Method of dna separation

FIELD: biotechnology.

SUBSTANCE: deoxyribonucleic acid (DNA) is separated from biological objects on carrier objects - gauze, paper, synthetic fabrics. The biological object - bone, horny tissue - is crushed. It is placed in a test tube containing a lytic buffer solution of the composition: 0.1 M Tris-HCl, 0.1 M EDTA, 0.1 M NaCl, 0.5% N-laurylsarcosil Na and proteinase K, pH 6-7. Cell lysate is obtained and is added with sorbent of magnetic nanoparticles of iron oxide Fe3O4, modified with chitosan. The mixture is stirred and incubated for 25-35 min. The test tube is placed on a magnetic rack and the mixture is divided into fractions - sorbent associated with DNA and the supernatant. The supernatant is removed. The residue is added with poured eluting buffer solution of the composition: 10 mM Tris-HCl, pH 7.4, 100 mM NaCl; 1 mM EDTA, and incubated. The test tubes are placed on a magnetic rack. The mixture is divided into fractions - sorbent - residue and supernatant - DNA, dissolved in the eluting buffer solution. The residue is removed. The final product of DNA is left in the supernatant.

EFFECT: invention enables to obtain DNA from different biological objects and increase the yield of the separated DNA not less than 1,5 times.

 

The invention relates to the field of nano-biotechnology and can be used to extract deoxyribonucleic acid (hereinafter referred to as the DNA from various biological objects.

There is a method of DNA extraction using phenol-chloroform mixture [1]. The disadvantage of this method [1] is the high toxicity of the applied substances, the complexity of the extraction procedure, framestarted (2-3 days).

There is a method of DNA extraction using chelating reagent ion exchange resin Chelex-100 (Chelex-100) [2]. The disadvantage is the low quality selected by the method [2] preparation of DNA due to the presence of impurities (products of lysis of the cells), the inability to extract DNA from bone and muscle tissue, contamination of the DNA preparation products lysis of cells (proteins, lipids).

The closest to the essence of the proposed method, the prototype, is a method of DNA extraction using geomagnetic of nanosolution (GMNC), based on the binding of DNA with a DNA probe of the sorbent [3].

The disadvantage of the prototype is limited the field of application of the method [3], if necessary, to extract DNA from a wide range of different biological objects (blood, saliva, hair), as it happens, for example, when conducting a forensic medical examination. The low number of selected DNA from the bone and mysecretkey, nail plates also restricts the use of the prototype.

The aim of the invention is the expansion of the list used for DNA extraction of biological objects, the improved performance of the work on DNA isolation, improving the quality and quantity of the selected DNA sample, simplifying, shortening the duration of the extraction procedure, a cheaper process.

Target those that receive nanoparticles of iron oxide Fe3O4. Nanoparticles modified by the addition of chitosan molecules. Preparing a suspension of nanoparticles, spend grinding investigated the biological object, fill its lytic buffer, incubated. Get cell lysate. To the lysate added to the nanoparticles incubated, separated into fractions in the form of sediment and nadeshiko remove adosados, to the precipitate add an eluting buffer solution, mix. Receive a suspension. The suspension is separated into fractions in the form of sediment and nadeshiko selected adosados. Adosados contain the selected DNA preparation.

The inventive method is carried out, for example, as follows. Select the sample studied biological object, such as a bone. The sample is crushed, for example bone - to powder. The crushed sample is placed in a clean test tube for DNA analysis, for example - about the Irku type Eppendorf. Known method [4] obtain nanoparticles of iron oxide (Fe3O4and using these nanoparticles prepared sorbent for DNA extraction. To do this in a clean utensils to prepare an acetate buffer solution of 0.015 M, for example composition (0,5H CH3COOH, 0,5H CH3COONa, pH of 3.6 to 5.6). In the prepared buffer solution dissolve chitosan, for example, with molecular mass (Mw=5.0×105) and the degree of deacetylase 94.50%, achieving a final concentration of chitosan 0.5 mg/ml Then in the resulting buffer solution of chitosan add previously obtained nanoparticles (Fe3O4), achieving a final concentration of nanoparticles (Fe3O4) 0.5 mg/ml and receive a suspension of modified chitosan nanoparticles in acetate buffer solution. A suspension of nanoparticles in vitro exposed to ultrasonic vibrations and break egregiously nanoparticles. A suspension of the nanoparticles is exposed to ultrasonic vibrations three times for 3 minutes In between periods of exposure to ultrasound suspended nanoparticles assert within 2 minutes Ultrasound is used, for example, frequency 20-22 kHz, when the intensity of the oscillations is less than 22 kW/m2. Under the influence of ultrasound suspended nanoparticles becomes homogeneous. In a homogeneous suspension of nanoparticles added dropwise a solution of alkali, for example, 10% aq is th NaOH solution, bring the hydrogen ion exponent (pH) suspended solids up to 8-9 units. While the nanoparticles started to settle to the bottom of the vessel. The process of sedimentation shall be controlled visually. Then the process of deposition of the nanoparticles continue, for example by centrifugation at 1000 rpm for 3 minutes Under the action of centrifugal force separates sediment in two phases: the formed precipitate (modified chitosan nanoparticles Fe3O4and adosados (supernatant acetate buffer solution). The supernatant is removed and the precipitate washed with, for example, distilled water. To do this, to the precipitate add distilled water (dH2O) in an amount covering the surface of the sediment. Shaking a vessel such as a test tube, washed nanoparticles. Then the nanoparticles are precipitated, for example, by centrifugation 1000 rpm for 3 min, and remove the distilled water. In this way re-conduct the procedure of washing the precipitated nanoparticles with distilled water. The washed nanoparticles are precipitated, for example by centrifugation at 1000 rpm for 3 min, remove the supernatant, to the precipitate add 0,015 M acetate buffer (pH 5.0).

A portion of the previously prepared analyzed biological object, such as a crushed sample of bone tissue in 5 g, placed in a test tube and pour lyse buffer R is the target, for example, composition: 0.1 M Tris-HCl, 0.1 M EDTA, 0.1 M NaCl, 0.5% Of N-laurylsarcosine Na and proteinase K (ph 6-7, 20-25°C). Lyse solution is stirred (suspended) with the crushed sample and receive a suspension containing lyse buffer solution and a sample of bone tissue. The suspension is incubated, for example, within 25-35 min After incubation the tube with the suspension is exposed to a constant magnetic field, for example, placing the tube on a standard laboratory magnetic tripod. Under the action of a constant magnetic field separates the slurry into two phases: the sediment - cell lysate and adosados acetate buffer solution. Formed adosados removed and receive sediment - cell lysate containing the fraction of DNA preparation from the sample.

To the cell lysate add previously prepared sorbent Fe3O4in 0,015 M acetate buffer solution, for example, in 20 μl suspension of modified nanoparticles in 1 ml of cell lysate. The suspension is stirred (suspended), for example, an automatic pipette. Then mixed suspension incubated for 30 min at a temperature in the range of plus 15-30°C. the tube with the suspension is exposed to a constant magnetic field, for example, by placing the tubes on a standard laboratory magnetic tripod. Under the influence of the magnetic field occurs once the bookmark suspension into two phases: the sediment - sorbent Fe3O4with contacting him molecules DNA and adosado - lyse buffer solution. Adosados (supernatant) was removed and to the precipitate poured a wash (eluting) buffer solution, for example, composition: 10 mm Tris-HCl, pH 7.4; 100 mm NaCl; 1 mm EDTA. The mixture is stirred, for example, automatic pipette, and then the test tube is placed in a standard laboratory magnetic tripod, where under the action of a constant magnetic field separates the slurry into two phases: the sediment - sorbent nanoparticles of Fe3O4and adosado - eluting buffer solution of DNA molecules. Adosados taken in clean containers, such as tubes type Eppendorf. Selected adosados is the final product - a solution containing the selected DNA preparation. Dedicated preparation of DNA in solution is used as intended, for example for setting the amplification reaction.

Above by DNA emit from muscle tissue, cornea tissue of animals, nail plates, biological objects on objects-media - gauze, paper, synthetic tissues, blood, different state, semen, hair, nail plates. DNA isolation from creatine animal tissues, nail plates is the same as from the bone: before the selection, you will grind the biological object. However, for the extraction of DNA is of predmetov-media, you must first make it flush to the biological material. For this purpose, the subject carrier (gauze, paper, synthetic fabric) size 1×1 cm was placed in 1 ml of distilled water (dH2O) and incubated at a temperature of plus 56-70°C, receive the washout of biological material. Then separate the subject vehicle and work with flushing by the above method.

The inventive method allows much faster in comparison with analogues [1, 2], to allocate DNA procedure DNA extraction takes about 1.5 hours for the most complex objects. The product yield by the present method is up to 200 ng (nanogram) DNA from 5 g of bone powder. The prototype is no more. 150 ng of 5 g of bone powder. That is, the inventive method allows to increase the output allocated DNA preparation is not less than 1.5 times. The inventive method allows to isolate DNA from biological materials, such as muscle tissue, horns, animal hair, nail plates, inapplicable to extract DNA according to the method prototype [3].

Spectrophotometric appropriate degree of purification of the DNA, for example from impurities - proteins and lipids on the ratio of wavelength And260/A280is 1.8 to 2.0. This corresponds to the generally accepted standard of purity of the DNA, that is selected by the claimed method the pure drug.

The inventive method is safe, used for DNA isolation components are completely harmless to humans. The way the paragraph is adequate to perform DNA isolation from a wide range of biological objects, not available for prototype and analogues, that has expanded applications. These results of applying the proposed method to confirm its originality. The inventive method of DNA extraction is feasible using standard technical devices and equipment in industrial food production, in the activities of health organizations, police, animal husbandry. This corresponds to the requirements of the invention the criterion of "industrial applicability",

The proposed method of DNA extraction is required specialists from different industries, rely on the data of molecular genetic analysis, such as diagnostic medicine when defining diseases in the sample DNA (hepatitis, HIV, hereditary diseases), forensics, veterinary medicine, agriculture.

An example of application of the present invention shows its usefulness, for example, for the diagnosis of human disease in medicine and agricultural animals in veterinary medicine. Application of the proposed method of DNA extraction significantly expands the list of objects used to extract nucleic acids, for example in the production of a forensic medical examination.

The present invention satisfies the criteria of novelty, as if about is the definition of prior art is not detected by the tool, having characteristics identical (i.e. the same executable their function and form complete these signs all signs listed in the claims, including the characteristics of the destination.

The inventive method of DNA extraction involves an inventive step, because it is not identified technical solutions that have the signs consistent with the distinguishing characteristics of this invention, and is not installed fame of influence of distinctive features on the specified technical result.

The claimed technical solution can be implemented in the industrial production of analytical and diagnostic equipment, in the activities of organizations in the food industry, health, animal husbandry, law enforcement agencies through the use of known standard of technical devices and equipment. This corresponds to the criterion "industrial applicability", presented to the inventions.

SOURCES USED

1. C.G. Mathew The isolation of high molecular weight eukaryotic DNA [Text] / C.G.Mathew// Nucleic Acids (Methods in Molecular Biology, volume 2). - 1984. - pp.31-34.

2. Walsh P.S. Chelex®100 as a Medium for Simple Extraction of DNA for PCR-Based Typing From Forensic Material [Text] / P.S. Walsh, D.A. Metzger // BioTechniques. - 1991. - pp.506-513. Patent Nos. US 5,494,647/A/.

3. Xiaojun Z. the Collection of Trace Amounts of DNA/mRNA Molecules Using Genomagnetic Nanocapturers [Text] / z Xiaojun, T-D.Rovelyn, W.Kemin, T.Weihong // Analytical Chemistry. - Vol.75, No. 14, 15.07.2003, pp.3476-343 (PROTOTYPE).

4. S. p. Gubin Magnetic nanoparticles: preparation methods, structure and properties [Text] Spoun, Wasteserv // USP 74(6), 2005. - S-568.

1. The method of DNA extraction from biological objects, which consists in the fact that the biological object is crushed and placed in the tube lyse buffer solution composition: 0.1 M Tris-HCl, 0.1 M EDTA, 0.1 M NaCl, 0.5% Of N-laurylsarcosine Na and proteinase K, pH 6-7, get the cell lysate, the lysate add sorbent magnetic nanoparticles modified with chitosan, mixed and incubated for 25-35 minutes, the test tube is placed on the magnetic stand, divide the mixture into fractions - sorbent associated with DNA, and the supernatant, adosados removed and to draught poured eluting buffer solution composition: 10 mm Tris-HCl, pH 7.4; 100 mm NaCl; 1 mm EDTA, incubate the test tubes are placed on a magnetic stand, divide the mixture into fractions - sorbent - sediment and adosado - DNA dissolved in the eluting buffer solution, the precipitate is removed, nadeshiko remains DNA-end product.

2. The method according to claim 1, characterized in that as the source of DNA used bone tissue.

3. The method according to claim 1, characterized in that as the source of DNA used corneal tissue.

4. The method according to claim 1, characterized in that as the source of DNA used biological objects on the subjects of media.

5. The method according to claim 4, Otley is audica fact, that as the source of DNA used biological objects on the object-carrier - gauze.

6. The method according to claim 4, characterized in that as the source of DNA used biological objects on the object-carrier - paper.

7. The method according to claim 4, characterized in that as the source of DNA used biological objects on the object-carrier - synthetic fabric.



 

Same patents:

FIELD: medicine, pharmaceutics.

SUBSTANCE: presented invention refers to medical microbiology, particularly to molecular-genetic typing of the strains Helicobacter pylori. What is presented is a method for differentiation of the strains H.pylori by multilocal VNTR-typing with the PCR involving oligonucleotide primers on VNTR-comprising loci of H.pylori - HpA, HpD, HpE and HpF; the strains H.pylori are differentiated by a number of repetitions in the amplified fragments in each VNTR-comprising locus of H.pylori - HpA, HpD, HpE and HpF that enables genetic typing of the studied strains.

EFFECT: what is presented is the method for differentiation of the strains Hpylori by multilocal VNTR-typing.

1 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: method provides for performance of a reaction of multi-segment reverse transcription (M-RT) of virus RNA, matched with reaction of cDNA amplification. Reactions are carried out in one stage with the help of one pair of universal primers selected to highly conservative areas available in all virus segments, in presence of fluorescently labelled nucleotides. The matrix for this reaction is a single-chain RNA of flu virus from analysed biological samples. The quality of the produced fluorescently labelled cDNA of type A flu virus is checked by the method of electrophoresis in 1% agarose body. The proposed method makes it possible to perform quick production of fluorescently labelled amplificates of a virus cDNA for all segments of a virus genome.

EFFECT: using this method considerably reduces time required to do detection and subtyping of A flue virus on diagnostic biochips in analysed samples.

2 dwg

FIELD: medicine.

SUBSTANCE: method involves genome DNA recovery, hydrolysis by methyl-sensitive and non-methyl-sensitive isoschizomers of restriction endonucleases. The DNA hydrolysis products are ligated with universal adapters from oligonucleotides CCGGTCAGAGCTTTGCGAAT and ATTCGCAAAGCTCTGA. It is followed by a chain reaction with universal fluorescence-labelled primers ATTCGCAAAGCTCTGACCGGGN conjugated in 5'-terminal with the fluorescent dye FAM with further capillary electrophoresis which induces formation of the marker system in the form of electrophoretogram peaks. The electrophoretogram peaks are analysed with the use of the whole kit of the system markers in the form of complete representation.

EFFECT: invention provides higher reproducibility of the formed DNA methylation marker system, simplifying a procedure of characterising normal tissue methylotypes, reducing a time of screening cycle, providing high performance of the method.

3 dwg, 1 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to field of molecular biology and biotechnology and can be used in medicine and in pharmaceutical industry. RNA molecule, capable of target-specific RNA interference, represents double-stranded RNA molecule, 23 nucleotides long, which has 3'-overhang from 1-5 nucleotides. It is obtained by joining two RNA strands and used for obtaining pharmaceutical composition. When introduced into multicellular eukaryotic organism or in a cell of multicellular eukaryotic organism, said RNA molecule ensures promotion of target-specific RNA interference and leads to reduction of target-gene expression level or to target-gene knockout. Method of promoting target-specific RNA interference by means of said RNA molecule is applied for determination or modulation of gene function. Cell, containing endogenic target nucleic acid, RNA molecule, capable of target-specific RNA interference, and exogenic target nucleic acid, is used in analytical procedures.

EFFECT: application of invention ensures target-gene silencing, mediated by target-specific RNA interference.

40 cl, 23 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: biomaterial preparation is RNA recovery, cDNA synthesis on the RNA matrix, control of the TFDP1 cDNA concentration by a control gene, quantitative PCR-amplification of a TFDP1 gene fragment. These procedures are followed by evaluation of the amplified TFDP1 DNA fragment for a biomaterial sample. If the TFDP1 gene cDNA concentration in physiological fluids exceeds 1.5% of the ACTB beta-actin gene cDNA concentration, the presence of transitional cell bladder cancer is diagnosed. A kit for implementing the CR-based technique includes two primers with a certain sequence at molar ratio 1:1. A version technique provides the ELISA-based diagnosing. Patient's urine and blood are sampled to recover a mixture of protein components of urine and blood that is followed by ELISA with monoclonal antibodies and/or polyclonal antibodies and/or their fragments to TFDP1 recombinant protein and/or its unique fragments more than 8 amino acids long. Bladder cancer is diagnosed if observing the TFDP1 protein concentration in the analysed samples exceeding the 5-fold TFDP1 protein concentration in the reference.

EFFECT: technique enables high-reliability diagnosing of bladder cancer, including at the early stage of progressing neoplastic aberration.

3 cl, 4 tbl, 4 dwg

FIELD: medicine.

SUBSTANCE: invention may be used for target modification of a duplex DNA (double straight DNA) sequence. What is presented is a donor oligonucleotide a sequence of which is complementary along its whole length to the modified acceptor DNA with the exception of one nucleotide forming a mispairing with the modified duplex DNA sequence describing the expected substitute. The oligonucleotide under the invention comprises two modified nucleotide which represent LNA, and spaced at one nucleotide from a mispairing point from both sides.

EFFECT: what is described is a method for effective modification of the duplex DNA sequence with the use of the new oligonucleotide; conditions and means required for implementation thereof are disclosed.

14 cl, 3 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: method for detection of neutrophil extracellular traps in mucosal secretions provides staining of a native preparation 0.1 ml with an equally component mixture 0.1 ml of the Evans blue dye in the concentration of 1:8000 and the Sytox Green dye in the concentration of 1:500, incubation for 5 minutes in the dark. Luminescent microscopy with using filters generating excitation light at wave length max. 490 nm and emission at wave length 520 nm is used to detect neutrophil extracellular traps, living bacterial cells, apoptotic bacterial cells, green cork bacterial cells. The number of neutrophil extracellular traps (%) containing bacteria in 100 counted traps is evaluated.

EFFECT: method enables visualising chromantin, assessing cell viability and accelerating the study.

2 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: disclosed is a method for synthesis of molecule libraries containing an oligonucleotide label.

EFFECT: obtained molecule libraries can be used to identify compounds bound with a defined biological target.

132 cl, 13 dwg, 7 tbl, 10 ex

FIELD: chemistry.

SUBSTANCE: method relates to a procedure for linking cognate pairs of VH and VL encoding sequences from a population of cells enriched in particular surface antigen markers. The linking procedure involves a multiplex molecular amplification procedure capable of linking nucleotide sequences of interest in a particular polymerase chain reaction (multiplex PCR).

EFFECT: method is particularly effective for generation of cognate pair libraries as well as combinatorial libraries of variable region encoding sequences from immunoglobulins.

25 cl, 7 dwg, 6 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: invention discloses a method for detecting the expressing genetic determinants of the pathogenic microorganisms Burkholderia with using reverse transcription and conjugated amplification (RT-PCR) for the following structure functional analysis. The method involves the stages of bacterial culture growing to an early logarithmic growth phase, RNA recovery and purification by nucleosorption from the sodium merthiolate processed broth culture, removal of DNA impurities by DNA-ase processing, cDNA synthesis in the presence of a ribonuclease and primer inhibitor specific to sequences of procaryote mRNA ribosome determinants, cDNA reamplification with the same primer for collection and use thereof as a matrix in gene-specific PCR, recovery and detection of the nucleotide sequence of amplicons.

EFFECT: method provides assessing the action of cell adaptation variations in response to the varying environmental conditions on the manifestations of the most important biological characteristics of microorganisms - virulence and antimicrobial resistance - with a high degree of sensitivity at various environmental conditions.

3 dwg, 3 ex

FIELD: oil and gas industry.

SUBSTANCE: invention refers to oil-processing and petrochemical industries. The invention refers to the method for processing of hydrocarbon-containing raw material, and namely heavy and/or residual raw material, in which to raw material there additionally added is metal organic salt having the following formula: M(OOC-R)n, or M(SOC-R)n or M(SSC-R)n, where R means alkyl, aryl, isoalkyl, tert-alkyl, alkylaryl, which possibly includes hydroxylic, keto-, amino-, carboxyl, thiocarbamic group, where n - 1-3, and M means transition metal from elements of the Periodic system, at decomposition of which there obtained are metal nanoparticles, or nanoparticles of those metals, based on 0.001-0.1 wt % of metal per mass of raw material; at that, as hydrocarbon additive, there used are paraffin hydrocarbons, or olefinic hydrocarbons, or fraction of shale tar, or their mixture in the quantity of 2.0-20.0 wt %.

EFFECT: increasing conversion degree of hydrocarbon-containing raw material; increasing the yield of distillate fractions.

3 cl, 22 tbl, 16 ex

FIELD: oil and gas industry.

SUBSTANCE: invention refers to oil-processing and petrochemical industries and can be used to increase the processing depth of hydrocarbon-containing raw material. The invention refers to the processing method of hydrocarbon-containing raw material using metal nanoparticles and includes its separation into fractions so that light hydrocarbon fractions and residual fraction is obtained; at that, before the stage of separation into fractions, either metal organic salt having formula M(OOC-R)n, or M(SOC-R)n or M(SSC-R)n is introduced, where R means alkyl, aryl, isoalkyl, tert-alkyl, alkylaryl, which possibly includes hydroxylic, keto-, amino-, carboxyl, thiocarbamic group, N - 1-3, and M means transition metal from elements of the Periodic table, at the decomposition of which there obtained are metal nanoparticles, or nanoparticles of those metals based on 0.001-0.1 wt % of metal per mass of raw material; at that, at least some portion of residual fraction is supplied by recycling to the stage of separation into fractions after being mixed with raw material. The invention also refers to versions of the method.

EFFECT: higher quality and extraction degree of light hydrocarbons of up to 95%.

16 cl, 5 dwg, 9 tbl, 10 ex

FIELD: chemistry.

SUBSTANCE: invention relates to catalysts. Described is a catalyst composition which contains a perovskite of formula LaMO3, where M is at least one element selected from iron, aluminium or manganese, in form of particles dispersed on an aluminium oxide or aluminium oxyhydroxide substrate, wherein after calcination at 700°C for 4 hours, the perovskite is in form of a pure crystallographic phase and the size of the perovskite particles does not exceed 15 nm or after calcination of said composition at 900°C for 4 hours, the size of perovskite particles does not exceed 18 nm, more specifically 15 nm, or after calcination of said composition at 1000°C for 4 hours, the size of perovskite particles does not exceed 22 nm. Described is a method of producing said catalyst compositions, involving: preparing a liquid medium containing aluminium oxide or aluminium oxyhydroxide and salts of elements La and M, optionally a substitute element, wherein said salts are selected from acetates, chlorides and nitrates; a base is added to the obtained medium until achieving pH of at least 9, which results in formation of a precipitate; the precipitate is separated from the reaction medium and, if chlorides or nitrates were used as said salts at the first step, the precipitate is washed; the precipitate is calcined. Described are catalyst systems which contain said composition, obtained using the method described above.

EFFECT: obtaining a novel catalyst composition.

13 cl, 1 dwg, 2 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: diagnostic technique for amyloidosis accompanying Alzheimer's disease consists in determining the difference of nano β-amyloid Aβ (1-42) and/or Aβ (1-40) monomer counts in test and reference aliquots of a blood plasma sample with the oligomer formations being dissociated to nano β-amyloid Aβ (1-42) and/or Aβ (1-40) monomers in the test aliquot by exposing the aliquot to ultrasound under certain condition.

EFFECT: use of the declared technique enables higher sensitivity of diagnosing amyloidosis accompanying Alzheimer's disease.

2 dwg, 1 tbl, 1 ex

FIELD: measurement equipment.

SUBSTANCE: in pressure measurement method using a pressure strain gauge based on nano- and microelectromechanical system (NaMEMS), in the measurement mode, value of measured pressure Pi is calculated by means of biharmonic spline interpolation at check points based on column-vector W(P0, Uiz, Upl) saved at calibration stage by the following formula: Pi=GT×W, where GT - transposed column-vector G; "x" means matrix product. Calibration for pressure measurement is performed as per the method consisting in recording of stresses of measuring Uiz and feeding Upl diagonals of bridge measuring circuit and recording to a read-only memory of sensor column-vector W, which is calculated by the following formula: W=g-1×P, where P - column-vector of reference pressure values at check points; g - matrix, the diagonal elements of which are equal to zero, and the rest components are calculated in a certain way. Pressure sensor based on NaMEMS, implementing the proposed measurement and calibration methods, involves a calculation device that includes a conversion unit of ADC code to numerical value of stress, a calculation unit of numerical pressure value; at that, in the calculation unit of numerical value of pressure, the measured pressure Pi is determined by the formula Pi=GT×W.

EFFECT: improving measurement accuracy of pressure and processibility.

3 cl, 3 dwg

FIELD: measurement equipment.

SUBSTANCE: converter comprises a substrate with a dielectric layer, on which there are four parallel arranged thin-film magnetoresistive strips connected into a bridge circuit, and each strip comprises upper and lower protective layers, between which there are two ferromagnetic films with a separating layer between them. The first insulating layer is arranged above magnetoresistive strips. On the surface of the first insulating layer there are four nanomagnets in the form of rectangular strips arranged along thin-film magnetoresistive strips. Each nanomagnet comprises an auxiliary layer of chrome with a hard-magnetic film applied above it and a protective layer. Coercive force of the hard-magnetic film is at least three times higher than the field of magnetic anisotropy of a ferromagnetic film. Nanomagnets are arranged with a distance equal to width of the nanomagnet strip. The period of nanomagnet repetition is equal to doubled period of repetition of thin-film magnetoresistive strips. The magnetic field created by nanomagnets in neighbouring arms of the bridge circuit is directed as antiparallel. The neighbouring magnetoresistive strips are in minima of positive and negative permanent field of nanomagnets.

EFFECT: reduced consumed capacity and heating.

2 cl, 4 dwg

FIELD: nanotechnology.

SUBSTANCE: invention relates to a method of obtaining a coating containing carbon nanotubes, fullerenes and/or graphenes. The method includes application of carbon nanotubes, fullerenes and/or graphenes on the tin-containing coating and addition of carbon nanotubes, fullerenes and/or graphenes in the tin-containing coating by mechanical and/or thermal processing. The application of the obtained base with the coating as an electromechanical part or a frame with external outputs is claimed.

EFFECT: invention provides a coating with a low tendency to abrasion, high resistance to frictional corrosion, with improved conductivity and friction coefficient.

22 cl

FIELD: medicine.

SUBSTANCE: invention refers to medicine and veterinary science; it is used in transplantology, traumatology, surgery and oncology, and may be used to fill bone defects. What is described is a bioimplant which represents a donor bone deimmunised with chlorine-containing oxidants, a surface of which is covered with a multifunctional bioactive nanostructured coating (MBNC) of M-Ca-P-C-O-N or M-Ca-CON, wherein M is a metal specified in a group consisting of Si, Ti, Zr, Hf, Nb, Ta, and colonised by recipient's mesenchymal stem cells (MSC).

EFFECT: MBNC-coated bioimplant is in line with the anatomical and morphological characteristics of the replaced bone, provides cell adhesion, no transplant rejection, accelerated formation of connective tissue and callus.

8 dwg, 1 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: what is presented is the use of L-carnosine for making a nanopreparation having antihypoxic and antioxidant activity combined with a combination of substances selected from the group of phospholipids, non-polar lipids in the following ratio, wt %: L-carnosine - 1.1-1.2, non-polar lipids such as triglycerides, cholesterol, free fatty acids, DL-α-Tocopherol - 1.2-2.5, phospholipids such as phosphatidylcholine, phosphatidylethanolamine, lysophosphatidylcholine, lysophosphatidylethanolamine, sphingomyelin - 95.3-96.3 for preparing a drug having antihypoxic and antioxidant activity. The drug can be presented in the form of liposomes containing L-carnosine.

EFFECT: invention provides higher stability of L-carnosine and its lifetime up to three days with underlying higher effectiveness in small doses, as well as to improve the cerebral ischemia tolerance, the recovery after acute hypoxia and to increase the antioxidant status of the brain tissue.

3 cl, 4 dwg

FIELD: chemistry.

SUBSTANCE: present invention relates to a solid dispersed material for use in rubber vulcanisation and a method for production thereof. The solid dispersed material is coated with a coating which contains a formed complex of aceto-metallised sodium salt and a transition metal.

EFFECT: use of the solid dispersed material during rubber vulcanisation cuts the amount of transition metal oxide used in the vulcanisation process.

51 cl, 8 tbl, 5 ex, 4 dwg

Magnetic materials // 2244971

FIELD: magnetic materials whose axial symmetry is used for imparting magnetic properties to materials.

SUBSTANCE: memory element has nanomagnetic materials whose axial symmetry is chosen to obtain high residual magnetic induction and respective coercive force. This enlarges body of information stored on information media.

EFFECT: enhanced speed of nonvolatile memory integrated circuits for computers of low power requirement.

4 cl, 8 dwg

Up!