Mutant pestivirus with mutations in core gene and area ns3 and vaccine on its basis

FIELD: biotechnologies.

SUBSTANCE: mutant pestivirus has a mutation in a gene that codes Core protein, resulting in the fact that virus may not express the functional Core protein. At the same time the virus additionally contains one or more mutations in amino acids 2160-2260 of C-end domain of helicase domain NS3 of the specified pestivirus, if the specified pestivirus is CSFV, or amino acids 2169-2269 of the C-end domain of the helicase domain NS3 of the specified pestivirus, if the specified pestivirus is BVD. Such replacements compensate absence of a functional Core protein in the pestivirus.

EFFECT: inventions make it possible to produce attenuated viruses of pestivirus type, which are used to produce vaccines for protection of mammals against an infection caused by pestivirus.

8 cl, 2 dwg, 2 ex

 

The present invention relates to mutant pestiviruses and vaccines containing these viruses.

Pestivirus cause economically important diseases in animals around the world. The genus Pestivirus in the family Flaviviridae that includes at least three types: virus, bovine viral diarrhea (bovine viral diarrhea virus, BVDV), classical swine fever virus (classical swine fever virus (CSFV)and the virus border disease of sheep (ovine border disease virus (BDV)). Described a fourth individual group of pestiviruses, including isolates from cattle and sheep, and now generally accepted to refer to these additional types as BVDV-2; respectively, the classical strains of BVDV referred to as BVDV-1.

CSFV causes swine classical swine fever. Classical swine fever is a highly contagious and sometimes fatal disease of pigs and can cause significant economic losses.

Animals can be protected against CSFV by vaccination, however, traditional inactivated or modified live vaccines have drawbacks related to both safety and efficiency. Thus, there should be new, improved types of vaccines.

Virus bovine viral diarrhea (BVDV) is a cause of congenital and enteric diseases with a wide spectrum of clinical manifestations. The disease was first described as PE is edudata disease of cattle with high morbidity and low mortality. Affected cattle had fever, diarrhoea and cough. This condition is called bovine viral diarrhoea. Today BVDV is considered the main pathogenic microorganism cattle with the world economic impact. Clinical pattern of BVDV infection within the herd and, therefore, its impact on production depends on the interaction of several factors, including the strain of the virus, the age of the cattle, herd immunity, and the interaction of the factors causing stress. BVDV-1 and BVDV-2 both cause acute infection in cattle (diarrhea, fever, hemorrhagic syndrome), as well as (if infection occurs during pregnancy) abortion, malformation of the embryo and chronic infection of calves.

Genome pestiviruses consists of single-stranded (+)RNA and contains a single large open reading frame (ORF), flanked 5'-untranslated region and 3'-untranslated region. The ORF encodes a large polyprotein predecessor, which leads to the formation 11-12 cleavage products. ORF processed in different viral proteins as cellular and viral proteases. Viral proteins in ORF placed in the following order: NH2-Npro-C-Erns-E1-E2-p7-NS2-NS3-NS4A-NS4B-NS5A-NS5B-COOH. Virions of pestivirus consist of four structural proteins, a small positive what about the charged Core (C) protein (Core (C) protein, which is intended to form the structure of the nucleocapsid with the genomic RNA, and three glycosylated membrane proteins (Erns, E1, E2). Neutralizing activity was mainly demonstrated for E2-specific antibodies.

Were investigated the minimum requirements for replication pestiviruses, for example, through the creation of defective genomes of pestivirus, not containing gene sequences for structural proteins. It was found that defective CSFV genomes still replicated and can be packaged into viral particles when introduced into cells SK-6 with RNA A187-CAT helper (Moser et al., J.Virol., 7787-7794, 1999). Has been described can replicate autonomously, but defective BVDV genome that does not contain genes encoding C, Erns, E1, E2, p7 and NS2 (Behrens et al., J.Virol., 72, 2364-2372, 1998). TRANS-complementary With and E1 deletion mutants of another pestivirus, BVDV, were described by Beer et al., in WO 04/016794.

For CSFV were opened mutants that exhibit attenuated viral virulence. For example, Risatti et al., Virology 364, 371-382, 2007, describes CSFV mutants with replacement in the field E2, which demonstrate attenuated phenotype. Maurer et al., Vaccine, 23(25), 3318-28, 2005, describes CSFV E2 mutants that do not contain the entire gene E2 or part thereof, which show partial protection against lethal infection with highly virulent CSFV. Meyers et al., Journal of Virology, 73(12), 10224-10235, 1999, describes CSFV Mut is now with mutations in the gene, encoding a protein Erns, which lead to mutations. TRANS-complementarian Erns deletion mutant CSFV were described in Wildjojoatmodjo et al., J. Virol., 74(7), 2973-80, 2000.

The present invention provides mutant pestivirus, which have a deletion in a gene encoding a protein Core, where the virus is additionally characterized in that it contains one or more mutations in the C-terminal domain helicase domain of NS3.

Preferably the mutant pestivirus of the present invention is the virus of classical swine fever Classical Swine Fever virus CSFV) or virus bovine viral diarrhea (Bovine Viral Diarrhea virus, BVDV).

Mutations in the gene region that encodes a protein Core must be such as to cause the inability to Express functional protein Core. This can be achieved by deletion of the gene encoding the protein Core, in whole or in part. The signal sequence From the end of the Core protein is required for further processing of polyprotein below. Thus, deletion of the gene Core (parts of it) should be conducted so that translocation signal sequence for Erns remained saved.

Translocation sequence is a sequence of 18 amino acids located between amino acids 250 and 267 preceding the cleavage site before the N-end of the protein of CSFV Erns (Ala-267/Glu-268). (Rümenapf et al., J. Virol., 5(2), 589-597, 1991; Rümenapf et al., J. Virol., 67(6), 3288-3294, 1993). For BVDV, the cleavage site before the N-end of the protein is Gly-270/Glu-271.

The exact length of the sequences required for sequential processing may vary depending on the strain or cell type. For example, for CSFV sequence encoding a Core may be removed from amino acids 169-248 (p619), thus connecting With the end of the Npro with the C-terminal amino acids of the protein Core, which contain a translocation signal for Erns (CPLWVTSC168/LEKALLAWAVITILLYQPVAA267/ENIT).

For BVDV sequence encoding a Core may be removed from amino acids 169-251, thus connecting With the end of the Npro with the C-terminal amino acids of the protein Core, which contain a translocation signal for BVDV Erns (CPLWVSSC168/LEKALLAWAIIALVFFQVTMG270/ENIT).

The deletion of most of the gene Core makes possible the replication of RNA after transfection, but not the production of infectious viral progeny.

The present invention was found that the absence of a gene encoding a functional protein Core, can be compensated by mutations in the NS3 region of the viral genome.

The introduction of these mutations into the cDNA copy of pestiviruses, which was removed Core gene (as described above), makes possible the release of infectious viruses.

Mutations in the NS3 region are clustered in the C-terminal domain helicase domain NS3, more precisely, on the bushes 100 amino acids in C-terminal domain.

For CSFV identified seven independent mutations of the C-terminal domain helicase domain NS3 region (amino acids 2160-2260). Preferred mutant CSF viruses according to the invention have one or more mutations in the C-terminal domain helicase domain NS3 selected from the group consisting of Asn2177Tyr, Glu2160Gly, Pro2185Thr/Ala, Gln2189Lys Pro2200Thr and Asn2256Asp.

Introduction mutation Asn2177Tyr in CSFV Core Δ (p619) and electroporation with crnc leads to unexpected release of viable infectious virus particles. On the Northern blot, blot analysis genomic RNA is visible as slightly reduced in size, and concentrated viral particles do not contain the protein Core. Viral titers reach 5×105ffu/ml in SK6 cells and, thus, are lower by about 10 times than the titles p447 wt.

Further, other mutations of Glu2160Gly, Pro2185Ala, Gln2189Lys Pro2200Thr and Asn2256Asp were introduced in CSFV Core Δ (p619)that led to p1033 (Ala2185), p1034 (Thr2200), p1035 (Lys2189), p1036 (Asp2256), p1037 (Gly2160and p1038 (Asp2256). In all cases, the virus was recovered after electroporation with the corresponding the SP6 transcripts, but its viability differed significantly (analysis of growth curve). The most viable was the genome containing the replacement of Asn2177Tyr.

Thus, the most preferred is a mutant who CSFV according to the invention, where a mutation in the C-terminal domain helicase domain NS3 contains a mutation Asn2177Tyr.

To study whether these mutations are additive effect was obtained stronger compensatory mutants. For double mutations of Asn2177Tyr was a combination of Glu2160Gly, Pro2185Ala, Gln2189Lys Pro2200Thr and Asn2256Asp. Triple mutations contained Asn2177Tyr together with Pro2185Ala and Pro2200Thr, Pro2185Ala and Gln2189Lys, Gln2189Lys and Pro2200Thr and Glu2160Gly and Gln2189Lys. For all tested combinations was demonstrated reduced viability compared to single mutations, indicating that adding permissive mutations improves NS3 in the recovery Core.

While no physical or phenotypic differences from the parent CSFV wt was not noticeable in the natural host CSFV Core Δ was severely weakened. Mutant viruses of the invention are thus suitable for use in vaccines to protect pigs against infection with CSFV.

For BVDV identified eight independent mutations in the C-terminal domain helicase domain NS3 region (amino acids 2169-2269).

Preferred mutant BVD viruses according to the invention have one or more mutations in the C-terminal domain helicase domain NS3 selected from the group consisting of Glu2189Lys, Leu2190Pro Thr2191Ala, Asp 2192Glu, Pro2194Leu, Tyr2204His, Asn2265Tyr, Asn2265Asp.

Most preferred is a mutant BVDV according to the invention, in which a mutation in the C-terminal domain helicase domain NS3 includes Asp2192Glu, Tyr2204His, Asn2265Tyr or Asn2265Asp mutation.

Protein Core, apparently, is not necessary for the formation of infectious particles. Apparently, it is not necessary to build pestivirus, but has other features. Its function is compensated by mutations in helicase domain of NS3. The exact sequence of residual amino acids of the protein Core, overlapping signal translocation (LEKALLAWAVITILLYQPVAA268for CSFV Erns or (LEKALLAWAIIALVFFQVTMG270for BVDV Erns (sequence, covering the period between the end of the Npro and the N-end Erns), is not required for the formation of infectious viral particles while maintaining the translocation Erns. The signal sequence of a foreign glycoprotein can functionally replace the authentic sequence. Construct, in which the residual Core amino acids were completely replaced by the N-terminal translocation signal CD46 is viable (CD46 is just an example translatemessage cellular protein). When it was introduced in the transmembrane domain of the bovine CD46 (SSGRSPGWLLLAPLLLLPTSSDA), was recovered viable virus, reaching titers of 2×104ffu/ml

Once egenie of pestiviruses in the absence of Core opens up the possibility for pestiviruses marker vaccine. Can be expected that antibodies directed against the protein Core, are present in the serum of animals that overcame the infection pestiviruses. Core is immunogenic and expressed in a sufficient amount.

Vaccine containing infectious viral particles according to the invention together with a pharmaceutically acceptable carrier is also part of the present invention.

EXAMPLES

Example 1: Construct with a deletion of the Core

To test the hypothesis that substitutions in NS3 compensate for the lack of a damaged Core protein, were introduced nucleotide substitutions in the cDNA infectious CSFV, in which the coding sequence of the Core (aa169-248 (SDDGASG-KPPESRKKL)) was removed (p619). So, With the end of Npro was connected to the C-terminal amino acid Core, which form a translocation signal for Erns (CPLWVTSC168/LEKALLAWAVITILLYQPVAA267/ENIT). The deletion of the greater part of the Core gene allows the replication of RNA after transfection, but not the production of infectious viral progeny. Introduction mutation Asn2177Tyr in CSFV Core Δ and electroporation crnc lead to unexpected release of infectious viral particles. For Northern - blot analysis genomic RNA is visible as slightly reduced in size, and concentrated viral particles do not contain the protein Core. Viral titers reach 5×105ffu/ml in SK6 cells and, thus, are lower by about 10 times than t the points p447 wt.

Further, other mutations of Glu2160Gly, Pro2185Ala, Gln2189Lys Pro2200Thr and Asn2256Asp were introduced in CSFV Core Δ (p619)that led to p1033 (Ala2185), p1034 (Thr2200), p1035 (Lys2189), p1036 (Asp2256), p1037 (Gly2160and p1038 (Asp2256). In all cases, the virus was recovered after electroporation with the corresponding the SP6 transcripts, but its viability differed significantly. The most viable was the genome containing the replacement of Asn2177Tyr (mutant "CSFV1017 Core Δ"). Protein Core, apparently, is not necessary for the formation of infectious particles. Its function is compensated by mutations in helicase domain of NS3.

To determine whether the compensation of the missing Core mutations in NS3 is also applicable for BVDV was removed Core the coding sequence of the BVDV cDNA clone NCP7 (GeneBank accession number AF220247) by PCR on subclone containing fragment XhoI/BglII fragment (NP 222-2335) using primers BVT86 (GCAGCTTGAAACCCATAGGGGGCAG) and Core268 (CTAGAGAAAGCCCTATTGGCCTG). The deletion was confirmed by sequencing and introduced into the full-size cDNA clone of legirovaniem XhoI/NcoI fragment (NP 222-4671). The obtained full-length plasmid without Core (p1026), coded Npropreceding signal sequence Ernssimilar CSFV Core Δ (p619). Transcripts R was replication in MDBK cells, but infectious virus is not observed the axis. Introduction replacement Pro2194Ala, Pro2209Tyr and Asn2265Asp NCP7ΔC made possible the recovery of infectious titers of the virus to about 103ffu/ml during the titration on MDBK cells. Modified NCP7ΔC, which was designed for reproduction in SK6 cells pigs, revealed the Core compensation at replacement Tyr2204His, Asn2265Tyr, Asn2265Asp Pro2194Leu, Gln2198Lys and Leu2199Pro. Virus NCP7, no Core was released from SK6 cells with significant titers (Asn2265Tyr: 3,3×105, Tyr2204His: 2×104and Asp2192Glu: 1,5×104ffu/ml).

On the basis of infectious copies of BVDV C86, conventional virus BVDV type 1, which grows well on MDBK cells was obtained as described above, a mutant with a deletion of the Core and was introduced mutation, similar Asn2265Asp (Asn2433Asp). After transfection into cells SK6 got a virus with a titer of 5×104ffu.

The transmembrane domain of the Core protein can be functionally substituted by the sequence of the host cell

To exclude the functional importance of residual amino acids, overlapping signal translocation (LEKALLAWAVITILLYQPVAA268for Erns, sequence, covering the period between the end of the Npro and the N-end Erns, was substituted in CSFV Core ΔN2177Y(p1017) the transmembrane domain of bovine CD46 (SSGRSPGWLLLAPLLLLPTSSDA). SP6 transcripts corresponding cDNA (R) were transfected in to EDI SP6. Viable virus was released, reaching titers of 2×104ffu/ml

Materials and methods

Cells and viruses

SK6 cells were cultured in plastic flasks in DMEM containing 10% fetal calf serum and non-essential amino acids, in an incubator with 5% CO2. Cells were perseval every three days. All CSFV were obtained from strain non-cp CSFV strain Alfort-p447 (Gallei et al., J. Virol., 79(4), 2440-2448, 2005).

Electroporation:

2 µg of SP6 transcript was inserted in the 5×106SK6 cells by electroporation. For this purpose, SK6 cells were trypsinization (90% confluentus), washed twice in PBS (Ca++ and Mg++), mixed with the transcript in the final volume of 310 ml and subjected to electroporation (Biorad Genepulser, 0,18 kV and 0.95 ICF) in cuvettes with 2 mm hole. Cells were collected from the cuvette and were sown on 35 mm plastic plates with DMEM containing 10% fetal calf serum.

Isolation of RNA and synthesis of cDNA:

The SK6 cells infected with the recovered virus, were washed, and RNA was isolated using Rneasy kit Kit (Quiagen) according to the Protocol recommended by the manufacturer. 2 µg RNA was used for reverse transcription using different primers, depending on the actual location of the region of interest. PCR was performed with appropriate primers, and the product sub-cloned in the vector pGEM-T (Promega).

Example 2: Experiment with the stomach is passed.

The experiments with animals were conducted with the aim of characterizing the virulence of the mutant "CSFV 1017 Core Δ virus classical swine fever Classical Swine Fever Virus CSFV) in experimental conditions.

Purpose:

The main goal of this experiment was the study will demonstrate whether CSFV mutant "CSFV 1017 Core Δ of a weakening in comparison with the parent strain CSFV Alfort p447". The use of indicator pigs allowed to learn about the distribution and transmission of the virus. Since the attenuation was confirmed, the remaining pigs were infected on January 2, the highly pathogenic strain of CSFV Koslov.

Experiment with animals:

Part I - infection

Six young pigs were bought on a commercial pig farm on October 16, 2006 and placed in a laboratory with a high level of protection at the Institute of Virology. Animals were divided randomly into two groups about the three pigs each. All animals individually proporcional rooms and ear tags.

Two groups (group 1: animals with numbers 75-77; group 2: animals with numbers 78-80) contained in the conditions of high protection (negative air pressure 100 PA) in a separate paddock without any contact with each other during the experiment. The animals were fed once a day. Water was supplied without restrictions. The animals were clinically healthy at the time of beginning is a test.

All animals before the start of the experiment, collected the blood samples and examined them for the presence of neutralizing antibodies to pestiviruses (CSFV virus border disease (BDV) and the virus bovine viral diarrhea (BVDV),in the neutralization assay. After a period of adaptation to a new environment, two pigs from each group were infected intramuscularly approximately 107TCID50CSFV1017(group 1) and CSFV Alfort p447 (group 2), respectively. Indicator pigs (one for each group) were removed from the group for at least 12 hours after infection. After this period of time, they were again placed in the appropriate group.

Animals in two groups each day examined for the presence of clinical symptoms and elevated body temperature. Body temperature greater than 40°C, was recorded as fever. During the experiment the animals showing clinical symptoms, which were not more tolerant, were euthanized for humane reasons. Posmertnye examination of all animals was carried out and recorded.

Blood samples (whole blood and EDTA antikoagulyantna blood) were taken from animals on day 0, 2, 4, 7, 10, 14, 21 and 28 after infection. Additional samples were taken on the day of the killing. Samples of whole blood was centrifuged at 1500 rpm for 15 minutes at room temperature (Labfuge 400R, Heraeus, Germany) to obtain serum. Then the serum was divided into suitable aliquots of 0.5 to 2.0 ml and stored at -80° C until further testing.

Part II - Provocative test

Pigs remaining after infection (part I), was introduced intranasally provocative test (71st day after infection) of 107TCID50highly pathogenic strain of CSFV Koslov. Blood samples were taken at 0, 3, 6 day after provocative trial and on the day of the killing of the relevant animals.

Laboratory studies

Cell count

Leukocytes in samples of EDTA blood were counted manually using the camera for counting in Neubauer (improved) after lysis of erythrocytes in acetic acid (2%). EDTA blood was collected in melanger Thoma (blood diluting pipette according to Thoma) to the level of 0.5. Then was added acetic acid (2%) to the level of 11 and lightly shook the dilution of the sample for 60 seconds. After filling cooked counting chambers breeding leukocytes were counted in fields for counting leukocytes under a light microscope. The exact value was calculated in accordance with the instructions to the camera. Values below 10 G/l were reported as leukopenia.

Cell count was performed on 0, 2, 4, 7, 10, 14, 21 and 28 day post-infection.

Neutralization analysis with peroxidase-linked antibodies

atransaction analyses with peroxidase-linked antibodies (NPLA) was performed in accordance with the "guidelines for the diagnosis" of the European Commission (Commission decision 2002/106 from 1 February 2002) and the Technical Part, using these viruses for detection of antibodies against CSFV and BVDV/pestiviruses respectively:

- BVDV NADL

- CSFV reference strain "Alfort 187" (CSF 902)

- CSFV Alfort p447 (parent strain)

- CSFV Koslov (strain provocative tests)

- CSFV Diepholz (CSF0104)

Analyses NPLA for detection of antibodies against BVDV were performed on primary cells veal kidneys of the embryo, whereas analyses NPLA for detection of antibodies against CSFV were performed on fixed cells, kidney pig (SK6). Antibody titers were expressed as values, return the highest dilution of the original serum, which prevents replication of the virus in 50% of the 2 duplicate wells. These neutralizing dilution of 50% (ND50) were calculated using the method according to KARBER.

Analyses NPLA for detection of antibodies against CSFV were performed at 0, 10, 14, 21 and 28 days after infection (CSFV Alfort p447 and CSF0902). Additionally explored the samples taken at 0, 3 and 6 days after provocative trial and on the day of the killing (CSFV Alfort p447 and CSF0902).

Samples taken after provocative samples were subjected NPLA using also strains of CSFV Koslov and CSF0104.

Analyses NPLA for detection of neutralizing antibodies against BVDV were conducted prior to the experiment.

Detection of antibodies by enzyme-linked immunosorbent assay (ELISA)

In addition to the analyses NPLA serum samples obtained on day 0, 14, 21 and 28 after infection and the day of the killing, were analyzed commercially available enzyme linked immunosorbent assay (ELISA) for detection of antibodies against CSFV. All tests were performed exactly as described in the manufacturer's instructions. Was used the following ELISA test kit:

- HerdChek CSFV, Idexx Laboratories, Worrstadt, Germany

Virus isolation

Virus isolation from preparations of leukocytes was performed during two passages permanent cell lines cells kidney SK6 pigs and Rie 5-1 in accordance with the European guide of diagnosis (Commission decision 2002/106/EC). Indirect monomachine conducted specific to pestivirus monoclonal antibodies to BVD/C16 (Peters et al., 1986) and commercially available specific peroxidase-linked conjugate (RAMPO, Dako).

Determination of antigen enzyme-linked immunosorbent assay (ELISA)

In addition to the selection of the virus was performed commercially available enzyme-linked immunosorbent assay (ELISA) for detection of antigen exactly to the manufacturer's instructions. Analyzed the samples taken at 0, 4, 7 and 10 day.

Was used the following ELISA test kit:

- CHEKIT HCV-Antigen, a former Dr. Bommeli AG, Liebefeld-Bern, Switzerland

Results

Part I - infection

Clinical symptoms and temperature (see Fig.1)

During the infectious part of the experiment only 76 animal showed slight fever on day 8 after infection (40,1°C). Low grade temp the atmospheric temperature 40.0°C were recorded for animals 75 and 76 on day 14 after infection.

In contrast, all animals of group 2 had fever. Animal 78 showed febrile temperature on the eighth and ninth day after infection and 13 days after infection until the end of the experiment on day 28.

Animal 79 showed the temperature at day 9 after infection and 14 days after infection until the end of the experiment. Febrile temperatures were registered for the animal 80 on the seventh, ninth, tenth day, and with 13 days to 20 days after infection. On day 21 80 animal showed a body temperature of 35.6°C.

Whereas animals of group 1 (75-77) during the first part of the experiment did not develop any clinical symptoms characteristic of CSFV infection in all animals of group 2 (78-80) developed distinct clinical symptoms. The severity of clinical symptoms varied from animal to animal. Animal 76 was alone, regardless of CSF infection on day 44 after infection due to severe lameness. During the experiment, the animal 78 developed acute diarrhea, conjunctivitis, anorexia, cutaneous lesions, and ataxia. The animal was killed on the 28th day after infection. The animal 79 arose only light, non-specific symptoms, including reduced appetite and mild diarrhoea. The animal was killed on the 28th day after infection. The animal 80 there is an acute symptom is, including gastrointestinal and respiratory symptoms, anorexia, lethargy and skin damage. The animal was murdered by dying on day 21 after infection.

The number of leukocytes (Figure 2)

In most cases, the animals of group 1 showed no radiation. However, animals 75 and 77 showed levels below 10 G/l at 20 days after infection. On the same day 76 animal showed only 10,3 G/l. All animals from group 2 developed acute leukopenia due to infection with CSFV Alfort p447. The animal 78 leukopenia started on day 4 after infection, and only 0,45 G/l was detected in the day of the killing. Indicator 79 pig showed leykopenicheskih levels 21 and 28 after infection and the boundary value of 10.6 G/l already on day 14 after infection. Animal 80 showed acute leukopenia, starting 4 days after infection. The final value was 1.4 G/l on day 21 after infection.

Pathology

Animals from group 1 were not killed during the infectious part of the experiment.

Animals from group 2 showed different pathological symptoms. The animal 78 found diffuse dermatitis, enlarged and haemorrhagic lymph nodes in the digestive tract and respiratory tract, atrophy of the thymus, bronchopneumonia, ulcerative gastritis, catarrhal enteritis, pyelonephritis, and petechial bleeding in to the re kidneys. The animal 79 found mild atrophy of the thymus, slightly enlarged lymph nodes in the digestive tract and respiratory tract, pneumonia (cranial lobe), ulcerative gastritis, acute catarrhal enteritis and cystitis. The animal 80 found petechial hemorrhages in the skin and subcutaneous layer (acra, abdomenalnyh Department), severely enlarged, edematous and hemorrhagic lymph nodes (systematically), severe atrophy of the thymus, petechial hemorrhages in the soft brain membranes, spleen, epiglottis, trachea, stomach, the wall of the alimentary canal, ileocecal valve, bladder, liver, gall bladder and kidneys. Also the animal 80 found catarrhal-purulent pneumonia, extensive bleeding under the endocardium and the inside of the heart muscle, severe hemorrhagic gastritis, constipation and serious intestinally jade.

Detection of antibodies

Neutralization analysis with peroxidase-linked antibodies (NPLA)

All animals tested negative for BVDV/pestivirus antibodies prior to the experiment. All samples taken on day 0 showed negative (<5 ND50the results with both CSFV strains used in NPLA (CSF0902 and Alfort p447).

When using CSFV strain Alfort p447 animals from group 1 showed positive results, starting from 14 days after infection (animal 75) in More detail, animal 75 showed positive results for 21 and 28 days after infection, reached titers of antibodies 158,5 ND50. Indicator, animal 77, has not developed any antibody titer.

When using CSF0902 only animal 76 showed a low titer of antibodies to 7.5 ND50on the 28th day after infection. Animals of group 2 remained negative (<5 ND50) CSFV antibodies in all analyses NPLA conducted during the experiment.

Antibody enzyme linked immunosorbent assay (Ab-ELISA)

While 75 animal showed the first equivocal result on day 21 after infection and was positive on the 28th day after infection, the animal 76 showed equivocal result on day 14 after infection and positive results for 21 and 28 days after infection. Animal 77 remained negative.

Animals 78 and 79 showed negative results throughout the study, whereas 80 animal showed equivocal result on the day of the killing (21 days after infection).

Virus isolation

Animals of group 1 showed negative results for infectious part of the study as SK6 and Rie 5-1 cells.

Animal 78 showed positive results in the fourth, seventh, tenth (research only on SK6 cells) and the fourteenth day after infec the regulation on the SK6 and Rie 5-1 cells, respectively. In addition, a positive result was obtained for this pig on the second day after infection by Rie 5-1 cells. Indicator pig, animal, 79, remained negative in both cell lines. On SK6 cells 80 animal showed positive results on the seventh, tenth and fourteenth day after infection. Positive results were also obtained on cells Rie 5-1 on day seven and fourteen (tenth day was not tested due to the lack of material in the sample).

Determination of antigen enzyme linked immunosorbent assay (Ag-ELISA)

Ag-ELISA remained negative for all animals from groups 1 and for animals 78 and 79 from group 2. Only 80 animal showed a positive result on day 10 after infection.

Part II - provocative test

Clinical signs and body temperature

Pigs remaining after infectious part, dogs 75 and 77, were subjected to a provocative test with highly pathogenic CSFV strain Koslov on day 71 after infection.

Animal 75 not found febrile temperature or any clinical symptoms after provocative infection, and it was killed on the 16th day after the provocative tests.

The animal 77 developed fever on day 3 after provocative infection and remained until the killing. The animal was dying alone is on the eighth day after provocative infection with acute neurological symptoms.

Pathology

Before provocative breakdown 76 animal was killed due to severe lameness. This animal did not find any pathological disorders, characteristic for CSF. Was detected only weak pneumonia in the cranial lobes.

Except the weak from pneumonia in the cranial lobes and easy ulcerative gastritis in animals 75 not found any pathological symptoms. Animal 77 had increased, partly hemorrhagic lymph nodes, catarrhal pneumonia, ascites, easy ulcerative gastritis, hepatic congestion, swelling of the gallbladder and intestinally jade.

Detection of antibodies

After provocative animal infection 75 showed titers of antibodies against provoking virus 160 ND50(day 16 after provocative tests) and the titer of >640 against CSF0104. Animal 77 remained negative.

Conclusion and summary

- CSFV mutant "CSFV 1017 Core Δ demonstrated virtually complete attenuation compared with the parent strain CSFV Alfort p447".

Unlike animals from group 2 animals from group 1 were not able to detect the virus in viral secretions on various cell lines.

With the exception of the indicator pigs, the animals of group 1 developed neutralizing antibodies after infection with CSFV 1017 Core Δ.

Indicator pig in group 1 did not show any on ogically of results for the determination of antibodies, and when the antigen. Thus, diffusion and transfer of mutant virus are highly unlikely.

- The absence of clinical signs after provocative infection by highly pathogenic strain of CSFV proved full protection of animals previously infected with CSFV 1017 Core Δ.

Indicator pig showed stroitelnie for CSF after provocative infection with CSFV strain Koslov.

1. Mutant pestivirus to get the vaccine to protect mammals against infection caused by pestiviruses, characterized in that the virus has a mutation in a gene encoding a protein Core, leading to the fact that the virus cannot Express the functional Core protein, virus, additionally characterized in that it contains one or more mutations in the amino acids 2160-2260 C-terminal domain helicase domain NS3 specified pestivirus if the specified pestivirus is CSFV (Classical Swine Fever Virus), or amino acids 2169-2269 C-terminal domain helicase domain NS3 specified pestivirus if the specified pestivirus is BVDV (Bovine Viral Diarrhea virus)that compensates for the absence of functional protein Core of pestivirus.

2. Mutant pestivirus according to claim 1, characterized in that pestivirus is the classical swine fever virus (CSFV).

3. Mutant CSFV according to claim 2, characterized in that the mutation in the C-terminal domain helicase domain NS3 you is wound from the group consisting of Asn2177Tyr, Glu2160Gly, Pro2185Thr/Ala, Gln189Lys Pro2200Thr and Asn2256Asp.

4. Mutant CSFV according to claim 2 or 3, characterized in that the mutation in the C-terminal domain helicase domain NS3 contains a mutation Asn2177Tyr.

5. Mutant pestivirus according to claim 1, characterized in that pestivirus is a virus bovine viral diarrhea (BVDV).

6. Mutant BVDV according to claim 5, characterized in that the mutation in the C-terminal domain helicase domain NS3 selected from the group consisting of Glu2189Lys, Leu2190Pro Thr2191Ala, Asp2194Glu, Pro2194Leu, Tyr2204His, Asn2265Tyr, Asn2265Asp.

7. Mutant BVDV according to claim 5 or 6, characterized in that the mutation in the C-terminal domain helicase domain NS3 contains a mutation Asp2192Glu, Tyr2204His, Asn2265Tyr or Asn2265Asp.

8. A vaccine for protecting a mammal from infection caused by pestiviruses, characterized in that it contains mutant pestivirus according to any one of the preceding paragraphs and a pharmaceutically acceptable carrier.



 

Same patents:

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to virology, and concerns the Newcastle disease virus strain. The characterised strain NDV/Pigeon/Omsk/13/2008 is recovered from a clinically healthy pigeon, and deposited in the Collection of Cultures of the State Research Centre for Virology and Biotechnology "Vector" of Federal Service for Supervision of Consumer Rights and Human Welfare under registration number No. V-513.

EFFECT: strain may be used for preparing an antigen-containing serum for the purpose of serum diagnosis of Newcastle disease.

1 tbl, 2 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and virology. The hMPV amplification according to the present invention is compatible with detecting the other viruses causing respiratory infections, as well as with the hMPV genetic typing as found in a sample. After the test sample are amplified with primers specific for each virus, the amplification products are used to produce one-chain DNAs and hybridised with the probes specific to the relevant viruses.

EFFECT: there are described the method and kit for detecting and identifying human metapneumovirus (hMPV) in the test samples, as well as s number of sequences and their application as the hMPV amplification primers.

19 cl, 5 dwg, 2 tbl, 2 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to veterinary virology and microbiology. What is presented is the influenza virus strain A/teal/Chany/7119/08/ subtype H15N4 deposited in Collection of Microorganisms of Federal State-Funded Institution of Science State Research Centre for Virology and Biotechnology "Vector", registration No. V-563. The invention may be used for preparing an antigen-containing substrate and serum for serum diagnosis of subtype H15N4 influenza, as well as a component of a polyclonal serum set for various subtypes of influenza A virus (H1-H16) for the purpose of typing newly nature-derived versions of influenza virus in hemagglutination-inhibition reaction (HIR), as well as for the purpose of detection of subtype H15 influenza virus antibodies in wildlife blood serum for assessment of indirect immunity for influenza virus of the given subtype in HIR.

EFFECT: invention may be used for preparing the antigen-containing substratum and serum for serum diagnosis of subtype H15N4 influenza, as well as a component of a polyclonal serum set for various subtypes of influenza A virus (H1-H16) for the purpose of typing newly nature-derived versions of influenza virus in hemagglutination-inhibition reaction (HIR), as well as for the purpose of detection of subtype H15 influenza virus antibodies in wildlife blood serum for assessment of indirect immunity for influenza virus of the given subtype in HIR.

1 dwg, 1 tbl, 2 ex

FIELD: biotechnology.

SUBSTANCE: method of preparation of composition comprising (i) virus-like particles is described, and the said virus-like particles are virus-like particles of RNA-containing bacteriophage, and (ii) an oligonucleotide, and the said oligonucleotide is packaged in the said virus-like particles. Also a method of production of nucleotide composition comprising oligonucleotides used in the above mentioned methods is described. Also the nucleotide composition produced with the method of this invention and their application is described. The said composition preferably has a purity of at least 98%, most preferably at least 99%. The invention can be used in medicine.

EFFECT: increased purification.

25 cl, 6 dwg, 1 tbl, 14 ex

FIELD: biotechnology.

SUBSTANCE: method comprises providing a host cell, which is infected with the virus, and the cultivation of the infected host cell at two different temperatures. Then the virus is collected, which is produced by the stages of cultivation. The high titer and increased purity of the virus can be obtained with use of dual temperature cultivation process.

EFFECT: invention can be used in human and veterinary medicine.

25 cl, 31 dwg, 11 tbl, 9 ex

FIELD: biotechnologies.

SUBSTANCE: application describes compositions and methods of nerve cells visualisation. A composition contains a virus component bound with a fluorescent dye to produce a complex, which is capable of penetration into nerve cells, where the virus component is selected from a neurotropic replication-defect virus, a virus protein of the neurotropic virus and capsid of the neurotropic virus.

EFFECT: reduced risk of iatrogenic damage of nerves in medicine.

19 cl, 23 dwg, 1 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: tick-borne encephalitis virus is inhibited with the use of L-lysin-α-oxidase produced by the strain of Trichoderma harzianum Rifai, Russian National Collection of Industrial Microorganisms (VKPM) F-180.

EFFECT: invention enables inhibiting viral activity of tick-borne encephalitis in cells in vivo.

2 tbl

FIELD: chemistry.

SUBSTANCE: invention discloses versions of a method of cleaning a liquid composition which contains recombinant factor VII from viruses. The composition to be cleaned contains at least 5% recombinant polypeptide of factor VII in activated form. Cleaning is carried out using a nanofilter with pore size of at most 80 nm.

EFFECT: methods enable to obtain a clean recombinant polypeptide of factor VII without breakdown of its active form.

34 cl, 1 dwg, 6 ex

FIELD: medicine.

SUBSTANCE: there are presented two recombinant plasmid DNA pFastBac 1 -G2R-dSECRET and pQE-60-TNFR-CrmB-Ind-67 coding TNF-binding CrmB protein domain. Said recombinant plasmid DNA pQE-60-TNFR-CrmB-Ind-67 is designed for transformation in cells of the strain E.coli SG13009[pRep4] - a producer of TNF-binding CrmB BHO protein domain.

EFFECT: presented group of inventions is applicable for preparing drugs used in therapy of severe human diseases caused by hyperproduction of tumour necrosis factor and may be used in medicine.

3 cl, 3 dwg, 12 ex

FIELD: medicine.

SUBSTANCE: what is presented is an influenza A virus propagation inhibitor; the inhibitor represents a complex of titanium dioxide nanoparticles and virus-specific deoxyribozyme. Deoxyribozyme is presented by an oligonucleotide of the following nucleotide sequence - 5'-GAAATAAGAGGCTAGCTACAACGACCTTCATTA.

EFFECT: invention may be used for influenza A virus propagation inhibition in infected eukaryotic cells.

3 cl, 6 dwg, 1 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: invention refers to virology and concerns an attenuated strain of serotype 2 African swine fever virus (ASF). The strain is prepared by adaptation to PPK-666 cell culture for 50 passages followed by virus selection by limiting dilution in this culture and CMS cells, and deposited in the collections of microorganism strains of the State Scientific Institution of Russian National Research Institution of Veterinary Virology and Microbiology of the Russian Academy of Agricultural Sciences, No. 183.

EFFECT: presented strain is applicable in the research and diagnostic centres for the purpose of epizootological monitoring, virological, molecular-genetic researches and development of diagnostic and vaccine preparations in ASF.

3 tbl, 3 ex

FIELD: medicine, veterinary.

SUBSTANCE: claimed invention relates to field of veterinary and describes chimeric vaccine antigen against classical swine plague virus (CSPV), characterised by the fact that it consists of extracellular segment of glycoprotein E2 of CSPV viral envelop on N-end of chimeric antigen and extracellular domain of swine CD 154 molecule, identified as SEQ ID NO: 2, on C-end of chimeric antigen. Chimeric antigens can be obtained in expression systems, which guarantee proper folding of tertiary structure of chimeric molecules. Vaccine compositions, which contain such chimeric antigens, cause early and strong immune response in vaccinised swine and create complete protection against CSPV. Chimeric antigens like obtained compositions, can be applied in veterinary as vaccines for preventive application in swine.

EFFECT: obtained vaccine compositions prevent transmission of virus from sows to their offspring.

10 cl, 11 dwg, 1 tbl, 5 ex

FIELD: biotechnology.

SUBSTANCE: the suggested vaccine contains suspension of viable spores of anthracic vaccinal strain "55-VNIIBB&M" at initial concentration of 500-700 mln. spores/cu.cm, cultural virus-containing raw material of vaccinal virus of cattle plague of "LT" strain at activity of not less than 7.0 lg TCD50/cu. cm, lactosopeptonic stabilizing agent and distilled water at the following content of components,%: spores of anthracic strain "55-VNIIVV&M" -6.2 - 10.0; cultural raw material of cattle plague virus of "LT" strain -25.0 - 30.0; lactosopeptonic stabilizing agent -48.0 - 50.0; distilled water - the rest. One vaccinal dosage contains about 20-25 mln. anthracic spores and about 4.5-5.5 lg TCD50 of cattle plague virus The suggested vaccine is of high immunogenicity, develops tense immunity in once vaccinated cattle that lasts for 12 mo, not less, moreover, it is areactogenous, safe and stable at storage.

EFFECT: higher efficiency.

3 ex, 3 tbl

The invention relates to the field of immunology

The invention relates to biotechnology, Virology and immunology, and can be used to create a vaccine against the virus of classical swine fever (CSFV)

The invention relates to veterinary Virology and biotechnology

The invention relates to veterinary Virology and biotechnology
The invention relates to biotechnology and the receipt of the vaccine and method of prevention of classical swine fever

The invention relates to the field of veterinary Virology in particular to testing of viral antigens, and can be used in the development and application of funds for the specific prevention of African swine fever

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and virology. Any two E2 encoding nucleic acid molecules have the identity percentage less than 75% in any part of 40 or more unbroken nucleotides. There are also described an infectious viral particle and a composition containing the mentioned expression vector.

EFFECT: what is disclosed is the expression vector containing the nucleic acid molecules coding at least two papillomavirus E2 polypeptides.

34 cl, 3 dwg, 1 tbl, 11 ex

Up!