ruber and 100 pellets with R. erythropolis) and incubated for 1-3 weeks. After that we selected 10 pellets and conducted a comparative assessment of the effectiveness of these strains for their survival in contaminated soil as described in example 1. Because the pellets were painted in a dark color after incubation in oil-contaminated soil was performed quantitative determination of formazan after the extraction of ethanol on the intensity of staining of the extracts on a tablet a spectrophotometer at 490 nm. As control was used blank (no microorganisms) granules after their incubation in oil-contaminated soil. The obtained results were calculated on the number of viable cells in the granule via a calibration dependence of optical density on the number of cells for these strains of bacteria. Next, each pellet was used for DNA extraction using a commercial kit ZR Soil DNA Miniprep Kit (Zymo Research) according to the instructions of the manufacturer. Selected from 1 gra the uly's DNA was used for PCR with sets of primers for R. ruber and R. erythropolis described [Bell for K.S., Kuyukina M.S., Heidbrink, S., J.C. Philp, Aw D.W.J., Ivshina V, Christofi N. Identification and environmental detection of Rhodococcus species by 16S rDNA-targeted PCR // J. Appl. Environ. - 1999. - V.87. - P.472-480], synthesized by the company "Synthol", Moscow. Used sets of primers of the following composition:

1) is specific for R. ruber as in example 1;

2) is specific for R. erythropolis (expected length of the amplified product 449 mon)

a) Rel 5'CGTCTAATACCGGATATGACCTCCTATC3',

b) Re2 5'GCAAGCTAGCAGTTGAGCTGCTGGT 3'.

The reaction mixture volume of 25 µl had the following composition: 10 mm PCR buffer; 2.5 mm MgCl2(for primers to R. ruber) and 1.5 mm MgCl2(for primers for R. erythropolis); 0.2 mm blend of the four deoxynucleotides (dNTP); 0.2 μm forward and reverse primer; and 0.4 units of Taq DNA polymerase, and 1 µl DNA, diiodotyrosine water. Modes of amplification for these primers as follows: 5 min at 95°C and 35 cycles of 30 sec at 95°C, 30 sec at 64°C (for R. erythropolis) or 60°C (R. ruber), 30 sec at 72°C, then 10 min at 72°C. PCR Products were visualized using agarose gel electrophoresis. Strains of R. ruber and R. erythropolis clearly detected by PCR results in granules of the gel after a long stay in contaminated soil (figure 2). The average number of living cells R. ruber was 3.2×105cells/ml, a R. erythropolis - 2,8×105cells/ml (table 2). Thus, these types of Rhodococcus successfully detected using the proposed is on the way after a long stay immobilized biocatalyst in oil-contaminated soil. The timing of the analysis was 6-8 p.m.

Example 3. Preparing a sample multi-species biocatalyst-based granules PVA cryogel size of 100 mm3prisoners in them of hydrocarbon-oxidizing bacteria (106cells/ml) of R. ruber IEGM 615 and R. opacus IEGM 245, taken in equal proportions as described in example 1. After storage of the biocatalyst in the refrigerator (5°C) within 2 months determined the viability of immobilized Rhodococcus. For analysis were taken at 10 pellets and put them in the wells of 96-well plate. Granules were stained using INT for 1 h and determined the intensity of the purple coloring on a tablet photometer at 630 nm. The obtained results were calculated on the number of viable cells in the granule via a calibration dependence of optical density on the number of cells for these strains Rhodococcus. Next, from each pellet was isolated DNA using a commercial kit ZR DNA Miniprep Kit (Zymo Research) according to the instructions of the manufacturer and perform species-specific PCR, as shown in example 1. Both strains of R. ruber and R. opacus, prisoners together in 1 granule, gel, clearly detected by PCR results (figure 3). The average number of living cells of these strains of microorganisms was 5.7×106cells/ml (table 3). Thus, species differentiation and identification innespace the activity of immobilized Rhodococcus was successfully carried out using the proposed method after prolonged storage of the biocatalyst. The timing of the analysis was 6 o'clock

Example 4. Prepared 4 sample manoidonove biocatalyst-based granules PVA cryogel size of 100 mm3prisoners in them of hydrocarbon-oxidizing bacteria R. opacus IEGM 245, taken at various concentrations (103, 104, 106and 108cells/ml)as described in example 1. For analysis were taken at 5 pellets of each sample and placed in wells of 96-well plate. Granules were stained using INT for 1 h and determined the intensity of the purple coloring on a tablet photometer at 630 nm. The obtained results were calculated on the number of viable cells in the granule via a calibration dependence of optical density on the number of cells for these strains of microorganisms. Next, from each pellet was isolated DNA as in example 3, and perform species-specific PCR, as shown in example 1. Cells of R. opacus clearly detected by PCR results in all of the pellets even at low (103cells/ml) concentration (figure 4). The timing of the analysis was 6 o'clock

Thus, the inventive method species differentiation of viable Rhodococcus, immobilized water-insoluble gel media, in comparison with analogues has a number of significant advantages, because it allows to determine the number of live bacterial cells determine Lenogo species in one sample (pellet) biocatalyst even when they are low (from 10 3cells/ml) concentration, in short (6-8 hours) time, without the need for cell isolation from gel medium and culturing bacteria and without the use of expensive equipment.

Description of figures and tables

Figure 1. The results of PCR amplification of DNA isolated from the granules of the gel with immobilized cells of Rhodococcus ruber and Rhodococcus opacus after incubation of the enzyme in the presence of hydrocarbon-contaminated water.

Figure 2. The results of PCR amplification of DNA isolated from the granules of the gel with immobilized cells of Rhodococcus ruber and Rhodococcus erythropolis after incubation biocatalyst in oil-contaminated soil for 1 and 3 weeks.

Figure 3. The results of PCR amplification of DNA isolated from the granules of the gel together with immobilized cells of Rhodococcus ruber and Rhodococcus opacus after storage of the biocatalyst.

Figure 4. The results of PCR amplification of DNA isolated from the granules of the gel with immobilized in different concentrations of cells of Rhodococcus ruber.

Table 1. The results of determining the viability of gel-immobilized cells of Rhodococcus ruber and Rhodococcus opacus after incubation of the enzyme in the presence of hydrocarbon-contaminated water.

Table 2. The results of determining the viability of gel-immobilized cells of Rhodococcus ruber and Rhodococcus erythropolis after incubation biocatalyst in oil-contaminated soil within 1 weeks.

Table 3. The results of determining the viability of gel-immobilized cells of Rhodococcus ruber and Rhodococcus opacus after storage of the biocatalyst.

Table 1
Types of RhodococcusRhodococcus ruberRhodococcus opacus
Value OP630 nmpainted INT granules of the gel with immobilized Rhodococcus1,53±0,121,18±0,09
Value OP490 nmextracts formazan painted INT granules of the gel with immobilized Rhodococcus0,42±0,020,28±0,03
The average number of immobilized living cells of Rhodococcus, CL/ml(2,7±0,16)×106(1,7±0,08)×106

Table 2
Types of microorganismsRhodococcus ruberRhodococcus erythropolis
Value OP490 nmextracts formazan painted INT granules of the gel with immobilized Rhodococcus (after 1 not who ate in the soil) 1,08±0,021,00±0,04
The average number of immobilized living cells of Rhodococcus (after 1 week in the soil), CL/ml(6,0±0,21)×105(4,7±0,36)×105
Value OP490 nmextracts formazan painted INT granules of the gel with immobilized Rhodococcus (after 3 weeks in the soil)0,87±0,050,73±0,09
The average number of immobilized living cells of Rhodococcus (after 3 weeks in the soil), CL/ml(3,2±0,18)×105(2,8±0,14)×105

Table 3
Types of microorganismsR. ruber+R. Opacus
Value OP630 nmpainted INT granules of the gel with immobilized Rhodococcus1,90±0,13
The average number of immobilized living cells of Rhodococcus, CL/ml(5,7±0,42)×106

1. The way the species differentiation of viable Rhodococcus immobilized in the granules of water-insoluble gel consisting in the spectrophotometric determination of the number of living cells in painted iodonitrotetrazolium (INT) sample gel, extracting DNA from the sample and carrying out PCR using sets of species-specific primers.

2. The method according to claim 1, characterized in that after application of the sample gel INT carry out the extraction of the formed formazan ethanol and then extracted DNA from the sample gel for the production of species-specific PCR.



 

Same patents:

FIELD: biotechnology.

SUBSTANCE: method comprises obtaining samples of highly purified DNA, fragmentation of the isolated DNA with restriction endonuclease having no recognition site in the amplified region, hydrolysis of fragmented DNA by methyl-dependent site-specific DNA-endonuclease GlaI or its isoschizomer, ligation of the universal oligonucleotide adapter to the hydrolysed DNA followed by amplification in real time using a primer and a probe complementary to the test DNA and the hybrid primer, which 3'end is complementary to at least 3 nucleotides of the 3' terminus of DNA in the test area of hydrolysis GlaI, and the remaining part is complementary to an adapter sequence, and making conclusion on the basis of a fluorescent signal on the presence of the sequence Pu(5mC)GPy.

EFFECT: improved method.

4 cl, 4 dwg, 5 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, more specifically to a response test to the hospital infection in a patient suffering from a septic shock, and can be used in medicine. A biological sample specified in the patient's blood, serum, saliva, tissue or circulating cells is prepared, and a biological material: nucleic acid or protein is extracted from the biological sample. A reagent specific to the S100A9 target gene expression product specified in an amplification primer, a hybridisation probe and/or antibody is used to determine the S100A9 target gene expression.

EFFECT: invention enables stating the response to the hospital infection in the patient suffering from the septic shock as shown by the S100A9 target gene overexpression to a certain threshold.

11 cl, 2 dwg, 3 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and concerns a kit for detecting Q fever by RT PCR. The characterised kit contains synthetic oligonucleotides limiting a fragment of groEL gene: GroEL F 5' CTTCTACTGTTATGACGCCTTCTTTGC 3'; GroEL R 5' CGCAAGTAGGCACCATTTCTGC 3', and a fluorescent probe: GroEL Probe 5' FAM-CACTTTCTCCATCGCTTCCGCAATAATA-TAMRA 3'.

EFFECT: invention can be used in medicine, veterinary science, clinical laboratory diagnostics for the recovery of the bacteria Coxiella burnetii DNA in test samples, as well as for solving scientific problems aiming at examining the given microorganism.

2 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: claimed group of inventions relates to the field of medicine. Claimed are a method and a set for determination of the presence in a patient of a higher risk of possessing cardiovascular disease or disorder by polymorphic variants of genes. Claimed is a method of identifying the patient, requiring early and/or aggressive or preventive therapy of cardiovascular disease and a method of treating such patient.

EFFECT: claimed group of inventions provides effective methods and sets for determining a risk of possessing cardiovascular disease, which makes it possible to identify the patient requiring therapy of cardiovascular disease.

10 cl, 4 dwg, 18 tbl, 1 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to the field of molecular biology and genetic engineering. Claimed are: a method and a set for the detection of poorly represented RNA fractions in a biological sample and for the detection of mycoplasma contamination, for which purpose used are operations of reverse transcription of RNA into cDNA with the application of reverse transcriptase Thermus thermophilus (rTth-pol) under conditions of "hot start", RT inactivation by processing with a chaotropic preparation, detection of cDNA of interest by a polymerase chain reaction (PCR).

EFFECT: invention can be used in medicine in testing for the mycoplasma presence.

15 cl, 3 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: claimed invention relates to the field of biotechnology and deals with a method of amplification and detection of nucleotide sequences in a reaction mixture and a set, used in the said method. The claimed method includes providing an analysed sample, reagents for realisation of amplification by a polymerase chain reaction (PCR) and, at least, four double-labelled probes. Each of the probes is specific to its nucleotide sequence to be detected, bears a fluorescent label and a respective fluorescence quencher, with both probes bearing similar labels, and probes, bearing similar labels, differ by a temperature of melting (Tm). After that, amplification of the nucleotide sequences and an analysis of a melting curve are performed by means of the double-labelled probes in the reaction mixture.

EFFECT: solution can be applied in the multiplex PCR analysis in real time in diagnostics of bioreagents.

9 cl, 9 dwg, 21 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention refers to biochemistry. What is involved is a qualitative assessment of the efficacy of oleic acid as an RNA carrier through biological membranes. The biological membrane is presented by soft sac cells of ripe pulp of honey pomelo of the genus Citrus. The RNA carrier is presented by oleic acid from the preparation Vitalang-2 in an amount of 10.8% and forming a complex with RNA. The preparation Vitalang-1 containing pure RNA is used as a reference. The pomelo cells are poured separately with aqueous solutions of the preparations Vitalang-1, Vitalang-2 and distilled water in an amount of 4.8 ml in each flask. They are incubated for 22 hours at room temperature. A spectrophotometer is used to measure optical density of the solutions versus distilled water with determining the RNA content in the pomelo cells and surrounding solution. Comparing the derived optical densities of the solutions provides stating the fact that Vitalang-2 penetrates through the biological membranes by 4.7-4.9 times more effectively than the preparation Vitalang-1. It is stated that absorption spectra of RNA recovered from the soft sacs are identical to those for the initial compounds.

EFFECT: invention enables assessing the efficacy of oleic acid used as the RNA carrier through the biological membranes.

1 ex

FIELD: biotechnology.

SUBSTANCE: presented primers flank the regions of genes PB2, PB1, PA, NP, MP, NS of low pathogenic avian influenza viruses and do not cross-react with related species.

EFFECT: designed primers enable to obtain complete information on the genes of avian influenza viruses, their belonging to a particular genetic line of the virus, the presence of nucleotide, amino acid substitutions in the genome of the pathogen.

1 dwg, 2 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: group of inventions relates to biotechnology. A method for detecting an expression level of MCP1 (CCL2) gene provides assessing its iRNA amount by a polymerase chain reaction with reverse transcription (RT-PCR) with real-time signal detection in human sampled cells, tissues and biological fluids. What is developed is a kit for quantitation of iRNA of MCP1 involving combinations of oligonucleotide primers and fluorescent probes for real-time RT-PCR to detect an amount of cDNA of MCP1 genes and RPL32, ACTB, PII normalisation genes.

EFFECT: using the group of inventions enables reducing calculation errors introduced when using one normalisation gene without increasing the number of amplifications, as well as reducing calculation errors raised in a simplified suggestion of the efficacy balance of the cDNA amplification reactions of MCP1 and a normalisation gene observed in ∆∆Ct method.

2 cl, 2 dwg, 3 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, genetic engineering and molecular biology. What is presented is a method for monitoring breast cancer in an individual. The method involves determining an expression ratio of the paired box 2 gene to beta defensin-1 gene (PAX2-to-DEFB1) in the cells produced from the individual's breast with the PAX2-to-DEFB1 expression ratio correlating with the breast conditions. What is also presented is a kit for monitoring breast cancer.

EFFECT: invention can be used in medicine in treating and monitoring cancer.

10 cl, 40 dwg, 8 tbl, 17 ex

FIELD: chemistry.

SUBSTANCE: invention relates to field of biotechnology and deals with method of quantitative determination of fixed rabies virus strain "Moskva 3253". Method includes decontamination and separation of RNA from virus-containing material, carrying out reaction of reverse transcription and polymerase chain reaction with hybridization-fluorescence account of results in "real time" mode with application of specific primers RV5-5'-GTTGGGCACTGAAACTGCTA-3', RV6-5'-GAATCTCCGGGTTCAAGAGT-3' and probe RV7-5'-ROX-AATCCTCCTTGAACTCCATGCGACAGA-BHQ2. Quantitative assessment of virus is determined on the basis of registration of signal of analysed sample fluorescence and its comparison with signal of fluorescence of PCR-standards, which contain different quantities of DNA-targets. Claimed method makes it possible to determine quantitative content of virus in rabies antigen of organ-tissue and culture origin.

EFFECT: application of invention contributes to standardisation of stage of rabies antigen preparation in production of heterological anti-rabies immunoglobulin.

2 tbl, 3 dwg, 2 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry and molecular biology. Conservation of cells of Escherichia coli in presence of buffered 80-90% glycerol is performed. Cell envelopes are removed with 3% triton X-100. Cell supramolecular structures are successively extracted with increasing concentrations of salts: 0.14 M (bacterioplasm), 0.35 M (loosely linked with cell residue), 2 M NaCl (strongly linked with cell residue), and 6 M guanidine hydrochloride with 0.1% β-mercaptoethanol (cell residue). Acid hydrolysis is carried out in said fractions. Anthrone method is carried out, with preliminary purification of anthrone preparation. Calibration graph is built and quantity of hexoses is determined by means of calculation formula.

EFFECT: invention makes it possible to determine quantity of hexoses in supramolecular structures of bacterial cell of Escherichia coli.

3 dwg, 3 tbl, 1 ex

FIELD: biotechnologies.

SUBSTANCE: invention can be used for detection of coliform bacteria and E.coli in specimens of food products and water at performance of bacteriological tests. Feed medium includes a nitrogen source represented by meat peptone or pancreatic hydrolysate of fish flour, sodium chloride, dibasic sodium phosphate, potassium monophosphate, sodium pyruvate, L-tryptophane, sodium dodecyl sulphate, 6-chloro-3-indolyl-β-D-galactopyranoside (Salmon - GAL), 5-bromine-4-chloro-3-indolyl-β-D-glucoronide-(X-GLUC), isopropyl- β-D1-tiogalactopyranoside (IPTG) and microbiological agar in the specified ratio.

EFFECT: invention allows reducing identification time, improving difernetiation accuracy of coliform bacteria and Ecoli, and simplifying a feed medium preparation method.

2 cl, 4 dwg, 1 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: invention can be used for detection and considering of E.coli and coliform bacteria in water, food products, clinic material, etc. Feed medium contains pancreatic hydrolysate of fish flour dried with Tergitol 7 on the bases of 0.1 g of Tergitol 7 per 6 g of dry pancreatic hydrolysate of fish flour, yeast extract, 1-water D (+) lactose, bromthymol blue, sodium dodecyl sulphate, 2,3,5-triphenyltetrazolium chloride, sodium carbonate and microbiological agar in the specified ratio.

EFFECT: invention allows preserving sterility of feed medium during 10 days, increasing accuracy of differentiation of coliform bacteria and Ecoli and simplifying a feed medium preparation method.

2 tbl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: invention pertains to the method for quick growth, detection and identification or counting of microcolonies of microorganisms at early stage. The described method includes the following stages: obtaining the container with medium with porous element located above or under the top surface of the medium, note that the medium has nutritious substances for quick growth of microcolonies of microorganisms and porous element has pores from 1000 to 107 Da; pouring the liquid sample without serial dilution into container to the area above porous element; capturing the microorganisms in porous element or at the medium above porous element; incubation of container for the time sufficient for quick growth of microcolony at an early stage; transfer of porous element and any medium above it from container to the secondary medium for evaluation, detection and identification of microorganisms; and microcolonies research relatively the growth, detection, identification or counting of microorganisms. The said method for growth, detection and identification or counting of microorganisms takes not more than approximately six hours.

EFFECT: invention allows more quickly, efficiently and less expensively indentifying the total number of revivable microcolonies of microorganisms, their identifying and distinguishing.

7 cl, 10 dwg

FIELD: biotechnology.

SUBSTANCE: amount of aerosol particles with a diameter of 0.3 mcm, 0.5 mcm and 1.0 mcm per unit of air volume is determined using the aerosol particle counter. The predicted total bacterial content of air environment is calculated by the formula: Y=0.0003(n0.5+n1.0)-1.2, at least upon one of conditions n0.3≤2.95n0.5 and/or n0.5≤3.99n1.0, where: Y is the predicted total bacterial content of air environment, CFU per unit of air volume; n0.3 is the number of aerosol particles with the diameter of 0.3 mcm per unit of air volume; n0.5 is the number of aerosol particles with the diameter of 0.5 mcm per unit of air volume; n1.0 is the number of the aerosol particles with the diameter of 1.0 mcm per unit of air volume; 0.0003, 2.95 and 3.99 are the coefficients; 1.2 is correcting dimensionless quantity.

EFFECT: invention enables to reduce the duration of analysis at express forecast of total bacterial content of air environment to 5 minutes.

1 tbl, 4 ex

FIELD: chemistry.

SUBSTANCE: present invention relates to microbiology and a method of detecting and counting viable Legionella pneumophila microorganisms in a sample. The described method involves: (1) contacting said microorganisms of said sample with at least one reducing compound which contains glutamate and pyruvate, and a culture medium which is a buffered charcoal yeast (BCYE) or GVPC agar culture medium, (2) incubating the product of step (1), and (3) detecting and determining the number of viable microorganisms. The reducing compound used directly or indirectly affects metabolism, reducing oxidative stress of the microorganism by reducing formation and/or breaking down reactive forms of oxygen.

EFFECT: disclosed method enables to accurately count Legionella pneumophila microorganisms in a stressed condition.

7 cl, 5 dwg, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to a method of altering immunomodulating properties of lipopolysaccharides of plague bacteria in vitro, which involves obtaining preparations of lipopolysaccharides (LPS) and mouse toxin (MT) Yersinia pestis with subsequent formation of a LPS-MT complex thereof. A modified form of LPS-MT is used as an inducer of synthesis of cytotoxins TNF-α and IFN-γ. To this end, a test sample is prepared, to which LPS is added in amount of 5 mcg (50 mcl from working dilution of 100 mcl/ml) and MT is added in amount of 50 ng (5 mcl from working dilution of 10 mcg/ml); the sample is then incubated for 30 min at 37°C. The volume of the sample in eppendorfs is then brought to 100 mcl with sterile buffered physiological solution of NaCl and the obtained mixture is added a tray dimple containing a culture of human monocyte cell line U-937 (1×106 cells in a dimple); the latter is cultured in a medium of PRMI 1640 with simultaneous double control. Further, 1, 4, 20 hours after the beginning of combined incubation of the preparations of LPS with monocytes, quantitative accounting of the synthesised cytotoxins is carried out, wherein change in the immunomodulating properties of LPS of plague bacteria in vitro is determined from the amount of cytotoxins produced and the dynamics of their synthesis.

EFFECT: invention enables to alter immunomodulating properties of lipopolysaccharides of plague bacteria in vitro, which enables to realise toxic potential of the endotoxin of plague bacteria.

2 cl, 8 dwg, 2 ex

FIELD: biotechnologies.

SUBSTANCE: method includes the following stages: contact of a sample with a source of nutrition for cells, containing antioxidant, representing pyroracemic acid or its salt, and an inhibitor of cell proliferation, which is selected from ciprofloxacin and cefalexin; contact of the specified sample with fluorescent-marked oligonucleotide probes, capable of specific hybridisation at least with one section of ribosomal nucleic acids, which belong to microorganisms of Legionella pneumophila kind and type; and detection and quantitative determination of a fluorescent signal.

EFFECT: provided method and set make it possible to more accurately and reliably detect and calculate viable microorganisms of Legionella pneumophila type, having excluded natural fluorescence of microorganisms from calculation.

6 cl, 2 dwg, 6 tbl, 2 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry. Disclosed is a method of determining maximum concentration of living bacteria. A suspension of bacteria with turbidity standard of 5 units is brought to concentration of 500000 mc per 1 ml. Electrical resistance of the suspension is then determined in a direct current field with maximum voltage across open ends of electrodes of 2.8 V. Maximum resistance in the range of 900-1500 kOhm indicates maximum concentration of living bacteria in suspensions of different types of microorganisms.

EFFECT: method provides quality estimation of concentration of living bacteria, which is sufficient for further identification of said bacteria, and cuts analysis time.

1 tbl, 4 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. The method is intended for the identification of nosocomial strains of microorganisms in carrying out epidemiological monitoring. Water-alcohol solutions of 3-4 aniline dyes are prepared. A standardised suspension of the studied microbial culture is added, incubated; the obtained results are estimated and the identity of strains is determined. In case of the identity of sensitivity indices of the separated and studied microbial cultures to each corresponding aniline dye the identification of nosocomial strain is stated.

EFFECT: invention makes it possible to increase the method accuracy.

4 tbl, 3 ex

Up!