Method of blocking signal path activated by tgf-beta factor of vgi in animal cells

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to molecular biology, specifically to proteins which regulate cell differentiation through inhibition of the TGF-beta cell superfamily. The invention is aimed at treating and preventing diseases related to human VgI orthologs. Noggin2 protein which contains VgI protein is injected into tissue in amount which is efficient for inhibiting VgI activity.

EFFECT: invention enables to solve the task of blocking the signal path activated by the TGF-beta factor of VgI in aniamal cells.

2 dwg, 4 ex

 

The invention relates to the field of molecular biology, specifically to proteins that regulate cell differentiation by inhibiting proteins of the superfamily of TGF-β, and can find application in medicine and cellular technologies.

The superfamily of transforming growth factor β (TGF-β) includes many growth factors that share common structural motifs. Data proteins involved in a wide range of biological processes, such as processes of cell and tissue differentiation during embryonic development and wound healing, restoration and reconstruction of bone tissue in the adult body, carcinogenesis, inflammation of different nature and many others.

Proteins VgI and its orthologues GDF1 and GDF3 form one of the families of the superfamily of TGF-beta (Andersson et al., Dev. Biol. (2007)311 (2):500-11). Used hereinafter, the term "ortholog" refers to a polypeptide or protein obtained from one species that is the functional copy of the polypeptide or protein of another species. Differences in the sequences of orthologues are the result of speciation. Proteins VgI/GDF1/GF3 play a key role in the regulation of the formation of the mesoderm in embryogenesis (Kessler PS, Melton DA., Induction of dorsal mesoderm by soluble, mature VgI protein. Development. (1995)121(7):2155-64), as well as in the regulation of the formation of right - left symmetry of the organs. In addition, the different nature is Yes violation of synthesis of these proteins causes the development of some pathologies in humans (cancer of the testes, abnormal formation of the heart, obesity) (Caricasole et al., Oncogene (1998) 16(1):95-103; Ezeh et al., Cancer (2005) 104(10):2255-2265; Andersson et al., PNAS (2008) 105 (20): 7252-7256; Roessler et al., Am. J. Hum. Gen. (2008) 83 (1):18-29). In this regard, an important task is the search for regulators of protein functioning VgI/GDF1/GF3, including finding their antagonists.

Identified a number of proteins of the extracellular matrix, which are antagonists of the various members of the superfamily of TGF-β (e.g., proteins of bone morphogenesis, BMP) and play an important role in the processes of cellular differentiation and development (Balemans and Van Hul, Dev Biol. (2002) 250(2):231-250; Avsian - Kretchmer and Hsueh, Mol Endocrinol. (2004) 18 (1):1-12). The BMP antagonists include, for example, proteins hordin, intropin, noggin, Cerberus and follistatin.

Proteins Cerberus and noggin vertebrate induce the formation of structures of the head in the anterior ectoderm of embryos of vertebrates. Protein noggin able to alter the differentiation of mesoderm precursors of the ventral primordia, such as blood and mesenchyme, in dorsal rudiments, such as muscle or chord, or differentiation of epidermal precursors in neutral rudiments. Function hardina similar to functions noggin, reflecting a similar mechanism of action of these proteins as BMP antagonists.

Antagonists of growth factors from the superfamily of TGF-β are important pharmaceutical, clinical, and laboratory instruments for R is gulali cell differentiation and therapeutic intervention.

Known homolog protein of vertebrates noggin called noggin (Fletcher et al., Gene Expr Patterns. 2004, v.5 (2), pp.225-230; Eroshkin et al., Gene Expr Patterns. 2004, v.6, pp.180-186). It was shown that the gene noggin has a differential expression pattern during development of Xenopus. However, the function noggin not investigated.

Known methods of regulating the activity of TGF-beta signaling cascades protein family noggin, including regulation of the activity of a family of TGF-beta factors - BMP (ADMP, BMP2, VMR, VMR, CDF6), with only one representative of a family of proteins noggin - "classic" squirrel noggin (noggin). However, the imposition of noggin in the tissues of the body can be done either by the introduction of matrix DNA or RNA constructs encoding the protein, or a direct introduction of the recombinant protein noggin (Brunet et al. (1998) Science 280, 1455-1457; Lamb et al. (1993) Science 262, 713-718; Slack J.M. & Tannahill, D. (1993). Noggin the dorsalizer. Nature 361, the 498-499; US Patent 5,670,481, Dorsal tissue affecting factor (noggin) and compositions comprising same, inventors: Harland; Richard M., Smith; William, publication date: September 23, 1997).

Closest to the claimed method described in McMahon et al., (1998) Genes. Dev. 12, 1438-1452, however, along with the rest of the known methods it is not possible to regulate TGF-beta signaling cascade activated protein VgI.

The invention solves the problem of blocking signaling pathways activated by TGF - beta factor VgI in animal cells.

The put is fair task is solved by blocking signaling pathways, activated TGF-beta factor VgI in animal cells, by introducing protein noggin in fabric containing protein VgI, in an amount effective for inhibiting the activity VgI.

It is established that noggin able to regulate differentiation of embryonic mesoderm and is a blocker activity of one of the inductors mesoderm differentiation - TGF-β factor VgI.

The method consists in the introduction of the protein noggin in an organism, tissue or cell in a quantity effective to block or reduce the activity of VgI or its orthologues, by preventing the binding of these factors with specific protein receptors.

The method may be used for the modification of cellular differentiation, where it involves bringing cells or surrounding the cell environment in contact with the protein noggin. In the implementation of the method can be used expressing the construct containing the coding noggin nucleic acid under the control of a suitable promoter. In this implementation of the method of changing cellular differentiation involves the creation of expressing constructs containing the coding noggin nucleic acid under the control of a suitable promoter; introducing a specified expressing constructs into the cell for expression noggin, where expression nagginda to changes in cell differentiation.

This method can be used for prevention and treatment related orthologues VgI person (proteins GDF1 and GDF3) diseases, such as inhibiting the progression of certain tumors of the testes (seminoma) and is caused by improper diet, obesity.

In the text the following abbreviations are used:

cDNA - DNA, complementary messenger RNA

mRNA - messenger RNA

PG - PG

PCR - polymerase chain reaction

The invention is illustrated graphics:

Figure 1. Binding of the protein VgI protein noggin and influence noggin on the differentiation of nerve and muscle tissues in embryos of Xenopus laevis. (G-K) signal in situ hybridization is shown in black.

A. Protein noggin molecule binds bone morphogenetic protein (BMP) and Vg1 protein molecules. A detailed description is given in the text of example 1.

B, C. Ventral microinjection 40 PG of synthetic mRNA gene noggin in embryos of X. laevis early development lead to the formation of a secondary axis of the body (black arrow indicates the major axis of the body, the gray arrow indicates the secondary axis of the body), while microinjection of the same amount of synthetic mRNA noggin lead to the formation of mushroom-like phenotype.

G-H. In situ hybridization of control embryos (left in each photo) and germ, microinjection the RNA noggin with mRNA samples given genetic markers, amplification of neural (G, D) and suppression of epidermal (E) and mesoderm (W, 3) differentsirovat. The signal is shown in black.

I. the Explants ventral marginal zone (VMZ) embryos, microinjection ventral RNA noggin, extended to the end of neuroscie thanks differentiation of skeletal muscle.

Because the Explants ventral marginal zone (VMZ) embryos, microinjection ventral RNA noggin to the end of neuroscie retain the round shape.

Figure 2. Influence noggin on the differentiation of nerve and muscle tissues in ectodermal explants of Xenopus laevis and suppression of differentiation of embryonic mesoderm using noggin.

A. Scheme of the experiments with the ectoderm explants animal region of the embryo (animal beanies - AC) and explants ventral marginal zone of the embryo (VMZ).

B. Reverse transcription - PCR analysis of samples of total RNA explants of the animal cap ectoderm region of embryos and explants ventral marginal zone of the embryo, microinjection mRNA noggin and noggin with primers to the neuroectodermal (NCAM, Xanf-1), epidermal (keratin), muscle (α-actin), posteriora mesoderm (brachyury) and endomesoderm (cerberus) molecular markers and Ef-1α as control the amount of mRNA. Noggin and noggin activate the expression of neural what's markers (NCAM, Xanf-1) and inhibit the expression of epidermal (keratin), while mRNA noggin, unlike mRNA noggin not discover the ability to activate the expression of muscle molecular marker α-actin in the ventral explants magnaloy zone.

B'. Suppression of the expression of mesoderm marker molecule (brachyury) in embryos, microinjection mRNA noggin. In' - fluorescent dye shows the distribution microinjection material.

G, G'. The expression of mesoderm marker molecule (brachyury) in embryos, microinjection mRNA noggin not detect changes in comparison with the control embryo (arrow).

The invention is illustrated by the examples.

Example 1.

Binding of the protein VgI protein noggin.

Introduction proteins noggin and VgI in embryos of X. laevis is carried out by their expression in the composition of the plasmid vector pCS2-3Myc-noggin2 and pCS2-proactivinB-3Flag-Vg1, respectively.

To obtain the vector pCS2-3Myc-noggin2 nucleotide sequence encoding three amino acid sequence of the epitope of the protein of the ICC (EQKLISEEDLEQKLISEEDLEQKLISEEDL), insert by PCR in cDNA noggin directly at the 3' end of the sequence that encodes a signal peptide noggin. To do this, at the first stage of cloning are respectively 5' and 3' overlapping part of the cDNA noggin in PCR with primers 5'-AATTGATCCGCCACCATGAAGAGGATAAATCTGC-3' and

5'-GAGGTCTTCCTCCGATATCAGCTTCTGTTCCAGATCCTCTTCAGAGATGAGTTTCT

GCTCATAAGGCTGACAGCACCCCTGA-3',

5'-GAACAGAAGCTGATATCGGAGGAAGACCTCGAGCAGAAACTCATCTCTGAAGAGGATCT

GCTCAGGCTTAGACCCTCT-3' and 5'-ATTCTCGAGTTAGCATGAACACTTACACTCTG-3', respectively. In the second stage, these cDNA fragments purified from not including primers, mixed together, denatured by heating, annealed and subjected to a second round of PCR with end primers 5'-AATTGGATCCGCCACCATGAAGAGGATAAATCTGC-3' and 5'-ATTCTCGAGTTAGCATGAACACTTACACTCTG-3'. Received a full-sized cDNA noggin2 containing a sequence encoding a three aminokislotnykh sequence ICC, clone into the vector pCS2 on restricted sites NcoI (blunt)/AgeI (blunt) and XhoI/XhoI.

The vector pSP64-proactivinB-3Flag-VgI is produced by a sequential series of klonirovanie. At the first stage of cloning, nucleotide sequence, encoding three amino acid sequence Flag (DYKDDDDKDYKDDDDKDYKDDDDK), insert by PCR in cDNA directly behind the sequence that encodes proregion protein activin-B Xenopus laevis. To do this, get the 5' and 3' overlapping part of the cDNA activin-B PCR with primers

5'-AATTGGATCCGCCACCATGGCTCTCCTGTTACTGCCTCTG-3' and

5'-TTTGTCATCATCGTCTTTGTAGTCCTTATCGTCGTCATCCTTGTAATCCTCGAGGCCTCTC

TTACGGA-3', 5'-GACTACAAAGACGATGATGACAAAGATTACAAGGATGACGACGAT

AAG TGCGATGGACACACAAATT-3' and 5'-AATGAATTCATGCACAGCCGCACTCGTCCA-3', respectively. In the second stage, these cDNA fragments purified from not including primers, mixed together, denatured by heating, annealing the Ute and subjected to a second round of PCR with end primers

5'-AATTGGATCCGCCACCATGGCTCTCCTGTTACTGCCTCTG-3' and

5'-AATGAATTCATGCACAGCCGCACTCGTCCA-3'.

Received a full-sized cDNA activin-B, containing the sequence encoding three aminokislotnykh sequence Flag epitope containing a XhoI site immediately after the sequence that encodes three Flag epitope, clone in the vector pSP64T on restricted sites HindIII (blunt)/AgeI (blunt) and EcoRI/EcoRI. Receive the intermediate vector pSP64T-proactivinB-3Flag-activin.

The cDNA fragment encoding the amino acid sequence of VgI, are derived from genomic DNA of Xenopus laevis by PCR with the corresponding specific primers to sequence Vg: 5'-ATTCTCGAGGATCCAGAGCTCAAGA-3' and 5'-ATAGAATTCTCACCTGCAGCCACAT-3'.

At the final stage of cloning the fragment VgI clone in the vector pSP64T-proactivinB-3Flag-activin on restricted sites XhoI and EcoRI. Get the vector pSP64T-proactivinB-3Flag-VgI.

Analysis of the ability of the expressed protein 3Myc-noggin2 to bind protein molecules 3Flag-VgI carried out by the method of co-thus. For this 600 pg of synthetic mRNA Mus-noggin2 and 600 pg of synthetic mRNA proactivinB-3Flag-VgI microinjection in developing embryos of X. laevis at stage 2 blastomeres. Further, these embryos are incubated in a solution of 0.1 MMR to early gastrula.

The allocation of expressed proteins is carried out by lizirovania embryos at early gastrula according to the method described in Tanegashima et al., Int.J.DevBiol (2004) 48:275-283.

After highlighting spend the absorbance of the Mature protein Mus-noggin resin ICC-Agarose (Sigma) according to the manufacturer's Protocol. After washing the resin in accordance with the Protocol of the manufacturer of the presence of this resin bound peroxidase protein 3Flag-VgI analyze method protein blotting using Flag-specific monoclonal antibody (Sigma).

The ability of protein molecules noggin to bind protein molecules VgI shown in Figure 1A.

As a control experiment using protein 3Flag-GIR associated protein noggin.

Example 2.

Impact noggin on the direction of development of the cells.

cDNA containing the complete coding region noggin, reamplification using PCR from a clone obtained in Eroshkin et al., Gene Expr Patterns. 2004, v.6, pp.180-186, using primers 5'-ATTACCGGTGGGAGAACCTTGTTCTTCATT-3' and 5'-ATTCTCGAGTTAGCATGAACACTTACACTCTG-3' and clone into the vector pCS2 (vector S2-noggin).

Full coding sequence noggin obtained by PCR amplification from the cDNA sample Xenopus laevis using noggin-specific primers 5'-TATCCATGGCAAGAAATCGGGAGCA-3' and 5'-ATTCTCGAGTCTCAGCATGAGCATTTGCA-3' and clone into the vector pCS2 (vector S2 - noggin).

Synthetic mRNA noggin and noggin get with a set of reagents mMESSAGE MASHINE Kit (Ambion) from the vector pCS2-noggin and vector S2-noggin respectively, the linearized with restriction endonuclease EcoRI (Fermentas). In the effects of microinjection of mRNA noggin on the development of Xenopus laevis compared with the previously described effects injection v noggin (Smith and Harland, Cell 1992, v.70, pp.829-840; Lamb et al., Science 1993, v.262, pp.713-718; Smith et al., Nature 1993, v.361, pp.547-549). In the course of these experiments, mRNA noggin and noggin is injected in the following blastomeres using microinjector Eppendorf.

Ventral injection of 40 PG of mRNA noggin in early embryos induce secondary axis of the body (Figure 1 B, black arrow - primary axis; the gray arrow to the secondary axis), while a similar injection of mRNA noggin (40 PG) lead to the development of mushroom-shaped embryos (Figure 1). Thus, unlike noggin (Dale and Slack, Development 1987, v.100, pp.279-295, Cell 1992, v.70, pp.829-840; Smith et al., Nature 1993, v.361, pp.547-549), noggin, despite its ability to bind BMP, does not induce secondary axis of the body when injected its mRNA in both ventral blastomere of 8-cell embryos. Instead formed abnormal mushroom embryos.

In situ hybridization on total drug embryos by injection of mRNA noggin with probes to mRNA neural (NCAM, Xanf-1), epidermal (gene keratin), muscle (gene α-actin) genetic markers and genetic markers of late mesoderm (brachyury) shows a giant neralization the ectoderm and reduction in muscle and epidermal differentiation (Figure 1G-H).

All together these results indicate that noggin can paralizovati the embryonic ectoderm, but inhibits differentiation of dorsal mesoderm and, therefore clicks the zoom, can prevent dorsalize action of endogenous noggin.

Use the explants derived from the ventral marginal zone (VMZ) embryos at early gastrula, to analyze the effects noggin on the differentiation of the mesoderm. Microinjection of mRNA noggin causes severe elongation of these explants, transforming the nature of their ventral mesoderm in muscle mesoderm (dorsalization) (Dale and Slack, Development 1987, v. 100, pp.279-295, Cell 1992, v.70, pp.829-840; Smith et al., Nature 1993, v.361, pp.547-549; Figure 1). In contrast, like VMZ explants without injections, expressing noggin or noggin and noggin at the same time, the explants remain rounded (Figure 1).

To analyze the impact of protein noggin on tissue differentiation using the method of reverse transcription - PCR (RT - PCR) and compared the expression of different genetic markers in explants naive ectoderm (animal beanies - AC), extracted from embryos at early gastrula, by microinjection previously introduced mRNA noggin or noggin (Figure 2A, B). Use the explants derived from the ventral marginal zone (VMZ) embryos at early gastrula, for the analysis of impacts noggin on the differentiation of the mesoderm (figure 1, L).

The explants AU extracted from embryos subjected to injection, using micronora and article is glass wand as previously described in the Zaraisky et al. Developmental Biology 1992, V. 152, pp.373-382. All explants incubated overnight in a solution of 0.5×MMR. Ten explants of each type were isolated total RNA and performed RT-PCR, as described in the Zaraisky et al. Developmental Biology 1992, V.152, pp.373-382. Using the following primers: gene α-actin: 5'-GCTGACAGAATGCAGAAG and 5'-TTGCTTGGAGGAGTGTGT; brachyury: 5'-GCTGGAAGTATGTGAATGGAG and 5'-TTAAGTGCTGTAATCTCTTCA; Cerberus: 5'-GCTTTGGTAAATGCATCTCTCTCC and 5'-GGTGACCAGTAAATCATACCTGCT; gene keratin HK: 5'-CTGAATAACATGAGAGCTG and 5'-TGGTTCTAGTTGTGGATGT; NCAM: 5'-CCTGCTTATGTGTATCGC and 5'-TTCACAGTACTGGGCTGTGCTT; Xanf-1,

described in Groppe et al., 2002.

RT - PCR on the basis of total RNA from explants of speakers and VMZ embryos subjected to injection of mRNA noggin or noggin, performed with primers for markers neuroectoderm (NCAM, Xanf-1), epidermis (keratin), muscle (α-actin), late mesoderm (brachyury) and endomesoderm (Cerberus) and Ef-1-α as a control (Figure 2 B).

It is shown that noggin and noggin activate the expression of neural markers (NCAM, Xanf-1) and inhibit epidermal marker (keratin), whereas only noggin activates expression of muscle marker (α-actin) in VMZ explants.

In this analysis noggin shows strong neutralizing activity, such activity noggin (Smith and Harland, Cell 1992, V.70, pp.829-840; Lamb et al., Science 1993, V.262, pp.713-718)inducyruya the expression of markers of the front part of the nervous system, but the inhibition of the epidermal marker.

The ability of the legs is in to neutralize the ectoderm, coupled with its ability to suppress dorsalis activity noggin confirms the ability noggin link in addition to BMP molecules and other factors, necessary for muscle differentiation.

Example 3.

The ability of the protein noggin to suppress the differentiation of embryonic mesoderm corresponds to its ability to block the signaling pathway activated protein VgI.

It is known that the signaling pathway activated protein VgI plays a key role in the differentiation of embryonic mesoderm (Kessler PS, Melton DA., Induction of dorsal mesoderm by soluble, mature VgI protein. Development. (1995)121(7):2155-64).

The ability of the protein noggin to suppress the differentiation of embryonic mesoderm corresponds to its ability to block the activity of signaling pathways activated protein VgI through the linking of protein molecules VgI (see Example 1).

The ability noggin to suppress the differentiation of embryonic mesoderm assessed by analyzing the expression of a universal marker of the early stages of development, the mesoderm gene brachyury - in early gastrula Xenopus laevis. Synthetic mRNA noggin and noggin, obtained as described in Example 2, is injected in the Equatorial region of one of ventral blastomeres at the stage 8 blastomeres in the amount of 40 PG with the use of microinjector Eppendorf.

Microinjection of mRNA noggin cause inhibition of gene expression of brachyury in the field of micro-injection, indicating that the suppression in this place differentiation of embryonic mesoderm (Figures 2 and'). Similar microinjection the RNA noggin not cause inhibition of the expression of brachyury and accordingly, suppression of the development of the mesoderm (Figure 2 G and G').

Thus, unlike noggin, noggin has a unique ability to suppress the differentiation of embryonic mesoderm.

Example 4.

Blocking mesodermally activity of the protein VgI using noggin.

The ability noggin block mesodermally activity of the protein VgI assess the ability noggin to suppress the expression of the genetic target cascade activated VgI, gene brachyury in explants of embryonic ectoderm germ (AC explants), microinjection mixture mRNA noggin mRNA and VgI. As a control, similar experiments were performed with mRNA and noggin.

Gene expression of brachyury analyzed by the method of reverse transcription - PCR of mRNA from ectodermal explants as described in Example 2.

It is established that noggin able to suppress the activation of brachyury expression induced by VgI. Thus inhibition of brachyury is observed only if the concentration of microinjections mRNA VgI is not higher than that noggin. In contrast, noggin not able to inhibit the activation of brachyury gene in similar tests.

The method of locking the signaling pathways activated by TGF-beta factor VgI in animal cells, by introducing the protein noggin 2 in cloth, containing protein VgI, in a quantity effective the La inhibiting the activity VgI.



 

Same patents:

FIELD: medicine.

SUBSTANCE: blood serum of children of first twelve months of life is examined and enzyme xanthine oxidase strength is determined. At ratio level of enzyme strength 10.2 nmole/(s●ml) and lower morphofunctional hepatobiliary system disorders are diagnosed, specified by liver pulp damage.

EFFECT: capability to conduct early diagnosis of morphofunctional hepatobiliary system disorders in children of first months of life who underwent perinatal hypoxia.

3 ex

FIELD: medicine.

SUBSTANCE: for diagnosis of parodontium inflammatory disease level of osteoprotegrin in blood serum is determined. At content of osteoprotegrin from 8.000 pmole/l to 11.999 pmole/l low-grade periodontitis is registered. At content of osteoprotegrin from 3.000 pmole/l to 7.999 pmole/l periodontitis of middle severity level is registered. At content of osteoprotegrin from 1.000 pmole/l to 2.999 pmole/l periodontitis of severe level is registered.

EFFECT: increase of effectiveness in diagnosis of periodontitis.

3 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: protein level S-100B is determined in blood serum in a patient suffering diabetes mellitus 1 type (DM), in the absence of clinical implications of brain damages. At increase of its level to more than 140 ng/L a subclinical stage of diabetical encephalopathy (DE) is detected.

EFFECT: increase of accuracy and objectiveness of diagnostics DE at early stages, capability of well-timed and reasonable appropriate therapeutic indications.

3 ex

FIELD: medicine.

SUBSTANCE: method for determining structural and functional state of erythrocyte membranes of peripheral blood of pregnant women with acute herpes virus infection is proposed which is the fact that at determining in the antibody sample of titer 1: 12800 protein glycophorin is detected by method of disc electrophoresis in a stepped gradient polyacrylamide gel with 10% sodium dodecyl sodium, and at increasing content of glycophorin up to 8.6±0.3 conditional units with regard to 6.55 conditional units in the control an increase in microviscosity of erythrocyte membranes are determined.

EFFECT: invention provides an assessment of the microviscosity of erythrocyte membranes of the peripheral blood of pregnant women who had exacerbation of herpes virus infection in the third trimester.

2 ex

FIELD: medicine.

SUBSTANCE: prediction of increasing the functional class of chronic cardiac failure (FC CCF) within the next year is ensured by determination of serum magnesium in blood serum (mmol/l) (XI), potassium of blood serum (mmol/l) (X2) and encephalic natriuretic peptide (pg/ml) (X3), observed diastolic dysfunction of left ventricle (LV) (1 - shown by cardiac ultrasound; 0 - not shown) (X4), high-grade ventricular premature beats (1 - shown by cardiac electrocardiogram; 0 - not shown) (X5) and cardiac fibrillation (1 - shown by cardiac ultrasound; 0 - not shown) (X6). The probability is calculated by formula Prob (event)=exp(eta)/(1+exp(eta)), where Prob (event) is probability of CCF progression, eta=-0.332674+2.12648*X1+6.34589*X2-0.00574387*X3+3.38776*X4=1-0.574371*X4+2-3.01702*X5=0; if Prob (event) is equal to 0, increasing the functional class is not expected; if Prob (event) is equal to 1, increasing the functional class by one unit is observed.

EFFECT: application of the method allows improving effectiveness of prediction of chronic cardiac failure progression.

4 tbl

FIELD: medicine.

SUBSTANCE: technique is ensured by evaluation of an adolescent body-weight index in patients with menstrual disorders. If the body-weight index is 17.5 kg/m2 and less, blood serum is analysed for leptin content. If said leptin content is 5.61 ng/ml and less, anorexia nervosa is diagnosed.

EFFECT: application of the technique allows differentiating specific eating disorder in girls with secondary oligomenorrhea that can prevent development of secondary hypogonadism leading to uterus hypoplasia and barreness in a fertile period.

3 ex, 1 tbl

FIELD: medicine.

SUBSTANCE: there is offered diagnostic technique, method for prediction or identification of predisposition to atherosclerosis and susceptibility to development of atherosclerosis plaques and/or vessel obstruction. The method involves sample analysis for percentage frequency of various subpopulations of T-lymphocytes and comparison of obtained data to the comparative and/or reference data.

EFFECT: application of multiple markers simplifies prediction of progression of the disease with higher predictive value.

18 cl, 4 tbl, 14 dwg

FIELD: medicine.

SUBSTANCE: invention refers to peptide reagents which react with prion proteins, polynucleotides coding these peptide reagents, to the methods for preparing antibodies with using such peptide reagents and polynucleotides, and to the antibodies received with using these methods. There is declared recovered peptide reagent which mainly reacts with pathogenic forms of conformational disease protein in comparison with nonpathogenic forms of conformational disease protein where said peptide reagent is prepared of peptide protein fragment where said peptide reagent is prepared of peptide chosen from the group that includes peptides with SEQ ID NO: 12-132.

EFFECT: invention provides detection of pathogenic prions in a sample and can be used as components of a therapeutic or preventive composition and for formation of prion-specific antibodies.

52 cl, 3 ex, 4 tbl, 5 dwg

FIELD: medicine.

SUBSTANCE: invention concerns medicine, namely to paediatric gastroenterology. To diagnose the primary form of hypercholesterolemia in infants and preschoolers with gastroenterological diseases, total cholesterol level and homocysteine level are determined by the biochemical blood analysis. If total cholesterol exceeds 5.2 mm/l, while homocysteine is more than 8.5 mcM/l, primary hypercholesterolemia is diagnosed.

EFFECT: higher diagnostic accuracy of primary hypercholesterolemia in infants and preschoolers.

4 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, and namely to dermatology. In order to diagnose onychodystrophy, there performed is visual inspection of patient's nails; after that its biological material is investigated. As biological material, there used is blood serum of the patient, in which there determined is content of peptide-fixed hydroxy-proline (PHP). If PHP content is more than 0.5 mcg/ml (PHP > 0.5 mcg/ml), onychodystrophy is diagnosed.

EFFECT: use of method allows improving accuracy of diagnostics of onychodystrophy and reducing the time required for investigations.

3 ex

FIELD: chemistry.

SUBSTANCE: invention refers to biotechnology, specifically to Noggin2 proteins and can be used in medicine. The signalling cascade activin is blocked by introducing Noggin2 in an organism, tissue or cell in amount effective to inhibit or decrease activin activity.

EFFECT: invention allows blocking effectively activity of protein activin.

2 dwg, 8 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine and concerns angiogenesis-preventing immunotherapy. Invention substance includes immunogenic compositions for treatment of disorders associated with angiogenesis intensification, containing oligonucleotides, coding polypeptides VEGFR2, introduced as a part of plasmid or viral vectors, as well as polypeptides VEGFR2, oligonucleotides, coding autologous VEGF with damaged function of receptor activation, polypeptides VEGF and their combinations. Immunogenic compositions can be used for treatment of malignant neoplasms and metastasises, at benign neoplasm and chronic inflammatory and autoimmune diseases. Advantage of invention lies in humoral and cellular immunity induction by means of specified compositions.

EFFECT: development of effective method angiogenesis preventive immunotherapy.

19 cl, 11 ex, 7 tbl

FIELD: medicine; pharmacology.

SUBSTANCE: releasing peptides of growth hormone are described with formula (I): R112345-R2, where:А1 designates Aib, Apc or Inp; А2 designates D-Bal, D-Bip, D-Bpa, D-Dip, D-1Nal, D-2Nal, D-Ser(Bzl) or D-Тrp; А3 designates D-Bal, D-Bip, D-Bpa, D-Dip, D-1Nal, D-2Nal, D-2Ser(Bzl) or D-Trp; А4 designates 2Fua, Orn, 2Pal, 3Pal, 4Pal, Pff, Phe, Pim, Taz, 2Thi, 3Thi, Thr(Bzl); А5 designates Apc, Dab, Dap, Lys, Orn or deleted; R1 designates hydrogen; and R2 designates NH2; and their pharmaceutically acceptable salts.

EFFECT: pharmaceutical compositions and the methods of their application are presented.

25 cl, 1 tbl, 2 ex

FIELD: biotechnology, immunology.

SUBSTANCE: invention reports about preparing and characterizing two forms of Nogo protein bound with the natural myelin with respect to the presence of immunogenic properties in their. These two forms correspond to natural products of alternative splicing, their fragments and derivatives, in particular, derivatives comprising deletions in amino acid residues, and chimeric protein also and comprising novel immunogenic polypeptides and their fragments. Invention can be used in medicine for diagnostic and curative aims.

EFFECT: valuable medicinal properties of protein.

18 cl, 79 dwg, 3 tbl, 8 ex

FIELD: biotechnology, gene engineering, pharmaceutical industry, medicine.

SUBSTANCE: method for production of recombinant placental growth factor (PLGF) includes culturing of modified prokaryotic cells containing inducible expression system of PLGF to produce OD600 of 14-50, followed by expression inducing, extraction, purification and solubilizing of inclusion bodies; enriching of obtained mixture with dimer a multimer form of expressed protein by anion exchange chromatography and isolation of PLGF preferably in dimmer form by reversed-phase chromatography.

EFFECT: method for PLGF production with high specific activity and high yield.

27 cl, 5 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: agents are used modulating stem cells proliferation when treating people and animals and accelerating recovery process after peripheral blood chemotherapy.

EFFECT: enhanced effectiveness of treatment.

79 cl, 28 dwg, 44 tbl

FIELD: biotechnology, peptides.

SUBSTANCE: invention relates to a method for preparing antibodies raised to human leukocyte differentiation factor (HLDF) or to HLDF fragment (31-38) representing peptide of the following structure: Arg-Arg-Trp-His-Arg-Leu-Glu-Lys possessing with antigenic and nucleic acids-hydrolyzing properties, and for diagnostic aims also. Antibodies are prepared from rabbit plasma blood immunized with three injections of antigens wherein synthetic HLDF factor or conjugate is used as antigens. Diagnosis of anaplastic state of human cells is carried out by using solutions of antibodies to HLDF factor or HLDF fragment (31-38) in the concentration 0.0013 mg/ml as biological markers. Invention provides carrying out the differential diagnosis of tumors and normal organs and effective detecting initial stages in cell differentiation disturbances.

EFFECT: improved preparing method of antibody, improved method for diagnosis.

6 cl, 21 dwg, 1 tbl

FIELD: biotechnology, veterinary science.

SUBSTANCE: invention proposes nucleic acid molecule GDF-9B of wild and mutated types, polypeptide encoding by these nucleic acids, vector, construction, ligand and methods for using such nucleic acids and polypeptides. Proposed group o invention provides carrying out the modulation of the ovary follicle growth via activity of homodimers of GDF-9B and heterodimers of GDF-9B/GDF-9 both in vivo and in vitro. Invention can be used in animal husbandry for aim of active and passive immunization against these polypeptides for the follicle growth change.

EFFECT: valuable properties of factors.

35 cl, 9 dwg, 4 tbl, 4 ex

FIELD: biotechnology, in particular epithelial cell growth factors useful in production of new keratinocyte growth factor (KGF).

SUBSTANCE: KGF protein is obtained by cultivation of recombinant host cell, transformed with vector containing DNA which encodes amini acid sequence of KGF protein. Obtained KGF protein in pharmaceutical composition is used for forcing of epithelial cell proliferation. Method of present invention makes it possible to produce KGF protein with specific mitogenic activity of 3.4 x 104 U/mg of protein in relation to keratinocyte cells.

EFFECT: new keratinocyte growth factor.

52 cl, 14 dwg, 3 tbl

FIELD: biotechnology, molecular biology, medicine, genetic engineering, pharmacy.

SUBSTANCE: the hemopoietic protein comprises the amino acid sequence of the formula: R1-L1-R1, R2-L1-R1, R1-R2 or R2-R1 wherein R1 represents the modified ligand flt-3; R2 represents the modified human IL-3, the modified or unmodified colony-stimulating factor. Modification of R1 is carried out by addition of N-end with C-end directly or through linker (L2) that is able to join N-end with C-end to form new C- and N-ends. The modified human IL-3 is prepared by replacing amino acids at positions 17-123. The human G-CSF is modified by exchange of amino acids. The hemopoietic protein is prepared by culturing cells transformed with vector comprising DNA that encodes the hemopoietic protein. The hemopoietic protein stimulates producing hemopoietic cells and this protein is used as a component of pharmaceutical composition used in treatment of humans suffering with tumor, infectious or autoimmune disease. Invention provides preparing multifunctional hemopoietic proteins eliciting the enhanced activity with respect to stimulation of hemopoietic cells and eliciting the improved physical indices. Invention can be used for preparing chimeric multifunctional hemopoietic proteins.

EFFECT: improved preparing and producing method, valuable medicinal properties of protein.

22 cl, 19 dwg, 18 tbl, 117 ex

FIELD: biotechnology, molecular biology, medicine, genetic engineering, pharmacy.

SUBSTANCE: the hemopoietic protein comprises the amino acid sequence of the formula: R1-L1-R1, R2-L1-R1, R1-R2 or R2-R1 wherein R1 represents the modified ligand flt-3; R2 represents the modified human IL-3, the modified or unmodified colony-stimulating factor. Modification of R1 is carried out by addition of N-end with C-end directly or through linker (L2) that is able to join N-end with C-end to form new C- and N-ends. The modified human IL-3 is prepared by replacing amino acids at positions 17-123. The human G-CSF is modified by exchange of amino acids. The hemopoietic protein is prepared by culturing cells transformed with vector comprising DNA that encodes the hemopoietic protein. The hemopoietic protein stimulates producing hemopoietic cells and this protein is used as a component of pharmaceutical composition used in treatment of humans suffering with tumor, infectious or autoimmune disease. Invention provides preparing multifunctional hemopoietic proteins eliciting the enhanced activity with respect to stimulation of hemopoietic cells and eliciting the improved physical indices. Invention can be used for preparing chimeric multifunctional hemopoietic proteins.

EFFECT: improved preparing and producing method, valuable medicinal properties of protein.

22 cl, 19 dwg, 18 tbl, 117 ex

Up!